WO2017142283A1 - 간암 치료 또는 예방용 조성물 - Google Patents
간암 치료 또는 예방용 조성물 Download PDFInfo
- Publication number
- WO2017142283A1 WO2017142283A1 PCT/KR2017/001575 KR2017001575W WO2017142283A1 WO 2017142283 A1 WO2017142283 A1 WO 2017142283A1 KR 2017001575 W KR2017001575 W KR 2017001575W WO 2017142283 A1 WO2017142283 A1 WO 2017142283A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- hepatocellular carcinoma
- pi3k
- cells
- ros
- tert
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Images
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/33—Heterocyclic compounds
- A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
- A61K31/495—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
- A61K31/505—Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim
- A61K31/519—Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim ortho- or peri-condensed with heterocyclic rings
- A61K31/52—Purines, e.g. adenine
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/33—Heterocyclic compounds
- A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
- A61K31/495—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
- A61K31/505—Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim
- A61K31/517—Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim ortho- or peri-condensed with carbocyclic ring systems, e.g. quinazoline, perimidine
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K9/00—Medicinal preparations characterised by special physical form
- A61K9/14—Particulate form, e.g. powders, Processes for size reducing of pure drugs or the resulting products, Pure drug nanoparticles
- A61K9/16—Agglomerates; Granulates; Microbeadlets ; Microspheres; Pellets; Solid products obtained by spray drying, spray freeze drying, spray congealing,(multiple) emulsion solvent evaporation or extraction
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K9/00—Medicinal preparations characterised by special physical form
- A61K9/20—Pills, tablets, discs, rods
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K9/00—Medicinal preparations characterised by special physical form
- A61K9/48—Preparations in capsules, e.g. of gelatin, of chocolate
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
Definitions
- the present application relates to a composition for preventing and treating liver cancer.
- liver cancer is the second leading cause of cancer-related deaths worldwide, with hepatocellular carcinoma (HCC) accounting for 85-90% of liver cancers. Approximately 70-80% of hepatocellular carcinomas are found only after progression to advanced grade. Sorafenib is currently the only drug approved for the treatment of advanced hepatocellular carcinoma.
- HCC hepatocellular carcinoma
- HCC cirrhosis .
- HBV hepatitis virus
- alcohol intake hepatitis hepatitis
- nonalcoholic fatty liver which makes it difficult to formulate strategies for treating HCC patients based on the history of cirrhosis alone.
- HCC development is known to involve a variety of pathways including the Wnt- ⁇ -catenin pathway, p53-Rb pathway, chromatin remodeling, and phosphatidylinositol 3-kinase (PI3K) -AKT (El-Serag HB, Rudolph KL. Hepatocellular carcinoma: epidemiology and molecular carcinogenesis.Gastroenterology. 2007; 132: 2557-76; Schulze K, Imbeaud S, Letouze E, Alexandrov LB, Calderaro J, Rebouissou S, et al. Exome sequencing of hepatocellular carcinomas identifies new mutational signatures and potential therapeutic targets. Nat Genet. 2015; 47: 505-11) Despite these findings, major determinants of progression from early HCC to progressive HCC (GII and GIII HCC) have not yet been identified.
- PI3K phosphatidylinositol 3-kinase
- Idelariship a PI3K inhibitor
- This inhibitor binds to the ATP-binding site of p110 ⁇ to inactivate the PI3K-AKT signaling pathway, where activation of the PI3K pathway is mediated by the class I PI3K catalytic isotypes p110 ⁇ , p110 ⁇ , p110 ⁇ and p110 ⁇ .
- P110 ⁇ is abundantly expressed in hematopoietic stem cells, and PI3K-AKT signaling essentially contributes to immune cell proliferation and stimulation of related cytokines and chemokines.
- the Idelariship has focused on cell survival, particularly on the death of immune cells.
- Korean Patent Laid-Open Publication No. 10-2014-0022836 relates to a combination therapy for hematologic malignancies and discloses the use of idelariship for the treatment of lymphocytic leukemia.
- the present invention is to provide a pharmaceutical composition that inhibits the proliferation of hepatocellular carcinoma by inhibiting TERT expression and telomerase in hepatocellular carcinoma cell line.
- the hepatocellular carcinoma is a hepatocellular carcinoma in which ROS and PI3K isoform p110 delta are overexpressed.
- the hepatocellular carcinoma according to the present application is advanced hepatocellular carcinoma
- the advanced hepatocellular carcinoma may be determined according to the liver cancer classification method according to several advanced stages known in the art, for example, but not limited thereto Advanced hepatocellular carcinoma is stage II or higher hepatocellular carcinoma based on the tumor-node-metastasis (TNM) of the Liver Cancer Study Group of Japan (LCSGJ).
- TNM tumor-node-metastasis
- LCSGJ Liver Cancer Study Group of Japan
- the advanced hepatocellular carcinoma is grade II or higher hepatocellular carcinoma based on the Edmonson Steiner grading system, which is a histological grade of tumor differentiation according to the degree of cancer differentiation.
- the pharmaceutical composition according to the present invention treats hepatocellular carcinoma by inhibiting ROS-PI3K-AKT-TERT signaling.
- the present disclosure provides the compound 5-fluoro-3-phenyl-2-[(1S) -1- (7H-purin-6-ylamino) propyl] -4 (3H) -quinazolinone,
- a kit for inhibiting PI3K isoform p110 delta expression in liver cancer cells or liver cancer cell lines in vivo or in vitro comprising an acceptable salt.
- liver cancer cells having a kit according to the present invention have high ROS levels.
- the present application is also directed to the compound 5-fluoro-3-phenyl-2-[(1S) -1- (7H-purin-6-ylamino) propyl] -4 (3H) -quinazolinone, its pharmaceuticals
- the present disclosure also provides 5-fluoro-3-phenyl-2-[(1S) -1- (7H-purin-6-ylamino) propyl] -4 (3H) -quinazolinone, or It relates to a method for inhibiting PI3K isoform p110 delta expression of the liver cancer cells, comprising the step of treating the salt thereof.
- the present disclosure also provides 5-fluoro-3-phenyl-2-[(1S) -1- (7H-purin-6-ylamino) propyl] -4 (3H) -quinazolinone, Or it provides a method for inhibiting the ROS-PI3K-AKT-TERT signaling pathway of the liver cancer cells comprising the step of treating the salt thereof.
- the liver cancer cells are cells having increased ROS levels, and include all liver cancer cell lines or liver cancer cells or tissues.
- the present disclosure also provides a pharmaceutically effective amount of compound 5-fluoro-3-phenyl-2-[(1S) -1- (7H-purin-6-ylamino) in a subject in need thereof.
- Propyl] -4 (3H) -quinazolinone or a pharmaceutically acceptable salt thereof is provided.
- the hepatocellular carcinoma is a hepatocellular carcinoma in which ROS and PI3K isoform p110 delta are overexpressed.
- the hepatocellular carcinoma according to the present application is advanced hepatocellular carcinoma
- the advanced hepatocellular carcinoma may be determined according to the liver cancer classification method according to several advanced stages known in the art, for example, but not limited thereto Advanced hepatocellular carcinoma is stage II or higher hepatocellular carcinoma based on the tumor-node-metastasis (TNM) of the Liver Cancer Study Group of Japan (LCSGJ).
- TNM tumor-node-metastasis
- LCSGJ Liver Cancer Study Group of Japan
- the advanced hepatocellular carcinoma is grade II or higher hepatocellular carcinoma based on the Edmonson Steiner grading system, which is a histological grade of tumor differentiation according to the degree of cancer differentiation.
- the pharmaceutical composition according to the present invention may inhibit the proliferation of tumors by inhibiting PI3K-AKT-TERT signaling activation activated by ROS in hepatocellular carcinoma (HCC), thereby reducing TERT expression and decreasing telomere length.
- HCC hepatocellular carcinoma
- p110 delta which is a ROS and thus a PIK3 isotype, may be useful for the treatment of advanced liver cancer or malignant liver cancer.
- FIG. 1 shows that Edelarypium according to one embodiment of the present disclosure inhibits HCC cell proliferation, PI3K-AKT-TERT signaling, and telomere length retention.
- AC It demonstrates dose-dependent inhibition of idelarism in two AKT activated HCC cell lines (activated of PI3K / AKT signaling) and non-liver cancer cell lines derived from normal liver (PI3K / AKT signaling is inactivated).
- Two HCC cell lines, Huh7 cells (A) and Hep3B cells (B), and non-hepatic cancer cell lines THLE-3 cells (C) derived from normal livers were treated with a range of doses of Idelariship, and cell proliferation was determined by MTS assay. Analyzed.
- Immunostaining images in the box indicate that the expression of p110 ⁇ , which is selectively targeted by edellaribium, is higher in HCC cells than THLE-3. Scale bar, 10 ⁇ m.
- Target inhibition and downstream signaling after edlarariship treatment in DF AKT activated HCC cell line model and non-hepatic cancer cell line model derived from AKT inactivated normal liver.
- Telomeres were shortened after edlarariship in GI and HCC cell lines. Telomere length was quantified by telomeres Southern blot (G), immunoFISH (H, J, and L), and quantitative PCR (I, K, and M).
- T / S ratio is the ratio of telomere repeat copy number to single-copy gene copy number.
- POC control percent.
- FIG. 2 shows that ROS promotes PI3K-AKT-TERT signaling activation and telomere elongation in HCC cell lines, and edellariship inhibits ROS-mediated PI3K-AKT-TERT signaling activation.
- P110 isotype mRNA levels in A, Huh7, Hep3B, and THLE-3 cells.
- CE cell viability (bright blue), telomere fluorescence (red), and TERT expression (black) and percent of TERT protein immunoassay in the presence of various concentrations of H 2 O 2 and ROS scavenger NAC. Average telomeres length is determined by FlowFISH. Huh7 cells (C), Hep3B cells (D), and THLE-3 cells (E). POC, control percent. NAC, N-acetylcysteine. FH, 300 ⁇ mol / LH 2 O 2 - The HCC cell lines and 150 ⁇ mol / LH 2 O 2 treatment After the treatment of the della risip in THLE-3 cells treated illustrates the target and inhibit downstream signaling.
- TERT expression was normalized to that of ⁇ -actin.
- POC control percent. Shows the telomere activity in the treated THLE-3 cells - IK, the presence or absence della risip treatment under 300 ⁇ mol / LH 2 O 2 - treated HCC cell lines and 150 ⁇ mol / LH 2 O 2.
- FIG. 3 shows that ROS-PI3K-AKT- ⁇ -catenin-TERT activation is inhibited by PI3K-AKT inhibitors.
- FIG. 4 shows that TERT expression and poor survival in HCC patients, HCC tumor tissues are positively associated with expression of the idelariship specific molecule p110 ⁇ .
- P110 ⁇ expression in A, GI, GII, and GIII HCC tumor tissues (n 98).
- B, p110 ⁇ mRNA shows mean TERT expression (horizontal line) in HCC tissues with low or high levels (n 98).
- C survival without relapse proportional to p110 ⁇ expression.
- n 84. Samples were divided into two groups based on mean p110 ⁇ expression. Survival was measured using the Kaplan-Meier method; Differences in survival were compared using a log-rank test. Corresponding risk (HR) is shown as survival plot.
- HR Corresponding risk
- RNA Pol II RNA Polymerase II.
- the present application is directed to the discovery that ROS overexpression of PIK3 isoforms, particularly p110 delta, in hepatocellular carcinoma, especially in advanced stage hepatocellular carcinoma, can be effectively treated for hepatocellular carcinoma, especially advanced stage hepatocellular carcinoma. It is based.
- the present application provides a compound 5-fluoro-3-phenyl-2-[(1S) -1- (7H-purin-6-ylamino) propyl] -4 (3H) -quina based on the identification of the pathogenesis of hepatocellular carcinoma.
- the compound '5-fluoro-3-phenyl-2-[(1S) -1- (7H-purin-6-ylamino) propyl] -4 (3H) -quinazolinone' herein refers to an idelariship ( idelalisib), the compounds are disclosed in International Publication No. WO 2012/152210 which is incorporated herein by reference.
- PI3K-Akt inhibitors in particular selective p110 ⁇ kinase inhibitors
- Huh7 cells and Hep3B cells which are HCC cell lines in one embodiment of the present application (FIGS. 1A and B)
- Telomerase reverse transcriptase expression It has been found herein that it has anti-telomerase efficacy that inhibits elongation and inhibits elongation of telomere length.
- composition herein binds to the ATP-binding site of p110 ⁇ to inactivate the PI3K-AKT signaling pathway.
- PI3K plays an essential role in regulating cell growth, proliferation, and metabolism by activating downstream kinases such as AKT, wherein activation of the PI3K pathway is mediated by class I PI3K catalytic isomers p110 ⁇ , p110 ⁇ , p110 ⁇ , and p110 ⁇ , This class of enzyme phosphorylates phosphatidylinositol 4,5-bisphosphate (PIP2), resulting in the essential second messenger substance, phosphatidylinositol 3,4,5-bisphosphate (PIP3).
- PIP2 phosphatidylinositol 4,5-bisphosphate
- PIP3 phosphatidylinositol 3,4,5-bisphosphate
- composition of the present invention inhibits PI3K-AKT-TERT signaling activated by Reactive Oxygen Species (ROS) (FIG. 2).
- ROS Reactive Oxygen Species
- composition of the present invention inhibits ROS-PI3K-AKT- ⁇ catenin-TERT activation (FIG. 3).
- PI3K-Akt signaling is overactivated by ROS in the present application, it was confirmed that nuclear expression of ⁇ -catenin is increased to increase TERT expression and elongate telomeres (FIG. 3C and FIG. 4).
- telomere shortening can also be caused by oxidative stress, which is mediated by intracellular increases in free radicals (ROS) in vivo.
- ROS free radicals
- telomere reverse transcriptase (TERT) -mediated activity during the course of various human tumors increases the telomere length, allowing tumor cells to grow indefinitely, which is preserved in HCC tumors.
- inhibition of PI3K-AKT signaling inhibited telomerase expression and inhibited telomere elongation.
- the present application includes the antitelomerase 5-fluoro-3-phenyl-2-[(1S) -1- (7H-purin-6-ylamino) propyl] -4 (3H) -quinazolinone It relates to a pharmaceutical composition for preventing and treating liver cancer.
- hepatocellular carcinoma refers to primary malignant tumors that occur in the liver tissue itself that occurs in patients with risk factors such as alcohol abuse, viral hepatitis, and target liver disease. Hepatocellular carcinoma accounts for more than 90% of all liver cancers, with 40-80% of patients recurring, most often recurring in the liver, but may also appear in the medial wall and mediastinum surrounding the lungs, lymph nodes, and abdominal cavity. Included.
- the hepatocellular carcinoma of the composition according to the present application is hepatocellular carcinoma of grade II (grade II) or higher in hepatocellular carcinoma divided into 1 to 4 stages according to the progression stage.
- hepatocellular carcinoma which the composition according to the present invention is effective may be hepatocellular carcinoma of stage 2 (stage II) or more in hepatocellular carcinoma divided into 1 to 4 stages according to the progression stage.
- treatment means any action that improves or beneficially alters the symptoms of a metabolic disease by administration of the present compositions.
- Those skilled in the art to which the present application belongs, will be able to determine the extent to which the composition of the present invention is correct, improved, improved and treated with reference to the data presented by the Korean Medical Association and the like. .
- Pharmaceutically acceptable addition salts used in the present invention include pharmaceutically acceptable acid addition salts.
- the expression pharmaceutically acceptable salt is a concentration that has a relatively nontoxic and harmless effect on the patient and that any side effects due to the salt do not degrade the beneficial efficacy of the base compound of formula 1, or Means inorganic addition salts.
- the acid may be a halogen acid such as hydrochloric acid or bromic acid; Inorganic acids such as sulfuric acid, nitric acid and phosphoric acid; And acetic acid, trifluoroacetic acid, propanoic acid, hydroxyacetic acid, lactic acid, pyruvic acid, oxalic acid, malonic acid, succinic acid (ie, butanedioic acid), maleic acid, fumaric acid, malic acid, tartaric acid, citric acid, methanesulfonic acid, ethane Organic acids such as sulfonic acid, benzenesulfonic acid, p-toluenesulfonic acid, cyclic acid, salicylic acid, p-amino-salicylic acid and pamoic acid.
- halogen acid such as hydrochloric acid or bromic acid
- Inorganic acids such as sulfuric acid, nitric acid and phosphoric acid
- acetic acid trifluoro
- Base salt forms are, for example, ammonium salts, alkali and alkaline earth metal salts, for example lithium, sodium, potassium, magnesium and calcium salts and the like, and also organic bases such as benzatin, N-methyl-D-glucamine, hydramine salts. Salts with, and salts with amino acids such as arginine, lysine and the like.
- the therapeutic or pharmaceutical composition according to the invention may be formulated in a suitable form with the pharmaceutically acceptable carriers generally used.
- 'Pharmaceutically acceptable refers to a composition that is physiologically acceptable and does not cause an allergic or similar reaction, such as gastrointestinal disorders, dizziness or the like, when administered to a human.
- pharmaceutically acceptable carriers include, for example, water, suitable oils, saline, carriers for parenteral administration such as aqueous glucose and glycols, and the like, and may further include stabilizers and preservatives. Suitable stabilizers include antioxidants such as sodium hydrogen sulfite, sodium sulfite or ascorbic acid.
- Suitable preservatives include benzalkonium chloride, methyl- or propyl-paraben and chlorobutanol.
- the composition according to the present invention if necessary according to the administration method or dosage form, suspensions, dissolution aids, stabilizers, isotonic agents, preservatives, adsorption agents, surfactants, diluents, excipients, pH adjusters, analgesics, buffers, Antioxidant etc. can be contained suitably.
- Pharmaceutically acceptable carriers and formulations suitable for the present invention including those exemplified above, are described in detail in Remington's Pharmaceutical Sciences, latest edition.
- compositions herein may be prepared in unit dose form by formulating with a pharmaceutically acceptable carrier and / or excipient, according to methods readily available to those of ordinary skill in the art. It can be prepared by incorporation into a dose container. The formulations can then be in the form of solutions, suspensions or emulsions in oil or aqueous media or in the form of powders, granules, tablets or capsules.
- the method of administering the pharmaceutical composition of the present application may be easily selected according to the formulation, and may be administered to mammals such as domestic animals and humans by various routes.
- it may be formulated in the form of powders, tablets, pills, granules, dragees, hard or soft capsules, liquids, emulsions, suspensions, syrups, elixirs, external preparations, suppositories, sterile injectable solutions, and so on.
- Oral or parenteral administration, in particular parenteral administration may be preferred.
- Formulations for parenteral administration include sterile aqueous solutions, non-aqueous solvents, suspensions, emulsions, lyophilized preparations, suppositories.
- non-aqueous solvent and the suspension solvent propylene glycol, polyethylene glycol, vegetable oil such as olive oil, injectable ester such as ethyl oleate, and the like can be used.
- base of the suppository witepsol, macrogol, tween 61, cacao butter, laurin butter, glycerol, gelatin and the like can be used.
- compositions herein are administered in pharmaceutically effective amounts.
- a pharmaceutically effective amount is a result of administering a compound according to the present application at a constant dose for a certain period of time, thereby producing a desired effect, that is, treating or alleviating hepatocellular carcinoma.
- the dosage may vary depending on the patient's weight, age, sex, health condition, diet, time of administration, method of administration, rate of excretion, and severity of the disease, but the effective dosage is usually used for adults (60kg).
- As the composition 1 to 500mg preferably 30 to 300mg can be administered once or divided into several times a day.
- the dosage may refer to the dosage of an existing drug, but it will be apparent to those skilled in the art that the dosage may vary depending on various conditions, so that the dosage may vary. It does not limit the scope of the invention.
- the frequency of administration can be administered once a day or divided into several times within the desired range, the administration period is not particularly limited.
- the present disclosure provides the compound 5-fluoro-3-phenyl-2-[(1S) -1- (7H-purin-6-ylamino) propyl] -4 (3H) -quinazolinone, Inhibiting the expression of the PI3K isoform p110 delta in liver cancer cells or hepatocellular cell lines, in particular hepatocellular carcinoma cells overexpressed ROS, in vitro or in vitro using acceptable salts, or ROS-PI3K-AKT-TERT signaling It provides a method and kit for inhibiting. Compounds used in the methods and kits and matters related to the inhibition of the biological phenomena may be referred to the foregoing.
- the compound according to the present invention or a composition comprising the same may be effectively used for the treatment of hepatocellular carcinoma.
- the present application provides a pharmaceutically effective amount of the compound 5-fluoro-3-phenyl-2-[(1S) -1- (7H-purin-6-ylamino) propyl] -4 (3H)-
- a method of treating hepatocellular carcinoma comprising administering quinazolinone or a pharmaceutically acceptable salt thereof to a subject in need thereof.
- HCC cell lines (Huh7 and Hep3B) were obtained from the Korea Cell Line Bank (KCLB, Seoul, Korea).
- THLE-3 cell line (immortalized human liver epithelial cell line produced by infection with the SV40 large T antigen) was obtained from the American Type Culture Collection (ATCC).
- ATCC American Type Culture Collection
- KCLB and ATCC performed cell line authentication using DNA fingerprinting with short tandem repeat analysis. All cell lines were examined for mycoplasma contamination.
- HCC cell lines were grown at 37 ° C. in a humidified 5% CO 2 incubator in DMEM (Welgene, Gyeongsan-si, Korea) supplemented with 10% fetal bovine serum (GenDepot, Barker, TX, USA).
- THLE-3 was incubated in a humidified 5% CO 2 incubator, 37 ° C. in BEGM (Lonza) supplemented with 10% fetal bovine serum as recommended in the ATCC manual.
- H 2 O 2 300 ⁇ mol / L hydrogen peroxide
- H1009 300 ⁇ mol / L hydrogen peroxide
- the cells were treated with 5 mmol / L N-acetylcysteine (NAC) (SigmaAldrich; A7250), 25 ⁇ mol / L idelalisib (LC Laboratoties, Woburn, MA) for 1 hour prior to the addition of H 2 O 2 .
- NAC N-acetylcysteine
- LC Laboratoties, Woburn, MA 25 ⁇ mol / L idelalisib
- the cells were then hybridized with buffer (70% deionized formamide (Amresco, Solon, OH, USA), 20 mmol / L TrisHCl [pH 6.8], 1% BSA, and 1 nmol / L FAM-labeled telomere PNA) nucleic acid) probe (TelGFAM: TTAGGGTTAGGGTTAGGG) (Panagene, Daejeon, Korea) or 1nmol / L FAM-labeled centromere PNA probe (CentFAM:.
- AAACTAGACAGAAGCATT was immersion suspending jaeseo to (Panagene) volume of hybridization buffer of 10 5 cells per The samples were then incubated for 10 minutes in a water bath at 85 ° C. The telomeres were hybridized for 3 hours at room temperature and in the dark, and then each sample was washed with a wash solution (Wash I: 70%).
- Hybridization solutions included 70% formaldehyde in 2 ⁇ SSC, 5% MgCl 2 , 0.25% blocking reagent (Roche, Basel, Switzerland), 15.4 nmol / L of Cy3-labeled telomere PNA probe (TelCCy3: CCCTAACCCTAACCCTAA) (Panagene, Daejeon, Korea), and 18.4 nmol / L FAM-label Centromere PNA probe (CentFAM: AAACTAGACAGAAGCATT) (Panagene). The slides were washed and then rinsed with PBS containing DAPI and then sealed with DAPI mounting medium (Vector Laboratories, Burlingame, CA, USA).
- telomere fluorescence level and the 8-oxo-dG fluorescence level refer to the ratio of telomere fluorescence intensity to centromere fluorescence intensity and the 8-oxo-dG fluorescence intensity to centromere fluorescence intensity ratio, respectively.
- telomere fluorescence intensity was quantified by quantification of telomere fluorescence intensity, centromere fluorescence intensity, and 8-oxo-dG fluorescence intensity.
- Telomere fluorescence levels and 8-oxo-dG fluorescence levels of tumor tissue were calculated by dividing the fluorescence levels of corresponding non-tumor tissues in 5 random fields. Image analysis was performed using Image-Pro plus 6.0 software (Media Cybernetics, Inc., Rockville, MD, USA).
- telomeres length was determined using the non-radioactive chemifluorescence TeloTAGGG telomeres length assay (Roche; Cat. No. 12 209 136 001) according to the manual.
- genomic DNA was isolated from HCC cells using the GeneJET Genomic DNA Purification Kit (Thermo Scientific; # K0721), 4 ⁇ g of genomic DNA was transferred to 16 units at 37 ° C. with 20 units of Hinf 1 (Enzynomics) and Rsa 1 (Enzynomics). Digest for time. The digested DNA was isolated by 0.8% agarose gel electrophoresis and then transferred to a positively charged nylon membrane using capillary transfer.
- DIG digoxigenin
- telomere repeat copy number T and S were determined by quantitative PCR analysis using genomic DNA extracted from the cells, and the previous method (Cawthon RM. Telomere length measurement that modified the T / S ratio in succession) by a novel monochrome multiplex quantitative PCR method.Nucleic Acids Res. 2009; 37: e21).
- p110 ⁇ -specific (1: 500, Abcam; ab32401) antibodies were used.
- the slide was washed and sealed using a medium containing DAPI (Vector Laboratories). Images were acquired using a confocal microscope (LSM 700; Carl Zeiss, Oberkochen, Germany). Image analysis was performed using Image-Pro plus 6.0 software (Media Cybernetics, Inc.).
- TRAP was performed using a TRAPEZE RT Telomerase Detection Kit (Millipore, Darmstadt, Germany; S7710) to quantitatively determine telomerase activity. According to the manual total protein extract (100 ng) was used for each reaction.
- a total of 2 ⁇ 10 5 cells were stored for 5 minutes in 2 ⁇ SDS sample buffer (100 mmol / L TrisHCl [pH 6.8], 4% SDS, 0.2% bromophenol blue, 20% glycerol, and 200 mmol / L ⁇ -mercaptoethanol). Boil and SDS-PAGE and Western blot. To detect TERT, cells were incubated for 15 min at 55 ° C. in 2 ⁇ SDS sample buffer.
- TERT-specific (1: 300, Rockland Immunochemicals, Gilbertsville, PA, USA; 600-401-252), AKT-specific (1: 1000, Cell Signaling Technology; # 9272), phospho-AKT-specific (1 : 2000, Cell Signaling Technology; # 4060), GAPDH-specific (1: 2000, Santa Cruz Biotechnology; sc-47724), or ⁇ -actin-specific (1: 2000, Sigma-Aldrich, St. Louis, MO , USA; A5441) Antibodies were diluted with TBS-Tween 20 in 5% skim milk or bovine serum albumin and incubated overnight at 4 ° C, then washed and HRP-conjugated secondary antibody (1: 1000, Abcam; ab131368 or ab131366) Incubated at. Chemifluorescence images were obtained using a FUSION-SOLO imager (Vilber Lourmat, Marne La Vallee, France).
- Cell viability was measured using Cell Titer 96 MTS (Promega) as described previously (10). 500-1000 cells per well were seeded and treated for 96 hours at drug concentrations as described in each graph. Each assay was repeated at least three times. Data was plotted to perform IC 50 values using GraphPad software. The optical density of formazan production was measured at 490 nm using a Flexstation 3 multimode plate reader (Molecular Devices).
- Huh7 cells were cultured for 4 days with or without 300 ⁇ mol / LH 2 O 2 treatment with or without PI3K inhibitor, AKT inhibitor, or GSK3 ⁇ inhibitor. The cells were fixed using 1% paraformaldehyde with gentle shaking for 20 minutes at room temperature.
- microcoal nuclease buffer 50 mmol / L TrisHCl [pH 8.0], 5 mmol / L CaCl, 100 ⁇ g / mL BSA, 10 mmol / L KCl, and protease inhibitor cocktail [Roche, Basel, Switzerland; 4693159001]).
- microcoal nuclease buffer 50 mmol / L TrisHCl [pH 8.0], 5 mmol / L CaCl, 100 ⁇ g / mL BSA, 10 mmol / L KCl, and protease inhibitor cocktail [Roche, Basel, Switzerland; 4693159001].
- To transfer Disrupted with 2-mm-diameter zirconium beads (Watson); Microcoal nuclease digestes (New England Biolabs, Beverly, MA, USA; M0247S).
- Chromatin (150 ⁇ g) was collected and diluted with dilution buffer 0.1% NP-40, 2 mmol / L EDTA, 150 mmol / L NaCl, 20 mmol / L TrisHCl [pH 8.0], protease inhibitor cocktail [Roche], and phosphatase inhibitor cocktail [Calbiochem]). Pre-cleared at 4 ° C. for 2 hours with 2 ⁇ g cut salmon sperm DNA, 10 ⁇ L preimmune serum (Santa Cruz Biotechnology; sc-2027), and Dynabeads Protein G (Life Technologies; 1004D) after dilution. -clearing).
- Dynabeads Protein G After immunoprecipitation, 20 ⁇ l Dynabeads Protein G was added and incubation was continued for 2 hours.
- the Dynabeads were prepared by TSE 1 (0.1% SDS, 1% Triton X-100, 2mmol / L EDTA, 20mmol / L TrisHCl, and 150mmol / L NaCl), TSE II (0.1% SDS, 1% Triton X-100, 2mmol, respectively).
- PCR amplification products were quantified by qPCR (ABI 7300; Applied Biosystems, Foster City, Calif., USA) using primers specific for the TERT promoter site. PCR amplification was normalized with a TERT intron. Primer sequences are as follows: ⁇ -catenin interaction site for ChIP (forward primer: TCCCGGGTCCCCGGCCCA; reverse primer: CCTCGCGGTAGTGGCTGCGC) and TERT intron for ChIP (forward primer: TGAGGGCTGAGAAGGAGTGT; reverse primer: CACGATAGACGACGACCTCA). On each side of the previously recorded ⁇ -catenin interaction site, 20-22 bp was added.
- the antibodies used were as follows: rabbit polyclonal anti- ⁇ -catenin (1: 200, Abcam, Cambridge, MA, USA; ab6302), mouse monoclonal anti-RNA polymerase II (1:50, Covance , Princeton, NJ, USA; MMS-126R), and rabbit polyclonal anti-SETD1A (1: 100, Novus Biologicals, Littleton, CO, USA; NBP1-81513).
- mice Animal experiments were performed according to protocols approved by Seoul National University Ethics Committee (Approval number: SNU-130225-6). Mice were placed under normal conditions (semi-specific pathogen free) and optionally provided with food and water. Five week old KSN / Slc nude mice were used for all xenografting studies. Mice weighing between 18 g and 20 g were used for the experiment.
- a 1 ⁇ 10 5 Huh7, 1 ⁇ 10 processes the 300 ⁇ mol / LH 2 O 2 alone 5 Huh7, or 25 ⁇ mol / L is della risip and 300 ⁇ mol / LH 2 O 2 by two processes differ from the mock treated 1 ⁇ 10 5 Huh7 was washed, harvested in PBS without Ca 2+ or Mg 2+ and subsequently injected into the subcutaneous tissue in 0.2 mL volumes. Tumor products were monitored weekly via caliper measurements of the two perpendicular diameters (largest diameter D1 and smallest diameter D2) of the tumor. Tumor volume was calculated to be ⁇ ⁇ D1 ⁇ D2 2/6 .
- telomere length measurements and survival rates were assessed using Fisher's exact test and log-rank test, respectively.
- P values in the comparison of telomere activity and messenger RNA expression levels between mock and ROS or PI3K-AKT inhibitor treatments were calculated using a two-sided test. The normality of the frequency distribution was tested using the Shapiro-Willk test.
- Statistical analysis was performed using R software (www.r-project.org) or Prism GraphPad Software version 4.0 (GraphPad Software Inc, San Diego, Calif., USA). All experiments were repeated at least three times independently. Significance values were adjusted to * P ⁇ 0.05, ** P ⁇ 0.01, and *** P ⁇ 0.001.
- a selective p110 ⁇ kinase inhibitor has been used to treat patients with chronic lymphocytic leukemia because of its activity of blocking PI3K-AKT signaling (Yang Q, et al. Clin Cancer Res. 2015; 21: 1537-42; Fruman DA, et al. Nat Rev Drug Discov. 2014; 13: 140-56).
- PI3K-AKT PI3K-AKT signaling
- THLE-3 cell line which represents endogenous proliferating endothelial cells, was included (FIG. 1C).
- TERT expression is regulated when PI3K-AKT signaling is activated, which is inhibited by Idelaria in HCC cells but not in THLE-3 cells.
- PI3K-AKT signaling activated are suitable targets to reduce TERT expression and telomere length in the presence of PI3K inhibitors.
- the present inventors treated cells with increasing ROS levels when treated with various concentrations of H 2 O 2 (0-300 ⁇ mol / L).
- the level and telomere length of TERT messenger RNA (mRNA) and protein in E. coli were compared.
- TERT expression and telomere length increased in HCC cells treated with 300 ⁇ mol / L of H 2 O 2 (telomere length increased 25% -30% and TERT Expression increased by 40% -45%; Figures 2C and D).
- idelariship reduced telomerase activity in two HCC cell lines (FIG. 2I and J), but not in THLE-3 cells (FIG. 2). 2K).
- ROS-mediated increase in TERT expression, telomerase activity, and telomere length was almost completely inhibited by Idelariship (FIG. 2F-K).
- mRNA levels of p110 ⁇ increased from early HCC tissues to advanced HCC tissues (2 or more stages) (FIG. 4A) and were positively associated with TERT mRNA expression (FIG. 4B). This means that the same primary signal causes increased p110 ⁇ and TERT expression.
- High mRNA levels of p110 ⁇ are associated with low recurrence-free survival ( Figure 4C), which indicates that high expression of mRNA levels of p110 ⁇ may be HCC prognostic markers such as high levels of TERT mRNA, high levels of ROS, or long telomeres. Say it can.
- the pharmaceutical composition of the present invention can inhibit HCC tumor proliferation by inhibiting p110 ⁇ kinase by inhibiting the expression of p110 ⁇ at high levels, and in particular, can be effectively used for the treatment of advanced hepatocellular carcinoma. It can also be seen that it is useful for treating liver cancer by specifically blocking ROS-PI3K-AKT-TERT signaling overactivation (FIG. 4D).
Landscapes
- Health & Medical Sciences (AREA)
- Veterinary Medicine (AREA)
- Chemical & Material Sciences (AREA)
- Medicinal Chemistry (AREA)
- Pharmacology & Pharmacy (AREA)
- Life Sciences & Earth Sciences (AREA)
- Animal Behavior & Ethology (AREA)
- General Health & Medical Sciences (AREA)
- Public Health (AREA)
- Epidemiology (AREA)
- Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Organic Chemistry (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
Abstract
본원은 화합물 5-플루오로-3-페닐-2-[(1S)-1-(7H-퓨린-6-일아미노)프로필]-4(3H)-퀴나졸리논, 그의 약학적으로 허용되는 염을 포함하는 간암 예방 및 치료용 약학조성물에 관한 것으로, 본원의 상기 조성물은 ROS-PI3K-AKT-TERT 신호전달을 저해함으로써, 상기 신호전달에 관여하는 단백질이 과발현되는 간세포암 특히 진행성 간세포암의 치료에 유용하게 사용될 수 있다.
Description
본원은 간암 예방 및 치료용 조성물에 관한 것이다.
간암의 전세계 암관련 사망의 두 번째 원인이 되는데, 이중 간세포암(hepatocellular carcinoma, HCC)이 간암의 85-90%를 차지한다. 간세포암의 대략 70-80%는 진행성 등급으로 진행된 후에야 발견된다. 현재 진행성 간세포암 특이적 치료제로 승인된 약물은 소라페닙이 유일하다.
HCC의 주요 원인은 간경변이다. 간경변을 일으키는 원인에는 간염 바이러스(HBV 또는 HCV)의 간염, 알코올 섭취, 및 비알코올성 지방간 등 여러가지가 있어 간경변 병력에만 기초하여 HCC 환자를 치료하는 전략을 세우기에는 어려움이 있다.
HCC 발생에는 Wnt-β-카테닌 경로, p53-Rb 경로, 크로마틴 리모델링, 및 포스파티딜이노시톨 3-키나아제(PI3K)-AKT 등 다양한 경로가 관련된 것으로 알려져 있으나 (El-Serag HB, Rudolph KL. Hepatocellular carcinoma: epidemiology and molecular carcinogenesis. Gastroenterology. 2007;132:2557-76; Schulze K, Imbeaud S, Letouze E, Alexandrov LB, Calderaro J, Rebouissou S, et al. Exome sequencing of hepatocellular carcinomas identifies new mutational signatures and potential therapeutic targets. Nat Genet. 2015;47:505-11) 이러한 연구 결과에도 불구하고, 초기 HCC에서 진행성 HCC(GII 및 GIII HCC)로의 진행의 주요 결정인자는 아직 확인되지 않았다.
PI3K 저해제인 이델라리십은 미국 FDA 및 유럽의약품청에서 재발성 지연성 비-호지킨씨 B-세포 악성종양 치료제로 승인받은 약물이다. 이 저해제는 p110δ의 ATP-결합 부위에 결합하여 PI3K-AKT 신호전달 경로를 불활성화시키는데, PI3K 경로의 활성화는 클래스 I PI3K 촉매적 이형체(isotype) p110α, p110β, p110δ 및 p110γ에 의해 매개된다. 조혈모세포에서 p110δ는 풍부하게 발현되고, PI3K-AKT 신호전달이 근본적으로 면역 세포 증식 및 관련 싸이토카인 및 케모카인의 자극에 기여하고 있다. 이에 지금까지는 이델라리십은 세포 생존, 특히 면역 세포의 사멸에 초점을 맞추고 있다.
대한민국 공개특허 공보 10-2014-0022836은 혈액 악성종양에 대한 조합 요법에 관한 것으로 이델라리십을 림프구성 백혈병 치료에 사용하는 것을 개시한다. 이델라리십이 간암 특히 진행성 간세포암에서 어떤 역할을 하는지에 대하여 알려진 바는 없다. 진행성 간세포암 특이적 치료제의 개발이 필요하다.
본원에서는 간세포암 세포주에서 TERT 발현 및 텔로머라아제를 저해함으로써 간세포암 증식을 억제하는 약학조성물을 제공하고자 한다.
한 양태에서 본원은 화합물 5-플루오로-3-페닐-2-[(1S)-1-(7H-퓨린-6-일아미노)프로필]-4(3H)-퀴나졸리논, 그의 약학적으로 허용되는 염을 포함하는 간세포암 예방 및 치료용 약학조성물을 제공한다.
본원에 따른 일 구현예에서 간세포암은 ROS 및 이에 PI3K 이형체 p110 델타가 과발현되는 간세포암이다.
본원에 따른 다른 구현예에서 본원에 따른 간세포암은 진행성 간세포암으로, 진행성 간세포암은 당업계에 공지된 수 개의 진행단계에 따른 간암 구분방법에 따라 결정될 수 있으며, 예를 들면 이로 제한하는 것은 아니나 진행성 간세포암은 LCSGJ (Liver Cancer Study Group of Japan)의 간세포암 TNM (tumor-node-metastasis) 기준으로 II기 이상의 간세포암이다. 또는 상기 진행성 간세포암은 암분화도에 따른 조직학적 그레이딩 방법 (histological grade of tumor differentiation)인 에드몬슨 슈타이너 그레이딩 시스템(Edmondson?Steiner grading system) 기준으로 그레이드 II 이상의 간세포암이다.
일 구현예에서 본원에 따른 약학 조성물은 ROS-PI3K-AKT-TERT 신호전달 억제에 의해 간세포암을 치료한다.
다른 측면에서 본원은 화합물 5-플루오로-3-페닐-2-[(1S)-1-(7H-퓨린-6-일아미노)프로필]-4(3H)-퀴나졸리논, 그의 약학적으로 허용되는 염을 포함하는 인비보 또는 인비트로에서 간암세포 또는 간암세포주에서 PI3K 이형체 p110 델타 발현 억제용 키트를 제공한다.
일 구현예에서 본원에 따른 키트가 효과가 있는 간암세포는 ROS레벨이 높은 것이다.
다른 측면에서 본원은 또한 화합물 5-플루오로-3-페닐-2-[(1S)-1-(7H-퓨린-6-일아미노)프로필]-4(3H)-퀴나졸리논, 그의 약학적으로 허용되는 염을 포함하는 인비보 또는 인비트로에서 간암세포 또는 간암세포주에서 ROS-PI3K-AKT-TERT 신호전달 억제용 키트를 제공한다.
다른 측면에서 본원은 또한 간암세포에 5-플루오로-3-페닐-2-[(1S)-1-(7H-퓨린-6-일아미노)프로필]-4(3H)-퀴나졸리논, 또는 그의 염을 처리하는 단계를 포함하는, 상기 간암세포의 PI3K 이형체 p110 델타 발현 억제 방법에 관한 것이다.
또 다른 측면에서 본원은 또한 간암세포에 5-플루오로-3-페닐-2-[(1S)-1-(7H-퓨린-6-일아미노)프로필]-4(3H)-퀴나졸리논, 또는 그의 염을 처리하는 단계를 포함하는 상기 간암세포의 ROS-PI3K-AKT-TERT 신호전달 경로 저해하는 방법을 제공한다.
일 구현예에서 상기 간암세포는 ROS 레벨이 증가한 세포이며, 간암세포주 또는 간암세포 또는 조직을 모두 포함하는 것이다.
또 다른 측면에서 본원은 또한 간세포암의 치료가 필요한 대상체에게 약학적으로 유효한 양의 화합물 5-플루오로-3-페닐-2-[(1S)-1-(7H-퓨린-6-일아미노)프로필]-4(3H)-퀴나졸리논 또는 그의 약학적으로 허용되는 염을 투여하는 단계를 포함하는, 간세포암 치료방법을 제공한다.
본원에 따른 일 구현예에서 간세포암은 ROS 및 이에 PI3K 이형체 p110 델타가 과발현되는 간세포암이다.
본원에 따른 다른 구현예에서 본원에 따른 간세포암은 진행성 간세포암으로, 진행성 간세포암은 당업계에 공지된 수 개의 진행단계에 따른 간암 구분방법에 따라 결정될 수 있으며, 예를 들면 이로 제한하는 것은 아니나 진행성 간세포암은 LCSGJ (Liver Cancer Study Group of Japan)의 간세포암 TNM (tumor-node-metastasis) 기준으로 II기 이상의 간세포암이다. 또는 상기 진행성 간세포암은 암분화도에 따른 조직학적 그레이딩 방법 (histological grade of tumor differentiation)인 에드몬슨 슈타이너 그레이딩 시스템(Edmondson?Steiner grading system) 기준으로 그레이드 II 이상의 간세포암이다.
본원에 따른 약학조성물은 간세포암(HCC)에서 ROS에 의해 활성화되는 PI3K-AKT-TERT 신호전달 활성화를 저해하여 TERT 발현을 감소시키고 텔로미어 길이를 감소하게 함으로써 종양의 증식을 억제할 수 있다. 특히 ROS 및 이에 따른 PIK3 아이소타입인 p110델타의 발현이 증가된 진행성 간암 또는 악성 간암의 치료에 유용하게 사용될 수 있다.
도 1은 본원의 일 구현예에 따른 이델라리십이 HCC 세포 증식, PI3K-AKT-TERT 신호전달, 및 텔로미어 길이 유지를 저해한다는 것을 나타낸 것이다. A-C. AKT 활성화된 두 개의 HCC 세포주(PI3K/AKT 신호전달의 활성화된) 및 정상 간에서 유래한 비 간암 세포주(PI3K/AKT 신호전달이 불활성화된)에서 이델라리십의 용량-의존적 저해를 나타낸 것이다. 두 개의 HCC 세포주인 Huh7 세포(A) 및 Hep3B 세포(B) 및 정상 간에서 유래한 비 간암 세포주 THLE-3 세포(C)를 일정 용량 범위의 이델라리십으로 처리하여, 세포 증식을 MTS 분석법으로 분석하였다. 박스 내의 면역염색 이미지는 이델라리십이 선택적으로 표적하는 p110δ의 발현이 THLE-3 보다는 HCC 세포에서 더 높다는 것을 나타낸다. 스케일 바, 10㎛. D-F, AKT 활성화된 HCC 세포주 모델 및 AKT 불활성화된 정상 간에서 유래한 비 간암 세포주 모델에서의 이델라리십 처리 후의 표적 저해 및 다운스트림 신호전달을 나타낸다. G-I, HCC 세포주에서 이델라리십 처리후에 텔로미어가 짧아진 것을 나타낸다. 텔로미어 길이는 텔로미어 서던 블랏(G), immunoFISH(H, J, 및 L), 및 정량적 PCR(I, K, 및 M)으로 정량하였다. T/S 비율은 텔로미어 반복 카피 수와 단일-카피 유전자 카피 수의 비율. POC, 대조군 퍼센트. 데이터에 기재된 수치는 평균 ± SEM(그룹당 n=4)를 나타낸다; ** t-시험에서 P <0.01.
도 2는 HCC 세포주에서 ROS는 PI3K-AKT-TERT 신호전달 활성화 및 텔로미어 신장을 촉진시키며, 이델라리십은 ROS-매개 PI3K-AKT-TERT 신호전달 활성화를 억제한다는 것을 나타낸다. A, Huh7, Hep3B, 및 THLE-3 세포에서의 p110 이형체 mRNA 레벨을 나타낸 것이다. B, 과산화수소(H2O2) 처리후의 Huh7, Hep3B, 및 THLE-3 세포에서의 p110 이형체 mRNA 레벨을 나타낸 것이다. C-E, 다양한 농도의 H2O2 및 ROS 스캐빈저 NAC 존재에서의 세포 생존율(밝은 청색), 텔로미어 형광(적색), 및 TERT 발현(흑색) 및 TERT 단백질 면역분석의 퍼센트를 나타낸 것이다. 평균 텔로미어 길이는 FlowFISH로 결정된다. Huh7 세포(C), Hep3B 세포(D), 및 THLE-3 세포(E). POC, 대조군 퍼센트. NAC, N-아세틸시스테인. F-H, 300μmol/L H2O2-처리된 HCC 세포주 및 150μmol/L H2O2-처리된 THLE-3 세포에서의 이델라리십 처리 후 표적 저해 및 다운스트림 신호전달을 나타낸 것이다. TERT 발현은 β-액틴의 것으로 정규화하였다. POC, 대조군 퍼센트. I-K, 이델라리십 처리 존재 또는 부존재하의 300μmol/L H2O2-처리된 HCC 세포주 및 150μmol/L H2O2-처리된 THLE-3 세포에서의 텔로미어 활성을 나타낸 것이다. 데이터에 나타난 수치는 평균 ± SEM(그룹당 n=4). 지시된 처리 그룹과 대조군 사이의 비교에 대한 P 수치는 t-테스트에서 ** P < 0.01, *** P < 0.001, 및 **** P < 0.0001 로 나타냈다.
도 3은 ROS-PI3K-AKT-β-카테닌-TERT 활성화가 PI3K-AKT 저해제에 의해 저해된다는 것을 나타낸다. A-C. PI3K 저해제 이델라리십(A), AKT 저해제 페리포신(B), 또는 GSK3β 저해제 XI(C) 존재 또는 부존재에서의 300μmol/L H2O2- 또는 mock-처리된 Huh7 세포에서의 TERT 프로모터의 β-카테닌 상호작용 부위를 사용한 ChIP를 나타낸다. 수치는 평균 ± SEM(그룹당 n=4); t-테스트에 의해 ** P < 0.01, 및 *** P < 0.001로 나타냈다. D, mock-처리된 Huh7 세포, 300μmol/L H2O2-처리된 Huh7 세포, 및 300μmol/L H2O2 및 25μmol/L 이델라리십 둘다를 처리한 Huh7 세포를 이식한 후 6번째 주에서의 누드 마우스의 대표적 이미지를 나타낸 것이다. 점원은 종양을 나타낸다. 스케일 바, 10㎝. E. 매주 측정한 마우스의 평균 종양 사이즈(㎣)를 나타낸 그래프이다. H2O2 및 이델라리십 둘다를 처리한 세포의 동등한 수를 주입한 마우스와 비교하여 단측(one-sided) 랭크 테스트를 사용하여 P 수치를 결정하였다. 마우스 수 : mock 처리에서는 4, H2O2 처리에서는 5, 그리고 H2O2 및 이델라리십 둘다 처리에서는 4.
도 4는 HCC 환자, HCC 종양조직에서의 TERT 발현 및 저조한 생존율이 이델라리십 특이적 분자 p110δ 발현과 양성 연관되어 있다는 것을 나타낸 것이다. A, GI, GII, 및 GIII HCC 종양조직(n=98)에서의 p110δ 발현을 나타낸 것이다. B, p110δ mRNA이 저레벨 또는 고레벨인 HCC 조직에서의 평균 TERT 발현(수평선)을 나타낸 것이다(n=98). C, p110δ 발현에 비례하는 재발없는 생존율. n=84. 표본은 평균 p110δ 발현에 근거하여 두 개의 그룹으로 분리하였다. 생존율은 Kaplan-Meier 방법을 사용하여 측정하였다; 생존율에서의 차이는 로그-랭크 테스트를 사용하여 비교하였다. 상응하는 위험률(HR)은 생존 플랏으로 나타내었다. D, 진행 HCC에서의 PI3K 및 AKT에 대한 저해제 및 ROS의 잠재적 기능을 나타내는 분자 모델을 나타낸 것이다. 진행 HCC에서 AKT 신호전달을 활성화시킴으로써 ROS 레벨이 상승되면 TERT가 상승조절된다는 것을 나타낸 것이다. AKT 활성화는 GSK3β 활성을 억제하고; GSK3β 불활성화는 연속하여 β-카테닌 단백질이 핵 내에 축적되게 한다. TERT 프로모터에서β-카테닌이 모집되면 TERT 발현이 증가하여, 텔로미어가 신장된다. RNA Pol II, RNA 폴리머라아제 II.
본원은 간세포암, 특히 진행단계의 간세포암에서 PIK3 이형체 중 특히 p110 델타형이 ROS에 의해 과발현되는 것을 규명하고, 이를 억제할 경우, 간세포암, 특히 진행단계 간세포암을 효과적으로 치료할 수 있다는 발견에 근거한 것이다.
따라서 본원은 이러한 간세포암 발병 기전 규명에 근거한, 화합물 5-플루오로-3-페닐-2-[(1S)-1-(7H-퓨린-6-일아미노)프로필]-4(3H)-퀴나졸리논(이델라리십)의 간세포암 치료에 대한 신규 용도에 관한 것이다.
한 양태에서 본원은 화합물 5-플루오로-3-페닐-2-[(1S)-1-(7H-퓨린-6-일아미노)프로필]-4(3H)-퀴나졸리논, 그의 약학적으로 허용되는 염을 포함하는, 간암 예방 및 치료용 약학조성물에 관한 것이다.
본원의 상기 화합물 ‘5-플루오로-3-페닐-2-[(1S)-1-(7H-퓨린-6-일아미노)프로필]-4(3H)-퀴나졸리논’은 이델라리십(idelalisib)이라고도 불리며, 본원에 참고로 포함된 국제공개번호 WO 2012/152210호에 화합물 및 이의 제조방법이 기재되어 있다.
PI3K-Akt 저해제, 특히 선택적 p110δ 키나아제 저해제인 본원에 따른 화합물이 본원의 일 실시예에서 HCC 세포주인 Huh7 세포 및 Hep3B 세포의 증식을 저해함(도 1A 및 B)과 더불어 TERT(telomerase reverse transcriptase) 발현을 저해하며 텔로미어 길이가 신장되는 것을 저해하는 항텔로머라아제 효능을 가진다는 것을 본원에서 규명하였다.
본원의 조성물은 p110δ의 ATP-결합 부위에 결합하여 PI3K-AKT 신호전달 경로를 불활성화시킨다. PI3K는 AKT와 같은 다운스트림 키나아제를 활성함으로써 세포 성장, 증식, 및 대사를 조절하는데 필수적 역할을 하는데, PI3K 경로의 활성화는 클래스 I PI3K 촉매적 이형체 p110α, p110β, p110δ 및 p110γ에 의해 매개되고, 상기 부류의 효소가 포스파티딜이노시톨 4,5-비스포스페이트(PIP2)를 인산화시키고, 필수적 두 번째 메신저 물질인 포스파티딜이노시톨 3,4,5-비스포스페이트(PIP3)이 생성된다.
본원의 다른 구현예에서 본원의 조성물이 ROS(Reactive Oxygen Species) 에 의해 활성화되는 PI3K-AKT-TERT 신호전달을 억제함을 확인하였다(도 2). ROS는 암세포에서 PI3K-AKT 신호전달 경로를 과활성화시키지만, 본원의 조성물에 의하여 상기 경로 활성화가 저해된다.
또한 본원의 다른 구현예에서 본원의 조성물이 ROS-PI3K-AKT-β카테닌-TERT 활성화를 억제함을 확인하였다(도 3). 본원에서 ROS에 의해 PI3K-Akt 신호전달이 과활성화되면 β카테닌의 핵내 발현이 증가하여 TERT 발현이 증가하게 되고 텔로미어가 신장됨을 확인하였다(도 3C, 도 4).
텔로미어를 길게하는 효소인 텔로머라아제가 저해되면 세포가 분열할수록 텔로미어는 짧아져서 궁극적으로 세포 성장 정지, 노쇠, 및 사멸로 이끈다. 텔로미어 단축은 또한 산화적 스트레스에 의해 야기될 수 있는데, 이는 인비보에서 활성 산소(ROS)가 세포내 증가됨으로써 매개된다. 하지만 초기 HCC에서 진행 HCC로의 진행과정 동안 ROS 레벨이 증가함에 따라, 텔로미어는 단축되기 보다는 길어진다. 다양한 인간 종양의 진행과정동안 TERT(telomerase reverse transcriptase)-매개 활성은 텔로미어 길이를 증가시켜 종양 세포가 무한증식하도록 하는데, HCC 종양에서 이러한 현상이 보존된다. 본원의 일 구현예에서는 PI3K-AKT 신호전달을 저해하면 텔로머라아제 발현이 저해되어 텔로미어 신장이 저해됨을 밝혔다. 따라서 본원은 항텔로머라아제인 5-플루오로-3-페닐-2-[(1S)-1-(7H-퓨린-6-일아미노)프로필]-4(3H)-퀴나졸리논을 포함하는 간암 예방 및 치료용 약학조성물에 관한 것이다.
본원에서 사용된 용어, 간세포암은 알콜 남용, 바이러스성 간염 및 대상성 간질환과 같은 위험인자를 갖는 환자에서 발생하는 간조직 자체에서 발생하는 원발성 악성 종양을 일컫는 것이다. 간세포암은 전체 간암의 90% 이상을 차지하며, 환자의 40~80%는 재발하는데, 대부분 다시 간에 재발하지만, 폐와 림프절, 복강을 둘러싸고 있는 안쪽 벽과 종격동에서 나타날 수도 있으며, 이러한 암도 본원에 포함된다.
본원에 따른 일구현예에서는 특히 진행성 간암 또는 악성 간암의 치료에 사용된다. 본원에서 간암의 진행 단계(grade)에 따른 구분은 당업계에 공지된 것으로 예를 들면 암분화도에 따른 조직학적 그레이딩 방법(histological grade of tumor differentiation)인 에드몬슨 슈타이너 그레이딩 시스템(EdmondsonSteiner grading system)(Pirisi M et al., Arch Pathol Lab Med. 2010 Dec;134(12):1818-22)을 참조할 수 있다. 이에 따르면 본원에 따른 조성물이 효과가 있는 간세포암은 진행단계에 따라 1 내지 4단계로 구분되는 간세포암에서 grade II (grade II) 이상의 간세포암이다. 또한 American Joint Committee on Cancer (AJCC) TNM Staging for Liver Tumors (7th ed., 2010)나 Liver Cancer Study Group of Japan (LCSGJ)-T의 최근판 HCC TNM(Tumor node metastasis) staging을 참고할 수도 있다. 이에 따르면 본원에 따른 조성물이 효과가 있는 간세포암은 진행단계에 따라 1 내지 4기로 구분되는 간세포암에서 2기(stage II) 이상의 간세포암일 수 있다.
본원에 사용된 용어 “치료”, “완화” 또는 “개선”이란 본원 조성물의 투여로 대사 질환의 증세를 호전시키거나 이롭게 변경하는 모든 행위를 의미한다. 본원이 속하는 기술분야에서 통상의 지식을 가진 자라면, 대한의학협회 등에서 제시된 자료를 참조하여 본원의 조성물이 효과가 있는 질환의 정확한 기준을 알고, 개선, 향상 및 치료된 정도를 판단할 수 있을 것이다.
본 발명에서 사용되는 약학적으로 허용되는 부가 염은 약학적으로 허용되는 산부가 염을 포함한다. 약학적으로 허용가능한 염이란 표현은 환자에게 비교적 비독성이고 무해한 유효작용을 갖는 농도로서 이 염에 기인한 부작용이 화학식 1의 염기 화합물의 이로운 효능을 떨어뜨리지 않는 화학식 1의 염기 화합물의 어떠한 유기 또는 무기 부가염을 의미한다. 예를 들면 산은 염산 또는 브롬산 등의 할로겐산; 황산, 질산 및 인산 등의 무기산; 및, 아세트산, 트리플루오로아세트산, 프로판산, 하이드록시아세트산, 락트산, 피루브산, 옥살산, 말론산, 숙신산(즉, 부탄디오익산), 말레산, 푸마르산, 말산, 타르타르산, 시트르산, 메탄설폰산, 에탄설폰산, 벤젠설폰산, p-톨루엔설폰산, 시클람산, 살리실산, p-아미노-살리실산 및 파모산 등의 유기산을 포함한다. 염기염 형태는 예컨대, 암모늄 염, 알칼리 및 알칼리 토금속 염으로 예를 들면 리튬, 소듐, 포타슘, 마그네슘 및 칼슘 염등이고, 또한 벤자틴, N-메틸-D-글루카민, 히드라바민 염과 같은 유기 염기와의 염, 및 아르기닌, 리신 등과 같은 아미노산과의 염을 포함한다.
본원에 따른 치료제 또는 약학적 조성물은 일반적으로 사용되는 약학적으로 허용가능한 담체와 함께 적합한 형태로 제형화될 수 있다. '약학적으로 허용되는'이란 생리학적으로 허용되고 인간에게 투여될 때, 통상적으로 위장 장애, 현기증 등과 같은 알레르기 반응 또는 이와 유사한 반응을 일으키지 않는 조성물을 말한다. 예로서 약학적으로 허용되는 담체로는 예를 들면, 물, 적합한 오일, 식염수, 수성 글루코스 및 글리콜 등과 같은 비경구 투여용 담체 등이 있으며 안정화제 및 보존제를 추가로 포함할 수 있다. 적합한 안정화제로는 아황산수소나트륨, 아황산나트륨 또는 아스코르브산과 같은 항산화제가 있다. 적합한 보존제로는 벤즈알코늄 클로라이드, 메틸- 또는 프로필-파라벤 및 클로로부탄올이 있다. 또한 본 발명에 따른 조성물은 그 투여방법이나 제형에 따라 필요한 경우, 현탁제, 용해보조제, 안정화제, 등장화제, 보존제, 흡착방지제, 계면활성화제, 희석제, 부형제, pH 조정제, 무통화제, 완충제, 산화방지제 등을 적절히 포함할 수 있다. 상기에 예시된 것들을 비롯하여 본 발명에 적합한 약학적으로 허용되는 담체 및 제제는 문헌[Remington's Pharmaceutical Sciences, 최신판]에 상세히 기재되어 있다. 본원의 조성물은 당해 발명이 속하는 기술 분야에서 통상의 지식을 가진 자가 용이하게 실시할 수 있는 방법에 따라, 약학적으로 허용되는 담체 및/또는 부형제를 이용하여 제제화함으로써 단위 용량 형태로 제조되거나 또는 다용량 용기 내에 내입시켜 제조될 수 있다. 이때 제형은 오일 또는 수성 매질중의 용액, 현탁액 또는 유화액 형태이거나 분말, 과립, 정제 또는 캡슐 형태일 수 있다.
본원의 약학 조성물의 투여방법은 제형에 따라 용이하게 선택될 수 있으며, 가축, 인간 등의 포유동물에 다양한 경로로 투여될 수 있다. 예를 들면, 산제, 정제, 환제, 과립제, 당의정, 경질 또는 연질의 캡슐제, 액, 에멀젼, 현탄액, 시럽제, 엘릭서, 외용제, 좌제, 멸균 주사용액 등의 형태로 제형화되어 전신 또는 국소적으로 경구 또는 비경구 투여될 수 있으며, 특히 비경구 투여가 바람직할 수도 있다.
비경구 투여를 위한 제형에는 멸균된 수용액, 비수성용제, 현탁제, 유제, 동결건조제제, 좌제가 포함된다. 비수성용제, 현탁용제로는 프로필렌글리콜, 폴리에틸렌 글리콜, 올리브 오일과 같은 식물성 기름, 에틸올레이트와 같은 주사 가능한 에스테르 등이 사용될 수 있다. 좌제의 기제로는 위텝솔(witepsol), 마크로골, 트윈(tween) 61, 카카오지, 라우린지, 글리세롤, 젤라틴 등이 사용될 수 있다.
본원의 약학 조성물은 약학적으로 유효한 양으로 투여된다. 약학적으로 유효한 양은 본원에 따른 화합물을 일정한 투여량으로 일정 기간 투여한 결과 목적하는 효과, 즉, 간세포암의 치료 또는 완화 효과를 가져오는 것이다. 투여량은 환자의 체중, 연령, 성별, 건강상태, 식이, 투여시간, 투여방법, 배설률 및 질환의 중증도 등에 따라 그 범위가 다양할 수 있으나, 유효 투여량은 통상적으로 성인(60kg)의 경우 일반적으로는 상기 조성물 1 내지 500mg, 바람직하게는 30 내지 300mg을 1일 1회 또는 수회 분할하여 투여할 수 있다. 투여량은 기존 약물의 투여량을 참고할 수 있으나, 투여량은 여러 가지 조건에 따라 변동가능하기 때문에, 상기 투여량에 가감이 있을 수 있다는 사실은 당업자에게 자명하며, 따라서 상기 투여량은 어떠한 면으로든 본 발명의 범위를 한정하는 것은 아니다. 투여횟수는 원하는 범위 내에서 하루에 1회, 또는 수회로 나누어 투여할 수 있으며, 투여 기간도 특별히 한정되지 않는다.
다른 측면에서 본원은 화합물 5-플루오로-3-페닐-2-[(1S)-1-(7H-퓨린-6-일아미노)프로필]-4(3H)-퀴나졸리논, 그의 약학적으로 허용되는 염을 이용하여 인비보 또는 인비트로에서 간암세포 또는 간암세포주, 특히 ROS가 과별현되는 간암세포(주)에서 PI3K 이형체 p110 델타 발현을 억제하거나, 또는 ROS-PI3K-AKT-TERT 신호전달을 억제하는 방법 및 키트를 제공한다. 상기 방법 및 키트에 사용되는 화합물 및 이에 의한 상기 생물학적 현상의 억제와 관련된 사항은 앞서 설명한 바를 참고할 수 있다.
상술한 바와 같이 본원에 따른 화합물 또는 이를 포함하는 조성물은 간세포암의 치료에 효과적으로 사용될 수 있다.
따라서 또 다른 측면에서 본원은 약학적으로 유효한 양의 화합물 5-플루오로-3-페닐-2-[(1S)-1-(7H-퓨린-6-일아미노)프로필]-4(3H)-퀴나졸리논 또는 그의 약학적으로 허용되는 염을 간세포암의 치료가 필요한 대상체에게 투여하는 단계를 포함하는, 간세포암의 치료방법에 관한 것이다.
약학적으로 유효한 양, 투여방법, 간세포암의 종류, 치료 기전 등은 앞서 설명한 바를 참고할 수 있다.
이하, 본 발명의 이해를 돕기 위해서 실시예를 제시한다. 그러나 하기의 실시예는 본 발명을 보다 쉽게 이해하기 위하여 제공되는 것일 뿐 본 발명이 하기의 실시예에 한정되는 것은 아니다.
실 시 예
방법 및 재료
종양 시료(Tumor Specimens)
인체 조직을 사용하는 모든 실험은 서울대학교 임상시험심사위원회의 승인을 받았다(SNUIRB No. E1308/001-035). 유전자 발현 분석을 하기 위하여 84개의 외과적 절제된 냉동 HCC 종양 조직 샘플 및 비-종양 간 조직 샘플을 분석하였다. 2005년에서 2009년 사이(133개의 파라핀-포매 샘플) 및 2011년에서 2013년 사이(28개의 냉동 조직 샘플)에는 한국 가톨릭대학의 서울성모병원에서, 2010년에서 2013년 사이에는 고려대학교 구로병원(KU Guro Gene Bank 2013-020) (56개의 냉동 조직 샘플)에서 각 케이스를 전향적(prospectively)이고 지속적으로 동정하였다. 본 발명에 사용된 거의 대부분의 조직 샘플은 본 발명자의 종전 연구에서도 사용되었다. 서울성모병원의 133개의 파라핀-포매 조직 중 93개 샘플 및 28개의 냉동 조직 샘플 중 19개 샘플 및 구로병원의 56개 냉동 조직 샘플 중 53개 샘플이 사용되었다(Ko E, et al., Seo HW, Jung ES, Kim BH, Jung G. The TERT promoter SNP rs2853669 decreases E2F1 transcription factor binding and increases mortality and recurrence risks in liver cancer. Oncotarget. 2015; Ko E, et al., Telomerase reverse transcriptase promoter methylation is related to a risk of recurrence in hepatocellular carcinoma. Hepatology. 2015). HCC GI, GII, 및 GIII 각각에서 p110δ mRNA 레벨의 정량화를 위해 사용된 98개의 샘플 중 14개 냉동 조직은 본 발명자의 다른 연구(Lim SO, et al., Hepatology. 2011;53:1352-62.)에서도 사용되었다. 종양 분화의 조직학적 이형도(histological grade)는 최고 등급을 나타내는 종양 부위에 근거하는 EdmondsonSteiner 등급 시스템에 따라 정의되었다.
세포 배양
HCC 세포주(Huh7 및 Hep3B)는 한국 세포주 은행(KCLB, Seoul, Korea)에서 얻었다. THLE-3 세포주(SV40 대형 T 항원과 함께 감염시켜 생산한 무한증식(immortalized) 인체 간 상피 세포주)는 ATCC(American Type Culture Collection)에서 구하였다. KCLB 및 ATCC는 short tandem repeat analysis으로 DNA 핑거프린팅을 사용하여 세포주 인증(authentication)을 수행하였다. 모든 세포주는 마이코플라즈마 오염을 조사하였다. 10% 소 태아 혈청(GenDepot, Barker, TX, USA)으로 보충된 DMEM(Welgene, Gyeongsan-si, Korea)에서 humidified 5% CO2 인큐베이터, 37℃에서 HCC 세포주를 키웠다. ATCC 매뉴얼에 추천된 바와 같이 10% 소 태아 혈청으로 보충된 BEGM (Lonza)에서 humidified 5% CO2 인큐베이터, 37℃에서 THLE-3를 배양하였다.
PI3K, AKT, 및 GSK3β에 대한 ROS 유도제, ROS 스캐빈저, 및 저해제의 처리
배지는 매일 교체하였고, 상기 세포는 300μmol/L 과산화수소(H2O2) (SigmaAldrich; H1009)에서 4일간 배양하였다. 몇몇 실험에서, 상기 세포는 H2O2를 첨가하기 전에 1시간 동안 5mmol/L N-아세틸시스테인(NAC) (SigmaAldrich; A7250), 25μmol/L 이델라리십(idelalisib)(LC Laboratoties, Woburn, MA, USA; I-7447), 25μmol/L 페리포신(perifosine) (LC Laboratoties, Woburn, MA, USA; P-6522) 또는 30μmol/L GSK3β 저해제(GSK3β inhibitor XI) (Santa Cruz; sc-204770)(31)로 미리 처리하였다. 음성 대조군으로 멸균 증류수(pH 7.0)를 사용하였다(mock treatment).
Flow FISH
몇몇 변형을 시켜 기존에 기재한 바와 같이(Rufer N, et al., Nat Biotechnol. 1998;16:743-7) Flow FISH를 수행하였다. 0.1% w/v 소혈청 알부민(BSA)를 함유하는 차가운 PBS(phosphate-buffered salin) 용액으로 상기 세포를 두 번 세척하였다. 이어서, 상기 세포를 혼성화 버퍼(70% 탈이온화된 포름아마이드(Amresco, Solon, OH, USA), 20mmol/L TrisHCl [pH 6.8], 1% BSA, 및 1nmol/L FAM-labeled 텔로미어 PNA(telomere peptide nucleic acid) 프로브 (TelGFAM: TTAGGGTTAGGGTTAGGG) (Panagene, Daejeon, Korea) 또는 1nmol/L FAM-labeled 센트로미어 PNA 프로브 (CentFAM: AAACTAGACAGAAGCATT) (Panagene)에 재서스펜젼시켰다. 혼성화 버퍼의 부피는 105 세포당 100㎕로 조정하였다. 다음으로, 각 샘플을 85℃ 수조에서 10분동안 배양하였다. 텔로미어 프로브를 실온, 암소에서 3시간동안 혼성화한 후, 각 샘플을 각각의 세척 용액(세척용액 I: 70% 탈이온화 포름아미드, 10mM risHCl [pH 6.8], 0.1% BSA, 및 0.1% 트윈Tween 20; 세척 용액 II: 0.1% BSA 및 0.1% 트윈 20 in PBS)으로 세척하고 용액(0.1% BSA, 10μg/mL RNase A, 및 0.06μg/mL의 7-AAD in PBS)내에서 37℃에서 1시간 동안 배양하였다. 각 개별 배양에서 총 15,00020,000 핵을 분석하였다. G1G0 세포주기 단계에서 모든 핵의 텔로미어 형광 강도는 CELLQUEST software를 사용한 BD FACS Calibur flow cytometer (Becton Dickinson, Franklin Lakes, NJ, USA)을 사용하여 측정하였다.
ImmunoFISH
확립된 ImmunoFISH 프로토콜(Plentz RR, et al., Hepatology. 2007;45:968-76)을 약간 변형시켜 사용하였다. 파라핀-포매 섹션을 자일렌으로 탈파라핀시켜 에탄올 gradient를 사용하여 재수화시켰다. 항원 복구(retrieval)는 100mmol/L 소디움 시트레이트(pH 6.0)내에서 마이크로웨이브에서 10분간 끓여서 수행하였다. 프로테이나아제 K (15μg/mL in PBS [pH 7.4])로 37℃에서 20분간 침투시킨 후, 8-옥소-dG-특이성 항체(1:100, Abcam, Cambridge, MA, USA; ab62623)를 PBS 0.1% Triton X-100 내 1% BSAdp 희석시켜 실온에서 밤새 배양하였다. 슬라이드를 세척한 후 1시간동안 Alexa 647 2차 항체로 처리하였다. 4% 포름알데히드를 사용하여 샘플을 고정시킨 후 에어 드라이를 하였다. 상기 샘플을 90℃에서 6분간 변성키신 후 암소에서 2시간동안 혼성화시켰다. 혼성화 용액에는 70% 포름알데히드 in 2× SSC, 5% MgCl2, 0.25% 블로킹 시약(Roche, Basel, Switzerland), 15.4nmol/L of Cy3-라벨 텔로미어 PNA 프로브 (TelCCy3: CCCTAACCCTAACCCTAA) (Panagene, Daejeon, Korea), 및 18.4nmol/L의 FAM-라벨 센트로미어 PNA 프로브(CentFAM: AAACTAGACAGAAGCATT) (Panagene)가 함유되어 있다. 슬라이드를 세척한 후, DAPI를 함유하는 PBS로 린스하였고, 그 후 DAPI 봉입제(mounting medium)(Vector Laboratories, Burlingame, CA, USA)로 봉입하였다. 본 발명자는 동시에 텔로미어 염색 및 8-옥소-dG 염색에 대한 내부 대조군으로 센트로미어를 염색하였다. 분자 ROS 마커인 산화적 DNA 부가(adduct) 8-옥소-2’-데옥시구아노신(8-옥소-dG)의 레벨은 HCC를 포함한 다양한 종양 타입에서 증가하는 것으로 보고되어 있다. 텔로미어 형광 레벨 및 8-옥소-dG 형광레벨은 각각 텔로미어 형광 강도 대 센트로미어 형광광도의 비, 및 8-옥소-dG 형광강도 대 센트로미어 형광 강도 비를 말한다. 텔로미어 형광 강도, 센트로미어 형광 강도, 및 8-옥소-dG 형광 강도의 정량에는 동일한 노출 시간이 사용되었다. 종양 조직의 텔로미어 형광 레벨 및 8-옥소-dG 형광 레벨은 5 랜덤 필드에서 상응하는 비-종양조직의 형광 레벨을 나누어 계산하였다. 이미지 분석은 Image-Pro plus 6.0 software (Media Cybernetics, Inc., Rockville, MD, USA)를 사용하여 수행하였다.
텔로미어 서던 블랏
텔로미어 길이는 비-방사성 화학형광 TeloTAGGG 텔로미어 길이 어세이(Roche; Cat. No. 12 209 136 001)를 매뉴얼에 따라 사용하여 결정하였다. GeneJET Genomic DNA Purification Kit (Thermo Scientific; #K0721)를 사용하여 HCC 세포에서 게놈 DNA를 분리한 후, 4㎍의 게놈 DNA를 20 유닛의 Hinf 1 (Enzynomics) 및 Rsa 1 (Enzynomics)로 37℃에서 16시간 동안 다이제스트하였다. 상기 다이제스트된 DNA를 0.8% 아가로스 겔 전기영동으로 분리한 후, 캐필러리 트랜스퍼를 사용하여 양전하 나일론 멤브레인으로 옮겼다. 블랏된 DNA는 42℃에서 16시간 동안 텔로미어 반복에 특이적인 디곡시제닌(DIG)-라벨된 프로브로 혼성화한 후, 알칼라인 포스파타아제에 접합된 DIG-특이적 항체와 함께 실온에서 30분 동안 배양하였다.
정량적 실시간-PCR를 통한 상대적 텔로미어 길이 측정
세포에서 추출한 게놈 DNA를 사용하여 정량적 PCR 분석을 통해 상대적 텔로미어 반복 카피 넘버(T) 및 싱글 카피 넘버(S)를 결정하였고, 연속하여 T/S 비율을 변형시킨 종전 방법(Cawthon RM. Telomere length measurement by a novel monochrome multiplex quantitative PCR method. Nucleic Acids Res. 2009;37:e21)처럼 계산하였다.
면역형광 분석법
p110δ 발현 레벨을 가시화하기 위하여, p110δ-특이적 (1:500, Abcam; ab32401) 항체를 사용하였다. 슬리이드를 세척하여 DAPI(Vector Laboratories)를 함유하는 배지를 사용하여 봉입하였다. 공초점 현미경(LSM 700; Carl Zeiss, Oberkochen, Germany)을 사용하여 이미지를 얻었다. 이미지 분석은 Image-Pro plus 6.0 software (Media Cybernetics, Inc.)를 사용하여 수행하였다.
TRAP(Telomerase Repeat Amplification Protocol) 분석
텔로머라아제 활성을 정량적으로 결정하기 위하여 TRAPEZE® RT Telomerase Detection Kit (Millipore, Darmstadt, Germany; S7710)를 사용하여 TRAP를 수행하였다. 매뉴얼에 따라 총 단백질 추출물(100ng)을 각 반응에 사용하였다.
정량적 실시간-PCR로 유전자 발현 레벨 결정
NucleoSpin® TriPrep Kit (Macherey-Nagel, Duren, Germany; 740966.250)를 사용하여 총 RNA를 분리하였고, TOPscript™ RT Drymix (dT18) (Enzynomics, Daejeon, Korea; RT200)를 사용하여 mock- 또는 지시된 시약이 처리된 세포의 총 RNA로부터 cDNA를 합성하였다. TOPreal™ qPCR 2× PreMIX (SYBR Green with high ROX) (Enzynomics, Daejeon, Korea; RT501M) 및 ABI Prism 7300 thermal cycler (Applied Biosystems, Foster City, CA, USA)를 사용하여 PCR을 수행하였다. β-액틴으로 유전자 발현을 노말라이즈하였다 : TERT (정방향 프라이머: GCCTTCAAGAGCCACGTC; 역방향 프라이머: CCACGAACTGTCGCATGT) (26) 및 β-Actin (정방향 프라이머: GCAAAGACCTGTACGCCAACA; 역방향 프라이머: TGCATCCTGTCGGCAATG). 프라이머 특이성을 체크하기 위하여 해리 단계를 추가하였다.
면역블랏 분석
총 2 × 105 세포를 2× SDS 샘플 버퍼(100mmol/L TrisHCl [pH 6.8], 4% SDS, 0.2% 브로모페놀 블루, 20% 글리세롤, 및 200mmol/L β-머캡토에탄올)에서 5분간 끓여서 SDS-PAGE 및 웨스턴 블랏을 하였다. TERT를 탐지하기 위하여, 세포를 2× SDS 샘플 버퍼에서 55℃에서 15분간 배양하였다. TERT-특이적 (1:300, Rockland Immunochemicals, Gilbertsville, PA, USA; 600-401-252), AKT-특이적 (1:1000, Cell Signaling Technology; #9272), phospho-AKT-특이적 (1:2000, Cell Signaling Technology; #4060), GAPDH-특이적 (1:2000, Santa Cruz Biotechnology; sc-47724), 또는 β-액틴-특이적(1:2000, Sigma-Aldrich, St. Louis, MO, USA; A5441) 항체를 5% 스킴 밀크 또는 우혈청알부민에서 TBS-트윈 20과 함께 희석하여 밤새 4℃에서 배양한 후, 세척하고 HRP-접합 이차 항체(1:1000, Abcam; ab131368 또는 ab131366)에서 배양하였다. FUSION-SOLO imager (Vilber Lourmat, Marne La Vallee, France)를 사용하여 화학형광 이미지를 얻었다.
세포 생존력 측정
종래 기재된 바와 같이(10) Cell Titer 96 MTS (Promega)를 사용하여 세포 생존력을 측정하였다. 웰당 500-1000세포를 씨드하여 각 그래프에 기재된 바와 같은 약물 농도에서 96시간 동안 처리하였다. 각 분석법은 최소 3번 반복하였다. 데이터를 플롯하여, GraphPad software를 사용하여 IC50 수치를 수행하였다. Flexstation 3 multimode plate reader (Molecular Devices)를 사용하여 490nm에서 포르마잔 생산의 광학 밀도를 측정하였다.
크로마틴 면역침강
종래 기재한 바와 같이(Lim SO, et al. Gastroenterology. 2008;135:2128-40, 40 e1-8.; Hoffmeyer K, et al. Science. 2012;336:1549-54.) 몇몇 변형시킨 ChIP(크로마틴 면역침강) 실험을 수행하였다. PI3K 저해제, AKT 저해제, 또는 GSK3β 저해제의 존재 또는 부존재하에 300μmol/L H2O2 처리하거나 또는 처리하지 않고 Huh7 세포를 4일 동안 배양하였다. 실온에서 20분동안 천천히 흔들면서 상기 세포를 1% 파라포름알데히드를 사용하여 고정하였다. 그 후, 상기 세포를 얼음으로 차갑게 한 PBS로 두 번 린스하고; 400μL 마이크로코칼 뉴클리아제 버퍼(50mmol/L TrisHCl [pH8.0], 5mmol/L CaCl, 100μg/mL BSA, 10mmol/L KCl, 및 프로테아제 저해제 칵테일[Roche, Basel, Switzerland; 4693159001])에 재서스펜젼시키고; 2-mm-지름 지르코니움 비드(Watson)로 디스럽트하여; 마이크로코칼 뉴클리아제 다이제스쳔이 되게 하였다(New England Biolabs, Beverly, MA, USA; M0247S). Chromatin (150μg)을 수집하여 희석 버퍼0.1% NP-40, 2mmol/L EDTA, 150mmol/L NaCl, 20mmol/L TrisHCl [pH 8.0], 프로테아제 저해제 칵테일[Roche], 및 포스파타제 저해제 칵테일 [Calbiochem])로 희석시킨 후 2㎍ 절단된 연어 정자 DNA, 10μL 전면역(preimmune) 혈청(Santa Cruz Biotechnology; sc-2027), 및 Dynabeads Protein G (Life Technologies; 1004D)로 2시간 동안 4℃에서 전-클리어링(pre-clearing)하였다. 면역침강후, 20μl Dynabeads Protein G를 첨가하고, 2시간 동안 배양을 지속하였다. 상기 Dynabeads를 각각 TSE 1 (0.1% SDS, 1% Triton X-100, 2mmol/L EDTA, 20mmol/L TrisHCl, 및 150mmol/L NaCl), TSE II (0.1% SDS, 1% Triton X-100, 2mmol/L EDTA, 20mmol/L TrisHCl, 및 500mmol/L NaCl), 및 버퍼 III (0.25mol/L LiCl, 1% NP-40, 1% deoxycholate, 1mmol/L EDTA, and 10mmol/L TrisHCl)에서 10분 동안 연속하여 세척하였다. 상기 비드는 그 후 TE 버퍼로 3번 세척하여 1% SDS 및 0.1mol/L NaHCO3를 사용하여 추출하였다. 포름알데히드 교차-연결을 역으로 하기 위하여 상기 용출액을 밤새 65℃로 가열하였다. NucleoSpin DNA clean-up kit를 사용하여 DNA 파편을 정제하였다. TERT 프로모터 부위에 특이적인 프라이머를 사용하여 qPCR(ABI 7300; Applied Biosystems, Foster City, CA, USA)로 PCR 증폭 생성물을 정량하였다. TERT 인트론으로 PCR 증폭을 노말라이즈하였다. 프라이머 서열은 하기와 같다 : ChIP에 대한 β-카테닌 상호작용 부위 (정방향 프라이머 : TCCCGGGTCCCCGGCCCA; 역방향 프라이머 : CCTCGCGGTAGTGGCTGCGC) 및 ChIP에 대한 TERT 인트론 (정방향 프라이머 : TGAGGGCTGAGAAGGAGTGT; 역방향 프라이머 : CACGATAGACGACGACCTCA). 기존에 기록된 β-카테닌 상호작용 부위의 각 면에는, 20-22bp가 첨가되었다. 사용된 항체는 하기와 같다 : 래빗 폴리클로날 항-β-카테닌(1:200, Abcam, Cambridge, MA, USA; ab6302), 마우스 모노클로날 항-RNA 폴리머라아제 II(1:50, Covance, Princeton, NJ, USA; MMS-126R), 및 래빗 폴리클로날 항-SETD1A (1:100, Novus Biologicals, Littleton, CO, USA; NBP1-81513).
인 비보 종양형성(Tumorigenicity) 분석
서울대학교 동물실험 윤리위원회의 승인을 받은 프로토콜에 따라 동물 실험을 수행하였다(Approval number: SNU-130225-6). 마우스를 통상의 조건(세미-특정 병원균 부재 상태)에 두고, 임의로 음식과 물을 제공하였다. 모든 이종이식(xenografting) 연구에 5주령 KSN/Slc 누드 마우스를 사용하였다. 18g에서 20g 사이 무게의 마우스를 실험에 사용하였다. 이종이식 분석법을 위하여, mock 처리를 한 1 × 105 Huh7, 300μmol/L H2O2 단독을 처리한 1 × 105 Huh7, 또는 25μmol/L 이델라리십 및 300μmol/L H2O2 둘 다를 처리한 1 × 105 Huh7을 세척하여 Ca2+ or Mg2+ 이 없는 PBS에서 하베스트하고 연속하여 0.2mL 부피로 등의 피하 조직에 주입하였다. 종양의 두 개의 수직 지름(가장 큰 지름 D1, 및 가장 작은 지름 D2)의 캘리퍼(caliper) 측정을 통하여 종양 생성물을 매주 모니터하였다. 종양 부피는 π × D1 × D22 /6 인 것으로 계산되었다.
통계 분석
텔로미어 길이 측정 및 생존율의 통계적 유의성은 각각 피셔의 정확 검정 및 로그-순위 검정을 사용하여 평가하였다. mock 및 ROS 또는 PI3K-AKT 저해제 처리 사이의 텔로미어 활성 및 메신저 RNA 발현 레벨 비교에서의 P 수치는 양측검정을 사용하여 계산하였다. 빈도 분포의 정상성(normality)는 Shapiro-Willk 검정을 사용하여 테스트하였다. 통계적 분석은 R 소프트웨어(www.r-project.org) 또는 Prism GraphPad Software version 4.0 (GraphPad Software Inc, San Diego, CA, USA)를 사용하여 수행하였다. 모든 실험은 독립적으로 최소 세 번 반복하였다. 유의성 수치는 * P < 0.05, ** P < 0.01, 및 *** P < 0.001로 맞추었다.
실시예 1. PI3K-Akt 저해제인 이델라리십이 HCC 세포 증식, TERT 발현, 및 텔로미어 길이 유지 저해 규명
선택적 p110δ 키나아제 저해제인 이델라리십은 PI3K-AKT 신호전달을 블락하는 활성으로 인해 만성 림프구성 백혈병 환자 치료에 사용되어왔다(Yang Q, et al. Clin Cancer Res. 2015;21:1537-42; Fruman DA, et al. Nat Rev Drug Discov. 2014;13:140-56). p110δ이 서로 다른 레벨로 잠복되어 있는 간 세포에서의 이델라리십의 활성을 측정하기 위하여, 본 발명자는 세 개의 간 세포주를 사용하여 증식 분석을 수행하였다. 상기 간세포주에는 초기 HCC 환자에게서 유래하며 고레벨의 p110δ을 나타내는 HCC 세포주인 Huh7 세포 및 Hep3B 세포가 포함되며(도 1A 및 B), 정상 어른 간 상피 세포에서 나타나는 정상 일차 세포에서 유래하며 저레벨의 p110δ를 나타내는 무한증식 내피세포인 THLE-3 세포주가 포함되었다(도 1C).
이델라리십이 농도-의존적 방식으로 두 개의 HCC 세포주의 세포 증식을 저해하는지를 살펴보았는데, 그 결과 상기 세포주의 세포증식을 저해하였다(도 1A 및 B). Huh7 및 Hep3B의 IC50은 30μmol/L 보다 작았고(도 1A 및 B) THLE-3 세포의 IC50은 200μmol/L 보다 컸다(도 1C). 세포 증식 저해와 더불어, 본 발명자는 또한 두 개의 HCC 세포주에서의 AKT 인산화 저해를 탐색하였다(도 1D 및 E). AKT 인산화의 기저치(basal level)은 THLE-3에서 낮고 25μmol/L 농도에서 이델라리십에 의해 감소되지 않았는데(도 1F), 이는 AKT 신호전달이 이들 세포에서 불활성화된다는 것을 말한다.
또한 이델라리십이 HCC 세포에서 TERT 발현 및 텔로미어 길이를 감소시키는지를 조사하였다. 이델라리십은 두 개의 HCC세포주에서 TERT 발현을 감소시켰지만(도 1D 및 E), THLE-3 세포에서는 그렇지 않았다(도 1F). TERT 발현이 감소되는 결과와 일치하게, 이델라리십에 의해 HCC 세포의 텔로미어 길이가 감소한 것으로 나타났다(도 1G-K). THLE-3 세포에서 TERT 발현의 기저치는 낮았고, 이델라리십에 의하여 THLE-3 세포에서의 TERT 발현 또는 텔로미어 길이 둘 다 감소하지는 않았다(도 1F, L 및 M). 이러한 결과는 PI3K-AKT 신호전달이 활성화되면 TERT 발현이 조절되는데, HCC 세포에서는 이델라리십에 의해 저해되지만 THLE-3 세포에서는 그렇지 않았다. 이는 PI3K-AKT 신호전달이 활성화된 세포는 PI3K 저해제 존재시에 TERT 발현 및 텔로미어 길이가 감소되게 하는 적절한 타겟이 된다는 것을 의미한다.
실시예 2. 이델라라십이 ROS로 유도된 TERT 상향조절 및 HCC 세포의 텔로미어 신장 저해 규명
종래에 ROS는 암 세포에서 PI3K-AKT 신호전달 경로를 과활성화시킬 수 있다는 것이 확인되었지만(Brazil DP, et al. Cell. 2002;111:293-303; Li VS, et al. Cell. 2012;149:1245-56.), ROS가 PI3K 이형체를 증가시키는지 그리하여 PI3K-AKT 활성화를 야기하는지는 알려지지 않았다. PI3K 이형체 p110δ 발현이 THLE-3 세포보다는 HCC 세포에서 더 높고(도 1 및 도 2A), p110δ 선택적 저해제인 이델라리십이 HCC 세포에서만 pAKT 및 TERT 발현, 및 텔로미어 유지를 저해하므로, 본 발명자는 ROS가 HCC 세포에서 p110δ 발현을 증가시키는 지를 실험하였다. 클래스 I PI3K 이형체 (p110α, p110β, p110δ, 및 p110γ)중에서 ROS 유도제 과산화수소(H2O2) 처리후의 HCC 세포에서 p110δ발현만이 증가하였다(도 2B). 이것은 ROS가 p110δ 발현의 상향조절을 통해 PI3K-AKT 신호전달을 특히 과활성화시킨다는 것을 말한다.
다음으로, ROS가 AKT 활성화를 통해 TERT 발현 및 텔로미어 길이를 증가시킬 수 있는지를 조사하기 위하여 본 발명자는 다양한 농도(0-300μmol/L)의 H2O2를 처리하였을 때 ROS 레벨이 증가하는 세포에서의 TERT 메신저 RNA(mRNA) 및 단백질의 레벨 및 텔로미어 길이를 비교하였다. H2O2에 노출되지 않은 대조군 HCC세포와 비교하였을 때, TERT 발현 및 텔로미어 길이는 300μmol/L의 H2O2를 처리한 HCC 세포에서 증가하였다(텔로미어 길이는 25%-30% 증가하였고 TERT 발현은 40%-45% 증가하였다; 도 2C 및 D). ROS 스캐빈저인 N-아세틸시스테인(NAC) 및 H2O2로 세포를 동시에 처리하면 HCC 세포에서 H2O2- 유도에 의한 TERT 발현과 텔로미어 길이 증가 현상이 사라졌다(도 2C 및 D). THLE-3 세포에서는, 150μmol/L의 H2O2에 노출되면 대부분의 세포(85%)가 생존하지 못하였다. 상기 농도에서 텔로미어 길이는 감소하였다(도 2E). 그러나 TERT 발현 레벨은 변하지 않았는데, H2O2 처리 후 AKT 인산화 레벨 변화가 없는 것과 일치하였다(도 2E). 이러한 결과는 HCC 세포에서 AKT 인산화 및 TERT 발현을 상향조절함으로써 ROS가 텔로미어를 길게 할 수 있다는 것을 말한다.
ROS-유도 PI3K-AKT 신호전달 과활성화에 대한 이델라리십의 효과를 연구하기 위하여, 본 발명자는 이델라리십에 노출된 H2O2-처리된 HCC 세포에서의 TERT 발현, 텔로미어 길이 및 텔로머라아제 활성을 측정하였다. TERT 발현 레벨 및 텔로미어 길이는 H2O2 단독을 처리한 HCC세포에서보다 이델라리십 처리 후의 H2O2-처리 HCC 세포에서 현저히 낮았다(텔로미어 길이는 40-45% 감소하고 TERT 발현은 65-70% 감소함; 도 2F 및 G). 이러한 결과는 이델라리십이 ROS-유도 PI3K-AKT 신호전달 과활성화를 저해한다는 것을 말한다. TERT 발현 및 텔로미어 길이의 결과(도 2F-H)와 유사하게, 이델라리십은 두 개의 HCC세포주에서 텔로머라아제 활성을 감소시켰는데(도 2I 및 J), THLE-3 세포에서는 그렇지 않다(도 2K). 본 발명자는 TERT 발현, 텔로머라아제 활성 및 텔로미어 길이에서 ROS-매개로 증가하는 것이 이델라리십에 의하여 거의 전부 저해되었다는 것을 밝혔다(도 2F-K).
실시예 3. 인비보에서 PI3K 저해제인 이델라리십이 HCC 종양 성장 촉진에 대한 ROS 작용 저해 규명
본 발명자는 TERT 전사동안 TERT 프로모터에서 크로마틴 접근성이 증가되는 것이 β-카테닌과 연관되어 있는지를 조사하였다. 이를 위하여 본 발명자는 내인성 β-카테닌 및, 크로마틴 리모델링에 의해 TERT 전사를 촉진한다고 보고되어 있는 히스톤 메틸트랜스퍼라아제 SetD1A에 대한 항체를 사용하여 크로마틴 면역침강을 수행하였다. 크로마틴 면역침강 분석법에서 PI3K 또는 AKT 저해제를 함께 처리하면, H2O2가 존재하더라도 HCC 세포에서 TERT 프로모터에 결합하는 β-카테닌 및 SetD1A가 감소한 반면(도 3A 및 B), GSK3β 저해제를 함께 처리하면 H2O2 처리와 상관없이 β-카테닌 및 SetD1A 결합이 증가하였다(도 3C). 이러한 결과는 ROS가 PI3K-Akt 신호전달 캐스케이드의 과활성화를 통해 β-카테닌의 핵 발현을 증가시킴으로써 TERT 프로모터로의 SetD1A의 모집을 촉진시킨다는 것을 말한다.
다음으로 이델라리십이 인 비보에서 종양 성장을 저해할 수 있는지를 조사하였다. 우선, H2O2 처리 후 PI3K-AKT 신호전달 과활성화된 HCC 세포가 주입된 누드 마우스에서 종양의 외관에 대한 지연시간(latency time)을 조사하였다. H2O2 처리된 1 × 105 HCC 세포와 함께 주입된 누드 마우스에서 종양 발병(tumor development)까지 걸린 지연시간은 28일이었다(도 3D 및 E). H2O2 처리가 되지 않은 1 × 105 HCC 세포를 주입한 누드 마우스에서 종양이 나타나는데 걸린 평균 시간은 70일이었다(도 3E). 반대로, H2O2 및 이델라리십 둘다를 처리한 HCC 세포와 함께 주입한 후 70일이 지나도 종양은 형성되지 않았다(도 3D). 이러한 결과는 ROS가 종양 성장을 촉진하며 종양 성장 촉진에 대한 ROS 작용은 인 비보에서 PI3K 저해제인 이델라리십에 의해 저해될 수 있다는 것을 말한다.
실시예 4. HCC 조직에서 p110δ 발현 레벨이 높아지면 TERT 발현 레벨이 높아지는 현상 및 이의 저조한 간암환자 생존률과의 관련성 규명
본원에서는 p110δ의 mRNA 레벨은 초기 HCC 조직에서부터 진행성 HCC 조직 (2기 이상)까지 증가하였으며(도 4A) TERT mRNA 발현과 양성적으로 연관되어 있음을 규명하였다(도 4B). 이는 동일한 일차 신호가 p110δ 및 TERT 발현이 증가하는 원인이 된다는 것을 말한다. p110δ의 mRNA 레벨이 높은 것이 무재발 생존율이 낮은 것과 연관되어 있는데(도 4C), 이는 p110δ의 mRNA 레벨이 높게 발현되는 것이 고레벨의 TERT mRNA, 고레벨의 ROS, 또는 긴 텔로미어 길이와 같은 HCC 예후 마커일 수 있다는 것을 말한다. 이는 본원의 약학조성물이 p110δ 키나아제를 저해함으로써 p110δ의 mRNA가 고레벨로 발현되는 것을 차단함으로써 HCC 종양 증식을 저해할 수 있음을 나타내며, 특히 진행성 간세포암의 치료에 효과적으로 사용될 수 있음을 나타내는 것이다. 또한 ROS-PI3K-AKT-TERT 신호전달 과활성화를 특이적으로 차단함으로써 간암을 치료하는데 유용하다는 것을 알 수 있다(도 4D).
이상에서 본원의 예시적인 실시예에 대하여 상세하게 설명하였지만 본원의 권리범위는 이에 한정되는 것은 아니고 다음의 청구범위에서 정의하고 있는 본원의 기본 개념을 이용한 당업자의 여러 변형 및 개량 형태 또한 본원의 권리범위에 속하는 것이다.
본 발명에서 사용되는 모든 기술용어는, 달리 정의되지 않는 이상, 본 발명의 관련 분야에서 통상의 당업자가 일반적으로 이해하는 바와 같은 의미로 사용된다. 본 명세서에 참고문헌으로 기재되는 모든 간행물의 내용은 본 발명에 도입된다.
Claims (12)
- 화합물 5-플루오로-3-페닐-2-[(1S)-1-(7H-퓨린-6-일아미노)프로필]-4(3H)-퀴나졸리논, 그의 약학적으로 허용되는 염을 포함하는 간세포암 예방 또는 치료용 약학조성물.
- 제 1 항에 있어서,상기 간세포암은 ROS 레벨 및 PI3K 이형체 p110 델타 발현이 증가해 있는 간세포암인, 간세포암 예방 또는 치료용 약학조성물.
- 제 1 항 또는 제 2 항에 있어서,상기 간세포암은 진행성 간세포암인, 간세포암 예방 또는 치료용 약학조성물.
- 제 3 항에 있어서,상기 진행성 간세포암은 암분화도에 따른 조직학적 그레이딩 방법 (histological grade of tumor differentiation)인 에드몬슨 슈타이너 그레이딩 시스템(Edmondson Steiner grading system) 기준으로 그레이드 II 이상의 간세포암인, 간세포암 예방 또는 치료용 약학조성물.
- 제 1 항 또는 제 2 항에 있어서,상기 간세포암의 치료는 ROS-PI3K-AKT-TERT 신호전달 저해에 의한 것인, 약학조성물.
- 간암세포에 5-플루오로-3-페닐-2-[(1S)-1-(7H-퓨린-6-일아미노)프로필]-4(3H)-퀴나졸리논, 또는 그의 염을 처리하는 단계를 포함하는, 상기 간암세포의 PI3K 이형체 p110 델타 발현 억제 방법.
- 제 6 항에 있어서,상기 간암세포는 ROS 레벨이 증가해 있는 것인. 방법.
- 간암세포에 5-플루오로-3-페닐-2-[(1S)-1-(7H-퓨린-6-일아미노)프로필]-4(3H)-퀴나졸리논, 또는 그의 염을 처리하는 단계를 포함하는 상기 간암세포의 ROS-PI3K-AKT-TERT 신호전달 경로 저해 방법.
- 간세포암의 치료가 필요한 대상체에게 약학적으로 유효한 양의 화합물 5-플루오로-3-페닐-2-[(1S)-1-(7H-퓨린-6-일아미노)프로필]-4(3H)-퀴나졸리논 또는 그의 약학적으로 허용되는 염을 투여하는 단계를 포함하는, 간세포암 치료방법.
- 제 9 항에 있어서,상기 간세포암은 ROS 레벨 및 PI3K 이형체 p110 델타 발현이 증가해 있는 간세포암인, 방법.
- 제 10 항에 있어서,상기 간세포암은 진행성 간세포암인, 방법.
- 제 11 항에 있어서,상기 진행성 간세포암은 암분화도에 따른 조직학적 그레이딩 방법 (histological grade of tumor differentiation)인 에드몬슨 슈타이너 그레이딩 시스템(Edmondson Steiner grading system) 기준으로 그레이드 II 이상의 간세포암인, 방법.
Priority Applications (3)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| JP2018561462A JP6871638B2 (ja) | 2016-02-15 | 2017-02-14 | 肝癌の治療または予防用組成物 |
| US15/998,556 US10463669B2 (en) | 2016-02-15 | 2017-02-14 | Composition for treating or preventing liver cancer |
| CN201780023517.4A CN109069513B (zh) | 2016-02-15 | 2017-02-14 | 用于治疗或预防肝癌的组合物 |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| KR1020160017187A KR101662975B1 (ko) | 2016-02-15 | 2016-02-15 | 간암 치료 또는 예방용 조성물 |
| KR10-2016-0017187 | 2016-02-15 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2017142283A1 true WO2017142283A1 (ko) | 2017-08-24 |
Family
ID=57164552
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/KR2017/001575 Ceased WO2017142283A1 (ko) | 2016-02-15 | 2017-02-14 | 간암 치료 또는 예방용 조성물 |
Country Status (5)
| Country | Link |
|---|---|
| US (1) | US10463669B2 (ko) |
| JP (1) | JP6871638B2 (ko) |
| KR (1) | KR101662975B1 (ko) |
| CN (1) | CN109069513B (ko) |
| WO (1) | WO2017142283A1 (ko) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2019121872A1 (en) * | 2017-12-20 | 2019-06-27 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Methods for the diagnosis and treatment of liver cancer |
Families Citing this family (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR101662975B1 (ko) * | 2016-02-15 | 2016-10-06 | 서울대학교산학협력단 | 간암 치료 또는 예방용 조성물 |
| CN110665007A (zh) * | 2019-09-19 | 2020-01-10 | 邦世(苏州)生物医药科技有限公司 | 一种治疗癌症用组合药物及其用途 |
| KR102699871B1 (ko) | 2021-04-29 | 2024-08-29 | 주식회사 서지넥스 | 약물전달물질로서의 간세포암 특이적 표적 엑소좀 조성물 및 이의 용도 |
| KR20230112770A (ko) | 2022-01-20 | 2023-07-28 | 가톨릭대학교 산학협력단 | 항섬유화 억제용 조성물 |
| CN114796482A (zh) * | 2022-05-31 | 2022-07-29 | 江苏省人民医院(南京医科大学第一附属医院) | gsk3β抑制剂在制备提高抗肝细胞肝癌疗效的药物中的应用 |
| KR20250044972A (ko) | 2023-09-25 | 2025-04-01 | 주식회사 마스터메디텍 | 이델라리십 함유 경구투여용 고형제제 및 그 제조방법 |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2014051359A1 (ko) * | 2012-09-26 | 2014-04-03 | 부경대학교 산학협력단 | 네퍼린을 유효성분으로 포함하는 간암 예방 또는 치료용 약제학적 조성물 |
| KR101662975B1 (ko) * | 2016-02-15 | 2016-10-06 | 서울대학교산학협력단 | 간암 치료 또는 예방용 조성물 |
Family Cites Families (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| AP2011005956A0 (en) * | 2009-04-20 | 2011-10-31 | Gilead Calistoga Llc | Methods of treatment for solid tumors. |
| CA2768843A1 (en) * | 2009-07-21 | 2011-01-27 | Gilead Calistoga Llc | Treatment of liver disorders with pi3k inhibitors |
| WO2013082540A1 (en) * | 2011-12-02 | 2013-06-06 | Gilead Calistoga Llc | Compositions and methods of treating a proliferative disease with a quinazolinone derivative |
| WO2014046617A1 (en) * | 2012-09-19 | 2014-03-27 | Agency For Science, Technology And Research | Compositions and methods for treating cancer |
| WO2015002729A2 (en) * | 2013-06-13 | 2015-01-08 | Biomatrica, Inc. | Cell stabilization |
| CN104817559B (zh) * | 2014-01-30 | 2021-05-25 | 苏州泽璟生物制药股份有限公司 | 氘代喹唑啉酮化合物以及包含该化合物的药物组合物 |
| WO2016097314A1 (en) * | 2014-12-19 | 2016-06-23 | Sandoz Ag | Amorphous and crystalline forms of idelalisib and process for forming the same |
-
2016
- 2016-02-15 KR KR1020160017187A patent/KR101662975B1/ko active Active
-
2017
- 2017-02-14 JP JP2018561462A patent/JP6871638B2/ja active Active
- 2017-02-14 WO PCT/KR2017/001575 patent/WO2017142283A1/ko not_active Ceased
- 2017-02-14 US US15/998,556 patent/US10463669B2/en active Active
- 2017-02-14 CN CN201780023517.4A patent/CN109069513B/zh active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2014051359A1 (ko) * | 2012-09-26 | 2014-04-03 | 부경대학교 산학협력단 | 네퍼린을 유효성분으로 포함하는 간암 예방 또는 치료용 약제학적 조성물 |
| KR101662975B1 (ko) * | 2016-02-15 | 2016-10-06 | 서울대학교산학협력단 | 간암 치료 또는 예방용 조성물 |
Non-Patent Citations (3)
| Title |
|---|
| GEDALY, R. ET AL.: "The Role of P13K/mTOR Inhibition in Combination with Sorafenib in Hepatocellular Carcinoma Treatment", ANTICANCER RESEARCH, vol. 32, 2012, pages 2531 - 2536, XP055409681 * |
| HWANG, JU YEONG ET AL.: "Sanguinarine Induces Apoptosis in Human Hepatocellular Carcinoma HepG2 Cells through the Generation of ROS and Modulation of Akt/ERK Signaling Pathways", JOURNAL OF SCIENCE, vol. 25, no. 9, 2015, pages 984 - 992, XP055411538 * |
| YANG, Q. ET AL.: "Idelalisib: First-in-class PI3K Delta Inhibitor for the Treatment of Chronic Lymphocytic Leukemia, Small Lymphocytic Leukemia, and Follicular Lymphoma", CLINICAL CANCER RESEARCH, vol. 21, no. 7, 2015, pages 1537 - 1542, XP055305408 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2019121872A1 (en) * | 2017-12-20 | 2019-06-27 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Methods for the diagnosis and treatment of liver cancer |
Also Published As
| Publication number | Publication date |
|---|---|
| KR101662975B1 (ko) | 2016-10-06 |
| CN109069513A (zh) | 2018-12-21 |
| US20190160073A1 (en) | 2019-05-30 |
| US10463669B2 (en) | 2019-11-05 |
| JP2019510075A (ja) | 2019-04-11 |
| JP6871638B2 (ja) | 2021-05-12 |
| CN109069513B (zh) | 2021-12-28 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| WO2017142283A1 (ko) | 간암 치료 또는 예방용 조성물 | |
| Bayurova et al. | HIV‐1 Reverse Transcriptase Promotes Tumor Growth and Metastasis Formation via ROS‐Dependent Upregulation of Twist | |
| Xu et al. | LncSHRG promotes hepatocellular carcinoma progression by activating HES6 | |
| Meng et al. | METTL3 promotes the progression of nasopharyngeal carcinoma through mediating M6A modification of EZH2. | |
| Liu et al. | Neutrophil extracellular traps promote gastric cancer cell metastasis via the NAT10-mediated N4-acetylcytidine modification of SMYD2 | |
| Jiang et al. | Galectin-1 gene silencing inhibits the activation and proliferation but induces the apoptosis of hepatic stellate cells from mice with liver fibrosis | |
| Kang et al. | NLRC3 silencing accelerates the invasion of hepatocellular carcinoma cell via IL‐6/JAK2/STAT3 pathway activation | |
| Ying et al. | Interferon alpha antagonizes the anti-hepatoma activity of the oncolytic virus M1 by stimulating anti-viral immunity | |
| WO2017026843A1 (ko) | 만성골수성백혈병에 관한 정보 제공 방법 | |
| Seo et al. | PTEN/AKT signaling pathway related to hTERT downregulation and telomere shortening induced in Toxoplasma GRA16-expressing colorectal cancer cells | |
| Liu et al. | Ethanol induces necroptosis in gastric epithelial cells in vitro | |
| Xu et al. | ApoM suppresses kidney renal clear cell carcinoma growth and metastasis via the Hippo-YAP signaling pathway | |
| Zheng et al. | S100A11 promotes metastasis via AKT and ERK signaling pathways and has a diagnostic role in hepatocellular carcinoma | |
| Mao et al. | OCT3/4 enhances tumor immune response by upregulating the TET1-dependent NRF2/MDM2 axis in bladder cancer | |
| WO2020113877A1 (zh) | E2f6抑制剂的功能与用途 | |
| Hu et al. | Spermine oxidase regulates liver inflammation and fibrosis through β-catenin pathway | |
| Duan et al. | Curcumin affects autophagy of prolactinoma cells by upregulating miR‐206 to exert antitumor effects | |
| CN111701025A (zh) | 用于治疗肾细胞癌的药物及其应用 | |
| Zheng et al. | Interleukin-1 prevents SARS-CoV-2-induced membrane fusion to restrict viral transmission via induction of actin bundles | |
| Pan et al. | PTEN status determines therapeutic vulnerability to celastrol in cholangiocarcinoma | |
| CN118286467B (zh) | 整合应激反应抑制剂isrib在治疗肝癌中的应用 | |
| CN110623953A (zh) | 中药单体氧化苦参碱在制备治疗或预防非小细胞肺癌药物上的应用 | |
| Younis et al. | Trichinella spiralis Larval Extract as a Biological Anti‐Tumor Therapy in a Murine Model of Ehrlich Solid Carcinoma | |
| Xue et al. | EP300 Modulates MCM8 Transcription and Augments the Malignant Phenotype of Hepatitis B Virus–Positive Hepatocellular Carcinoma Cells | |
| WO2014018619A1 (en) | Methods and compounds for increasing threonyl-trna synthetase activity |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 17753444 Country of ref document: EP Kind code of ref document: A1 |
|
| ENP | Entry into the national phase |
Ref document number: 2018561462 Country of ref document: JP Kind code of ref document: A |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 17753444 Country of ref document: EP Kind code of ref document: A1 |