WO2017131293A1 - 주의력결핍 과잉행동장애 치료제에 대한 치료 반응 예측용 조성물 및 방법 - Google Patents
주의력결핍 과잉행동장애 치료제에 대한 치료 반응 예측용 조성물 및 방법 Download PDFInfo
- Publication number
- WO2017131293A1 WO2017131293A1 PCT/KR2016/004969 KR2016004969W WO2017131293A1 WO 2017131293 A1 WO2017131293 A1 WO 2017131293A1 KR 2016004969 W KR2016004969 W KR 2016004969W WO 2017131293 A1 WO2017131293 A1 WO 2017131293A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- subject
- attention deficit
- hyperactivity disorder
- deficit hyperactivity
- genotype
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
Definitions
- the present invention was made by the task number HI12C0011 (A120013) under the support of the Ministry of Health and Welfare, the research and management professional agency of the task is the Ministry of Health Industry Promotion, the research project name is "disease overcoming technology development", the research title is "attention deficit and excess Behavioral Disorder Intermediation Research Center ", host institution is Seoul National University Hospital, and the research period is 2012.05.01 ⁇ 2017.03.31.
- the present invention relates to compositions and methods for predicting treatment response to a therapeutic agent for attention deficit hyperactivity disorder.
- ADHD Attention Deficit Hyperactivity Disorder
- Methylphenidate is the most widely prescribed primary agent of ADHD and is known to improve symptom and executive performance with a response rate of 65-75%. Its main mechanism of treatment is due to the blocking of dopamine and norepinephrine transporters by increasing dopamine and norepinephrine in the prefrontal cortex and increasing dopamine in the striatum. Despite its primary effects on the dopamine and norepinephrine systems, previous animal studies have shown that other mechanisms of MPH are the glutamatergic system, in particular N-methyl-D-aspartate (N-methyl-D- aspartate: NMDA) receptor was demonstrated to be relevant.
- N-methyl-D-aspartate N-methyl-D- aspartate
- the GRIN2B gene is an NMDA receptor related gene that encodes an NR2B subunit.
- the GRIN2B gene is known to be associated with several developmental disorders and has been the target of pharmacogenetic studies of schizophrenia and manic depression.
- One aspect provides a composition for predicting responsiveness to methylphenidate treatment in a subject with attention deficit hyperactivity disorder.
- Another aspect provides a method of predicting responsiveness to methylphenidate treatment in a subject with attention deficit hyperactivity disorder.
- Another aspect provides a method of selecting a subject having a likelihood to respond to methylphenidate treatment among subjects with attention deficit hyperactivity disorder.
- One aspect is methylation in subjects with attention deficit hyperactivity disorder, including a reagent capable of detecting the rs2284411 polymorphic site of a polynucleotide encoding a glutamate receptor (ionotropic, N-methyl D-aspartate 2B: GRIN2B).
- a reagent capable of detecting the rs2284411 polymorphic site of a polynucleotide encoding a glutamate receptor ionotropic, N-methyl D-aspartate 2B: GRIN2B.
- glycosylcholine receptor is a protein encoded by the GRIN2B gene, also referred to as N-methyl D-aspartate receptor subtype 2B, NMDAR2B, or NR2B. Can be.
- polynucleotide encoding a glutamate receptor may be named the gene encoding GRIN2B or the GRIN2B gene.
- rs2284411 polymorphism refers to an SNP identified by the number 'rs2284411' in NCBI's single nucleotide polymorphism (SNP) database.
- the polymorphic site may be a site located at 13713238 th of chromosome 12.
- the polymorphic site means a site indicated by [C / T], which is the 26th nucleotide of the following nucleotide sequences.
- the subject with attention deficit hyperactivity disorder may be a subject diagnosed according to ADHD diagnostic criteria known in the art.
- the diagnostic criteria may be, for example, those described in the Diagnostic and Statistical Manual of Mental Disorder-Fourth Edition (DSM-IV).
- DSM-IV Diagnostic and Statistical Manual of Mental Disorder-Fourth Edition
- K-SADS-PL Korean version of Kiddie-Schedule for Affective Disorders and Schizophrenia-Present and Lifetime Version
- the methylphenidate may have the following formula.
- the methylphenidate may be a drug also named under the trade names Concerta, Methylin, Medikinet, Ritalin, Equasym XL, Quillivant XR, or Metadate.
- the reagent may be a primer set or probe.
- the primer set may consist of oligonucleotides of SEQ ID NO: 2 and SEQ ID NO: 3.
- the primer set may be used to amplify a DNA fragment comprising the rs2284411 polymorphic site with a genomic DNA comprising a polynucleotide encoding the glutamate receptor or a portion thereof as a template.
- the sequencing of the amplified fragments can determine the genotype of the polymorphic site.
- the genotype of the site can be determined by performing a primer extension reaction using an extension primer specific for the polymorphic site on the amplified fragment.
- the extension primer may be an oligonucleotide of SEQ ID NO.
- the probe may have a sequence complementary to a polynucleotide consisting of contiguous nucleotides including the polymorphic site as part of a polynucleotide encoding the glutamate receptor or a polynucleotide complementary thereto.
- the genotype of the polymorphic site may be determined by a difference in stability of a duplex formed by hybridization with the probe or a difference in signal generation depending on whether the hybridization with the probe is performed.
- Another aspect includes obtaining a nucleic acid sample from a subject with attention deficit hyperactivity disorder; Determining the genotype of the site by detecting an rs2284411 polymorphic site of the polynucleotide encoding a glutamate receptor (GRIN2B) in the sample; If the genotype is C / C, determining that the subject's responsiveness to methylphenidate treatment is greater than a subject with attention deficit hyperactivity disorder wherein the genotype is C / T or T / T A method of predicting responsiveness to methylphenidate treatment in a subject with attention deficit hyperactivity disorder is provided.
- GRIN2B glutamate receptor
- glutamate receptors GRIN2B
- polynucleotides encoding them rs2284411 polymorphism
- subjects with attention deficit hyperactivity disorder methylphenidate treatment are as described above.
- the sample may be obtained from blood of the subject.
- the detecting step may be to use a primer set or probe specific to the polymorphic site.
- the primer set may consist of oligonucleotides of SEQ ID NO: 2 and SEQ ID NO: 3.
- the method for determining the genotype of the site using the primer set or probe is as described above.
- the detecting step may be performed by sequencing, microarray analysis, allele specific PCR analysis, PCR extension analysis, mass spectrometry, or a combination thereof.
- the detecting step comprises a polymerase chain reaction using a nucleic acid sample obtained from the subject as a template and a primer set capable of amplifying a site including the polymorphic site in the polynucleotide or a polynucleotide complementary thereto. Performing; And determining the sequence of the resulting amplification product.
- Sequencing may be performed by conventional sequencing methods used in the art for sequencing.
- the sequencing may be performed using an automated genetic analyzer.
- Microarray analysis can be performed using an array in which a probe specific for the polymorphic site is immobilized.
- Allele-specific PCR analysis is a primer set including a primer designed with the base where the SNP is located at the 3 'end.
- complementary binding is possible depending on the base of the SNP. It may or may not be possible so that the amplification reaction may be performed using a difference that may or may not be normal.
- PCR extension assays first inactivate DNA fragments containing bases on which a single nucleotide polymorphism is located by amplifying pairs with primer pairs and then dephosphorylation all nucleotides added to the reaction, followed by extension primers specific for SNPs, dNTP mixtures. , By adding a didioxynucleotide, a reaction buffer and a DNA polymerase. In the primer extension reaction, since the position at which the extension reaction is terminated differs depending on the base where the polymorphism is located, the base can be determined by comparing the length of the extended product. When the extension primer or didioxynucleotide is fluorescently labeled, fluorescence may be detected through a genetic analyzer. When the extension primer or didioxynucleotide is not labeled, SNP can be detected by measuring molecular weight through matrix assisted laser desorption ionization-time of flight (MALDI-TOF).
- MALDI-TOF matrix assisted laser desorption ionization
- Another aspect includes obtaining a nucleic acid sample from two or more subjects with attention deficit hyperactivity disorder; Determining the genotype of the site by detecting an rs2284411 polymorphic site of the polynucleotide encoding the glutamate receptor (GRIN2B) from each sample; And selecting a subject having genotype C / C as a subject having a possibility to respond to methylphenidate treatment, and having a possibility of responding to methylphenidate treatment among subjects with attention deficit hyperactivity disorder. It provides a way to choose.
- glutamate receptors GRIN2B
- polynucleotides encoding them rs2284411 polymorphism
- subjects with attention deficit hyperactivity disorder methylphenidate treatment are as described above.
- the sample may be obtained from blood of the subject.
- the detecting step may be to use a primer set or probe specific to the polymorphism.
- the primer set may consist of oligonucleotides of SEQ ID NO: 2 and SEQ ID NO: 3.
- the method for determining the genotype of the site using the primer set or probe is as described above.
- the detecting step may be performed by sequencing, microarray analysis, allele specific PCR analysis, PCR extension analysis, mass spectrometry, or a combination thereof. Each analysis method is as described above.
- compositions according to one aspect and methods of predicting according to other aspects can effectively predict responsiveness to methylphenidate treatment in subjects with attention deficit hyperactivity disorder.
- the selection method it is possible to effectively select a subject having a possibility of responding to methylphenidate treatment among subjects with attention deficit hyperactivity disorder.
- Example 1 GRIN2B in Attention Deficit Hyperactivity Disorder ( ADHD ) Correlation Analysis of rs2284411 Polymorphism with Methylphenidate Reaction
- Exclusion criteria for the ADHD group were as follows: (1) IQ ⁇ 70; (2) hereditary diseases; (3) brain trauma, organic brain disorders, seizures, Current or past history of other neurological disorders (4) autism spectrum disorder, communication or learning disorders (5) schizophrenia or other childhood onset psychotic disorders (6) major depressive disorders Or bipolar disorder (7) Tourette's syndrome or chronic motor / vocal tic disorder (8) Obsessive-compulsive disorder (9) Methylphenidate treatment history that lasted more than one year or occurred within the previous four weeks. IQ was measured using the Korean Educational Development Institute's Wechsler Intelligence Scales for Children (KEDI-WISC). Written informed consent was obtained from the legal guardian of the participants and approved by the Institutional Review Board of Seoul National University Hospital for the research protocol (IRB No. 1206-054-414).
- the ADHD-RS is an 18-item scale, graded by the 0-3 scale, with a total score ranging from 0-54.
- the CGI-I scale is a widely used measure by doctors to assess symptom improvement and has a range of 1 representing 'very improved' to 7 representing 'very bad'. All evaluators did not know about the GRIN2B genotype.
- CPT continuous performance test
- ADS attention diagnostic system
- Genomic DNA was extracted from the blood of patients who were cryopreserved using G-DEX II Genomic DNA Extraction Kit (Intron, Korea). 5 'ACG TTG GAT GAT GAC ATC ATC AGT GTC TGC (SEQ ID NO: 2) and 5' ACG TTG GAT GCA TGA CTT TTT TCC CCT ACT C templated with genomic DNA and constructed through Assay Designer 3.1 (Sequenom, Inc.) The DNA set containing the rs2284411 polymorphic site of GRIN2B was amplified using the primer set of (SEQ ID NO: 3).
- the nucleotides added for PCR reactions were inactivated by dephosphorylation with 0.3 U shrimp alkaline phosphatase, followed by 5 uM of rIN2284411 specific extension primers (5 ′ GCA TAA AAG GAG AGC ATC: SEQ ID NO: 4) of GRIN2B.
- Primer extension was performed by adding didioxynucleotides, reaction buffer, and Thermosequenase enzyme (Sequenom, CA). Primer extension reaction was carried out 55 cycles consisting of 94 °C 5 seconds, 52 °C 5 seconds, 72 °C 5 seconds after denaturation of 2 minutes at 94 °C.
- the reaction byproduct was desalted with SpectroCLEAN (Sequenom, Inc.) and then distributed to SpectroCHIP (Sequenom, Inc.) using SpectroJET (Sequenom, Inc.).
- SpectroCLEAN Sequenom, Inc.
- SpectroCHIP Sequenom, Inc.
- SpectroJET Sequenom, Inc.
- the rs2284411 polymorphism of GRIN2B was detected by analyzing primer extension products using a chip-based MALDI-TOF mass spectrometry platform (Sequenom, Inc., California, USA).
- the GRIN2B genotype was classified into two groups because of the scarcity of the recessive genotype: the C / C group and the C / T + T / T group.
- the demographic and clinical characteristics of these two groups were independent of the t-test for continuous variables and ⁇ 2 for categorical variables. Comparisons were made using the test or Fisher's exact test. 'Excellent responsiveness' as the outcome variable, GRIN2B T / T + C / T genotype as the primary predictor, and age, gender, IQ, baseline CGI-S score, baseline ADHD-RS total score as covariate Using a final methylphenidate dose, multivariate logistic regression analysis was performed.
- Table 2 below shows the results of the logistic regression analysis investigating the association between the therapeutic response and the GRIN2B genotype. All results were adjusted for age, gender, IQ, baseline CGI-S score, baseline ADHD-RS total score, and final methylphenidate dose.
- a OR stands for odds ratio and was adjusted for age, sex, IQ, baseline CGI-S score, baseline ADHD-RS total score, and final methylphenidate dose.
- IA stands for careless score
- HI stands for overaction-impulsiveness score.
- ADHD-RS data included 53 C / C and 20 T / C + TT subjects.
- the C / C genotype was superior to the C / T + T / T genotype after 6 months of treatment with methylphenidate and significantly more significant. It was related.
- Table 3 shows the comparison of post-treatment changes in ADHD-RS scores between GRIN2B genotypes.
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Genetics & Genomics (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Physics & Mathematics (AREA)
- Immunology (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Pathology (AREA)
Abstract
주의력결핍 과잉행동장애 치료제에 대한 치료 반응 예측용 조성물 및 방법에 관한 것이다. 일 양상은 글루타메이트 수용체 (glutamate receptor, ionotropic, N-methyl D-aspartate 2B: GRIN2B)를 코딩하는 폴리뉴클레오티드의 rs2284411 다형성 부위를 검출할 수 있는 시약을 포함하는, 주의력결핍 과잉행동장애를 갖는 대상에서 메틸페니데이트 치료에 대한 반응성을 예측하기 위한 조성물을 제공한다. 다른 양상은 주의력결핍 과잉행동장애를 갖는 대상에서 메틸페니데이트 치료에 대한 반응성을 예측하는 방법 및 주의력결핍 과잉행동장애를 갖는 대상 중 메틸페니데이트 치료에 반응할 가능성을 갖는 대상을 선택하는 방법을 제공한다.
Description
본 발명은 대한민국 보건복지부의 지원 하에서 과제번호 HI12C0011(A120013)에 의해 이루어진 것으로서, 상기 과제의 연구관리 전문기관은 보건산업진흥원, 연구사업명은 "질환극복기술개발", 연구과제명은 "주의력결핍과 과잉행동장애 중개연구센터", 주관기관은 서울대병원, 연구기간은 2012.05.01~2017.03.31 이다.
본 특허출원은 2016년 1월 25일에 대한민국 특허청에 제출된 대한민국 특허출원 제10-2016-0008895호에 대하여 우선권을 주장하며, 상기 특허출원의 개시 사항은 본 명세서에 참조로서 삽입된다.
주의력결핍 과잉행동장애 치료제에 대한 치료 반응 예측용 조성물 및 방법에 관한 것이다.
주의력결핍 과잉행동장애 (ADHD)는 발달상 부적절한 주의력 결핍, 과잉행동, 및/또는 충동성의 증상을 특징으로 하는 신경발달장애이다. ADHD의 주요 병태생리로서 이상 도파민 및 노르에피네프린 신경전달이 상정되었고, 도파민 및 노르에피네프린 관련 유전자에 대하여 여러 후보 유전자 연관 연구가 수행되었다.
메틸페니데이트 (methylphenidate: MPH)는 가장 널리 처방되는 ADHD의 1차 약제이고, 65 내지 75%의 반응률로 증상 및 실행기능수행을 개선시키는 것으로 알려졌다. 그의 주요 치료 기전은, 전전두 피질(prefrontal cortex)에서 도파민 및 노르에피네프린의 증가 및 선조체에서 도파민을 증가시키는 것에 의한 도파민 및 노르에피네프린 수송체의 차단에 의한 것이다. 도파민 및 노르에피네프린 시스템에 대한 그의 1차적인 효과에도 불구하고, 이전 동물 연구는 MPH의 또 다른 기전으로서 글루탐산성 시스템(glutamatergic system), 특히 N-메틸-D-아스파테이트 (N-methyl-D-aspartate: NMDA) 수용체의 관련성을 입증하였다.
GRIN2B 유전자는 NMDA 수용체 관련 유전자로서, NR2B 서브유닛을 코딩한다. GRIN2B 유전자는 여러 발달 장애와 연관되어 있는 것으로 알려져 있고, 정신분열증 및 조울증의 약리유전학 연구의 표적이 되어왔다.
그러나, 현재까지 메틸페니데이트에 대한 반응성과 GRIN2B 유전자의 관련성에 대해서는 알려진 바 없었다.
일 양상은 주의력결핍 과잉행동장애를 갖는 대상에서 메틸페니데이트 치료에 대한 반응성을 예측하기 위한 조성물을 제공한다.
다른 양상은 주의력결핍 과잉행동장애를 갖는 대상에서 메틸페니데이트 치료에 대한 반응성을 예측하는 방법을 제공한다.
다른 양상은 주의력결핍 과잉행동장애를 갖는 대상 중 메틸페니데이트 치료에 반응할 가능성을 갖는 대상을 선택하는 방법을 제공한다.
일 양상은 글루타메이트 수용체 (glutamate receptor, ionotropic, N-methyl D-aspartate 2B: GRIN2B)를 코딩하는 폴리뉴클레오티드의 rs2284411 다형성 부위를 검출할 수 있는 시약을 포함하는, 주의력결핍 과잉행동장애를 갖는 대상에서 메틸페니데이트 치료에 대한 반응성을 예측하기 위한 조성물을 제공한다.
용어 "글루타메이트 수용체 (glutamate receptor, ionotropic, N-methyl D-aspartate 2B: GRIN2B)"는 GRIN2B 유전자에 의해 코딩되는 단백질로서, N-메틸 D-아스파테이트 수용체 서브타입 2B, NMDAR2B, 또는 NR2B로도 명명될 수 있다. 용어 "글루타메이트 수용체를 코딩하는 폴리뉴클레오티드"는 GRIN2B를 코딩하는 유전자 또는 GRIN2B 유전자로 명명될 수 있다. 용어 "rs2284411 다형성"은 NCBI의 단일염기다형성(SNP) 데이터베이스에서 번호 'rs2284411'에 의해 확인되는 SNP를 의미한다. 상기 다형성 부위는 12번 염색체의 13713238번째에 위치한 부위일 수 있다. 상기 다형성 부위는 하기 뉴클레오티드 서열 중 26번째 뉴클레오티드인 [C/T]로 표시된 부위를 의미한다.
ACTTTTTTCCCCTACTCTTGGTCCA[C/T]TTGATGCTCTCCTTTTATGCTCCTA (서열번호 1)
상기 주의력결핍 과잉행동장애(ADHD)를 갖는 대상은 당해 분야에 알려져 있는 ADHD 진단 기준에 따라 진단된 대상일 수 있다. 상기 진단 기준은 예를 들면, 정신장애의 진단 및 통계편람 제4판 (Diagnostic and Statistical Manual of Mental Disorder-Fourth Edition: DSM-IV)에 기재된 것일 수 있다. ADHD의 검사 도구로는 예를 들면, 한국판 Kiddie-Schedule for Affective Disorders and Schizophrenia-Present and Lifetime Version (K-SADS-PL)를 이용할 수 있다.
상기 메틸페니데이트는 하기 식을 가질 수 있다. 상기 메틸페니데이트는 상표명 Concerta, Methylin, Medikinet, Ritalin, Equasym XL, Quillivant XR, 또는 Metadate로도 명명되는 약제일 수 있다.
상기 시약은 프라이머 세트 또는 프로브일 수 있다.
상기 프라이머 세트는 서열번호 2 및 서열번호 3의 올리고뉴클레오티드로 이루어질 수 있다. 상기 프라이머 세트는 상기 글루타메이트 수용체를 코딩하는 폴리뉴클레오티드를 포함하는 게놈 DNA 또는 그의 일부를 주형으로 상기 rs2284411 다형성 부위를 포함하는 DNA 단편을 증폭하는데 이용될 수 있다. 증폭된 단편의 염기서열 분석을 통해 상기 다형성 부위의 유전형을 결정할 수 있다. 또한, 증폭된 단편에 대해 상기 다형성 부위에 특이적인 연장 프라이머를 이용한 프라이머 연장 반응을 수행하여 상기 부위의 유전형을 결정할 수 있다. 상기 연장 프라이머는 서열번호 4의 올리고뉴클레오티드일 수 있다.
상기 프로브는 상기 글루타메이트 수용체를 코딩하는 폴리뉴클레오티드 또는 그에 상보적인 폴리뉴클레오티드의 일부로서 상기 다형성 부위를 포함하여 연속된 뉴클레오티드로 이루어진 폴리뉴클레오티드에 상보적인 서열을 가질 수 있다. 상기 프로브와의 혼성화에 의해 형성되는 듀플렉스(duplex)의 안정성 차이 또는 상기 프로브와의 혼성화 여부에 따른 신호 생성의 차이에 의해 상기 다형성 부위의 유전형을 결정할 수 있다.
다른 양상은, 주의력결핍 과잉행동장애를 갖는 대상으로부터 핵산 시료를 수득하는 단계; 상기 시료에서 글루타메이트 수용체 (GRIN2B)를 코딩하는 폴리뉴클레오티드의 rs2284411 다형성 부위를 검출하여, 상기 부위의 유전형을 결정하는 단계; 상기 유전형이 C/C인 경우, 상기 대상의 메틸페니데이트 치료에 대한 반응성이, 상기 유전형이 C/T 또는 T/T인 주의력결핍 과잉행동장애를 갖는 대상에 비해 더 큰 것으로 결정하는 단계를 포함하는, 주의력결핍 과잉행동장애를 갖는 대상에서 메틸페니데이트 치료에 대한 반응성을 예측하는 방법을 제공한다.
상기 방법에서, 글루타메이트 수용체 (GRIN2B), 이를 코딩하는 폴리뉴클레오티드, rs2284411 다형성, 주의력결핍 과잉행동장애를 갖는 대상, 및 메틸페니데이트 치료에 대해서는 전술된 바와 같다.
상기 시료는 상기 대상의 혈액으로부터 수득된 것일 수 있다.
상기 검출하는 단계는 상기 다형성 부위에 특이적인 프라이머 세트 또는 프로브를 이용하는 것일 수 있다. 상기 프라이머 세트는 서열번호 2 및 서열번호 3의 올리고뉴클레오티드로 이루어질 수 있다. 상기 프라이머 세트 또는 프로브를 이용하여 상기 부위의 유전형을 결정하는 방법에 대해서는 전술된 바와 같다.
상기 검출하는 단계는 염기서열 분석, 마이크로어레이 분석, 대립유전자 특이적 PCR 분석, PCR 연장 분석, 질량 분광측정법, 또는 그 조합에 의해 수행될 수 있다.
상기 검출하는 단계는, 상기 대상으로부터 수득된 핵산 시료를 주형으로 하고, 상기 폴리뉴클레오티드 또는 이와 상보적인 폴리뉴클레오티드 중 상기 다형성 부위를 포함하는 부위를 증폭할 수 있는 프라이머 세트를 이용하여 중합효소 연쇄 반응을 수행하는 단계; 및 얻어진 증폭 산물의 서열을 결정하는 단계를 포함할 수 있다.
염기서열 분석은 염기서열 결정을 위해 당해 분야에서 이용되는 통상의 염기서열 분석방법에 의해 수행될 수 있다. 상기 염기서열 분석은 자동화된 유전자분석기를 이용하여 수행될 수 있다. 마이크로어레이 분석은 상기 다형성 부위에 특이적인 프로브가 고정화된 어레이를 이용하여 수행될 수 있다. 대립유전자 특이적 PCR 분석은 SNP가 위치하는 염기를 3' 말단으로 하여 고안한 프라이머를 포함한 프라이머 세트로 상기 SNP가 위치하는 DNA 단편을 증폭할 경우, 상기 SNP 위치의 염기에 따라 상보적인 결합이 가능하거나 가능하지 않게 되어 증폭 반응이 정상적으로 이루어지거나 이루어지지 못하는 차이를 이용하여 수행될 수 있다.
PCR 연장 분석은 먼저 단일염기 다형성이 위치하는 염기를 포함하는 DNA 단편을 프라이머 쌍으로 증폭한 다음, 반응에 첨가된 모든 뉴클레오티드를 탈인산화시킴으로써 불활성화시키고, 여기에 SNP에 특이적인 연장 프라이머, dNTP 혼합물, 디디옥시뉴클레오티드, 반응 완충액 및 DNA 중합효소를 첨가하여 프라이머 연장반응을 수행하여 이루어질 수 있다. 프라이머 연장반응에서, 상기 다형성이 위치하는 염기에 따라 연장반응이 종결되는 위치가 상이하므로, 연장된 산물의 길이를 비교함으로써 상기 염기를 결정할 수 있다. 상기 연장 프라이머 또는 디디옥시뉴클레오티드를 형광 표지한 경우, 유전자 분석기를 통해 형광을 검출할 수 있다. 상기 연장 프라이머 또는 디디옥시뉴클레오티드가 표지되지 않은 경우, MALDI-TOF(matrix assisted laser desorption ionization-time of flight)를 통해 분자량을 측정함으로써, SNP를 검출할 수 있다.
다른 양상은, 주의력결핍 과잉행동장애를 갖는 2 이상의 대상으로부터 핵산 시료를 수득하는 단계; 상기 각 시료로부터 글루타메이트 수용체 (GRIN2B)를 코딩하는 폴리뉴클레오티드의 rs2284411 다형성 부위를 검출하여, 상기 부위의 유전형을 결정하는 단계; 및 상기 유전형이 C/C인 대상을 메틸페니데이트 치료에 반응할 가능성을 갖는 대상으로 선택하는 단계를 포함하는, 주의력결핍 과잉행동장애를 갖는 대상 중 메틸페니데이트 치료에 반응할 가능성을 갖는 대상을 선택하는 방법을 제공한다.
상기 방법에서, 글루타메이트 수용체 (GRIN2B), 이를 코딩하는 폴리뉴클레오티드, rs2284411 다형성, 주의력결핍 과잉행동장애를 갖는 대상, 및 메틸페니데이트 치료에 대해서는 전술된 바와 같다.
상기 시료는 상기 대상의 혈액으로부터 수득된 것일 수 있다.
상기 검출하는 단계는 상기 다형성에 특이적인 프라이머 세트 또는 프로브를 이용하는 것일 수 있다. 상기 프라이머 세트는 서열번호 2 및 서열번호 3의 올리고뉴클레오티드로 이루어질 수 있다. 상기 프라이머 세트 또는 프로브를 이용하여 상기 부위의 유전형을 결정하는 방법에 대해서는 전술된 바와 같다.
상기 검출하는 단계는 염기서열 분석, 마이크로어레이 분석, 대립유전자 특이적 PCR 분석, PCR 연장 분석, 질량 분광측정법, 또는 그 조합에 의해 수행될 수 있다. 각각의 분석 방법에 대해서는 전술된 바와 같다.
일 양상에 따른 조성물 및 다른 양상에 따른 예측하는 방법에 의하면, 주의력결핍 과잉행동장애를 갖는 대상에서 메틸페니데이트 치료에 대한 반응성을 효과적으로 예측할 수 있다.
다른 양상에 따른 선택하는 방법에 의하면, 주의력결핍 과잉행동장애를 갖는 대상 중 메틸페니데이트 치료에 반응할 가능성을 갖는 대상을 효과적으로 선택할 수 있다.
본 발명은 하기 실시예에 의하여 더욱 구체적으로 설명한다. 그러나, 하기 실시예는 본 발명의 이해를 돕기 위한 것일 뿐, 어떤 의미로든 본 발명의 범위가 이러한 실시예에 의하여 한정되는 것은 아니다.
실시예 1: 주의력결핍 과잉행동장애( ADHD )에서 GRIN2B의 rs2284411 다형성과 메틸페니데이트 반응의 연관성 분석
1.1. 연구 대상
2010년 8월부터 2014년 8월까지 서울대학교병원 아동청소년정신과의 외래병동으로부터 6 내지 14세의 환자를 모집하였다. 이들은 정신장애의 진단 및 통계편람 제4판 (Diagnostic and Statistical Manual of Mental Disorder-Fourth Edition: DSM-IV)의 기준에 따라, 아동청소년 정신과의사에 의해 ADHD로 진단되었다. 한국판 Kiddie-Schedule for Affective Disorders and Schizophrenia-Present and Lifetime Version (K-SADS-PL) 검사를 통해 ADHD 진단을 확인하였다. ADHD 군에 대한 배제 기준은(exclusion criteria)은 하기와 같았다: (1) 70 미만의 IQ (2) 유전성 질환 (3) 뇌 손상(brain trauma), 기질성 뇌 장애(organic brain disorder), 발작, 또는 기타 신경 장애의 현재/과거 병력 (4) 자폐 스펙트럼 장애(autism spectrum disorder), 의사소통 장애 또는 학습 장애 (5) 정신분열증 또는 기타 소아기 발병 정신 장애(childhood onset psychotic disorder) (6) 주요 우울 장애 또는 양극성 장애 (7) 투렛 증후군 또는 만성 운동성/음성 틱 장애(chronic motor/vocal tic disorder) (8) 강박 장애 (9) 1년 이상 지속되거나 이전 4주 이내에 이루어진 메틸페니데이트 치료 이력. 한국교육개발원의 웩슬러 아동지능검사 (Korean Educational Development Institute's Wechsler Intelligence Scales for Children: KEDI-WISC)를 이용하여 IQ를 측정하였다. 참가자의 법적 보호자로부터 서면 동의를 받았고, 연구 프로토콜에 대하여 서울대학교병원의 임상시험 심사위원회의 승인을 받았다 (IRB No. 1206-054-414).
1.2. 메틸페니데이트 투여 및 치료 반응의 정의
이 연구는 2년 종적 연구의 일부로서 수행되었다. 참가자는 1일 1회 아침식사 후 메틸페니데이트 또는 아토목세틴으로 처방받았다. 이 연구에 포함된 참가자는 메틸페니데이트 공개 임상시험(open-label trial)의 참가자이고 6개월 동안 치료 반응을 평가하였다. 참가자들은 병원을 방문하고 약제 조정을 위해 2, 4, 6, 8, 16, 및 24주차에 아동청소년 정신과의사와의 면담을 수행하였다. 초기 투여랑을 2주간 고정한 후, 충분한 치료 반응이 달성될 때까지 대상자 및 부모의 보고에 근거한 정신과의사의 판단에 의해 증가시켰다. 최대 투여랑은 72 mg이고, 최종 투여량은 0.7 내지 1.5mg/kg의 범위로 설정되었다.
메틸페니데이트 치료 전후 ADHD 증상에서의 변화를 평가하기 위하여, 아동 정신과의사에 의해 ADHD 평가 척도(ADHD Rating Scale-IV: ADHD-RS)의 한국 버전 및 임상총괄평가-개선(Clinical Global Impression - Improvement: CGI-I) 척도를 환자에게 적용하였다. ADHD-RS는 0 내지 3 스케일에 의해 등급이 정해지는 18개-문항(item) 척도로 총 점수는 0 내지 54의 범위를 갖는다. 9개 문항은 주의력 결핍 증상을 평가하고, 나머지 9개 문항은 과잉행동-충동성 증상을 표적으로 한다. CGI-I 척도는 의사에 의해 증상 개선을 평가하는데 널리 이용되는 척도로서, '매우 개선된'을 나타내는 1 내지 '매우 악화된'을 나타내는 7의 범위를 갖는다. 모든 평가자는 GRIN2B 유전형에 대해 알지 못했다.
치료 반응을 평가하기 위한 객관적인 도구로서, 주의력 진단 시스템(attention diagnostic system: ADS)으로 명명되는 한국판 연속 수행 검사 (continuous performance test: CPT)를 치료 전후에 수행하였다. 반응하지 않는 횟수를 측정하는 누락 오류(omission error) (부주의의 측정), 잘못된 반응의 횟수를 측정하는 오경보 오류(commission error) (충동성의 측정), 정확한 반응의 평균 반응 시간인 정반응 시간(response time), 및 정확한 반응의 반응 시간에 대한 표준 편차를 나타내는 정반응 시간 표준편차(standard deviation of response time) (반응 시간 변동성의 측정)의 변량을 연령에 대해 조정된 T 점수로 나타내었다. 보다 낮은 T 점수가 보다 우수한 수행능력을 나타낸다.
6개월 평가 기간에 ADHD-RS 및 CGI-I 점수에서의 치료 후 변화에 따라 치료 반응에 대한 4개의 상이한 기준을 적용하였다. 제1 기준으로, ADHD-RS 점수에서 40% 이상의 감소를 나타내는 대상을 우수 반응자로 정의하고, 나머지 대상을 낮은 반응자로 정의하였다. 개선된 증상 도메인을 확인하기 위하여 ADHD-RS 주의력, 과잉행동-충동성, 및 총 점수를 각각 분석하였다. 제2 기준으로, 6개월 평가 기간에 CGI-I 점수가 2 이하인 대상을 우수 반응자로 분류하고, 3 내지 7의 점수를 갖는 대상을 낮은 반응자로 분류하였다. 제3의 보다 엄격한 기준으로서, ADHD-RS 점수에서 40% 이상의 감소를 나타내고 CGI-I 점수가 2 이하인 대상을 우수 반응자로 분류하고, 나머지 대상을 낮은 반응자로 간주하였다. 제4 기준으로, CPT에 의해 측정되는 치료 반응의 경우, 각 변량에서 10% 이상의 감소를 나타내는 대상을 우수 반응자로 분류하고, 나머지 대상을 낮은 반응자로 분류하였다.
1.3. 유전자형 분석
동결저장되었던 환자의 혈액으로부터 G-DEX II Genomic DNA Extraction Kit (Intron, Korea)를 이용하여 게놈 DNA를 추출하였다. 게놈 DNA를 주형으로 하고 Assay Designer 3.1 (Sequenom, Inc.)을 통해 제작된 5' ACG TTG GAT GAT GAC ATC ATC AGT GTC TGC (서열번호 2) 및 5' ACG TTG GAT GCA TGA CTT TTT TCC CCT ACT C (서열번호 3)의 프라이머 세트를 이용하여 GRIN2B의 rs2284411 다형성 부위를 포함하는 DNA 단편을 증폭하였다. PCR 반응을 위해 첨가된 뉴클레오티드를 0.3 U의 shrimp alkaline phosphatase를 이용하여 탈인산화시킴으로써 불활성화하고, 여기에 GRIN2B의 rs2284411 특이적인 연장 프라이머 (5' GCA TAA AAG GAG AGC ATC: 서열번호 4) 5 uM, 디디옥시뉴클레오티드, 반응 완충액, 및 Thermosequenase 효소 (Sequenom, CA)를 첨가하여 프라이머 연장반응을 수행하였다. Primer extension 반응은 94℃에서 2분간의 변성 후, 94℃ 5초, 52℃ 5초, 72℃ 5초로 이루어진 55회 사이클을 수행하였다. 반응 부산물을 SpectroCLEAN (Sequenom, Inc.)로 탈염화시킨 후 SpectroJET (Sequenom, Inc.)를 사용하여 SpectroCHIP (Sequenom, Inc.)에 분배하였다. chip-based MALDI-TOF mass spectrometry platform (Sequenom, Inc., California, USA)를 이용하여 프라이머 연장 산물을 분석함으로써 GRIN2B의 rs2284411 다형성을 검출하였다.
1.4. 통계 분석
GRIN2B 유전자형은 열성 유전자형의 희소성으로 인해 2개의 군으로 분류되었다: C/C 군 및 C/T + T/T 군. 이 2개군 간 인구통계학 특성 및 임상적 특성을 연속 변수에 대한 독립 t-검정 및 범주형 변수(categorical variables)에 대한 χ2
검정 또는 Fisher의 정확검정(Fisher's exact test)를 이용하여 비교하였다. 결과 변수로서 '우수한 반응성'을, 1차 예측자(primary predictor)로서 GRIN2B T/T + C/T 유전자형을, 및 공변량으로서 연령, 성별, IQ, 기저선 CGI-S 점수, 기저선 ADHD-RS 총 점수, 최종 메틸페니데이트 투여량을 이용하여, 다변량 로지스틱 회귀 분석(multivariate logistic regression analysis)을 수행하였다. ADHD-RS의 총 점수, 주의력 점수, 및 과잉행동-충동성 점수 및 연속 수행 검사(CPT)의 변수에서의 변화를 독립 t-검정을 이용하여 유전자형 군 간 비교하였다. 모든 통계 분석은 SPSS (version 22.0; SPSS Inc., Chicago, IL, USA)를 이용하여 수행되고, 통계적 유의성은 0.05의 p 값 (2-tailed)로 정의하였다.
1.5. 결과
110명의 ADHD 환자 중 75명의 환자 (연령 8.84 ± 2.23세, 남성 64명 및 여성 11명)이 최종 분석에 포함되었고, 이 중 73명의 환자가 치료 전후 ADHD-RS를 완료하였다. 치료 후 6개월 차의 평균 최종 메틸페니데이트 투여량은 28.14 ± 12.31 mg이고, 평균 ADHD-RS의 총 점수는 24.85 ± 11.03에서 14.48 ± 9.25로 유의한 감소를 나타내었다 (p<0.001). 6개월 기간에 CGI-I 점수가 2 이하인 참가자는 37명 (49.3%)이고, ADHD-RS 총 점수가 40% 이상 감소한 참가자는 38명 (50.7%)이며, 19명의 참가자 (25.3%)가 ADHD-RS 총 점수 및 CGI-I에서 개선을 나타내었다. 메틸페니데이트에 대한 우수한 반응자 및 낮은 반응자 간 인구통계학 특성 및 임상적 특성에는 유의한 차이가 없었다.
χ유전 분석 결과, 54명이 C/C 유전형을 갖고, 19명이 C/T 유전형을 가지며, 2명이 T/T 유전형을 갖는 것으로 나타났다. C 대립유전자 빈도는 0.847이고 T 대립유전자 빈도는 0.153이었다. GRIN2B 다형성 분포는 Hardy-Weinberg 평형의 예측된 값을 갖는 적합도(goodness-of-fit)를 가졌다 (p>0.05). GRIN2B 유전자형에 따른 기저선 인구통계학 특성 및 임상적 특성을 하기 표 1에 나타내었다. 하기 표 1에서 SD는 표준 편차를 나타내고, NOS는 특정되지 않은 경우를 나타내며, MPH는 메틸페니데이트를 나타낸다.
| 특성 | C/C(n=54) | T/C +TT (n=21) | t 또는 χ2 | p |
| 연령(세), 평균(SD) | 8.96 (2.22) | 8.52 (2.30) | -0.76 | 0.448 |
| 성별(남성), N(%) | 47 (87.0) | 17 (81.0) | 0.45 | 0.474 |
| 지능 지수, 평균(SD) | 108.72 (15.07) | 103.34 (13.57) | -1.40 | 0.489 |
| ADHD 서브타입, N(%) | 4.53 | 0.209 | ||
| 부주의형(predominantly inattentive type) | 15 (27.8) | 9(42.9) | ||
| 과잉행동-충동형(predominantly hyperactive-impulsive type) | 3 (5.6) | 0 (0) | ||
| 혼합형 | 31 (57.4) | 8 (38.1) | ||
| NOS | 5 (9.3) | 4 (19.0) | ||
| CGI-S 점수, mean(SD) | 4.76 (0.78) | 4.33 (0.66) | -2.22 | 0.029 |
| ADHD-RS 점수, mean (SD) | ||||
| 총 점수 | 26.56 (10.21) | 20.48 (12.10) | -2.20 | 0.031 |
| 주의력결핍 서브점수 | 15.91 (5.50) | 12.24 (4.69) | -2.70 | 0.009 |
| 과잉행동 서브점수 | 10.65 (5.99) | 8.24 (8.54) | -1.38 | 0.171 |
| 기저선 CPT 변량 점수 | ||||
| 누락 오류 | 75.48 (19.17) | 67.95 (19.51) | -1.49 | 0.142 |
| 오경보 오류 | 66.83 (16.81) | 65.55 (21.20) | -0.24 | 0.811 |
| 반응 시간 | 59.62 (15.50) | 56.75 (13.27) | -0.73 | 0.468 |
| 반응 시간 표준 편차 | 55.62 (10.34) | 47.95 (8.29) | -2.97 | 0.004 |
| 평균 초기 MPH 투여량 | 15.60 (6.03) | 13.00 (4.71) | -1.52 | 0.133 |
| 평균 최종 MPH 투여량 | 29.08 (11.17) | 25.90 (14.73) | -0.99 | 0.325 |
표 1에 나타낸 바와 같이, C/C 군 및 C/T + T/T 군 간 연령, 성별, IQ, 서브타입 분포, 또는 최종 메틸페니데이트 투여량에서의 유의한 차이가 존재하지 않았다. 그러나, C/C 군은 보다 높은 기저선 CGI-S 점수, ADHD-RS 총 점수 및 ADHD-RS 주의력 점수를 가졌다. 이들 점수를 하기 로지스틱 회귀 분석에 포함시켰다. 또한, 2개군 간 CPT 반응 시간 표준편차에서도 유의한 차이가 존재하였다.
하기 표 2는 치료 반응과 GRIN2B 유전자형의 연관성을 조사한 로지스틱 회귀 분석의 결과를 나타낸다. 모든 결과를 연령, 성별, IQ, 기저선 CGI-S 점수, 기저선 ADHD-RS 총 점수, 및 최종 메틸페니데이트 투여량에 대해 조정하였다. 하기 표 2에서, aOR은 odds ratio의 약자로서, 연령, 성별, IQ, 기저선 CGI-S 점수, 기저선 ADHD-RS 총 점수, 및 최종 메틸페니데이트 투여량에 대해 조정되었다. IA는 부주의 점수의 약자이며, HI는 과잉행동-충동성 점수의 약자이다. ADHD-RS 데이터는 53명의 C/C 및 20명의 T/C + TT 대상자를 포함하였다.
| 반응 기준 | C/C(n=54),N (%) | T/C +TT(n=21), N(%) | OR (95% CI)a | p |
| ADHD-RS, IA = 40% | 35 (66.0) | 5 (25.0) | 5.27 (1.52 - 18.33) | 0.009 |
| ADHD-RS, HI = 40% | 32 (60.4) | 6 (30.0) | 4.31 (1.17-15.81) | 0.028 |
| ADHD-RS, total = 40% | 33 (62.3) | 5 (25.0) | 4.35 (1.23-15.42) | 0.023 |
| CGI-I ≤2 | 33 (61.1) | 4 (19.0) | 8.83 (1.72-45.47) | 0.009 |
| ADHD-RS, IA = 40% 및 CGI-I ≤2 | 19 (35.8) | 1 (5.0) | 14.18 (1.37-146.21) | 0.026 |
| ADHD-RS, HI = 40% 및 CGI-I ≤2 | 0 (0.00) | 6 (30.0) | . | 0.977 |
| ADHD-RS, total = 40% 및 CGI-I ≤2 | 18 (34.0) | 1 (5.0) | 9.03 (1.02-79.99) | 0.048 |
| CPT 누락 오류 = 10% | 35 (67.3) | 9 (45.0) | 1.62 (0.47-5.52) | 0.442 |
| CPT 오경보 오류 = 10% | 39 (75.0) | 12 (60.0) | 2.75 (0.76-9.98) | 0.123 |
| CPT 반응 시간 = 10% | 28 (53.8) | 9 (45.0) | 0.73 (0.195-2.75) | 0.644 |
| CPT 반응 시간 표준 편차 = 10% | 34 (65.4) | 5 (25.0) | 10.77 (2.28-50.83) | 0.003 |
표 2에 나타낸 바와 같이, ADHD-RS 총 점수 (OR 4.35, 95% CI 1.23-15.42, p=0.023), 주의력 점수 (OR 5.27, 95% CI 1.52-18.33, p=0.009) 및 과잉행동-충동성 점수 (OR 4.31, 95% CI 1.17-15.81, p=0.028)에 근거하여, C/C 유전자형은 C/T + T/T 유전자형에 비해 메틸페니데이트의 6개월 치료 후 더 우수한 치료반응과 유의하게 연관되었다. 또한, 치료 후 평가 기간에 GRIN2B 유전자형과 CGI-I 점수 간 유의한 연관성이 존재하였다 (OR 8.83, 95% CI 1.72-45.47, p=0.009).
보다 엄격한 기준을 적용할 경우, CGI-I 및 ADHD-RS 주의력 점수 개선의 관점 (OR 14.18, 95% CI 1.37-146.21, p=0.026) 및 CGI-I 및 ADHD-RS 총 점수 개선의 관점 (OR 9.03, 95% CI 1.02-79.99, p=0.048)에서, C/C 유전자형은 C/T + T/T 유전자형에 비해 보다 높은 반응률(response rate)을 나타내었다. 그러나, CGI-I 및 ADHD-RS 과잉행동 점수 기준을 이용할 경우, GRIN2B 유전자형과 반응률 간에는 유의한 연관성이 존재하지 않았다. CPT 점수의 개선에 의해 정의된 반응률 중에서, GRIN2B는 반응 시간 표준편차의 개선과 유의한 연관성을 나타내었다 (OR 10.77, 95% CI 2.28-50.93, p=0.003).
하기 표 3은 GRIN2B 유전자형 간 ADHD-RS 점수에서의 치료 후 변화를 비교한 결과를 나타낸다.
| 변량 | C/C (n=53), N (%) | T/C +TT (n=21), N(%) | t | Cohen's d | p |
| ADHD-RS, 평균 (SD) | |||||
| 부주의 | -7.77 (5.64) | -1.25 (7.12) | 4.10 | 0.97 | <0.001 |
| 과잉행동-충동성 | -5.25 (4.92) | -0.45 (9.83) | 2.77 | 0.66 | 0.007 |
| 전체 | -13.02 (9.73) | -1.70 (15.49) | 3.73 | 0.89 | <0.001 |
| CPT, 평균 (SD) | |||||
| 누락 오류 | -15.12 (20.49) | -9.10 (20.66) | 1.11 | 0.27 | 0.275 |
| 오경보 오류 | -12.31 (14.49) | -11.45 (15.91) | 0.22 | 0.05 | 0.827 |
| 반응 시간 | -8.02 (15.19) | -3.35 (14.77) | 1.18 | 0.28 | 0.243 |
| 반응 시간 표준 편차 | -10.02 (11.04) | 1.05 (10.33) | 3.88 | 0.93 | <0.001 |
표 3에 나타낸 바와 같이, C/C 유전자형 군과 C/T + T/T 유전자형 군 간 ADHD-RS 총 점수 (p<0.001), 주의력 점수 (p < 0.001), 과잉행동-충동성 점수 (p = 0.007), 및 CPT의 반응 시간 표준편차 (p<0.001)의 변화에 있어서 유의한 차이가 존재하였다.
서열번호 1 : acttttttcc cctactcttg gtccayttga tgctctcctt ttatgctcct a
서열번호 2 : acgttggatg atgacatcat cagtgtctgc
서열번호 3 : acgttggatg catgactttt ttcccctact c
서열번호 4 : gcataaaagg agagcatc
Claims (13)
- 글루타메이트 수용체 (glutamate receptor, ionotropic, N-methyl D-aspartate 2B: GRIN2B)를 코딩하는 폴리뉴클레오티드의 rs2284411 다형성 부위를 검출할 수 있는 시약을 포함하는, 주의력결핍 과잉행동장애를 갖는 대상에서 메틸페니데이트 치료에 대한 반응성을 예측하기 위한 조성물.
- 청구항 1에 있어서, 상기 시약이 프라이머 세트 또는 프로브인 것인 조성물.
- 청구항 2에 있어서, 상기 프라이머 세트가 서열번호 2 및 서열번호 3의 올리고뉴클레오티드로 이루어지는 것인 조성물.
- 주의력결핍 과잉행동장애를 갖는 대상으로부터 핵산 시료를 수득하는 단계;상기 시료에서 글루타메이트 수용체 (GRIN2B)를 코딩하는 폴리뉴클레오티드의 rs2284411 다형성 부위를 검출하여, 상기 부위의 유전형을 결정하는 단계;상기 유전형이 C/C인 경우, 상기 대상의 메틸페니데이트 치료에 대한 반응성이, 상기 유전형이 C/T 또는 T/T인 주의력결핍 과잉행동장애를 갖는 대상에 비해 더 큰 것으로 결정하는 단계를 포함하는, 주의력결핍 과잉행동장애를 갖는 대상에서 메틸페니데이트 치료에 대한 반응성을 예측하는 방법.
- 청구항 4에 있어서, 상기 시료가 상기 대상의 혈액으로부터 수득되는 것인 방법.
- 청구항 4에 있어서, 상기 검출하는 단계가 상기 다형성 부위에 특이적인 프라이머 세트 또는 프로브를 이용하는 것인 방법.
- 청구항 6에 있어서, 상기 프라이머 세트가 서열번호 2 및 서열번호 3의 올리고뉴클레오티드로 이루어지는 것인 방법.
- 청구항 4에 있어서, 상기 검출하는 단계가 염기서열 분석, 마이크로어레이 분석, 대립유전자 특이적 PCR 분석, PCR 연장 분석, 질량 분광측정법, 또는 그 조합에 의해 수행되는 것인 방법.
- 청구항 4에 있어서, 상기 검출하는 단계가,상기 대상으로부터 수득된 핵산 시료를 주형으로 하고, 상기 폴리뉴클레오티드 또는 이와 상보적인 폴리뉴클레오티드 중 상기 다형성 부위를 포함하는 부위를 증폭할 수 있는 프라이머 세트를 이용하여 중합효소 연쇄 반응을 수행하는 단계; 및얻어진 증폭 산물의 서열을 결정하는 단계를 포함하는 것인 방법.
- 주의력결핍 과잉행동장애를 갖는 2 이상의 대상으로부터 핵산 시료를 수득하는 단계;상기 각 시료로부터 글루타메이트 수용체 (GRIN2B)를 코딩하는 폴리뉴클레오티드의 rs2284411 다형성 부위를 검출하여, 상기 부위의 유전형을 결정하는 단계; 및상기 유전형이 C/C인 대상을 메틸페니데이트 치료에 반응할 가능성을 갖는 대상으로 선택하는 단계를 포함하는, 주의력결핍 과잉행동장애를 갖는 대상 중 메틸페니데이트 치료에 반응할 가능성을 갖는 대상을 선택하는 방법.
- 청구항 10에 있어서, 상기 시료가 상기 대상의 혈액으로부터 수득되는 것인 방법.
- 청구항 10에 있어서, 상기 검출하는 단계가 상기 다형성에 특이적인 프라이머 세트 또는 프로브를 이용하는 것인 방법.
- 청구항 12에 있어서, 상기 프라이머 세트가 서열번호 2 및 서열번호 3의 올리고뉴클레오티드로 이루어지는 것인 방법.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| KR1020160008895A KR101792813B1 (ko) | 2016-01-25 | 2016-01-25 | 주의력결핍 과잉행동장애 치료제에 대한 치료 반응 예측용 조성물 및 방법 |
| KR10-2016-0008895 | 2016-01-25 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2017131293A1 true WO2017131293A1 (ko) | 2017-08-03 |
Family
ID=59398053
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/KR2016/004969 Ceased WO2017131293A1 (ko) | 2016-01-25 | 2016-05-12 | 주의력결핍 과잉행동장애 치료제에 대한 치료 반응 예측용 조성물 및 방법 |
Country Status (2)
| Country | Link |
|---|---|
| KR (1) | KR101792813B1 (ko) |
| WO (1) | WO2017131293A1 (ko) |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20090253595A1 (en) * | 2008-04-03 | 2009-10-08 | Bj Services Company | Surfactants for hydrocarbon recovery |
| WO2012027491A1 (en) * | 2010-08-24 | 2012-03-01 | The Children's Hospital Of Philadelphia | Association of rare recurrent genetic variations to attention-deficit, hyperactivity disorder (adhd) and methods of use thereof for the diagnosis and treatment of the same |
| WO2012054681A2 (en) * | 2010-10-21 | 2012-04-26 | Mayo Foundation For Medical Education And Research | Methods for selecting medications for treating patients having attention-deficit hyperactivity disorder |
| KR101157526B1 (ko) * | 2011-09-20 | 2012-06-22 | 서울대학교산학협력단 | 주의력결핍 과잉행동장애의 진단용 snp와 그를 포함하는 마이크로어레이 및 키트 |
-
2016
- 2016-01-25 KR KR1020160008895A patent/KR101792813B1/ko active Active
- 2016-05-12 WO PCT/KR2016/004969 patent/WO2017131293A1/ko not_active Ceased
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20090253595A1 (en) * | 2008-04-03 | 2009-10-08 | Bj Services Company | Surfactants for hydrocarbon recovery |
| WO2012027491A1 (en) * | 2010-08-24 | 2012-03-01 | The Children's Hospital Of Philadelphia | Association of rare recurrent genetic variations to attention-deficit, hyperactivity disorder (adhd) and methods of use thereof for the diagnosis and treatment of the same |
| WO2012054681A2 (en) * | 2010-10-21 | 2012-04-26 | Mayo Foundation For Medical Education And Research | Methods for selecting medications for treating patients having attention-deficit hyperactivity disorder |
| KR101157526B1 (ko) * | 2011-09-20 | 2012-06-22 | 서울대학교산학협력단 | 주의력결핍 과잉행동장애의 진단용 snp와 그를 포함하는 마이크로어레이 및 키트 |
Non-Patent Citations (1)
| Title |
|---|
| PARK ET AL.: "Association between the GRM7 rs3792452 Polymorphism and Attention Deficit Hyperacitiveity Disorder in a Korean Sample", BEHAVIORAL AND BRAIN FUNCTIONS, vol. 9, no. 1, 7 January 2013 (2013-01-07), pages 1 - 8, XP021152449 * |
Also Published As
| Publication number | Publication date |
|---|---|
| KR20170102586A (ko) | 2017-09-12 |
| KR101792813B1 (ko) | 2017-11-02 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Mah et al. | Identification of the semaphorin receptor PLXNA2 as a candidate for susceptibility to schizophrenia | |
| Addington et al. | Polymorphisms in the 13q33. 2 gene G72/G30 are associated with childhood-onset schizophrenia and psychosis not otherwise specified | |
| US20210230693A1 (en) | Diagnosis and prediction of autism spectrum disorder | |
| Billing-Ross et al. | Mitochondrial DNA variants correlate with symptoms in myalgic encephalomyelitis/chronic fatigue syndrome | |
| US11332792B2 (en) | Mitochondrial DNA mutation profile for predicting human health conditions and disease risk and for monitoring treatments | |
| EP3507384B1 (en) | Methods and composition for the prediction of the activity of enzastaurin | |
| EP3167080B1 (en) | Genetic addiction risk analysis for rds severity index and kit | |
| JP2013538589A (ja) | 自閉症を診断するための組成物及び方法 | |
| Cheon et al. | Association between homozygosity of a G allele of the alpha-2a-adrenergic receptor gene and methylphenidate response in Korean children and adolescents with attention-deficit/hyperactivity disorder | |
| US20140342919A1 (en) | Markers related to age-related macular degeneration and uses therefor | |
| US20110091899A1 (en) | Combination of risk alleles associated with autism | |
| US7906283B2 (en) | Methods to identify patients at risk of developing adverse events during treatment with antidepressant medication | |
| US12612661B2 (en) | Compositions and methods for assessing the efficacy of inhibitors of neurotransmitter transporters | |
| WO2017131293A1 (ko) | 주의력결핍 과잉행동장애 치료제에 대한 치료 반응 예측용 조성물 및 방법 | |
| US20050255498A1 (en) | APOC1 genetic markers associated with age of onset of Alzheimer's Disease | |
| US20050255495A1 (en) | SLC5A7 genetic markers associated with age of onset of Alzheimer's disease | |
| KR102650359B1 (ko) | 약물 과민반응 진단용 snp 및 이를 이용한 진단 방법 | |
| KR102110883B1 (ko) | 정신 질환 진단용 kmt2c 다형성 마커 | |
| WO2025164902A1 (ko) | 알츠하이머병 발병 위험도 예측을 위한 레이 복잡도 복사 점수 저하와 관련이 있는 단일염기다형성 마커 및 이의 용도 | |
| US7405043B2 (en) | Responsiveness to therapy for liver disorders | |
| Kodama et al. | Simultaneous copy number losses within multiple subtelomeric regions in early-onset type2 diabetes mellitus | |
| US20100028868A1 (en) | Responsiveness to Therapy for Liver Disorders | |
| Khan | Studying the Prevalence and Genetic Contributions to Parkinsonism in Pakistan | |
| HK40011257A (en) | Methods and composition for the prediction of the activity of enzastaurin | |
| HK40011257B (en) | Methods and composition for the prediction of the activity of enzastaurin |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 16888269 Country of ref document: EP Kind code of ref document: A1 |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 16888269 Country of ref document: EP Kind code of ref document: A1 |
