WO2017129753A1 - Means and methods for staging, typing and treating a cancerous disease - Google Patents
Means and methods for staging, typing and treating a cancerous disease Download PDFInfo
- Publication number
- WO2017129753A1 WO2017129753A1 PCT/EP2017/051789 EP2017051789W WO2017129753A1 WO 2017129753 A1 WO2017129753 A1 WO 2017129753A1 EP 2017051789 W EP2017051789 W EP 2017051789W WO 2017129753 A1 WO2017129753 A1 WO 2017129753A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- dcc
- cells
- somatic
- cancer
- dccs
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
- A61P35/04—Antineoplastic agents specific for metastasis
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/112—Disease subtyping, staging or classification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/118—Prognosis of disease development
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Definitions
- the present invention relates to methods for diagnosing, staging and treating cancer.
- the present invention provides methods for determining the stage/type of a cancerous disease, comprising detecting somatic alterations of the DNA of one or more disseminated cancer cells (DCCs), obtained after homing to a distant organ, such as a lymph node; and determining the somatic evolution of the DCC(s) based on the detected somatic alterations, wherein the somatic evolution is indicative of the stage/type of the cancerous disease.
- DCCs disseminated cancer cells
- Cancer staging/typing is the process of determining the extent to which a cancer has developed by spreading.
- Contemporary practice is to assign a number from I-IV to a cancer, with I being an isolated cancer and IV being a cancer which has spread to the limit of what the assessment measures.
- stage IV indicates distant spread of the cancer.
- the stage generally takes into account the size of a tumor, whether it has invaded adjacent organs, how many regional (nearby) lymph nodes it has spread to (if any), and whether it has appeared in more distant locations (metastasized).
- the determined stage of a cancer is generally used to find a suitable strategy for therapy of the cancer, e.g. surgical therapy or drug therapy.
- therapy in particular drug therapy, is often unsuccessful due to, inter alia, resistance.
- MRD minimal residual disease
- DCCs disseminated cancer cells
- CTCs circulating tumor cells
- PT primary tumor
- the technical problem underlying the present invention is the provision of accurate methods for the early determination of the stage/type of a cancerous disease and corresponding improved means and methods for treating a cancerous disease.
- the invention accordingly, relates to a method for staging and/or typing of a cancerous disease, said method comprising the following steps:
- step (b) determining the somatic evolution of the DCC(s) based on the detected somatic alteration(s) in step (a),
- somatic evolution of the DCC(s) is indicative of the stage/type of the cancerous disease.
- the cancerous disease to be staged/typed is melanoma.
- the invention relates to a method for staging and/or typing of a cancerous disease, said method comprising the following steps:
- step (a) detecting somatic alterations of the DNA of one or more disseminated cancer cell(s) DCC(s) obtained from one or more lymph node(s); and (b) determining the somatic evolution of the DCC(s) based on the detected somatic alteration(s) in step (a),
- somatic evolution of the DCC(s) is indicative of the stage/type of the cancerous disease, wherein the cancerous disease is melanoma.
- the illustrative appended Examples demonstrate that DCCs acquire alterations that are critical for metastatic progression within lymph nodes. This indicates that parallel progression of the primary tumor and DCCs takes place (as opposed by intratumoral progression of DCCs).
- Parallel progression of the primary tumor and DCCs means that analysis of the primary cancer cannot be used to evaluate whether DCCs progress to metastases.
- Parallel progression of the primary tumor and DCCs also means that progression of DCCs to metastasis cannot be prevented by resection of the primary cancer.
- parallel progression means that analysis of the primary cancer cannot be used to determine whether the metastases respond to a certain therapy.
- this metastasis signature can advantageously be used to evaluate whether the DCCs will form metastases.
- this metastases signature can be used in order to evaluate whether the metastases will respond to a certain therapy.
- the present invention relates to a method for identifying the metastasis signature of one or more DCC(s) (i.e. for staging and/or typing of a cancerous disease) said method comprising the following steps:
- step (b) determining the metastasis signature (i.e. the somatic evolution) of the DCC(s) based on the detected somatic alteration(s) in step (a).
- metastasis signature i.e. the somatic evolution
- metastases signature of the DCC(s) is indicative of the stage/type of the cancerous disease.
- the cancerous disease is melanoma.
- the stage/type of a cancerous disease can be used to evaluate whether the cancerous disease (preferably a melanoma) responds to a certain therapy. Therefore, the method of the present invention is useful to determine whether a certain therapy should be initiated, continued or discontinued.
- Another embodiment of the present invention relates to a method for treating a cancerous disease, said method comprising the following steps:
- step (b) determining the somatic evolution of the DCC(s) based on the detected somatic alteration(s) in step (a);
- step (c) determining the stage/type of the cancerous disease based on the somatic evolution of the DCC(s) determined in step (b),
- stage/type of the cancerous disease is used to initiate, continue or discontinue therapy of said cancerous disease.
- the cancerous disease is melanoma.
- the invention also relates to a pharmaceutical composition for use in treating a cancerous disease in a subject, wherein treatment is initiated, continued or discontinued based on the stage/type of said cancerous disease, wherein said stage/type of said cancerous disease is determined by:
- step (b) determining the somatic evolution of the DCC(s) based on the detected somatic alteration(s) in step (a);
- step (c) determining the stage/type of the cancerous disease based on the somatic evolution of the DCC(s) determined in step (b).
- the cancerous disease is melanoma.
- Said pharmaceutical composition may be any type of medicament for the treatment of a cancerous disease, including composition comprising a chemotherapeutic drug or a composition comprising a drug for immunotherapy.
- One embodiment of the present invention relates to the methods or pharmaceutical composition of the invention, further comprising determination of the DCC density (DCCD), wherein the DCCD is the number of DCCs per million cells in the lymph node used to obtain the DCCs, wherein the DCCD is indicative of the stage/type of the cancerous disease.
- DCCD DCC density
- the appended Examples show that DCCs from lymph nodes with a DCCD of > 100 are able to grow to a colony and to develop to tumors in a xenograft experiment, in particular for melanoma. Therefore, one aspect of the present invention relates to the herein provided methods, or the herein provided pharmaceutical composition, wherein a DCCD of > 100 is indicative for the development of metastases, in particular in the case of melanoma.
- immunological changes i.e. signs of T cell exhaustion indicating a blunted T cell response and DCCs progressing to metastases
- This information can be used to determine whether therapies targeting the microenvironment will be effective, in particular therapy targeting cells of the immune system.
- therapies targeting the microenvironment will be effective, in particular therapy targeting cells of the immune system.
- the tissue origin of the primary tumor and target site of dissemination and metastasis differ.
- analysis of the microenvironment (e.g. immune cells) of the primary tumor may be less suited to evaluate whether the microenvironment at the target site of dissemination and metastasis is affected or whether a certain therapy targeting the microenvironment of DCC(s) and metastases will be effective.
- the microenvironment in lymph nodes is indicative of the stage/type of the cancerous disease outside the primary tumor.
- a DCCD of > 2000 in particular in the case of melanoma, is indicative of a yet further advanced stage/type of the cancerous disease, in particular melanoma.
- the appended Examples show that the number of antigen-experienced CD8 T cells increases with increasing DCCD, which is indicative of T cell activation related to tumor cell growth and metastases formation.
- PD-1 high expressing CD8 T cells are significantly enriched in lymph nodes with a DCCD at about 2000, i.e.
- PD-1 high CD8 T cells are considered as terminally exhausted T cells. These cells co-express Tim-3, another marker of exhausted T cells and have an impaired ability for cytokine production. Exhausted T cells lose effector functions in a hierarchical manner: IL-2 production, high proliferative capacity and cytolytic activity are lost first, followed by impaired cytokine production.
- PD-1 expressing CD8 T cells isolated from tumor tissue of metastatic melanoma patients were shown to be tumor-reactive. An increase in MDSCs (myeloid derived suppressor cells) was concomitant with the increase with PD-1 high expressing CD8 T cells.
- MDSCs are immunosuppressive immune cells and cancer tissues with high infiltration of MDSCs are associated with poor patient prognosis and resistance to therapies. Also, the percentage of MDSC is increased in patients with a DCCD at about 2000, whereas the percentage of cytolytic CD56dim NK cells is decreased in lymph nodes with a high DCCD. CD56dim NK cells possess high cytolytic function and therefore can kill tumor ceils. All together the appended Examples demonstrate that changes in the local immune m icroen vi ronmen t in the target organ of dissemination are associated with metastatic outgrowth, for which the DCCD gives an indicative measurement.
- the methods or pharmaceutical composition of the invention further comprise determination of the DCC density (DCCD), wherein the DCCD is the number of DCCs per million cells in the lymph node used to obtain the DCCs, wherein the DCCD is indicative of the stage/type of the cancerous disease, wherein a DCCD of > 100 is indicative for the development of metastases and/or wherein a DCCD of > 2000 is indicative of the immune system being unable to inhibit metastatic growth.
- DCCD DCC density
- treatment may further comprise immune therapy specifically addressing immune cells and their ability to inhibit metastasis growth.
- the appended Examples show that depending on the metastasis signature (i.e. the type of somatic alterations) patient-derived DCCs are able to form tumors in mice.
- all DCCs that were able to form tumors had either a BRAF mutation, a loss of chromosome 9p 11-13, a loss of chromosome 9p21-24, a gain of chromosome 7q21-36, or a NRAS mutation.
- deletions of 9p 11-13 and/or 9p21-24 are observed in about 90% of cells carrying more than one somatic alteration. All together, in about 20% of the samples, a loss of 9pl 1 was observed in combination with a loss of 9p24.
- one aspect of the present invention relates to the methods of the invention, or the pharmaceutical composition of the invention, wherein the somatic alterations comprise at least one of the somatic alterations selected from the group consisting of a BRAF mutation, a loss of chromosome 9p 11-13, a loss of chromosome 9p21-24, a gain of chromosome 7q21-36, and a NRAS mutation.
- the somatic alterations may also comprise at least two, three, four or all of the somatic alterations selected from the group consisting of a BRAF mutation, a loss of chromosome 9p 11-13, a loss of chromosome 9p21- 24, a gain of chromosome 7q21-36, and a NRAS mutation.
- a BRAF mutation indicates that the DCC(s) will develop to metastases.
- step (a) further comprises evaluating the proliferation of the DCC(s), wherein in step (b) an increased proliferation of the DCC(s) indicates that the DCC(s) will develop to metastases.
- the proliferation can be measured, e.g., by analyzing the amount of proliferation markers such as the proliferation marker Ki-67.
- the frequency of Ki-67 positive cells can be determined by assessing the percentage of cells that stain positive for the marker, e.g. by immunohistochemistry, immunofluorescence. This percentage provides an estimate of cells in the cell cycle, i.e. the percentage of proliferating cells.
- the stage/type of a cancerous disease can be used to evaluate whether the cancerous disease (preferably a melanoma) responds to a certain therapy.
- the presence or absence of genetic alterations within DCCs also indicates whether a certain treatment is to be initiated, continued or discontinued.
- one embodiment of the present invention relates to the methods of the invention, or the pharmaceutical composition of the invention, wherein if the DCC(s) are found to carry a BRAF mutation, a treatment that is directed against cells carrying said mutation is to be initiated or continued. However, if the DCC(s) were found to not carry a BRAF mutation, a treatment that is directed against cells carrying said mutation might be harmful to the patient.
- a treatment that is directed against cells carrying said mutation is to be initiated or continued.
- a treatment that is directed against cells carrying said mutation might be harmful to the patient.
- PD-1 high expressing T cells which are thought to not respond to PD-1 blockade (PMID: 257975 16), i.e. regain functionality, are found in increasing numbers in lymph node(s) harboring DCC(s)
- no therapy response might be observed under therapeutically PD-1 or PD- Ll blockade or the therapy might be even harmful to the patient (i.e. autoimmunity without anti-cancer response).
- the type of cancerous disease is not particularly limited as long as the disease involves the dissemination of cells from a primary disease site into lymph node(s) and/or other tissue, for example bone marrow. It is preferred that the cancerous disease is a melanoma.
- the present invention relates to a method for staging and/or typing of a cancerous disease, a method for treating a cancerous disease and a pharmaceutical composition for use in treating a cancerous disease, in particular cancer.
- the stage/type of a cancerous disease, in particular cancer can be determined by detecting the somatic alterations, in particular genetic and/or epigenetic alterations, in the DNA of disseminated cancer cells (DCCs) obtained from a tissue sample of a subject, in particular obtained from one or more lymph node(s) of a subject, in particular draining and/or regional lymph node(s) and/or sentinel lymph node(s).
- DCCs disseminated cancer cells
- the present invention provides a method for staging and/or typing of a cancerous disease, a method for treating a cancerous disease and a pharmaceutical composition for use in treating a cancerous disease, in particular cancer where the stage/type of a cancerous disease, in particular cancer, is determined by detecting the somatic alterations, in particular genetic and/or epigenetic alterations, in the DNA of one or more CTC(s) obtained from blood of a subject, in particular obtained from a blood sample obtained from a subject or obtained using an in vivo CTC-capturing-device.
- the embodiments provided herein may also be applied to CTC(s), unless indicated otherwise, instead or in addition to DCC(s).
- the skilled person is readily aware how to adapt the teaching provided herein for DCC(s) to CTC(s) accordingly.
- the inventors determined the time point of metastatic seeding of melanoma relative to the depth of dermal invasion and characterized ectopic molecular evolution in cancer, in particular melanoma; see inter alia Example 1 and Figure 1. More specifically, as also large melanomas may be non-invasive, the time point of metastatic seeding of melanoma relative to the depth of dermal invasion (not relative to the total size) of the melanoma was analyzed.
- Disseminated cancer cells lacked typical driver changes before lymphatic colony formation regardless of primary tumor thickness; see inter alia Example 5 and Figures 2, 3 and 4.
- driver mutations in BRAF or NRAS and signature chromosomal rearrangements became significantly enriched in colony-forming DCCs and/or xenografts from DCCs and put patients at high risk for death.
- DCCs leave primary tumors early and evolve at different sites in parallel; see inter alia Example 6 and Figure 5.
- staging and/or typing of cancerous diseases can be improved, in particular a more accurate method of staging and/or typing of cancerous diseases can be provided, by using information from cells derived from primary tumors, in particular DCCs obtained from different sites where cells evolve, i.e. sites where DCCs migrate, like for example lymph nodes, or sites where cells, in particular CTCs derived from a primary tumor circulate, for example blood.
- the inventors surprisingly found that the somatic evolution of said DCCs or CTCs, respectively, determined based on somatic, in particular genetic and/or epigenetic alterations detected in the DNA of said DCCs or CTCs, respectively, can be used to stage/type a cancerous disease, in particular cancer.
- the stage of a cancerous disease is usually determined using, for example, the TNM staging system.
- TNM Classification of Malignant Tumours is a cancer staging notation system that gives codes to describe the stage of a patient's cancer, wherein T describes the size of the original (primary) tumor and whether it has invaded nearby tissue, N describes nearby (regional) lymph nodes that are involved, and M describes distant metastasis (spread of cancer from one part of the body to another).
- Tx tumor cannot be evaluated
- Tis carcinoma in situ
- TO no signs of tumor
- Tl T2, T3, T4: size and/or extension of the primary tumor.
- the above stages of cancerous diseases are in many cases insufficient to determine a suitable strategy for therapy of a cancerous disease. Therefore, a new model was found, which uses the somatic evolution of cells, in particular DCCs obtained from one or more lymph node(s) of a subject, in particular draining and/or regional lymph node(s) and/or sentinel lymph node(s), but also, if available, DCCs from other organs than lymph nodes, such as bone marrow or liquor, informing about the molecular state of brain DCCs.
- the somatic evolution of cells may also be determined using CTCs obtained from blood of a subject.
- novel and inventive methods of the present invention use the somatic evolution of cells, in particular DCCs and/or CTCs, as indicator of the stage/type of a cancerous disease, in particular cancer.
- DCCs are cells that disseminated from a primary tumor site before surgery and spread lymphatically or hematogeneously. They may be detected using epithelial cell markers or melanocytic markers in case of melanoma, which are not found on the surface of lymphatic cells or cells found in bone marrow.
- EpCAM and/or cytokeratins are cell markers that may be targeted in the detection of DCCs (Klein (2009), Nat Rev Cancer 9:302- 312), in particular in the case of carcinomas.
- the targeting cell markers can be expressed and/or located intracellularly and/or at the surface of the cell.
- DCCs from melanoma may be detected by using gplOO and/or MCSP (melanoma-associated chondroitin sulfate proteoglycan) and/or Melan A (MART-1), and/or CD 146 as targeting cell markers.
- DCCs can be detected and isolated for example from bone marrow aspirates or lymph nodes.
- the DCCD can be determined by immunocytology.
- the single cell suspension may be stained with antibodies against the said targeting cell markers such as EpCAM (Guzvic et al. (2014) Cancer Res. 74:7383-7394), cytokeratin (Schardt et al.
- DCCD DCC-density
- CTCs are cells that are also derived from a primary tumor site before surgery, but that circulate in the blood system. After primary tumor surgery they may be derived from latent or manifest metastatic colonies. They may be detected and isolated using EpCAM as targeting cell marker, but are not limited to this targeting cell marker. Enrichment and detection markers are similar to those used for detection in other mesenchymal organs (bone marrow, lymph nodes) and include for example EpCAM and Cytokeratins for epithelial markers and the mentioned melanocytic markers in melanoma. CTCs may be obtained from blood (e.g. from leukapheresis products) (Fischer et al.
- Such devices or particles are implanted or infused into a subject/patient to capture and enrich CTCs in the body of the subject/patient.
- the CTCs can then be retrieved from the CTC-capturing-device or -particles ex vivo or in vivo.
- the term "somatic evolution” as used herein relates to the accumulation of alterations in cells, in particular cancerous disease cells, in particular DCCs, during a lifetime, and the effects of those alterations on the fitness of those cells.
- Somatic evolution of cancer cells is due to spontaneous or induced genetic/epigenetic alterations and subsequent natural selection during clonal expansion, which selects cells according to fitness, proliferation rate, apoptosis rate and the like.
- cancer therapy acts as a form of artificial selection, killing sensitive cancer cells, but leaving behind resistant cells. Often the tumor will regrow from those resistant cells, the patient will relapse, and the therapy that had been previously used will no longer be effective.
- somatic evolution is an ongoing process during the development of cancerous diseases and/or therapy of a cancerous disease.
- somatic evolution is determined based on somatic alterations, including epigenetic alterations and/or genetic alterations. Therefore, based on the number and/or nature of somatic alterations, including epigenetic alterations and/or genetic alterations, the somatic evolution of a cell, in particular a DCC, can be determined.
- nucleic acids in particular DNA, comprised in a cell, in particular a DCC.
- Alteration means a deviation from a reference state like for example a state at a given point of time in a reference sample obtained from a subject, for example in a sample obtained from a subject comprising cells derived from other tissue than the sample to be analyzed in the methods of the present invention and/or comprising stem cells of the subject, or a state generally taken as reference with regard to a particular segment of DNA, for example a DNA sequence taken from a sequence database or a known pattern of epigenetic alterations such as a methylation pattern.
- a somatic alteration may be detected by comparing an observed state with a reference state. Any observed deviation may then be categorized as somatic alteration.
- said alteration may be categorized as real somatic alteration or an error introduced by the employed detection method, for example sequencing method.
- the present invention discloses means and methods particularly useful for error-free detection of somatic alterations. Such methods are preferred to be used in the methods of the present invention.
- Somatic alterations within the meaning of the present invention include epigenetic and/or genetic alterations. Genetic alterations include alterations on the level of the sequence of the DNA, i.e. the succession of nucleotides comprised in DNA, and alterations of the relative abundance of segments of the DNA comprised in the sample to be analyzed.
- genetic alterations within the meaning of the present invention may include, inter alia, single nucleotide variations (SNV), sequence mutations, Microsatellite shifts and instability, Loss of heterozygosity (LOH), copy number alterations, karyotypic variations including chromosome structural aberrations and/or aneuploidy.
- SNV single nucleotide variations
- LH Loss of heterozygosity
- copy number alterations include chemical alterations of DNA that are not on the level of the DNA sequence and alterations of external factors involved in DNA structure formation, processing and the like.
- epigenetic alterations within the meaning of the present invention may include, inter alia, methylation, in particular methylation of CG pairs, deficiencies of DNA repair proteins, and/or alterations in histone architecture or structure like methylation, acetylation, sumoylation, activating or inactivating histone marks and/or alterations in chromatin architecture like for example in eu- or hetero-chromatin and the like.
- somatic alterations in particular genetic alterations, comprise one or more driver mutation(s) and/or passenger mutation(s).
- driver mutation refers to mutations that give a selective advantage to a clone in its microenvironment, through either increasing its survival or reproduction. Driver mutations tend to cause clonal expansions.
- the somatic alterations, in particular genetic alterations, determined in the methods of the present invention may comprise one or more driver mutation(s).
- one common feature of cellular, in particular DCC progression is the expansion of a clone with a somatic alteration, in particular a genetic and/or epigenetic alteration.
- driver mutations are known in the art.
- driver mutations may be, inter alia, mutations in known oncogenes.
- Oncogenes are genes known to be associated with the development of a cancerous disease, in particular cancer.
- driver mutation(s) within the meaning of the present invention include, but are not limited to, mutations in known oncogenes.
- the genes coding for the neuroblastoma RAS viral oncogene homo log (NRAS) or BRAF are known oncogenes. Further known oncogenes are reported in databases such as the COSMIC database by Forbes et al. (2014) Nucleic Acid Res. 43, D805-81 1 , or in reports by Vogelstein et al. (2013) Science 339(6127): 1546-58, Akagi et al. (2004) Nucleic Acid Res. 32, D523-7 or Huret et al. (2000) Nucleic Acid Res. 28(1):349-51.
- driver mutations may be detected in the methods of the present invention.
- the methods used in the present invention for detecting the somatic alterations, in particular genetic and/or epigenetic alterations, in oncogenes are suitable for simultaneous detection of somatic alterations in multiple oncogenes.
- Particular driver mutations that may be detected in the methods of the present invention comprise driver mutations in the gene coding for NRAS comprising, inter alia, the exon 3 mutation cl 81C>A.
- the present invention relates to a method for staging and/or typing of a cancerous disease, the method comprising the steps of detecting somatic alterations of the DNA of one or more DCC(s) obtained from a tissue sample, in particular one or more lymph node(s); and determining the somatic evolution of the DCC(s) based on the detected somatic alteration(s) in the DNA of the one or more DCC(s), wherein the somatic evolution of the DCC(s) is indicative of the stage/type of the cancerous disease, wherein detection of somatic alterations comprises detection of the nucleotide at position 2986 of SEQ ID NO: l , wherein a cytosine at position 2986 of SEQ ID NO: l is indicative of a non-diseased stage/type and an adenine at position 2986 of SEQ ID NO: l is indicative of a diseased stage/type.
- a guanine at position 2987 of SEQ ID NO: l or a thymine at position 2987 of SEQ ID NO: l is indicative of a diseased stage.
- the present invention furthermore relates to a method for treating a cancerous disease, the method comprising the steps of detecting somatic alterations in the DNA of one or more DCC(s) obtained from a tissue sample, in particular one or more lymph node(s) of a subject; determining the somatic evolution of the DCC(s) based on the detected somatic alteration(s) in the DNA of the one or more DCC(s); and determining the stage/type of the cancerous disease based on the somatic evolution of the cancerous disease determined based on the detected somatic alterations in the DNA of the one or more DCC(s), wherein the stage/type of the cancerous disease is used to initiate, continue or discontinue therapy of said cancerous disease, wherein detection of somatic alterations comprises detection of the nucleotide at position 2986 of SEQ ID NO:
- the invention furthermore relates to a pharmaceutical composition for use in treating a cancerous disease in a subject, wherein treatment is initiated, continued or discontinued based on the stage/type of the cancerous disease, wherein the stage/type of the cancerous disease is determined by detecting somatic alterations in the DNA of one or more DCC(s) obtained from a tissue sample, in particular one or more lymph node(s) of a subject; determining the somatic evolution of the DCC(s) based on the detected somatic alteration(s) in the DNA of the one or more DCC(s); and determining the stage/type of the cancerous disease based on the somatic evolution of the cancerous disease determined based on the detected somatic alterations in the DNA of the one or more DCC(s), wherein detection of somatic alterations comprises detection of the nucleotide at position 2986 of SEQ ID NO: l, wherein a cytosine at position
- 2986 of SEQ ID NO: l is used to discontinue treatment and an adenine at position 2986 of SEQ ID NO: l is used to continue or initiate treatment. Furthermore, a guanine at position
- 2987 of SEQ ID NO: l or a thymine at position 2987 of SEQ ID NO: l is used to continue or initiate treatment of the cancerous disease.
- the detection of somatic alterations may comprise the detection of genetic and/or epigenetic alterations of one or more oncogenes.
- the detection of somatic alterations may comprise the detection of somatic alterations in known oncogenes.
- known driver mutations may also be detected in BRAF, another known oncogene encoding a protein involved in directing cell growth.
- BRAF another known oncogene encoding a protein involved in directing cell growth.
- driver mutations are described in the art to cause a constitutively active form of BRAF, which is associated with the development of cancer.
- BRAF inhibitors directed to the native and mutated form have been described; see e.g. Wan et al. (2004) Cell 116 (6): 855-67; Tsai et al.
- sorafenib is a small molecular kinase inhibitor drug approved for the treatment of primary kidney cancer (advanced renal cell carcinoma), advanced primary liver cancer (hepatocellular carcinoma), and radioactive iodine resistant advanced thyroid carcinoma. Sorafenib inhibits, inter alia, wild-type and mutant BRAF.
- a further exemplary BRAF inhibitor is vemurafenib, which is a selective inhibitor of the V600E mutated BRAF protein responsible for an aggressive form of melanoma. It has also been shown to be an effective inhibitor of V600K mutated BRAF protein.
- vemurafenib promotes tumor growth; see Hatzivassiliou et al. (2010) Nature 464 (7287): 431-5 or Halaban et al. (2010) Pigment Cell Melanoma Res. 23(2): 190-200.
- classical melanoma diagnosis does not comprise determination of the mutational state of patients with regard to the BRAF oncogene.
- the herein described new model of parallel evolution of cells in the primary tumor and DCC(s) indicates that detection of the mutational state in the primary tumor is insufficient for determination of the best suitable therapy of melanoma patients.
- the herein provided more accurate methods of cancer staging/typing may comprise a step of detecting the mutational state of the BRAF oncogene. Therefore, the present invention relates to a method for staging and/or typing of a cancerous disease, the method comprising the steps of detecting somatic alterations of the DNA of one or more DCC(s) obtained from a tissue sample, in particular one or more lymph node(s); and determining the somatic evolution of the DCC(s) based on the detected somatic alteration(s) in the DNA of the one or more DCC(s), wherein the somatic evolution of the DCC(s) is indicative of the stage/type of the cancerous disease, wherein detection of somatic alterations comprises detection of the nucleotide triplet at positions
- nucleotide triplet guanine at position 171428, tyrosine at position 171429 and guanine at position 171430 of SEQ ID NO:2 is indicative of a non-diseased stage/type
- a nucleotide triplet guanine at position 171428, adenine at position 171429 and guanine at position 171430 of SEQ ID NO:2 is indicative of a diseased stage/type.
- the present invention furthermore relates to a method for treating a cancerous disease, the method comprising the steps of detecting somatic alterations in the DNA of one or more DCC(s) obtained from a tissue sample, in particular one or more lymph node(s); determining the somatic evolution of the DCC(s) based on the detected somatic alteration(s) in the DNA of the one or more DCC(s); and determining the stage/type of the cancerous disease based on the somatic evolution of the cancerous disease determined based on the detected somatic alterations in the DNA of the one or more DCC(s), wherein the stage/type of the cancerous disease is used to initiate, continue or discontinue therapy of said cancerous disease, wherein detection of somatic alterations comprises detection of the nucleotide triplet at positions 171428 to 171430 of SEQ ID NO:2, wherein a nucleotide triplet guanine at position 171428, tyrosine at position 171429 and guanine at position 171430 of SEQ ID
- a nucleotide triplet adenine at position 171428, adenine at position 171429 and guanine at position 171430 of SEQ ID NO:2 and a nucleotide triplet adenine at position 171428, guanine at position 171429 and guanine at position 171430 of SEQ ID NO:2 is used to initiate or continue treatment. It is preferred that treatment comprises the use of an inhibitor of BRAF. Accordingly, treatment preferably comprises the use of sorafenib or vemurafenib. Moreover, it is preferred that the cancerous disease is melanoma.
- the invention furthermore relates to a pharmaceutical composition for use in treating a cancerous disease in a subject, wherein treatment is initiated, continued or discontinued based on the stage/type of the cancerous disease, wherein the stage/type of the cancerous disease is determined by detecting somatic alterations in the DNA of one or more DCC(s) obtained from a tissue sample, in particular one or more lymph node(s) of a subject; determining the somatic evolution of the DCC(s) based on the detected somatic alteration(s) in the DNA of the one or more DCC(s); and determining the stage/type of the cancerous disease based on the somatic evolution of the cancerous disease determined based on the detected somatic alterations in the DNA of the one or more DCC(s), wherein detection of somatic alterations comprises detection of the nucleotide triplet at positions
- nucleotide triplet guanine at position 171428, tyrosine at position 171429 and guanine at position 171430 of SEQ ID NO:2 is used to discontinue treatment and a nucleotide triplet guanine at position 171428, adenine at position
- nucleotide triplet adenine at position 171428, adenine at position 171429 and guanine at position 171430 of SEQ ID NO:2 is used to initiate or continue treatment.
- a nucleotide triplet adenine at position 171428, adenine at position 171429 and guanine at position 171430 of SEQ ID NO:2 and a nucleotide triplet adenine at position 171428, guanine at position 171429 and guanine at position 171430 of SEQ ID NO:2 is used to initiate or continue treatment.
- the pharmaceutical composition comprises an inhibitor of BRAF. Accordingly, it is preferred that the pharmaceutical composition comprises sorafenib or vemurafenib.
- the present invention relates to, inter alia, a pharmaceutical composition comprising a BRAF inhibitor, preferably sorafenib or vemurafenib, for use in treating a cancerous disease in a subject, wherein treatment is initiated, continued or discontinued based on the stage/type of the cancerous disease, wherein the stage/type of the cancerous disease is determined by detecting somatic alterations in the DNA of one or more DCC(s) obtained from a tissue sample, in particular one or more lymph node(s) of a subject; determining the somatic evolution of the DCC(s) based on the detected somatic alteration(s) in the DNA of the one or more DCC(s); and determining the stage/type of the cancerous disease based on the somatic evolution of the cancerous disease determined based on the detected somatic alterations in the DNA of the one or
- nucleotide triplet guanine at position 171428, tyrosine at position 171429 and guanine at position 171430 of SEQ ID NO:2 is used to discontinue treatment and a nucleotide triplet guanine at position 171428, adenine at position
- a nucleotide triplet adenine at position 171428, adenine at position 171429 and guanine at position 171430 of SEQ ID NO:2 and a nucleotide triplet adenine at position 171428, guanine at position 171429 and guanine at position 171430 of SEQ ID NO:2 is used to initiate or continue treatment.
- the cancerous disease is preferably liver cancer, kidney cancer or melanoma. It is more preferred that the cancerous disease is melanoma.
- the invention provides means and methods of treating a cancerous disease, in particular cancer.
- the present invention relates to a method of treating a cancerous disease, in particular cancer, comprising obtaining and analyzing a sample from a patient suspected of having or having a cancerous disease, in particular cancer; wherein analyzing comprises sequencing of the DNA of DCC(s) comprised in the sample; detecting the presence or absence of somatic alterations, in particular genetic and/or epigenetic alterations, in the DNA, wherein the presence of somatic alterations indicates that an effective amount of a pharmaceutical composition has to be administered to the patient.
- the invention furthermore relates to a method of diagnosing a cancerous disease, comprising obtaining and analyzing a sample from a patient suspected of having a cancerous disease, in particular cancer; wherein analyzing comprises sequencing of the DNA of DCC(s) comprised in the sample; detecting the presence or absence of somatic alterations, in particular genetic and/or epigenetic alterations, in the DNA, wherein the presence of somatic alterations indicates a patient has, or is likely to have, a cancerous disease and the absence of somatic alterations indicates the patient does not have, or is not likely to have, a cancerous disease.
- Somatic alterations, in particular genetic alterations, determined in the methods of the present invention may also comprise one or more passenger mutations.
- a passenger mutation is a mutation that has generally no or only little effect on the fitness of a clone but may be associated with a clonal expansion because it occurs in the same genome with a driver mutation.
- passenger mutations may be those mutations that are known to have a higher probability to be found in a genome where a driver mutation occurred or is likely to occur in the future.
- Somatic alterations, in particular genetic or epigenetic alterations, determined in the methods of the present invention may also comprise one or more copy number alterations.
- Copy- number alterations are alterations of the DNA of a genome that result in the cell having an abnormal or, for certain genes, a normal variation in the number of copies of one or more sections of the DNA.
- a copy number alteration may correspond to parts of the genome that have been deleted (fewer than the normal number) or multiplied (more than the normal number).
- Each alteration may correspond to the deletion or gain, in particular duplication, of a genomic region, which may range from about one kilobase (1,000 nucleotide bases) to several megabases (1,000,000 nucleotide bases) in size.
- Copy number alterations have been associated with susceptibility or resistance to disease. For example, gene copy number can be elevated in cells associated with cancer, e.g. in DCCs. Accordingly, copy number alterations may also be determined in the methods of the present invention in order to determine the somatic evolution of a cell, in particular of a DCC. The somatic evolution may then be used to determine the stage/type of a cancerous disease, in particular cancer.
- Particular copy number alterations determined in the methods of the present invention comprise loss of chromosome 9p 11-13, loss of chromosome 9p21-24 and/or gain of chromosome 7q21. Accordingly, the present invention relates to the methods or pharmaceutical compositions of the invention, wherein the somatic alterations of the DNA comprise at least one of the alterations selected from a loss of chromosome 9p 11-13, a loss of chromosome 9p21-24 and gain of chromosome 7q21.
- the number of somatic alterations, in particular genetic and/or epigenetic alterations may also be determined in order to determine the somatic evolution of a cell, in particular a DCC.
- a DCC somatic evolution of a cell
- the overall number of accumulated somatic alterations may also achieve a threshold value, which is indicative of an advanced stage of the cancerous disease, in particular the cancer; see e.g. Shain et al. (2015) N Engl J Med 373; 20: 1926.
- the accuracy of the methods of the present invention may be further increased by using additional parameters to determine the overall somatic evolution of a cell population, in particular DCCs comprised in a lymph node of a subject or derived from other tissue (early) invaded by cancer cells, e.g. bone marrow or brain.
- DCCs comprised in a lymph node of a subject or derived from other tissue (early) invaded by cancer cells, e.g. bone marrow or brain.
- DCCs being organized in small nests of cells rather than isolated cells. Moreover, it was surprisingly found that in xenotransplanation experiments, only mice transplanted with cells, in particular DCCs, derived from lymph nodes of patients in which said cells, in particular
- the threshold value indicative for a high probability that cells accumulated important driver mutations in their genome so that an advanced stage/type of the cancerous disease, in particular cancer is determined to be in the range of about 50 or more, preferably 60, 70, 80, 90 or more, most preferably 100 cells per one million cells in the respective tissue sample.
- a DCCD between about 50 and about 100, preferably between about 60 and about 100, preferably between about 70 and about 100, preferably between about 80 and about 100 and most preferably between about 90 and about 100 is indicative of an advanced stage/type of a cancerous disease, in particular cancer.
- the cell density can be calculated with respect to the overall number of cells in the obtained sample or with respect to another cell population found in the obtained sample.
- the DCC cell population comprised in the tissue sample obtained from a patient is detected using a marker, e.g. EpCAM and/or cytokeratins.
- the DCC cell population comprised in a melanoma tissue sample obtained from a patient is preferably detected using gplOO as a marker.
- alternative DCC markers may also be used, which may cause alternative threshold values corresponding to an advanced stage/type of the cancerous disease, as the person skilled in the art will appreciate. Accordingly, it should be recognized that the determined DCCD in a tissue sample, in particular lymph node sample or bone marrow sample obtained from a patient, which is used as an indicator of the stage/type of a cancerous disease, in particular cancer, can vary based on the method used to determine the cell density.
- gplOO is used as a marker to determine the number of DCCs comprised in the obtained sample, wherein DCCs are gplOO positive.
- the methods of the present invention in addition to determination of somatic alterations, in particular genetic and/or epigenetic alterations, comprised in one or more DCCs obtained from one or more lymph nodes of a patient, comprise a step of determining the DCCD in the lymph node used to obtain the DCCs, in particular the lymph node obtained from a patient.
- the methods of the present invention may further comprise a step of determining the CTCD in order to improve accuracy.
- determining the CTCD in addition to determination of somatic alterations, in particular genetic and/or epigenetic alterations, comprised in one or more CTCs from a patient, in particular retrieved from blood samples or in vivo CTC-capturing-devices, comprise a step of determining the CTC density (CTCD).
- the CTCD is the number of CTCs per one million cells in the blood sample obtained from a patient, or in the case of an in vivo capturing-device by some parameter that relates the CTC number to the filtered blood volume (blood volume or filtering time as surrogate).
- a specific threshold value that may be determined based on the used detection method of CTCs, for example comprising the use of MCSP or EpCAM as a marker, but not limited to this, an advanced stage/type of the cancerous disease may be determined.
- the one or more cell(s), in particular the one or more DCC(s) is/are preferably obtained from one or more lymph node(s).
- Lymph nodes are oval- shaped organs of the lymphatic system, distributed widely throughout the body including the armpit and stomach and linked by lymphatic vessels. Lymph nodes are major sites of B, T, and other immune cells. Lymph nodes are important for the proper functioning of the immune system, acting as filters for foreign particles and cancer cells. Lymph nodes are known to have clinical significance. They become inflamed or enlarged in various infections and diseases, which range from throat infections to cancer.
- the one or more lymph node(s) is/are regional lymph node(s), wherein a regional lymph node is a lymph node close to a site being in a status of developing a disease, in particular a site susceptible to developing a cancerous disease, in particular cancer or a site that has developed a cancerous disease, in particular cancer.
- the regional lymph node is a lymph node anatomically close to a cancer site, for example a tumor.
- the one or more lymph node used in the methods of the invention is/are (a) draining lymph node(s). Draining lymph nodes are lymph nodes to which cells migrate.
- the draining lymph node(s) of a diseased site or a site susceptible of developing a disease is/are the first lymph node(s) invaded by cells migrating from said site.
- lymph node(s) is/are also called sentinel lymph node(s), i.e. the hypothetical first lymph node or group of nodes draining a cancerous disease, in particular a cancer.
- sentinel lymph node/s is/are the target organs primarily reached by metastasizing cancer cells from the tumor.
- sentinel lymph nodes can be totally void of cancer because they were detected prior to dissemination.
- the DCCs used in the methods of the present invention are derived from one or more sentinel lymph node(s) in order to determine whether a subject is susceptible to develop a cancerous disease, in particular cancer, or determine the stage/type of a cancerous disease, in particular cancer.
- sample obtained from one or more lymph node(s) refers to a sample of cells, tissue or fluid that is removed from a subject for the purpose of determining if the sample contains cancerous tissue, in particular DCC(s), and/or for determining the somatic evolution of said cells.
- sample is obtained because a subject is suspected of having cancer due to an earlier diagnosis and/or a predisposition.
- the sample may then also be examined for the presence or absence of cancer, cancer stem cells, and/or cancer stem cell gene signature expression using methods known in the art.
- the lymph node samples used in the methods of the present invention may be obtained by lymph node biopsy, for example needle biopsy or open biopsy as described in the art; see e.g. Chang KL et al. (2009) Modern Surgical Pathology. 2nd ed. Philadelphia, PA: Saunders Elsevier; 2009:chap 41.
- the term “subject” refers to any animal (e.g., a mammal), including, but not limited to, humans, non-human primates, rodents, and the like, which is to be the recipient of a particular treatment.
- the terms “subject” and “patient” are used interchangeably herein in reference to a human subject. Accordingly, it is preferred that the one or more DCC(s) are obtained from a human subject, more preferred a human patient, wherein the subject/patient may be suspected of having cancer or may be susceptible to a cancerous disease, in particular cancer.
- the term "subject suspected of having cancer” or "patient susceptible to a cancerous disease” refers to a subject/patient that presents one or more symptoms indicative of a cancer (e.g., a noticeable lump or mass) or is being screened for a cancer (e.g., during a routine physical).
- a subject suspected of having cancer or a patient susceptible to a cancerous disease, in particular cancer can also have one or more risk factors.
- a "subject suspected of having cancer” or “patient susceptible to a cancerous disease” encompasses an individual who has received an initial diagnosis but for whom the stage of cancer is not known. The term further includes people who once had cancer (e.g., an individual in remission).
- the term also refers to a subject with one or more risk factors for developing a specific cancer. Risk factors include, but are not limited to, gender, age, genetic predisposition, environmental exposure, previous incidents of cancer, preexisting non-cancer diseases, and lifestyle.
- the methods of the present invention are for staging and/or typing and/or predicting outcome and/or treating a cancerous disease, in particular cancer.
- the type of cancerous disease is not particularly limited as long as the disease involves the dissemination of cells from a primary disease site into lymph node(s) and/or other tissue, for example bone marrow.
- dissemination relates to the process of migration by active migration or passive transport by body fluids from a primary disease site to a secondary site, for example a lymph node or bone marrow or blood.
- the methods of the present invention are for staging/typing of a cancerous disease, in particular a cancerous disease involving dissemination of cells, preferably involving lymphatic dissemination.
- solid cancer refers to one or more cells which are growing or have grown in an uncontrolled manner to form cancer tissue.
- solid cancer includes, but is not limited to “carcinomas”, “adenocarcinomas” and “sarcomas”.
- “Sarcomas” are cancers of the connective tissue, cartilage, bone, muscle, and the like.
- Carcinomas are cancers of epithelial (lining) cells.
- “Adenocarcinoma” refers to carcinoma derived from cells of glandular origin.
- cancer and tumor are used interchangeably throughout the subject specification.
- Solid cancers may arise in nearly any tissue of the body and the methods of the present invention may be used for staging and/or typing and/or predicting outcome and/or treating of any of these cancers.
- Exemplary "solid cancers" which may be staged and/or typed and/or whose outcome may be predicted and/or which may be treated in accordance with the present invention include acoustic neoma, adenocystic carcinoma, adrenocortical cancer, alveolar soft-part sarcoma, anal cancer, angiosarcoma, basal cell carcinoma (bcc), bladder cancer, bone cancers, bowel cancer, brain stem glioma, breast cancer, CNS cancers, carcinoid cancers, cervical cancer, childhood brain cancers, childhood soft tissue sarcoma, chondrosarcoma, choriocarcinoma, colorectal cancers, dermatofibrosarcoma-protuberans, desmoplastic small round cell cancer, ductal carcinoma,
- the present invention relates to a method for staging and/or typing of melanoma, said method comprising the steps of detecting somatic alterations of the DNA of one or more DCC(s) obtained from one or more lymph node(s); and determining the somatic evolution of the DCC(s) based on the detected somatic alteration(s) in the DNA of the one or more DCC(s), wherein the somatic evolution of the DCC(s) is indicative of the stage/type of melanoma.
- the present invention relates to a method for treating melanoma, said method comprising the steps of detecting somatic alterations in the DNA of one or more DCC(s) obtained from lymph node(s) of a patient; determining the somatic evolution of the DCC(s) based on the detected somatic alteration(s) in the DNA of the one or more DCC(s); and determining the stage/type of melanoma of said patient based on the somatic evolution of melanoma determined based on the detected somatic alteration(s) in the DNA of the one or more DCC(s), wherein the stage/type of melanoma is used to initiate, continue or discontinue melanoma therapy.
- the present invention relates to a therapeutic intervention, preferably a pharmaceutical composition, for use in treating melanoma in a patient, wherein treatment is initiated, continued or discontinued based on the stage/type of melanoma, wherein said stage/type of melanoma is determined by detecting somatic alterations in the DNA of one or more DCC(s) obtained from lymph node(s) or liquor (preferably form lymph node(s), more preferably from a sentinel lymph node) of said patient; determining the somatic evolution of the DCC(s) based on the detected somatic alteration(s) in the DNA of the one or more DCC(s); and determining the stage/type of melanoma of said patient based on the somatic evolution of melanoma determined by detecting somatic alterations in the DNA of one or more DCC(s) obtained from lymph node(s) or liquor of said patient.
- a therapeutic intervention preferably a pharmaceutical composition
- the invention relates to a method for staging and/or typing of melanoma, said method comprising the steps of detecting somatic alterations of the DNA of one or more CTC(s) obtained from blood; and determining the somatic evolution of the CTC(s) based on the detected somatic alteration(s) in the DNA of the one or more CTC(s), wherein the somatic evolution of the CTC(s) is indicative of the stage/type of melanoma.
- in vivo CTC-capturing-devices may be used for obtaining the CTCs from blood.
- the present invention relates to a method for treating melanoma, said method comprising the steps of detecting somatic alterations in the DNA of one or more CTC(s) obtained from blood of a patient; determining the somatic evolution of the CTC(s) based on the detected somatic alteration(s) in the DNA of the one or more CTC(s); and determining the stage/type of melanoma of said patient based on the somatic evolution of melanoma determined based on the detected somatic alteration(s) in the DNA of the one or more CTC(s), wherein the stage/type of melanoma is used to initiate, continue or discontinue melanoma therapy.
- the present invention relates to a pharmaceutical composition for use in treating melanoma in a patient, wherein treatment is initiated, continued or discontinued based on the stage/type of melanoma, wherein said stage/type of melanoma is determined by detecting somatic alterations in the DNA of one or more CTC(s) obtained from blood of said patient; determining the somatic evolution of the CTC(s) based on the detected somatic alteration(s) in the DNA of the one or more CTC(s); and determining the stage/type of melanoma of said patient based on the somatic evolution of melanoma determined by detecting somatic alterations in the DNA of one or more CTC(s) obtained from blood of said patient.
- the methods of the present invention comprise a step of detecting somatic alterations of the DNA of one or more DCC(s) or CTC(s), respectively, obtained from a tissue sample, in particular a lymph node sample or bone marrow sample or blood.
- a tissue sample in particular a lymph node sample or bone marrow sample or blood.
- somatic alterations may comprise epigenetic and/or genetic alterations.
- epigenetic alterations the person skilled in the art is well-aware of methods capable of detecting epigenetic alterations with regard to a reference sample or with regard to a reference standard known in the art.
- epigenetic alterations to be detected in the DNA of one or more DCC(s) may include methylation, in particular methylation of CpG(s), deficiencies of DNA repair proteins, and/or alterations in histone architecture or structure like methylation, acetylation, sumoylation, activating or inactivating histone marks and/or alterations in chromatin architecture like for example in eu- or hetero- chromatin and the like. Accordingly, in the methods of the present invention a step of DNA methylation analysis may be included.
- Methylation of the 5' carbon of cytosine is a form of epigenetic modification that does not affect the primary DNA sequence, but affects secondary interactions that play a critical role in the regulation of gene expression. Aberrant DNA methylation may suppress transcription and subsequently gene expression. Methylation analysis as in the methods of the present invention may comprise selective modification of the target DNA.
- Such modification may comprise the addition of methylation-dependent restriction enzymes (MDREs) or methylation-sensitive restriction enzymes (MSREs), preferably MDREs.
- MDREs methylation-dependent restriction enzymes
- MSREs methylation-sensitive restriction enzymes
- Selective modification of the target DNA may also comprise addition of a chemical agent that is able to selectively differentiate between methylated or unmethylated nucleotides.
- methylation analysis as employed in the methods of the present invention may be able to selectively identify methylated cytosines that may later be read-out using methods known in the art, e.g. methods described in WO 2015/118077 or WO 2000/017390.
- treatment with bisulfite is known to convert unmethylated cytosines (C) to uracil (U) while methylated cytosines are not converted (Frommer et al. 1992. Proc. Natl. Acad.Sci. USA 89, 1827-1831).
- Sequencing of DNA subsequent to treatment with bisulfite may be used to identify methylated nucleotides, in particular cytosines.
- Treatment with MDREs leads to methylation-dependent restriction of DNA fragments, while treatment with MSREs leads to methylation-dependent inhibition of restriction.
- Sequencing of DNA subsequent to MDRE/MSRE restriction in addition to Msel restriction may be used to identify methylated nucleotides, in particular cytosines.
- chromatin immunoprecipitation ChIP
- ChIP chromatin immunoprecipitation
- Related Techniques such as ChlP-chip, ChlP-PET, ChlP-Seq, MeDIP, DamID or the like; see Minard et al. (2009) Genesis 47(8), pp.559-72 and references cited therein.
- methylation of DNA may genome-wide be detected using MeDIP, MeDIP-chip or MeDIP-seq.
- Exemplary protocols comprise steps of subjecting purified DNA to sonication to shear it into random fragments.
- the resulting fragments may range from 300 to 1000 base pairs (bp) in length, preferably between 400 and 600 bp.
- the DNA fragments are then denatured to produce single-stranded DNA. Following denaturation, the DNA is incubated with 5-methylcytosine (5-mC) antibodies available in the art.
- 5-methylcytosine (5-mC) antibodies available in the art.
- the classical immunoprecipitation technique is then applied: magnetic beads conjugated to anti-mouse-IgG are used to bind the anti-5mC antibodies, and unbound DNA is removed in the supernatant.
- proteinase K is added to digest the antibodies and release the DNA, which can be collected and prepared for DNA detection. Subsequent DNA detection is done using methods described further below for detection of genetic alterations.
- a fraction of the input DNA obtained after the sonication step above is labeled with cyanine-5 (Cy5; red) deoxy-cytosine -triphosphate while the methylated DNA, enriched after the immunoprecipitation step, is labeled with cyanine-3 (Cy3; green).
- the labeled DNA samples are cohybridized on a 2-channel, high-density genomic microarray to probe for presence and relative quantities. The purpose of this comparison is to identify sequences that show significant differences in hybridization levels, thereby confirming the sequence of interest is enriched, i.e. methylated.
- MeDIP-seq the coupling of MeDIP with next generation, short-read sequencing technologies such as 454 or Illumina sequencing.
- the high-throughput sequencing of the methylated DNA fragments produces a large number of short reads (36-50 bp or 400 bp, depending on the technology).
- the short reads are aligned to a reference genome using alignment software such as Mapping and Assembly with Quality (Maq) which uses a Bayesian approach, along with base and mapping qualities to model error probabilities for the alignments.
- the reads can then be extended to represent the -400 to 700 bp fragments from the sonication step.
- the coverage of these extended reads can be used to estimate the methylation level of the region.
- a genome browser such as ENSEMBL can also be used to visualize the data.
- Validation of the approach to assess quality and accuracy of the data can be done using, inter alia, quantitative PCR This is done by comparing a sequence from the MeDIP sample against an unmethylated control sequence. The samples are then run on a gel and the band intensities are compared. The relative intensity serves as the guide for finding enrichment.
- ChIP techniques may also be used to detect other epigenetic alterations, such as histone modifications or modifications relating to other proteins bound to DNA.
- epigenetic alterations such as histone modifications or modifications relating to other proteins bound to DNA.
- Such techniques are known in the art and extensively described in various standard reference books, such as "Chromatin Immunoprecipitation Assays - Methods and Protocols" by Philippe Collas, Humana Press (2009).
- the person skilled in the art is well-aware that other techniques may also be applied to detect epigenetic alterations of DNA. Accordingly, in the methods of the present invention, any technique suitable for detecting such modifications, in particular epigenetic alterations, may be applied.
- next generation sequencing techniques as marketed by Illumina ® are known to the person skilled in the art and are suitable for detecting epigenetic alterations such as methylation, in particular combined with further techniques such as next-generation sequencing, in particular methylation sequencing; and/or for detecting protein-DNA interactions, techniques such as chromatin immunoprecipitation (ChIP) and/or ChIP combined with next-generation sequencing, in particular ChlP-Seq (for example using protocols available for Illumina® sequencing machines).
- Chrin immunoprecipitation ChIP
- ChIP chromatin immunoprecipitation
- a preferred example of a method suitable for isolated and/or simultaneous detection of epigenetic and/or genetic alterations is a method comprising the steps of providing a sample comprising DNA, in particular a sample derived from one or more lymph node(s) or a bone marrow sample comprising one or more DCC(s) or CTC(s); adding an agent to said DNA that selectively recognizes epigenetically modified nucleic acids, in particular methlylated nucleic acids, e.g.
- sequence information obtained in the last step of the above described method may be used to simultaneously detect genetic alterations.
- the obtained sequence information may, for example, be used in methods for DNA sequence analysis like whole genome sequencing, whole exome sequencing, whole regulome sequencing, sequencing-based methylation analysis, sequencing-based breakpoint detection, ChIP sequencing, or targeted sequencing and variations thereof.
- the methods of the present invention comprise a step of detecting somatic alterations of the DNA of one or more DCC(s) or CTC(s), respectively, obtained from a tissue or body fluid sample, in particular a lymph node sample or bone marrow sample or liquor (in the case of DCC(s)), or blood (in the case of CTC(s)), respectively.
- a tissue or body fluid sample in particular a lymph node sample or bone marrow sample or liquor (in the case of DCC(s)), or blood (in the case of CTC(s)), respectively.
- any method may be employed within the context of the present invention. However, it is preferred to use methods which are fast, efficient, reliable and only require low input amounts. This is particularly important for detecting DCCs or CTCs in an early phase of cancer spread where only one single cell may be present in a tissue or body fluid sample, in particular a lymph node sample or bone marrow sample or liquor sample, or blood respectively.
- sequencing methods known in the art may be employed that are particularly suitable for sequencing of low amounts of input DNA, e.g. as described in Mardis (2008) Annu Rev Genomics Hum Genet 9, 387-402.
- a preferred method to be employed in the present invention is a DNA sequencing method comprising the use of endonucleases, oligonucleotides specifically recognizing overhangs created by the endonucleases and further oligonucleotides for amplification.
- the oligonucleotides may, for example, comprise barcode sequences in order to distinguish between fragments generated by the endonucleases and in order to generate an internal sequencing reference for error-free sequencing.
- An exemplary and preferred method for DNA sequencing comprises the steps of providing a sample comprising DNA, in particular a sample derived from one or more lymph node(s) or a bone marrow sample or a liquor or blood sample comprising one or more DCC(s) or CTC(s); digesting the DNA with a restriction endonuclease under conditions suitable to obtain DNA fragments of similar length, wherein said restriction endonuclease is capable of providing 5' overhangs, wherein the terminal nucleotide of the overhang is phosphorylated or, wherein said restriction endonuclease is capable of providing 3' overhangs, wherein the terminal nucleotide of the overhang is hydroxylated on said DNA fragments; annealing a first oligonucleotide to said DNA fragments, wherein a first sequence of said first oligonucleotide is complementary to the 5 ' or 3 ' overhang, respectively, of said DNA fragment, and a second sequence of said first oligonucle
- the methods of the present invention comprise a step of determining the somatic evolution based on the detected somatic alterations.
- the somatic evolution is determined based on the accumulated somatic alterations during the lifetime of a cell, in particular a DCC or CTC, preferably comprising further parameters such as the DCCD/CTCD.
- the somatic evolution may be determined and the stage/type of the cancerous disease, in particular cancer, may be determined, treatment methods may be adjusted and the like.
- the person skilled in the art will appreciate how to express the determined stage/type of a cancerous disease, using, for example, letter codes, number codes or the like.
- Figure 1 Dissemination of melanoma cells as function of tumor thickness
- Continuous line Weibull distribution incorporating a fraction of patients without long-term dissemination (95% CI lower dashed lines).
- Upper dashed line only 63.5% of melanomas disseminate lymphatically (95% CI 53.5-73.4 %). Fifty percent of this value (31.75%) provides the median thickness (0.40 mm, 95% CI 0.04- 0.75 mm) of disseminating melanomas (straight dashed line).
- Figure 2 gplOO-positive cells from SLNs display multiple CNAs.
- E Percentage of patients with homogeneous (all cells harboring the mutation) and heterogeneous BRAF NRAS mutational status among DCCs. DCCs were detected using two markers, gplOO or MCSP.
- FIG. 5 Colonization-associated changes in DCCs.
- D Colonization signature (genetic loci identified in Figure 5 A-C), BRAF and NRAS mutational status of patient-derived DCCs and their respective xenografts.
- Figure 7 Model of melanoma progression from local to metastatic disease
- FIG. 8 CGH profiles of 30 control cells isolated from blood, lymph node or bone marrow. Cells were identically isolated and amplified as gplOO-positive cells. All chromosomes are depicted. In some cases, we used sex-mismatch control DNA to demonstrate successful hybridization. Colored bars indicate relative gains or losses of the X- chromosome (red, underrepresentation in test cells; green, overrepresentation in test cells) bars next to the ideogram. Chromosomal regions (centromeric regions) marked by gray bars are excluded from analysis as they contain repetitive regions. All cells displayed normal genomes.
- Paraffin-blocks of primary tumors could be received from external dermatologists. (Note, that acquisition of primary tumors is extremely difficult as almost all patients are operated outside of the University hospital).
- Figure 12 Oncogenic mutations in BRAF and NRAS of paired primary tumors and DCCs. Squares indicate areas (PT) or individual cells (DCCs). Black filled squares indicate that the mutation was detected and white filled squares indicate wild type sequence. Blue and red filled squares indicate NRASmut Q61K and NRASmut Q61R, respectively. Grey lined squares indicate samples of which no sequence could be obtained.
- Figure 13 (A) Top: Lowest FDR-adjusted p-values that identify genetic loci separating DCCs (n 30) from patients with DCCD ⁇ 19 into two groups according to observed PT thickness.
- Figure 14 Xenotransplantation of single cells and spheres from melanoma cell lines.
- Xenograft from LN 154 was erroneously FFPE-fixed and could not be analysed thereafter.
- the y-axis cut- off was set according to the highest percentage of PD-1 high expressing CD8 T cells in control lymph nodes. At a DCCD > 2000 a significantly increased number of samples showed a higher percentage of PD-1 high expressing CD8 T cells than in healthy controls (y-axis cut off; p ⁇ 0.004, fisher's exact test).
- the flowcytometric dot plots illustrate representative examples of PD-1 and Tim-3 expression in lymph nodes with a DCCD ⁇ 2000 and a DCCD > 2000
- C Single cell suspensions of lymph nodes were stimulated with PMA/ionomycin and the percentage of TNF and IFNg expressing PD-1 high and PD-1 intermediate expressing CD8 T cells and their respective median fluorescence intensity (MFI) for TNF and INFg was determined by flowcytometry.
- PD-1 high cells show a reduced percentage of IFNg and TNF producing cells as well as a reduced MFI for both cytokines.
- Unstimulated CD8 T cells were used as control and were found to be negative for TNF and IFNg production.
- the IFNg or TNF score combines the ratio of the percentage of PD-1 intermediate plus negative CD8 T cells to PD-1 high CD8 T cells multiplied with the ratio of the percentage of cytokine producing PD-1 high to PD-1 intermediate CD8 T cells and the ratio of the median cytokine fluoresence intensity of cytokine expressing PD-1 high CD8 T cells to the median fluoresence intensity of PD-1 intermediate expressing cells.
- IFNg score ratio % CD8 PD-1 int+neg/%PD-l high x % IFNg PD-1 high/% IFNg PD-1 int cells x ratio MFI IFNg+ cells of PDlhi/ MFI IFNg+ cells of PD-1 int CD8 T cells. The lower the score the more PD-1 high CD8 T cells with reduced IFNg or TNF secretion are present. Lymph nodes from healthy controls (patients without cancer) were used as a control.
- Figure 16 Colonization is associated with an increase in MDSCs and a decrease in cytolytic NK cell numbers
- the respective DCCD of each lymph node is given and the ratio of the percentage of CD56 bnght over cytolytic CD56 dim cells is shown. A decrease in the ratio indicates a reduction in the percentage of cytolytic CD56 im cells versus non-cytolytic CD56 bright NK cells.
- Tl and T4 melanomas employs primary tumor tissue. It assumes that the molecular characteristics of metastasis-initiating DCCs can be identified within the primary tumor, because primary tumors and DCCs are thought to be largely identical. To test this assumption, investigated the genomic profiles of primary tumors and their matched DCCs was investigated.
- DCCs from thick melanomas could harbor characteristic alterations responsible for the prognostic relevance of high T stage, which are absent in DCCs from thin melanomas. Therefore, a focus was set on DCCs before evident lymph node colonization as being representative of the time of arrival and their genomic profile was investigated.
- Ki-67 expression was assessed in 37 nodes with DCCD ⁇ 100 (Group A) and 21 nodes with DCCD>100 (Group B) involving evaluation of 937 cells in total.
- Group A the number of nodes with DCCD ⁇ 100 (Group A) and 21 nodes with DCCD>100 (Group B) involving evaluation of 937 cells in total.
- Cancer cells forming a lymph node colony displayed a characteristic signature of alterations.
- DCCs were transplanted into NSG-mice.
- First conditions for xenotransplantation of rare melanoma cells were evaluated (Quintana (2008) Nature 456, 593-598).
- two approaches were compared: direct transplantation of groups of DCCs and transplantation of DCC-spheres after brief culture under melanosphere conditions.
- Melanospheres formed tumors in immunodeficient NSG mice more frequently than groups of single cells (p ⁇ 0.0001, log-rank test; Figure 6 A, B and Figure 14).
- PD-1 is induced on T cells in response to T cell activation, but is down-regulated once the immune response has eliminated the antigen. If the antigen does not vanish, as is the case during chronic viral infections, PD-1 is not downregulated and T cells lose effector functions in a hierarchical manner: IL-2 production, high proliferative capacity and cytolytic activity are lost first, followed by impaired cytokine production.
- PD-1 is induced on T cells in response to T cell activation, but is down-regulated once the immune
- the IFNg or TNF score combines the ratio of the percentage of PD-1 intermediate and negative CD8 T cells to PD-1 high CD8 T cells multiplied with the ratio of the percentage of cytokine producing PD-1 high to PD-1 intermediate CD8 T cells and the ratio of the median cytokine fluorescence intensity of cytokine expressing PD-1 high CD8 T cells over the median fluorescence intensity of PD-1 intermediate expressing cells.
- a decrease in the score indicates an increased number of exhausted CD8 T cells and consequently a loss of CD8 T cell function.
- the melanoma cell lines A375 and MelHo were used (obtained from the Leibniz Institute DSMZ-German Collection of Microorganisms and Cell cultures). MelHo is listed in the ICLAC-database for mis-identified cell lines due to unclear patient-origin, but was used as the cell line is heterogenic for the exon 15 mutation cl799T>A (BRAF). The origin of the cell lines was verified by short tandem repeat (STR) analysis (Cell-IDTM, Promega).
- STR short tandem repeat
- the cell lines 70-61 and 102-4 were developed from DCC-derived xenografts and are exon 15 mutation cl799T>A (BRAF) and exon 3 mutation cl81C>A (NRAS) mutated, respectively, as determined by Sanger sequencing (Sequiserve, Vaterstetten, Germany). Their patient-origin was verified by short tandem repeat (STR) analysis (Cell-IDTM, Promega), their melanoma- origin by a human pathologist and their aberrant genotype by CGH. A375 and MelHo were maintained in DMEM, 10%FCS, 0.5 x Pen/Strep; 102-4 and 70-61 in RPMI, 10% FCS, 0.5xPen/Strep. All cell lines were routinely tested for mycoplasma and were found to be negative.
- STR short tandem repeat
- lymphatic tissue was cut into 1-mm pieces and disaggregated mechanically into a single-cell suspension by rotating knives (DAKO Medimachine, DAKO), washed with HBSS (Life Technologies, Heidelberg, Germany) and centrifuged on a density gradient made of a 60% Percoll solution (Amersham, Uppsala, Sweden). Cells were counted using a Neubauer counting chamber.
- MCSP + cells were isolated using a micromanipulator (Eppendorf PatchMan NP2) and transplanted.
- Single cells of disaggregated lymph nodes were stained with viability dye eFlour 780 (ebioscience) for live/dead cell discrimination.
- viability dye eFlour 780 ebioscience
- To reduce non-specific binding single cell suspensions were incubated for 10 min at 4°C with PBS/10% AB-serum (Bio-Rad, subsequently stained with fluorescence-labeled antibodies for 30 min at 4°C, washed two times with PBS/2% FCS/0.01% NaN 3 and fixed with Fluoro-Fix buffer (Biolegend).
- Cells were analyzed on a LSR II machine equipped with FACS DIVA 5.03 software (BD Bioscience,) and data was analyzed with FloJo 8.8.6 (Treestar). The cells were stained using the following antibodies (Biolegend).
- NK cell identification CD45 (HI30), CD3 (Sk7), CD56 (HDC56), CD 161 (HP-3610).
- CD8 T cell identification CD45 (HI30), CD3 (Sk7), CD8 (HIT8a), CD45RA (HI 100), CCR7 (G043H7), PD-1 (EH12.2H7), Tim-3 (F38-2E3), TNF (Mabl l), IFNg (4S.B3).
- single cells of disaggregated lymph nodes were stimulated for 4 hours with PMA (lOng/ml, Sigma) and ionophore (1 ⁇ g/ml, Sigma) in the presence of lxBrefeldin A (Biolegend).
- Single cells of disaggregated lymph nodes were stained with viability dye eFlour 780 (ebioscience) for live/dead cell discrimination.
- Spheres or MCSP + cells from disaggregated sentinel lymph nodes were collected using a micropipettor or micromanipulator and pooled in a microwell (volume 10-15 ⁇ , Terasaki). Micro wells were pre-coated over night with 12 mg/mL poly-HEMA (Sigma-Aldrich) at RT. Single cells were transplanted in a final volume of 30 ⁇ and 25% high-concentration matrigel (BD Biosciences) as published before (Quintana (2008) Nature 456, 593-598).
- mice were injected with an insulin syringe (Microfme, 29G, U-50, BD Biosciences) sub-cutaneously into NOO.Cg-Prkdc scid ILlriTMTM 3'1 ⁇ (NSG, 6-8 weeks old, males and females). Mice were purchased from the Jackson Laboratory and maintained under specific-pathogen free conditions, with acidified water and food ad libitum in the research animal facilities of the University of Regensburg, Germany. All approved experimental animal procedures were conducted to German federal and state regulations. Mice were palpated every week at the site of injection.
- insulin syringe Macrofme, 29G, U-50, BD Biosciences
- STR short tandem repeat
- the PALM Microbeam system (Bernried) was used for microdissection and catapulting. DNA was processed as previously described (Klein (2002) Lancet 360, 683- 689; Klein (2002) J Exp Med 196, 359-368).
- NRAS and BRAF genes were detected using Sanger sequencing (Sequiserve, Vaterstetten, Germany) after gene specific amplification from WGA samples.
- the primers for BRAF exon 15 analysis were as follows: forward 5 ⁇ -TCC AGAC AACTGTTC AAACTG and reverse 5 ⁇ -CTCTTC ATAATGCTTGCTCTG, encompassing the mutations of codon 600 (V600E, previously called V599E; V600K, V600R).
- PCR primers for NRAS exon 3 codon 61 analysis were: forward 5 ⁇ -GGC AAAT AC AC AGAGGAAGC and reverse 5 ' - ACCCCCAGGATTCTTACAGA encompassing the common mutations of codon 61 : Q61K and Q61R.
- the PCR cycler was set to 94 °C (2 min), 63 °C (30 sec) and 72 °C (2 min) for one cycle; 94 °C (15 sec), 63 °C (30 sec) and 72 °C (20 sec) for 14 cycles; 94 °C (15 sec), 63 °C (30 sec) and 72 °C (30 sec) for 24 cycles and an additional final extension step at 72 °C (2 min).
- PCR products were sent for sequencing to Sequiserve, Vatterstetten.
- the mutation assay was established using single cells or genomic DNA of cell lines with known exon 15 mutation cl799T>A (BRAF) and exon 3 mutation cl81C>A (NRAS).
- the mutant BRAF allele was detected in 62% (70-61), 84% (MelHo) of detected sequences over all analyzed single cells and in 61% (70-61) and 86% (MelHo) in bulk genomic DNA.
- the mutation NRAS allele was present in 59% of all single cells and 46% of the bulk genomic DNA.
- the number of samples with a DCCD>100 increased with tumor thickness as a Weibull cumulative distribution function with a median of 8.9 mm (95% CI 6.8 to 14.3 mm), i.e. 22 times higher than the median thickness at seeding (Fig. 1C).
- the obtained estimate is fitted by a Weibull distribution.
- Explicit formulas for the Weibull distribution were used to calculate the hazard rates.
- the hazard function describes the instantaneous risk per unit thickness for an event (dissemination, colonization) for those tumors, for which the event has not yet occurred. For example, the hazard rate of 1 per mm (0.2 per mm) indicates that the tumor needs to grow 1 mm (5 mm, respectively) on average for the event to occur.
- DCCD- and thickness thresholds associated with low p-values might indicate primary tumor sizes and genomic alterations that facilitate direct dissemination to lymph nodes.
- CNAs and specific mutations were acquired in the primary irrespective of the notion that some aberrations (shared or not shared) remained undetected by our approach.
- CNAs were analyzed as they best reflect cancerous progression as opposed to point mutations (Bauer (2006) Dermatologic therapy 19, 40-49; Shain (2015) The New
- DCCs were analyzed before colony formation from patients with thick melanomas. They were compared with pre-colonizing DCCs from thin melanomas, but no differentiating CNAs could be identified. Also the number of CNAs did not differ between pre-colonizing DCCs from thin vs. thick melanomas.
- DCCD- 100 was further associated with colony formation in the lymph node and significant increase in mean Ki-67 proliferation index from 11% (DCCD ⁇ 100) to 22% (DCCD>100), confirming basal proliferation and indicating the acquisition of advantageous changes.
- BRAF mutations are found in DCCs at colony formation in sentinel lymph nodes but rarely before. Although benign nevi harbor BRAF mutant cells in 70-88% (Pollock (2003) Nature genetics 33, 19-20; Shain (2015) The New England journal of medicine 373, 1926-1936), it is unclear whether BRAF mutations (or generally MAPK pathway mutations) initiate melanoma and are transmitted linearly. Several reasons argue against this scenario for many melanomas. First, primary tumors display generally lower rates of BRAF mutations than benign nevi (40% vs.
- VGP melanomas expand in the dermis i.e. become tumorigenic
- they often acquire BRAF mutations (Dong (2003) Cancer research 63, 3883-3885; Verlinden (2014) Medicine 93, e285), and increase their proliferation rate - with Ki-67 frequencies of >20% being a marker of poor outcome (Gimotty (2005) Journal of clinical oncology : official journal of the American Society of Clinical Oncology 23, 8048-8056).
- DCCs in SLN and possibly other metastatic sites re-capitulate this process during colonization.
- Tl melanomas are mostly cured by surgery (Balch (2009) Journal of clinical oncology : official journal of the American Society of Clinical Oncology 27, 6199-6206) strongly supports proliferation-stimulating factors secreted more abundantly by thick melanomas, which then promote the acquisition of genetic changes required for colony formation.
- Formal proof of this scenario would require model systems that enable genomic in vitro progression of immature to mature cancer cells triggered by supporting factors. Such models are currently not available. Unstimulated and consequently slow in vivo progression over years as observed in some patients may account for late recurrences (Ossowski (2010) Pigment cell & melanoma research 23, 41-56) and argue at least partially for a lead-time effect.
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Immunology (AREA)
- Analytical Chemistry (AREA)
- Pathology (AREA)
- Genetics & Genomics (AREA)
- Wood Science & Technology (AREA)
- General Health & Medical Sciences (AREA)
- Oncology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- Microbiology (AREA)
- Hospice & Palliative Care (AREA)
- Biochemistry (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Veterinary Medicine (AREA)
- Medicinal Chemistry (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Pharmacology & Pharmacy (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- General Chemical & Material Sciences (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Investigating Or Analysing Biological Materials (AREA)
- Peptides Or Proteins (AREA)
- Medicines Containing Material From Animals Or Micro-Organisms (AREA)
Priority Applications (8)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201780008861.6A CN108770360B (zh) | 2016-01-27 | 2017-01-27 | 对癌性疾病进行分期、分型和治疗的手段和方法 |
| AU2017211976A AU2017211976B2 (en) | 2016-01-27 | 2017-01-27 | Means and methods for staging, typing and treating a cancerous disease |
| KR1020187024606A KR20180102674A (ko) | 2016-01-27 | 2017-01-27 | 암 질환의 단계 구분, 유형 분류 및 치료를 위한 수단 및 방법 |
| CA3012404A CA3012404A1 (en) | 2016-01-27 | 2017-01-27 | Means and methods for staging, typing and treating a cancerous disease |
| JP2018539138A JP2019508032A (ja) | 2016-01-27 | 2017-01-27 | がん性疾患をステージング、タイピングおよび処置するための手段および方法 |
| SG11201805990XA SG11201805990XA (en) | 2016-01-27 | 2017-01-27 | Means and methods for staging, typing and treating a cancerous disease |
| US16/073,271 US11702701B2 (en) | 2016-01-27 | 2017-01-27 | Means and methods for staging, typing and treating a cancerous disease |
| EP17706412.8A EP3408411A1 (en) | 2016-01-27 | 2017-01-27 | Means and methods for staging, typing and treating a cancerous disease |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| EP16152883.1 | 2016-01-27 | ||
| EP16152883.1A EP3199641B1 (en) | 2016-01-27 | 2016-01-27 | Means and methods for staging, typing and treating a cancerous disease |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2017129753A1 true WO2017129753A1 (en) | 2017-08-03 |
| WO2017129753A8 WO2017129753A8 (en) | 2017-10-19 |
Family
ID=55310656
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/EP2017/051789 Ceased WO2017129753A1 (en) | 2016-01-27 | 2017-01-27 | Means and methods for staging, typing and treating a cancerous disease |
Country Status (10)
| Country | Link |
|---|---|
| US (1) | US11702701B2 (https=) |
| EP (2) | EP3199641B1 (https=) |
| JP (1) | JP2019508032A (https=) |
| KR (1) | KR20180102674A (https=) |
| CN (1) | CN108770360B (https=) |
| AU (1) | AU2017211976B2 (https=) |
| CA (1) | CA3012404A1 (https=) |
| ES (1) | ES2905208T3 (https=) |
| SG (1) | SG11201805990XA (https=) |
| WO (1) | WO2017129753A1 (https=) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US11040027B2 (en) | 2017-01-17 | 2021-06-22 | Heparegenix Gmbh | Protein kinase inhibitors for promoting liver regeneration or reducing or preventing hepatocyte death |
Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2000017390A1 (en) | 1998-09-18 | 2000-03-30 | Micromet Ag | Dna amplification of a single cell |
| WO2002037113A2 (en) | 2000-11-03 | 2002-05-10 | Michael Giesing | Clinical and functional validation of targets from disseminated cancer cells |
| EP2503009A1 (en) | 2011-03-25 | 2012-09-26 | Massimo Zollo | Biomarker for detecting circulating tumor cells and related detecting methods and kit |
| WO2013009632A2 (en) * | 2011-07-08 | 2013-01-17 | The University Of Utah Research Foundation | Methods of detecting hereditary cancer predisposition |
| US20130149704A1 (en) * | 2011-12-10 | 2013-06-13 | Abbott Molecular Inc. | Materials and methods for diagnosis of malignant melanoma and prognosis of metastasis of malignant melanoma |
| WO2015023553A2 (en) * | 2013-08-13 | 2015-02-19 | Bionumerik Pharmaceuticals, Inc. | Contemporaneous, heterogeneously-oriented, multi-targeted therapeutic modification and/or modulation of disease by administration of sulfur- containing, amino acid-specific small molecules |
| WO2015118077A1 (en) | 2014-02-05 | 2015-08-13 | Fraunhofer-Gesellschaft zur Förderung der angewandten Forschung e.V. | Error-free sequencing of dna |
-
2016
- 2016-01-27 EP EP16152883.1A patent/EP3199641B1/en active Active
- 2016-01-27 ES ES16152883T patent/ES2905208T3/es active Active
-
2017
- 2017-01-27 AU AU2017211976A patent/AU2017211976B2/en active Active
- 2017-01-27 KR KR1020187024606A patent/KR20180102674A/ko active Pending
- 2017-01-27 EP EP17706412.8A patent/EP3408411A1/en not_active Withdrawn
- 2017-01-27 CA CA3012404A patent/CA3012404A1/en active Pending
- 2017-01-27 US US16/073,271 patent/US11702701B2/en active Active
- 2017-01-27 WO PCT/EP2017/051789 patent/WO2017129753A1/en not_active Ceased
- 2017-01-27 SG SG11201805990XA patent/SG11201805990XA/en unknown
- 2017-01-27 CN CN201780008861.6A patent/CN108770360B/zh active Active
- 2017-01-27 JP JP2018539138A patent/JP2019508032A/ja active Pending
Patent Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2000017390A1 (en) | 1998-09-18 | 2000-03-30 | Micromet Ag | Dna amplification of a single cell |
| WO2002037113A2 (en) | 2000-11-03 | 2002-05-10 | Michael Giesing | Clinical and functional validation of targets from disseminated cancer cells |
| EP2503009A1 (en) | 2011-03-25 | 2012-09-26 | Massimo Zollo | Biomarker for detecting circulating tumor cells and related detecting methods and kit |
| WO2013009632A2 (en) * | 2011-07-08 | 2013-01-17 | The University Of Utah Research Foundation | Methods of detecting hereditary cancer predisposition |
| US20130149704A1 (en) * | 2011-12-10 | 2013-06-13 | Abbott Molecular Inc. | Materials and methods for diagnosis of malignant melanoma and prognosis of metastasis of malignant melanoma |
| WO2015023553A2 (en) * | 2013-08-13 | 2015-02-19 | Bionumerik Pharmaceuticals, Inc. | Contemporaneous, heterogeneously-oriented, multi-targeted therapeutic modification and/or modulation of disease by administration of sulfur- containing, amino acid-specific small molecules |
| WO2015118077A1 (en) | 2014-02-05 | 2015-08-13 | Fraunhofer-Gesellschaft zur Förderung der angewandten Forschung e.V. | Error-free sequencing of dna |
Non-Patent Citations (96)
| Title |
|---|
| AGUIRRE-GHISO ET AL., NATURE MED., vol. 19, no. 3, 2013, pages 276 - 7 |
| AKAGI ET AL., NUCLEIC ACID RES., vol. 32, 2004, pages D523 - 7 |
| ANJA ULMER ET AL: "Quantitative Measurement of Melanoma Spread in Sentinel Lymph Nodes and Survival", PLOS MEDICINE, vol. 11, no. 2, 18 February 2014 (2014-02-18), pages e1001604, XP055286022, DOI: 10.1371/journal.pmed.1001604 * |
| AUSUBEL ET AL.: "Current Protocols in Molecular Biology", 1992, GREENE PUBLISHING ASSOCIATES |
| BALCH ET AL., JCO, vol. 27, 2009, pages 6199 - 6206 |
| BALCH, JOURNAL OF CLINICAL ONCOLOGY : OFFICIAL JOURNAL OF THE AMERICAN SOCIETY OF CLINICAL ONCOLOGY, vol. 27, 2009, pages 6199 - 6206 |
| BAUER, DERMATOLOGIC THERAPY, vol. 19, 2006, pages 40 - 49 |
| BEATE RINNER ET AL: "Molecular evidence for the bi-clonal origin of neuroendocrine tumor derived metastases", BMC GENOMICS, BIOMED CENTRAL LTD, LONDON, UK, vol. 13, no. 1, 5 November 2012 (2012-11-05), pages 594, XP021120042, ISSN: 1471-2164, DOI: 10.1186/1471-2164-13-594 * |
| BOIKO, NATURE, vol. 466, 2010, pages 133 - 137 |
| BOLLAG ET AL., NATURE, vol. 467, no. 7315, 2010, pages 596 - 9 |
| BREAST CANCER RES TREAT., vol. 131, 2012, pages 801 - 808 |
| CHANG KL ET AL.: "Modern Surgical Pathology, 2nd ed.", 2009, SAUNDERS ELSEVIER, article "chapter 41" |
| COLE ET AL., LANCET, vol. 358, 2001, pages 277 - 286 |
| CRESPI B ET AL: "Evolutionary biology of cancer", TRENDS IN ECOLOGY AND EVOLUTION, NORTH-HOLLAND, AMSTERDAM, NL, vol. 20, no. 10, 1 October 2005 (2005-10-01), pages 545 - 552, XP027774576, ISSN: 0169-5347, [retrieved on 20051001] * |
| CZYZ, PLOS ONE, vol. 9, 2014, pages E85907 |
| DESHWAR, GENOME BIOLOGY, vol. 16, 2015, pages 35 |
| DON X. NGUYEN ET AL: "Metastasis: from dissemination to organ-specific colonization", NATURE REVIEWS. CANCER, vol. 9, no. 4, 1 April 2009 (2009-04-01), GB, pages 274 - 284, XP055359862, ISSN: 1474-175X, DOI: 10.1038/nrc2622 * |
| DONG, CANCER RESEARCH, vol. 63, 2003, pages 3883 - 3885 |
| ENGEL ET AL., EUR J CANCER, vol. 39, 2003, pages 1794 - 1806 |
| ENGEL, EUROPEAN JOURNAL OF CANCER, vol. 39, 2003, pages 1794 - 1806 |
| EYLES ET AL., J CLIN INVEST., vol. 120, 2010, pages 2030 - 2039 |
| FISCHER ET AL., PNAS, vol. 110, 2013, pages 16580 - 16585 |
| FORBES ET AL., NUCLEIC ACID RES., vol. 43, 2014, pages D805 - 811 |
| FRIBERG, JOURNAL OF SURGICAL ONCOLOGY, vol. 65, 1997, pages 284 - 297 |
| FROMMER ET AL., PROC. NATL. ACAD.SCI. USA, vol. 89, 1992, pages 1827 - 1831 |
| GALANZHA ET AL., CYTOMETRY, vol. 79, 2011, pages 814 - 824 |
| GERLINGER ET AL., THE NEW ENGLAND JOURNAL OF MEDICINE, vol. 366, 2012, pages 883 - 892 |
| GIANNI ET AL., LANCET ONCOL., vol. 12, 2011, pages 236 - 244 |
| GIMOTTY, JOURNAL OF CLINICAL ONCOLOGY : OFFICIAL JOURNAL OF THE AMERICAN SOCIETY OF CLINICAL ONCOLOGY, vol. 23, 2005, pages 8048 - 8056 |
| GIMOTTY, JOURNAL OF CLINICAL ONCOLOGY: OFFICIAL JOURNAL OF THE AMERICAN SOCIETY OF CLINICAL ONCOLOGY, vol. 23, 2005, pages 8048 - 8056 |
| GORGES ET AL., CLINCANCER RES., 2015, pages 1416 |
| GUZVIC ET AL., CANCER RES., vol. 74, 2014, pages 7383 - 7394 |
| HAFNER, PNAS, vol. 107, 2010, pages 20780 - 20785 |
| HALABAN ET AL., PIGMENT CELL MELANOMA RES., vol. 23, no. 2, 2010, pages 190 - 200 |
| HANSEN ET AL., NAT. GENET., vol. 43, 2011, pages 768 - 775 |
| HARLOW; LANE: "Antibodies: A Laboratory Manual", 1990, COLD SPRING HARBOR LABORATORY PRESS |
| HATZIVASSILIOU ET AL., NATURE, vol. 464, no. 7287, 2010, pages 431 - 5 |
| HOLOHAN ET AL., NATURE REVIEWS CANCER, vol. 13, 2013, pages 714 |
| HURET ET AL., NUCLEIC ACID RES., vol. 28, no. 1, 2000, pages 349 - 51 |
| HUSEMANN ET AL., CANCER CELL, vol. 13, 2008, pages 58 - 68 |
| HUSEMANN ET AL., CELL, vol. 13, 2008, pages 58 - 68 |
| JIAO, BMC BIOINFORMATICS, vol. 15, 2014, pages 35 |
| JOURNAL OF CLINICAL ONCOLOGY : OFFICIAL JOURNAL OF THE AMERICAN SOCIETY OF CLINICAL ONCOLOGY, vol. 30, 2012, pages 2522 - 2529 |
| KLEIN ET AL., LANCET, vol. 360, 2002, pages 683 - 689 |
| KLEIN, J EXP MED, vol. 196, 2002, pages 359 - 368 |
| KLEIN, LANCET, vol. 360, 2002, pages 683 - 689 |
| KLEIN, NAT REV CANCER, vol. 9, 2009, pages 302 - 312 |
| KLEIN, NATURE, vol. 501, 2013, pages 365 - 372 |
| KLEIN, PNAS, vol. 96, 1999, pages 4494 - 4499 |
| LEITER ET AL., JCO, vol. 22, 2004, pages 3660 - 3667 |
| LOHR, NATURE BIOTECHNOLOGY, vol. 32, 2014, pages 479 - 484 |
| MA, PNAS, vol. 105, 2008, pages 14254 - 14261 |
| MARDIS, ANNU REV GENOMICS HUM GENET, vol. 9, 2008, pages 387 - 402 |
| MINARD ET AL., GENESIS, vol. 47, no. 8, 2009, pages 559 - 72 |
| NATURE MED., vol. 19, no. 3, 2013, pages 274 - 5 |
| NI, PNAS, vol. 110, 2013, pages 21083 - 21088 |
| OMHOLT, CLINICAL CANCER RESEARCH : AN OFFICIAL JOURNAL OF THE AMERICAN ASSOCIATION FOR CANCER RESEARCH, vol. 9, 2003, pages 6483 - 6488 |
| OSSOWSKI, PIGMENT CELL & MELANOMA RESEARCH, vol. 23, 2010, pages 41 - 56 |
| PEINADO, NATURE MEDICINE, vol. 18, 2012, pages 883 - 891 |
| PHILIPPE COLLAS: "Chromatin Immunoprecipitation Assays - Methods and Protocols", 2009, HUMANA PRESS |
| PLATZ ET AL., MOL ONCOL, vol. 1, 2008, pages 395 - 405 |
| PLATZ, MOLECULAR ONCOLOGY, vol. 1, 2008, pages 395 - 405 |
| POLLOCK, NATURE GENETICS, vol. 33, 2003, pages 19 - 20 |
| POLZER ET AL., EMBO MOL MED., vol. 6, 2014, pages 1371 - 138 |
| POLZER, EMBO MOLECULAR MEDICINE, vol. 6, 2014, pages 1371 - 1386 |
| POLZER; KLEIN, NATURE MED., vol. 19, no. 3, 2013, pages 274 - 5 |
| POMRANING KR; SMITH KM; FREITAG M, METHODS, vol. 47, no. 3, March 2009 (2009-03-01), pages 142 - 50 |
| POULIKAKOS, NATURE, vol. 464, 2010, pages 427 - 430 |
| QUINTANA, NATURE, vol. 456, 2008, pages 593 - 598 |
| RHIM ET AL., CELL, vol. 148, 2012, pages 349 - 361 |
| SAINT-JEAN, J INVEST DERMATOL, 2013 |
| SAMBROOK ET AL.: "Molecular Cloning: A Laboratory Manual, 2nd ed.", 1989, COLD SPRING HARBOR LABORATORY PRESS |
| SANBORN, PNAS, vol. 112, 2015, pages 10995 - 11000 |
| SANGER ET AL., INT J CANCER, vol. 129, 2011, pages 2522 - 2526 |
| SAUCEDO-ZENI ET AL., INT J ONCOL., vol. 41, 2012, pages 1241 - 1250 |
| SCHARDT ET AL., CANCER CELL, vol. 8, 2005, pages 227 - 239 |
| SCHMIDT-KITTLER ET AL., PNAS, vol. 100, 2003, pages 7737 - 7742 |
| SCHWARTZ ET AL., JMB, vol. 425, no. 21, 2013, pages 3914 - 8 |
| SHAIN ET AL., THE NEW ENGLAND JOURNAL OF MEDICINE, vol. 373, 2015, pages 1926 - 1936 |
| SHAIN, THE NEW ENGLAND JOURNAL OF MEDICINE, vol. 373, 2015, pages 1926 - 1936 |
| SNYDER, THE NEW ENGLAND JOURNAL OF MEDICINE, vol. 371, 2014, pages 2189 - 2199 |
| STRINO, NUCLEIC ACIDS RESEARCH, vol. 41, 2013, pages E165 |
| TSAI ET AL., PNAS, vol. 105, no. 8, 2008, pages 3041 - 6 |
| ULMER ET AL., CLIN CANCER RES., vol. 11, 2005, pages 5425 - 5432 |
| ULMER ET AL., PLOS MED., vol. 11, 2014, pages E1001604 |
| ULMER, CLINICAL CANCER RESEARCH : AN OFFICIAL JOURNAL OF THE AMERICAN ASSOCIATION FOR CANCER RESEARCH, vol. 11, 2005, pages 5425 - 5432 |
| ULMER, PLOS MED, vol. 11, 2014, pages E1001604 |
| VAN A TRINH ET AL: "Chemoprevention for Brain Metastases", CURRENT ONCOLOGY REPORTS, CURRENT SCIENCE INC, NEW YORK, vol. 14, no. 1, 18 October 2011 (2011-10-18), pages 63 - 69, XP035007068, ISSN: 1534-6269, DOI: 10.1007/S11912-011-0200-1 * |
| VERLINDEN, MEDICINE, vol. 93, 2014, pages E285 |
| VOGELSTEIN ET AL., SCIENCE, vol. 339, no. 6127, 2013, pages 1546 - 58 |
| WAN ET AL., CELL, vol. 116, no. 6, 2004, pages 855 - 67 |
| WEBER M; DAVIES JJ; WITTIG D ET AL., NAT. GENET., vol. 37, no. 8, August 2005 (2005-08-01), pages 853 - 62 |
| WILSON IM ET AL., CELL CYCLE, vol. 5, no. 2, 2005, pages 155 - 8 |
| YACHIDA, NATURE, vol. 467, 2010, pages 1114 - 1117 |
| YANCOVITZ, PLOS ONE, vol. 7, 2012, pages E29336 |
| ZHANG X; YAZAKI J; SUNDARESAN A ET AL., CELL, vol. 126, no. 6, September 2006 (2006-09-01), pages 1189 - 201 |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US11040027B2 (en) | 2017-01-17 | 2021-06-22 | Heparegenix Gmbh | Protein kinase inhibitors for promoting liver regeneration or reducing or preventing hepatocyte death |
Also Published As
| Publication number | Publication date |
|---|---|
| CN108770360A (zh) | 2018-11-06 |
| EP3199641A1 (en) | 2017-08-02 |
| CA3012404A1 (en) | 2017-08-03 |
| EP3408411A1 (en) | 2018-12-05 |
| ES2905208T3 (es) | 2022-04-07 |
| JP2019508032A (ja) | 2019-03-28 |
| AU2017211976B2 (en) | 2022-09-22 |
| SG11201805990XA (en) | 2018-08-30 |
| US11702701B2 (en) | 2023-07-18 |
| KR20180102674A (ko) | 2018-09-17 |
| WO2017129753A8 (en) | 2017-10-19 |
| US20190062845A1 (en) | 2019-02-28 |
| CN108770360B (zh) | 2022-06-14 |
| EP3199641B1 (en) | 2021-09-29 |
| AU2017211976A1 (en) | 2018-08-02 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Guo et al. | DNA hypomethylation silences anti-tumor immune genes in early prostate cancer and CTCs | |
| Lenos et al. | Stem cell functionality is microenvironmentally defined during tumour expansion and therapy response in colon cancer | |
| Shao et al. | Silencing EGFR-upregulated expression of CD55 and CD59 activates the complement system and sensitizes lung cancer to checkpoint blockade | |
| Perrone et al. | PI3KCA/PTEN deregulation contributes to impaired responses to cetuximab in metastatic colorectal cancer patients | |
| Fortunato et al. | Circulating mir‐320a promotes immunosuppressive macrophages M2 phenotype associated with lung cancer risk | |
| US20220010385A1 (en) | Methods for detecting inactivation of the homologous recombination pathway (brca1/2) in human tumors | |
| Lorenzo-Martín et al. | VAV2 signaling promotes regenerative proliferation in both cutaneous and head and neck squamous cell carcinoma | |
| Sircoulomb et al. | Genome profiling of ERBB2-amplified breast cancers | |
| Wang et al. | Multi-omics analyses reveal biological and clinical insights in recurrent stage I non-small cell lung cancer | |
| Zhai et al. | Arid1a inactivation in an Apc‐and Pten‐defective mouse ovarian cancer model enhances epithelial differentiation and prolongs survival | |
| US20070220621A1 (en) | Genetic characterization and prognostic significance of cancer stem cells in cancer | |
| NL2007467A (en) | Compositions and methods for detecting cancer metastasis. | |
| Guijarro et al. | Dual Pten/Tp53 suppression promotes sarcoma progression by activating Notch signaling | |
| Sinha et al. | Single-cell evaluation reveals shifts in the tumor-immune niches that shape and maintain aggressive lesions in the breast | |
| Pan et al. | Association of DSC3 mRNA down-regulation in prostate cancer with promoter hypermethylation and poor prognosis | |
| Gasparini et al. | Prognostic determinants in epithelioid sarcoma | |
| He et al. | CAMTA1, a novel antitumor gene, regulates proliferation and the cell cycle in glioma by inhibiting AKT phosphorylation | |
| Meng et al. | Histone methyltransferase ASH1L primes metastases and metabolic reprogramming of macrophages in the bone niche | |
| Mellai et al. | Promoter hypermethylation of the EMP3 gene in a series of 229 human gliomas | |
| Park et al. | High p16INK4A expression in glioblastoma is associated with senescence phenotype and better prognosis | |
| Lee et al. | Prognostic implication of MET overexpression in myxofibrosarcomas: an integrative array comparative genomic hybridization, real-time quantitative PCR, immunoblotting, and immunohistochemical analysis | |
| Zhao et al. | TWIST2: A new candidate tumor suppressor in prostate cancer | |
| US11702701B2 (en) | Means and methods for staging, typing and treating a cancerous disease | |
| Lee et al. | Loss of LPAR6 and CAB39L dysregulates the basal-to-luminal urothelial differentiation program, contributing to bladder carcinogenesis | |
| KR20220105160A (ko) | 암의 치료 방법 |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 17706412 Country of ref document: EP Kind code of ref document: A1 |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 11201805990X Country of ref document: SG |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 3012404 Country of ref document: CA |
|
| ENP | Entry into the national phase |
Ref document number: 2018539138 Country of ref document: JP Kind code of ref document: A |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| ENP | Entry into the national phase |
Ref document number: 2017211976 Country of ref document: AU Date of ref document: 20170127 Kind code of ref document: A |
|
| ENP | Entry into the national phase |
Ref document number: 20187024606 Country of ref document: KR Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 1020187024606 Country of ref document: KR Ref document number: 2017706412 Country of ref document: EP |
|
| ENP | Entry into the national phase |
Ref document number: 2017706412 Country of ref document: EP Effective date: 20180827 |