WO2017115001A1 - Procédé d'identification d'individus susceptibles d'être atteints de diabète - Google Patents

Procédé d'identification d'individus susceptibles d'être atteints de diabète Download PDF

Info

Publication number
WO2017115001A1
WO2017115001A1 PCT/ES2017/070003 ES2017070003W WO2017115001A1 WO 2017115001 A1 WO2017115001 A1 WO 2017115001A1 ES 2017070003 W ES2017070003 W ES 2017070003W WO 2017115001 A1 WO2017115001 A1 WO 2017115001A1
Authority
WO
WIPO (PCT)
Prior art keywords
metabolic syndrome
individual
nir
kit
diabetes
Prior art date
Application number
PCT/ES2017/070003
Other languages
English (en)
Spanish (es)
Inventor
María Isabel QUEIPO ORTUÑO
Isabel MORENO INDIAS
Francisco José TINAHONES MADUEÑO
Fernando CARDONA DÍAZ
Original Assignee
Servicio Andaluz De Salud
Universidad De Málaga
Centro De Investigación Biomédica En Red (Ciber)
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Servicio Andaluz De Salud, Universidad De Málaga, Centro De Investigación Biomédica En Red (Ciber) filed Critical Servicio Andaluz De Salud
Publication of WO2017115001A1 publication Critical patent/WO2017115001A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Definitions

  • the present invention is within the field of medicine, microbiology and nutrition, and specifically refers to a method for predicting or forecasting the probability of an individual suffering from metabolic diseases, and preferably diabetes.
  • the intestinal microbiota can contribute to the development of inflammation and insulin resistance by two different mechanisms, either the intestinal microbiota using its metabolic activities that could participate in the extraction of calories from ingested food substances, its storage in the tissue adipose host and increased adipokin production and levels of free fatty acids in plasma, or by chronic inflammation that could induce, or both.
  • the intestinal microbiota influences intestinal permeability in obese mice, thus promoting the translocation of bacterial products and stimulating the characteristic inflammation of low obesity and insulin resistance. It has been proven that the microbiota profile associated with human obesity is also associated with local and systemic inflammation, although no relationship has been found between the composition of the obese microbiota and intestinal permeability, suggesting that the composition of the microbiota associated with obesity has a pro-inflammatory effect.
  • a first invention solves the problem described above with respect to identifying individuals whose microbiota makes them prone to insulin resistance, providing a method comprising: a) obtaining a biological sample isolated from the intestine of said individual, and b) determining the groups taxonomic compounds that make up the intestinal microbiota in the sample isolated from step (a), c) classify the individual from step (a), in the group of individuals with a probability at least 2 times greater, preferably 3 times greater, and more preferably 4 times higher, if you have metabolic syndrome or a disease related to metabolic syndrome, if you have: i) a percentage of Firmicutes and / or Fusobacteria at least 2 times higher, preferably 3 times higher, and more preferably 3.4 times higher than a reference individual, and / or ii) a percentage of Pseudomonaceae, Prevotellaceae, Fusobacteriaceae, Pseudomonas, Prevotella, Catenibacterium, Veillon
  • a second invention solves the problem described above referring to a probiotic composition by providing a composition comprising: i) Bacterial strains of the families that are selected from the list comprising
  • Bacteroidaceae Lachnospiraceae, Ruminococcaceae, Enterobacteriaceae, Erysipelorichaceae, Odoribacteraceae, Porphyromonadaceae, and / or ii) bacterial strains of the Bacteroides and Blautia genera, and / or
  • the aOTUs of the present invention have studied that the taxonomic groups that make up the intestinal microbiota can be used to predict or predict the risk of an individual suffering from metabolic syndrome or a disease related to metabolic syndrome.
  • a first aspect of the first invention relates to a method of obtaining useful data to predict or predict the risk of an individual suffering from metabolic syndrome or a disease related to metabolic syndrome, hereafter referred to as the first method of invention, comprising: a) obtaining a biological sample isolated from the intestine of said individual, and b) determining the taxonomic groups that make up the intestinal microbiota in the sample isolated from step (a).
  • the biological sample isolated from the individual's intestine is a sample of the cecal appendix.
  • the disease related to the metabolic syndrome is selected from the list comprising: overweight, obesity, adipocyte hypertrophy, liver steatosis or fatty liver, dyslipidemia, hyperglycemia, insulin resistance and diabetes, metabolic syndrome, hypertension, diseases cardiovascular, immune system dysfunction, or any combination thereof.
  • the determination of the taxonomic groups that make up the intestinal microbiota of step (b) can be performed by any procedure known in the state of the art.
  • the determination of the taxonomic groups that make up the intestinal microbiota of step (b) is performed by PCR. In another preferred embodiment of this aspect of the invention, the determination of the taxonomic groups that make up the intestinal microbiota of step (b) further comprises pyrosequencing techniques.
  • the determination of the taxonomic groups that make up the intestinal microbiota of step (b) comprises a Gradient Denaturing Gel Electrophoresis (DGGE).
  • DGGE Gradient Denaturing Gel Electrophoresis
  • the determination of the taxonomic groups that make up the intestinal microbiota of step (b) is performed by antibodies, preferably fluorescent.
  • the determination of the taxonomic groups that make up the intestinal microbiota of step (b) is performed by fluorescent in situ hybridization (FISH) techniques.
  • FISH fluorescent in situ hybridization
  • step (b) further comprises measuring the microbial activity of the taxonomic groups that make up the intestinal microbiota.
  • microbial activity is measured, but not limited to, by stable radioisotopes, microelectrodes and / or isotopes.
  • taxonomic group means the group of microorganisms classified in a certain taxonomic category. Normally a taxonomic group that classifies microorganisms covers one or several smaller groups, subordinated to the larger one.
  • a taxonomic category constitutes a classification group.
  • the taxonomic ranges or categories normally used in taxonomy are: Domain, Kingdom, Edge or Division, Class, Order, Family, Genus, Species.
  • a second aspect of the first invention relates to a method to predict or predict the risk of an individual suffering from metabolic syndrome or a disease related to metabolic syndrome, hereafter referred to as the second method of the invention, which comprises determining taxonomic groups. which make up the intestinal microbiota in an isolated biological sample as described in the first method of the invention, and further comprises: c) classifying the individual from step (a), in the group of individuals with a probability at least 2 times greater, preferably 3 times greater, and more preferably 4 times greater, of suffering from metabolic syndrome or a disease related to metabolic syndrome, if it has: i) a percentage of Firmicutes and / or Fusobacteria at least 2 times higher, preferably 3 times higher, and more preferably 3.4 times higher than that of a reference individual, and / or ii) a percentage of Pseudomonaceae, Prevotellaceae, Fus obacteriaceae, Pseudomonas, Prevotella, Catenibacterium,
  • morbidly obese subjects sensitive to insulin have a HOMA-IR value ⁇ 3. This cut-off point was established from the mean ⁇ 2 Standard Deviations of a healthy control population
  • the biological sample isolated from the individual's intestine is a sample of the cecal appendix.
  • the disease related to the metabolic syndrome is selected from the list comprising: overweight, obesity, adipocyte hypertrophy, liver steatosis or fatty liver, dyslipidemia, hyperglycemia, insulin resistance and diabetes, metabolic syndrome, hypertension, diseases cardiovascular, immune system dysfunction, or any combination thereof.
  • the disease is diabetes, and even more preferably, type II diabetes.
  • Steps (b) and / or (c) of the method described above can be totally or partially automated, for example, by means of a robotic sensor device for detecting the presence in step (b) or computerized classification in step (c).
  • an "isolated biological sample” includes, but is not limited to, cells, tissues and / or biological fluids of an organism, obtained by any method known to a person skilled in the art.
  • the isolated biological sample is from the cecal appendix.
  • cecal appendix or vermiform appendix to the no-outlet cylinder connected to the intestine blind.
  • this appendix is an evolutionary vestige that contains a certain bacterial diversity.
  • the sample of the cecal appendix comprises all the parts of the tissue that comprise it.
  • Firmicutes is understood as the microorganisms that make up this Phylum. Almost all the bacteria of this Phylum are Gram positive although it includes Gram negative and others that lack a cell wall.
  • the group is divided into several classes: Bacilli, facultative or obligated aerobes, Clostridia, anaerobic organisms, Mollicutes etc. In phylogenetic trees, the first two groups appear to be paraphyletic, so most likely they can be restructured. Currently, more than 274 genres of the Firmicutes edge are recognized. The most important classes are: • Bacilli: Order Bacillales: Bacillus, Listeria, Paenibacillus and Staphylococcus. Lactobacillales order: Enterococcus, Lactobacillus, Lactococcus, Leuconostoc, Oenococcus, Pediococcus and Streptococcus
  • Clostridia Order Clostridium, Desulforudis, Heliobacterium and Peptostreptococcus.
  • Catenibacterium Within this class are Catenibacterium, Lachnospiraceae and Ruminococcaceae.
  • Negativicutes Selenomonas and Sporomusa. The genus Veillonella is also found.
  • the genus Blautia is found within Firmicutes. In this report it is understood as Phylobacteria at the edge of anaerobic Gram-negative bound bacteria with lipopolysaccharides. They are bacilli that are found as commensals or pathogens. Families with their most important genera are:
  • Leptotrichiaceae Sebaldella, Sneathia, Streptobacillus, Leptotrichia
  • Fusobacteriaceae Cetobacterium, Fusobacterium, llyobacter, Propionigenium and Psychrilyobacter.
  • Pseudomonadaceae means the family of bacteria that includes Pseudomonas, Commamonas, Cellvibrio, Azotobacter. These genera contain: Azomonas, Azorhizophilus, and Azotobacter.
  • the family Pseudomonadaceae belongs to the domain Bacteria, kingdom Bacteria phylum Proteobacteria, class Gammaproteobacteria, order Pseudomonadales.
  • Prevotellacae means the family of bacteria that belongs to the Bacteroidetes phylum, Bacteroidetes class, order Bacteroidales. They are among the most common cultivable microorganisms of the rumen and back intestine of cattle and sheep, where they help the breakdown of proteins and carbohydrates. They are also present in humans.
  • One of the genres that belong to this family is P revotell a.
  • Proteobacteria is understood as one of the main groups of bacteria. They include a wide variety of pathogens, such as Escherichia, Salmonella, Vibrio, Helicobacter, Neisseria gonorrhoeae, Burkholderia glumae and many others. Others are free-living, and include many of the bacteria responsible for nitrogen fixation. The most important sub-profiles and classes are: • Subfilo Rhodobacteria: Class Alphaproteobacteria, Betaproteobacteria, Gammaproteobacteria (Order Enterobacteriales and Familia Enterobacteriaceae) and Zetaproteobacteria.
  • Subfilo Thiobacteria Deltaproteobacteria, Epsilonproteobacteria.
  • the term “individual” in this report is synonymous with “patient”, and is not intended to be limiting in any way, and may be of any age, sex and physical condition.
  • a third aspect of the first invention relates to a kit or device, hereinafter kit or device of the invention, comprising the elements necessary to identify the taxonomic groups that make up the intestinal microbiota in an isolated sample.
  • the kit or device of the invention comprises primers, probes and / or antibodies capable of identifying taxonomic groups by characterizing the 16S region of the rRNA, and where:
  • primers or primers are polynucleotide sequences of between 10 and 30 base pairs, more preferably between 15 and 25 base pairs, even more preferably between 18 and
  • the probes are polynucleotide sequences of between 80 and 1100 base pairs, more preferably between 100 and 1000 base pairs, and even more preferably between 200 and 500 base pairs;
  • the antibodies are capable of specifically binding to a region formed by any of the amino acid sequences SEQ ID NO: 2
  • the kit or device of the invention comprises primers for amplifying variable regions of the 16S rRNA gene.
  • the primers comprise the sequences SEQ ID NO: 3 (primer HDA1) (5'- GACTCCTACGGGAGGCAGCAGT-3 ') and SEQ ID NO: 4 (HDA2 primer) (5'-3- GTATTACCGCGGCTGCTGGCAC').
  • Direct primers were designed with the adapter sequence A SEQ ID NO: 5 (CGTATCGCCTCCCTCGCGCCA) plus a key sequence SEQ ID NO: 6 (TCAG) and reverse primers with the adapter sequence B SEQ ID NO: 7 (CTATGCGCCTTGCCAGCCCG) plus a sequence SEQ ID NO: 8 (TCGA).
  • 454- adapters were included in the direct primer followed by a 10 bp Multiplex-specific identifier (MID).
  • the primers, probes or antibodies are modified or labeled, for example, but not limited to, by radioactive or immunological screening.
  • the kit may contain oligonucleotides designed from a known 16S rRNA sequence of microbiota microorganisms, and / or capable of hybridizing with the sequence of said genes for subsequent PCR amplification.
  • the PCR program was created as follows 95 ° C 10 min and 30 cycles of 95 ° C 1 min, 50 ° C 1 min, 1.5 min 72 ° C followed by 72 ° C for 10 minOTUs.
  • PCR products were purified twice using Agencourt AMPure Kit (Beckman Coulter, Milano, Italy) and quantified using the Quant-iT TM PicoGreen® dsDNA Assay Kit (Invitrogen, Burlington, ON) and An equimolar pool was obtained before further processing and sequencing on a GS 454 junior platform in accordance with the manufacturer's protocols through the use of a titanium chemistry (Roche Applied Science, Indianapolis, IN).
  • the kit or device of the invention further comprises the elements necessary to perform a massive sequencing, preferably a pyrosequencing.
  • the oligonucleotides have modifications in some of their nucleotides, such as, but not limited to, nucleotides having any of their atoms with a radioactive isotope, usually 32 P or tritium, immunologically labeled nucleotides, such as with a molecule of digoxigenin, and / or immobilized in a membrane.
  • the kit of the invention may include positive and / or negative controls.
  • the kit may also contain, without any limitation, buffers, protein extraction solutions, agents to prevent contamination, inhibitors of protein degradation, etc.
  • the kit can include all the supports and containers necessary for commissioning and optimization.
  • the kit further comprises instructions for carrying out the methods of the invention.
  • the oligonucleotide (s) are immobilized in spots on a (preferably solid) surface.
  • the kit comprises a microarray, or microarray of the invention.
  • An RNA microarray is a matrix on a solid substrate (usually a glass holder or a cell of a thin silicon film) that evaluates large amounts of different RNAs that are detectable by specific probes immobilized on spots on a solid substrate.
  • Each spot contains a specific nucleic acid sequence, usually a DNA sequence, such as probes (or indicators).
  • oligonucleotide sequences can be constructed on the surface of a chip by sequential elongation of a growing chain with a single nucleotide using photolithography.
  • the oligonucleotides are anchored at the 3 'end by a method of selective activation of nucleotides, protected by a photolabile reagent, by the selective incidence of light through a photomask.
  • the photomask can be physical or virtual.
  • oligonucleotide probes can be between 10 and 100 nucleotides, more preferably, between 20 and 70 nucleotides, and even more preferably, between 24 and 30 nucleotides.
  • a fourth aspect of the first invention relates to the use of the kit or device of the invention for obtaining useful data to predict or predict the risk of an individual suffering from metabolic syndrome or a disease related to metabolic syndrome.
  • the disease related to the metabolic syndrome is selected from the list comprising: overweight, obesity, adipocyte hypertrophy, hepatic steatosis or fatty liver, dyslipidemia, hyperglycemia, insulin resistance and diabetes, metabolic syndrome, hypertension, cardiovascular diseases, immune system dysfunction, or any combination thereof.
  • the disease is diabetes, and even more preferably, type II diabetes.
  • a fifth aspect of the invention relates to a computer program comprising program instructions to make a computer carry out the process according to any of the methods of the invention.
  • the invention encompasses computer programs arranged on or within a carrier.
  • the carrier can be any entity or device capable of supporting the program.
  • the carrier may be constituted by said cable or other device or means.
  • the carrier could be an integrated circuit in which the program is included, the integrated circuit being adapted to execute, or to be used in the execution of, the corresponding processes.
  • the programs could be incorporated into a storage medium, such as a ROM, a CD ROM or a semiconductor ROM, a USB memory, or a magnetic recording medium, for example, a floppy disk or a disk Lasted.
  • the programs could be supported on a transmissible carrier signal.
  • it could be an electrical or optical signal that could be transported through an electrical or optical cable, by radio or by any other means.
  • the invention also extends to computer programs adapted so that any processing means can implement the methods of the invention.
  • Such programs may have the form of source code, object code, an intermediate source of code and object code, for example, as in partially compiled form, or in any other form suitable for use in the implementation of the processes according to the invention .
  • Computer programs also cover cloud applications based on that procedure.
  • a sixth aspect of the first invention relates to a computer-readable storage medium comprising program instructions capable of having a computer perform the steps of any of the methods of the invention.
  • a seventh aspect of the first invention relates to a transmissible signal comprising program instructions capable of having a computer perform the steps of any of the methods of the invention.
  • a nucleic acid or polynucleotide sequence may comprise the five bases that appear biologically (adenine, guanine, thymine, cytosine and uracil) and / or bases other than the five that appear biologically. These bases can serve different purposes, for example, to stabilize or destabilize hybridization; to stimulate or inhibit probe degradation; or as junction points for detectable debris or screening debris.
  • a polynucleotide of the invention may contain one or more modified, non-standard, derivatized base moieties, including, but not limited to, N 6 -methyl-adenine, N 6 -tert-butyl-benzyl-adenine, imidazole, Substituted imidazoles, 5-fluorouracil, 5-bromouracil, 5- chlorouracil, 5-iodouracil, hypoxanthine, xanthine, 4-acetylcytosine, 5- (carboxyhydroxymethyl) uracil, 5-carboxymethylaminomethyl-2-thiouridine, 5-carboxymethylamino, dihydroxymethylamino, dihydroxymethylaminomethyl D- galactosylqueosine, inosine, N6-isopentenyladenine, 1- methylguanine, 1-methylinosine, 2,2-dimethylguanine, 2-methylladenine, 2-methylguanine, 3-methylcytosine, 5-methyl
  • nucleic acid or polynucleotide sequence may comprise one or more modified sugar moieties including, but not limited to, arabinose, 2-fluoroarabinous, xylulose, and a hexose.
  • polynucleotide and “nucleic acid” are used interchangeably herein, referring to polymeric forms of nucleotides of any length, both ribonucleotides (RNA or RNA) and deoxyribonucleotides (DNA or DNA).
  • amino acid sequence refers to a polymeric form of amino acids of any length, which may be coding or non-coding, Chemically or biochemically modified.
  • the present invention means biologically active variant or fragment, those variants or fragments of the indicated peptides that have the same physiological, metabolic or immunological effect, or have the same utility as those described. That is, they are functionally equivalent. Such effects can be determined by conventional methods.
  • identity refers to the proportion of identical nucleotides or amino acids between two nucleotide or amino acid sequences that are compared.
  • Sequence comparison methods are known in the state of the art, and include, but are not limited to, the GAG program, including GAP (Devereux et al., Nucleic Acids Research 12: 287 (1984) Genetics Computer Group University of Wisconsin, Madison, (Wl); BLAST, BLASTP or BLASTN, and FASTA (Altschul et al., 1999. J. Mol. Biol. 215: 403-410.
  • GAP Geneticeux et al., Nucleic Acids Research 12: 287 (1984) Genetics Computer Group University of Wisconsin, Madison, (Wl); BLAST, BLASTP or BLASTN, and FASTA (Altschul et al., 1999. J. Mol. Biol. 215: 403-410.
  • a first aspect of the second invention relates to the use of a composition, hereafter referred to as the composition of the invention, comprising: i) Bacterial strains of the families that are selected from the list comprising
  • Bacteroidaceae Lachnospiraceae, Ruminococcaceae, Enterobacteriaceae, Erysipelorichaceae, Odoribacteraceae, Porphyromonadaceae, and / or ii) bacterial strains of the genera Bacteroides and Blautia, and / or iii) cellular components, metabolites, secreted molecules or any combination thereof, obtained from strain i), strain ii), or both, or from a combination of microorganisms comprising at least one strain i), strain ii), or both, or any combination thereof, for use in the preparation of a medicine for the prevention, relief and / or treatment of overweight, obesity, insulin resistance and / or metabolic syndrome and / or a disease related to metabolic syndrome.
  • the disease related to the metabolic syndrome is selected from the list comprising: overweight, obesity, adipocyte hypertrophy, liver steatosis or fatty liver, dyslipidemia, hyperglycemia, insulin resistance, prediabetes, diabetes , metabolic syndrome, hypertension, cardiovascular diseases, immune system dysfunction, or any combination thereof.
  • the disease is prediabetes.
  • the disease is type diabetes.
  • the composition defined generally, is a set of components that is formed at least by the strain of the invention in any concentration; or at least by the cellular components, metabolites, secreted molecules of the strain of the invention or any combination thereof; or by a combination thereof.
  • the composition of the invention can additionally comprise at least one lactic or bifidobacterial bacteria of intestinal, food or environmental origin.
  • the lactic bacterium is selected from the list comprising, but not limited to, a bacterium of the genus Bifidobacterium, Lactobacillus, Lactococcus, Enterococcus, Propionibacterium, Leuconostoc, Weissella, Pediococcus or Streptococcus, or any combination thereof.
  • it can additionally comprise at least one strain of fungus or yeast such as, but not limited to, belonging to the genus Saccharomyces, Candida, Pichia, Debaryomyces, Torulopsis, Aspergillus, Rhizopus, Mucor or Penicillium.
  • the cells comprising the composition may be non-viable or viable and be at any stage of the state of development or growth (latent, exponential, stationary, etc.), regardless of the morphology present.
  • said additional microorganism comprises at least one intestinal bacterium or a lactic bacterium.
  • the composition of the invention may further comprise at least one bioactive component, active substance, active ingredient or therapeutic agent, such as other components of food, plant products and / or drugs.
  • bioactive component refers to a compound with biological activity in the scope of the patent that can improve or complement the activity of a strain or a combination of bacterial strains described above, of the composition of the invention, including ingredients or food components (for example and without limitation: polyunsaturated fatty acids, conjugated linoleic acid, prebiotics, fiber, guar gum, glucomannan, chitosan, copper picolinate, calcium, etc.), plants, extracts or plant components (for example and without limiting polyphenols, ephedrine or extracts of Ephedra spp., green tea [Camellia sinensis], bitter orange [Citrus aurantium]) and drugs (for example, but not limited to, statins, orlistat, sibutramine, liraglutide etc.) .
  • the type genus is Bacteroides Castellani & Chalmers 1919
  • the bacterium is selected from the Bacteroidaceae family from the genera Bacteroides, Acetofilamentum, Acetomicrobium, Acetothermus, Anaerorhabdum, Capsularis, or any combination thereof. Even more preferably, the genus is Bacteroides. In another preferred embodiment, the genus is Bacteroides and even more preferably the species is selected from the list consisting of B. acidifaciens, B. barnesiae, B. caccae, B. cellulosilyticus, B. chinchillae, B. clarus, B. coprocola , B.
  • coprophilus B. coprosuis, B. denticanum, B. dorei, B. eggerthii, B. faecichinchillae, B. faecis, B. finegoldii, B. fluxus, B. fragilis, B. galacturonicus, B. gallinarum, B Graminisolvens, B. helcogenes, B. heparinolyticus, B. intestinalis, B. massiliensis, B. nordii, B. oleiciplenus, B. ovatus, B. paurosaccharolyticus, B. plebeius, B. propionicifaciens, B. pyogenes, B.
  • reticulotermitis B. rodentium, B. salanitronis, B. salyersiae, B. sartorii, B. stercorirosoris, B. stercoris, B. thetaiotaomicron, B. uniformis, B. vulgatus, B. xylanisolvens, B. xylanolyticus, B. zoogleoformans, B Acidifaciens, or any combination thereof.
  • the bacterium is selected from the family Lachnospiraceae from the genera Acetitomaculum, Anaerofilum, Anaerostipes, Butyrivibrio, Catenibacterium, Catonella, Coprococcus, Johnsonella, Lachnobacterium, Lachnospira, Oribaculum, Pseudobutyrivibrio, Rosesebyribibrio Ruminococcus, Shuttleworthia, Sporobacterium or any combination thereof.
  • the bacterium is selected from the Ruminococcaceae family from the genera Acetanaerobacterium, Acetivibrio, Anaerobacterium, Anaerofilum, Anaerotruncus, Candidatus Soleaferrea s Caproiciproducens, Ercella, Ethanoligenens, Faecaliphacterium, Fastmiosphere, Fastmiosphere
  • Hydrogenoanaerobacterium Mageeibacillus, Oscillospira, Papillibacter, Pseudobacteroides, Ruminiclostridium, Ruminococcus, Saccharofermentans, Sporobacter, Subdoligranulum, or any combination thereof.
  • the bacterium is selected from the Enterobacteriaceae family from the genera Alishewanella, Alterococcus, Aquamonas, Aranicola, Arsenophonus, Azotivirga, Blochmannia, Brenneria, Buchnera, Budvicia, Buttiauxella, Cedecea, Citrobacter Dickeya, Edwardsiella, Enterobacter, Erwinia, Escherichia, Ewingella, Grimontella, Hafnia, Klebsiella, Kluyvera, Leclercia, Leminorella, Moellerella, Morganella, Obesumbacterium, Pantoea, Paracolobactrum, Pectobacterium, Phlomobacter, Photorhabdus, Plesiomonas, Pragia, Proteus, Providencia, Rahnella, Raoultella, Salmonella, Samsonia, Serratia, Shigella, Sodalis, Tatumella, Tra
  • Etymology N.L. fem. n. Erysipelothrix, type genus of the family; suff. -aceae, ending denoting a family; N.L. fem. pl. n. Erysipelotrichaceae, the family of Erysipelothrix.
  • the type genus is Porphyromonas Shah and Collins 1988.
  • Etymology N.L. fem. n. Porphyromonas, type genus of the family; suff. - aceae, ending to denote a family; N.L. fem. pl. n. Porphyromonadaceae, the Porphyromonas family.
  • the organisms of the Porphyromonadaceae family are cellular organisms of the Superein Bacteria; Superphylum Bacteroidetes / Chlorobi group; Phylum Bacteroidetes; Bacteroidia class; Bacteroidales order.
  • the bacterium is selected from the Porphyromonadaceae family from the Porphyromonas and Dysgonomonas genera.
  • the bacterium is selected within the genus Blautia, and even more specifically from among the species Blautia coccoides, Blautia faecis, Blautia glucerasea, Blautia hansenii, Blautia hydrogenotrophica, Blautia luti, Blautia obeum, Blautia product, Blautia schinkii, Blautia stercoris, Blautia wexierae, or any combination thereof.
  • the composition of the invention comprises organisms of the species Prevotella stercorea, Mitsuokella multiacida, Veilloneilla dispar and Lactobacillus rhamnosus, or any combination thereof, and even more preferably the composition has a combination of organisms of the species Prevotella stercorea, Mitsuokella multiacida, Veilloneilla dispar and Lactobacillus rhamnosus simultaneously. Even more preferably, the composition of the invention comprises, as living organisms, only those belonging to said species.
  • composition is a pharmaceutical composition, hereinafter pharmaceutical composition of the invention.
  • pharmaceutical composition of the invention further comprises a pharmaceutically acceptable carrier and / or excipient.
  • the pharmaceutical composition of the invention further comprises another active ingredient.
  • Said active principle can be selected among others, but not limited to, among statins, orlistat, sibutramine, liraglutide, or combinations thereof.
  • the pharmaceutical composition is a set of components that is formed at least by the strain of the invention in any concentration; or at least by the cellular components, metabolites, secreted molecules of the strain of the invention or any of its combinations, which has at least one application in the improvement of the physical or physiological or psychological well-being of a subject, which implies an improvement of the state general health or reduction of disease risk.
  • Said pharmaceutical composition may be a medicine.
  • the term medicament has a more limited meaning than the meaning of "pharmaceutical composition", as defined in the present invention, since the medicament necessarily implies a preventive or therapeutic effect.
  • the medicament referred to in the present invention can be for human or veterinary use.
  • the "medicine for human use” is any substance or combination of substances that is presented as having properties for the treatment or prevention of diseases in humans or that can be used in humans or administered to humans in order to restore, correct or modify physiological functions by exercising a pharmacological, immunological or metabolic action, or to establish a medical diagnosis .
  • veterinary medicinal product is any substance or combination of substances that is presented as having curative or preventive properties with respect to animal diseases or that can be administered to the animal in order to restore, correct or modify its physiological functions by exercising a pharmacological, immunological or metabolic action, or to establish a veterinary diagnosis.
  • Premixes for medicated feed prepared to be incorporated into a feed will also be considered “veterinary medicinal products”.
  • excipient refers to a substance that aids the absorption of any of the components of the composition of the present invention, stabilizes said components or aids in the preparation of the pharmaceutical composition in the sense of giving it consistency or providing flavors that Make it more enjoyable.
  • the excipients could have the function of keeping the components together such as starches, sugars or cellulose, sweetening function, dye function, drug protection function such as to isolate it from air and / or moisture, function filling a tablet, capsule or any other form of presentation such as dibasic calcium phosphate, a disintegrating function to facilitate the dissolution of the components and their absorption in the intestine, without excluding other types of excipients not mentioned in this paragraph.
  • excipient is defined as that matter which, included in the galenic forms, is added to the active principles or to their associations to enable their preparation and stability, modify their organoleptic properties or determine the physicochemical properties of the Pharmaceutical composition and its bioavailability.
  • the "pharmaceutically acceptable” excipient must allow the activity of the compounds of the pharmaceutical composition, that is, to be compatible with said components.
  • galenic form or pharmaceutical form is the provision to which the active ingredients and excipients are adapted to constitute a medicament. It is defined by the combination of the way in which the pharmaceutical composition is presented by the manufacturer and the way in which it is administered.
  • the "vehicle” or carrier is preferably an inert substance.
  • the function of the vehicle is to facilitate the incorporation of other compounds, allow a better dosage and administration or give consistency and form to the pharmaceutical composition. Therefore, the carrier is a substance that is used in the medicament to dilute any of the components of the pharmaceutical composition of the present invention to a certain volume or weight; or that even undiluted said components is capable of allowing a better dosage and administration or give consistency and form to the medication.
  • the pharmaceutically acceptable carrier is the diluent.
  • the excipient and the vehicle must be pharmacologically acceptable, that is, the excipient and the vehicle are allowed and evaluated so as not to cause damage to the organisms to which it is administered.
  • the composition of the present invention can be presented in the form of solutions or any other form of Clinically permitted administration and in a therapeutically effective amount.
  • the pharmaceutical composition of the invention can be formulated in solid, semi-solid, liquid or gaseous forms, such as tablet, capsule, powder, granule, ointment, solution, suppository, injection, inhalant, gel, microsphere or aerosol.
  • the pharmaceutical composition is presented in a form adapted to oral administration.
  • the form adapted to oral administration refers to a physical state that can allow oral administration.
  • Said form adapted to oral administration is selected from the list comprising, but not limited to, drops, syrup, herbal tea, elixir, suspension, extemporaneous suspension, drinkable vial, tablet, capsule, granulate, seal, pill, tablet, tablet, tablet or lyophilized.
  • the pharmaceutical composition is presented in a form adapted to sublingual, nasal, intracatecal, bronchial, lymphatic, rectal, transdermal, inhaled or parenteral administration.
  • the term "therapeutically effective amount” refers to that amount of the component of the pharmaceutical composition that when administered to a mammal, preferably a human, is sufficient to produce prevention and / or treatment. , as defined below, of a disease or pathological condition of interest in the mammal, preferably a human.
  • Said component of the pharmaceutical composition refers to the strain of the invention; or to cellular components, metabolites, secreted molecules; or a combination thereof, and which may optionally be comprised in said composition in combination with an additional bioactive component, and which contribute to the therapeutic effect of the pharmaceutical composition.
  • the therapeutically effective amount will vary, for example, according to the activity of the strain of the invention; of the additional microorganism or additional microorganisms comprising the composition of the invention; of cellular components, metabolites, secreted molecules or any combination thereof, in any form of presentation; the therapeutically effective amount will also vary according to the metabolic stability and duration of action of the compound; the age, body weight, general state of health, sex and diet of the patient; the mode and time of administration; the rate of excretion, the combination of drugs; the severity of the disorder or the particular pathological condition; and the subject who undergoes therapy, but can be determined by a specialist in the art according to their own knowledge and that description.
  • the composition is a food composition of the "medical food” type, hereinafter food composition of the invention.
  • the food composition of the invention also called nutritional composition, is selected from a food (which can be a food for specific nutritional purposes or a medicinal food), a supplement, a nutraceutical, a probiotic or a symbiotic.
  • the food composition of the invention comprises the compound of the invention in an amount effective for the prevention, improvement, relief and / or treatment of obesity and / or metabolic syndrome or a disease related to metabolic syndrome, in mammals, including a human being.
  • Preferred food compositions are selected from the list consisting of: a beverage, milk, yogurt, cheese, fermented milk, flavored milk beverage, soy milk, pre-cooked cereals, bread, cakes, butter, margarine, sauces, frying oils , vegetable oils, corn oil, olive oil, soybean oil, palm oil, sunflower oil, cottonseed oil, condiments, salad dressings, fruit juices, syrups, desserts, glazes and fillings, frozen products Soft, sweet, gum and intermediate foods.
  • the food composition of the invention can be a nutritional or dietary supplement.
  • the nutritional or dietary supplement comprises a sterile composition containing the compound of the invention, preferably provided with a gastric acid resistant coating, being a delayed release composition.
  • the food composition, including the compound of the invention and / or the nutritional or dietary supplement comprises appropriate "carriers" such as diluents, adjuvants, excipients or carriers with which the compound of the invention is administered.
  • Suitable suitable excipients include, but are not limited to starch, glucose, fructose, lactose, sucrose, gelatin, malt, rice, flour, calcium sulfate, silica gel, sodium stearate, glycerol monostearate, talc, sodium chloride, skim milk powder, glycerol, propylene, glycol, water, ethanol, and the like.
  • Such nutritional supplements can be used to combat problems hepatic, and help maintain the health or healthy lifestyle of the mammal, preferably a human being.
  • the term "food composition” or "nutritional composition” as used in the present invention refers to that food that, regardless of providing nutrients to the subject who takes it, beneficially affects one or more functions of the organism, so that It provides a better state of health and well-being.
  • said nutritional composition may be intended for the prevention and / or treatment of a disease or to reduce the risk factors of the disease.
  • dietary supplement synonymous with any of the terms “dietary supplement”, “nutritional supplement”, “food supplement” or “food supplement” is a component or components intended to supplement food, and may be a food.
  • Some examples of dietary supplements are, but are not limited to, vitamins, minerals, botanicals, amino acids and components of foods such as enzymes and glandular extracts. They are not presented as substitutes for a conventional food or as a single component of a food or food diet, but as a complement to the diet.
  • nutraceutical refers to substances isolated from a food and used in a dosage form that have a beneficial effect on health. Said nutraceutical can be a supplement.
  • probiotic refers to microorganisms that when supplied in adequate amounts exert beneficial effects on the health of the host organism.
  • the term "symbiotic” as used in the present invention refers to those foods that contain a mixture of prebiotics and probiotics. As a general rule, they contain a prebiotic component that favors the growth and / or metabolic activity and, in short, the effect of the probiotic with which it is combined, as for example and without limitation it can be the association of fructooligosaccharides or galactooligosaccharides to an intestinal bacteria such as example a strain of the species B. uniformis.
  • the food is selected from the list comprising: dairy product, vegetable product, meat product, snack, chocolate, beverage or infant food.
  • the dairy product is selected from the list comprising, but not limited to, product derived from fermented milk (for example, but not limited to yogurt or cheese) or unfermented (for example, but not limited to, ice cream, butter, margarine, whey ).
  • the vegetable product is, for example, but not limited to, a cereal in any form of presentation, fermented or unfermented.
  • the drink can be, but not limited to, any fruit juice or unfermented milk.
  • treatment refers to combating the effects caused by a disease or pathological condition of interest in a subject (preferably mammal, and more preferably a human) that includes:
  • prevention as understood in the present invention is to prevent the onset of the disease, that is, to prevent the disease or pathological condition from occurring in a subject (preferably mammal, and more preferably a human), in particularly, when said subject has a predisposition for the pathological condition.
  • weight refers to a pathology characterized in that the subject has a body mass index (BMI) equal to or greater than 25.
  • BMI body mass index
  • the BMI has the following formula for its calculation: Mass (Kg) / height2 (m).
  • Overweight is characterized by a BMI between ⁇ 25 to ⁇ 30.
  • the term "obesity" refers to a pathology characterized in that the subject has a BMI is equal to or greater than 30. Obesity is classified in different levels, considering that subjects with BMI> 40 suffer from morbid obesity. Other parameters used to determine if an individual suffers from central obesity are the absolute waist circumference (the subject suffers from obesity when it is> 102 cm in men [central obesity] and> 88 cm in women) or the waist-hip index (the subject suffers obesity when it is> 0.9 for men and> 0.85 for women). An alternative way to determine obesity is to measure the percentage of body fat (the subject is obese when he has approximately> 25% body fat in a man and approximately> 30% body fat in women).
  • exclusion criteria for the included patients were the following: type 2 diabetes mellitus treated with insulin or oral antidiabetics, cardiovascular diseases in the 6 months prior to the inclusion of a study, arthritis, evidence of acute or chronic inflammatory disease , infectious diseases, or those individuals who were receiving medications that could alter the lipid profile or metabolic parameters at the time of inclusion in the study, renal involvement and the patient's decision not to participate in the study.
  • Subjects were invited to participate in the Endocrinology Service of the Virgen de la Victoria Hospital in Malaga (Malaga, Spain). Written informed consent was obtained in all cases and the protocol was approved by the Ethical Committee of the Virgen de la Victoria Hospital.
  • Body weight, height, waist and hip were measured according to standardized procedures.
  • the BMI is calculated as the weight (kilograms) divided by the height (meters) squared.
  • VAT was obtained during bariatric surgery in morbidly obese patients.
  • the biopsy samples were washed in physiological saline buffer and immediately frozen in liquid nitrogen until analysis.
  • Frozen adipose tissue was homogenized with an Ultra-Turrax 8 (Ika, Staufen, Germany).
  • Total RNA was extracted using the RNeasy midi lipid tissue kit (QIAGEN Science, Hilden, Germany), and the total RNA was treated with RNase-free 55 U deoxyribonuclease (QIAGEN Science, Hilden, Germany) following the manufacturer's instructions.
  • RNA purity was determined by absorbance at 260/280 ratio on the Nanodrop ND-1000 spectrophotometer (Thermo Fisher Scientific Inc. of Waltham, MA).
  • TaqMan ® primer / probe assemblies were used as follows: cyclophilin A (4333763, RefSeq NM_002046.3), used as an endogenous control for the target gene in each reaction, TNF alpha (Hs00174128_m1, RefSeq NM_000594.2), IL-6 (Hs00174131_m1, RefSeq NM_000600.2), IL-1 ⁇ (Hs00174097_m1, RefSeq NM_000576.2), CD1 1 b [integrin aM (complement component 3 receptor subunit 3)] (Hs01064804_m1, RefSeq NM_000632.3), the insulin receptor substrate 1 (IRS-1) (Hs00178563_m1, RefSeq.NM_005544.2), insulin receptor substrate 2 (IRS-2) (Hs00275843_s1, RefSeq.
  • cyclophilin A 4333763, RefSeq NM_002046.3
  • NM_003749.2 A threshold cycle (Ct value) was obtained for each amplification curve and a Ct value was first calculated by subtracting the Ct value for human cyclophilin A from cDNA from the Ct value for each sample and transcription. Times of changes compared to the endogenous control were then determined by calculating 2 " ⁇ .
  • Variable regions 2 and 3 of the rRNA were amplified using mixture of Takara Ex Taq PCR (Takara Bio USA, Madison, Wl) and PCR primers HDA1 (5'- GACTCCTACGGGAGGCAGCAGT-3 ') and HDA2 (5'-3- GTATTACCGCGGCTGCTGGCAC ').
  • Direct primers were designed with the adapter sequence A (CGTATCGCCTCCCTCGCGCCA) plus a key sequence (TCAG) and reverse primers with the adapter sequence B (CTATGCGCCTTGCCAGCCCG) plus a key sequence (TCGA).
  • 454-adapters were included in the direct primer followed by a 10 bp Multiplex-specific identifier (MID).
  • the PCR program was created as follows 95 ° C 10 min and 30 cycles of 95 ° C 1 min, 50 ° C 1 min, 1.5 min 72uC followed by 72uC for 10 minOTUs. After agarose gel electrophoresis, the PCR products were purified twice using Agencourt AMPure Kit (Beckman Coulter, Milano, Italy) and quantified using the Quant-iT TM PicoGreen® dsDNA Assay Kit (Invitrogen, Burlington, ON) and An equimolar pool was obtained before further processing and sequencing on a GS 454 junior platform in accordance with the manufacturer's protocols through the use of a titanium chemistry (Roche Applied Science, Indianapolis, IN).
  • Bioinformatic analysis Pyrosequencing data was analyzed using the QIIME 1.8.0 software. The raw readings were first filtered following the 454 amplicon processing. The readings obtained after pyrosequencing were demultiplexed and filtered again using the QIIME splitjibrary.py script. In order to guarantee a higher level of accuracy, the readings were excluded from the analysis if they had an average quality score of less than 25, if there were so-called ambiguous bases, if there were primer mismatches and if they were shorter than 100 bp. The analysis of the pipeline used to analyze the 16S gene was as follows:
  • Operational taxonomic units were collected by grouping sequences in a similarity of> 97% and the representative sequences, chosen as the most abundant in each group, were submitted to the UCLUST to obtain the taxonomy allocation and relative abundance of each OTU using the 16S rRNA Greengenes gene database.
  • the abundance group was achieved with the g-test with the group_significance.py script inside QIIME in order to check if the presence / abundance of any OTUs was significantly associated with a specific group.
  • the weighted UniFrac distance matrix was used to perform the ANOSIM statistical test through the QIIME compare_category.py script, in order to verify if there were differences between the two types of patients.
  • the comparison between the results of morbidly obese patients with and without IR was performed with the Mann-Whitney test. Spearman's correlation coefficients were calculated to estimate the correlations between the variables.
  • Statistical analyzes were performed with the SPSS statistical package version 15.0 (SPSS Inc., Chicago, IL, USA). Values were considered statistically significant when p ⁇ 0.05. The results are presented as the mean ⁇ standard deviation.
  • the samples Prior to the evaluation of the measures of alpha and beta diversity, the samples were normalized to 302 sec, which corresponded to the lowest number of quality readings obtained from any individual sample in the data set.
  • QIIME software generally provides reliable phylogenetic assignments in DNA sequences up to the taxonomic level of gender. However, it has been able to detect the following taxa: Prevotella stercorea, Mitsuokella multacida and Veilloneilla uneven in the IR-MO group.
  • TNF alpha is capable of phosphorylating the serine residue substrate (IRS-1) from the insulin receptor, leading to its inactivation. Therefore, the presence of a local dysbiosis in the appendix and the inflammation caused by these intestinal bacteria of the IR-MO group could be pathological and could be related to the development of IR in morbidly obese patients. The significant increase in Prevotella abundance suggests an evolution of a degrading nichemucin in the IR-MO group.
  • the degradation of mucin by bacteria is often considered as an initial stage in pathogenesis, as it would disturb the protection of the host mucous surfaces and potentially lead to an alteration of the epithelial barrier with an increase in intestinal permeability and facilitate Bacterial translocation and induction of inflammation in the host, as we think possibly occurs in IR-MO patients.
  • the significant increase in CD11 b visceral adipose tissue expression in the IR-MO group may be due to this increase in permeability that trigger an immune response, inflammation, and infiltration of immune cells in liver and adipose tissue. .
  • the inventors have observed a significant positive correlation between the expression visceral adipose tissue of CD1 1 b and the relative abundance of Veillonella in the IR-MO group. These bacteria are capable of fermenting glucose and lactate to propionate, acetate and succinate; however, these short fatty acids do not induce the synthesis of mucin, which could result in a reduction of the tight junction set generating an increase in the permeability of the intestine. This situation is capable of inducing insulin resistance and also reducing levels of secreted intestinal hormones, such as GLP-1 and PYY as described in IR-MO patients in the present study.
  • a possible mechanism to explain the significant decrease in GLP1 and PYY secretion in IR-MO patients may be that their secretion would be modulated by the AGCC produced by their altered intestinal microbiota.
  • the significant decrease in the abundance of Lachnospiraceae and Ruminococcaceae found in this study in the IR-MO group is very relevant because both families are capable of degrading complex polysaccharides to short-chain fatty acids including acetate, butyrate and propionate that can be used. for energy by the host.
  • SCFA act as anti-inflammatory molecules, capable of inhibiting the activation of NF-kB in the host immune cells by binding to G-protein coupled receptors (GPR43 and GPR41), thereby blocking the inflammatory responses and TNF IL6 suppression and release.
  • GPR43 and GPR41 G-protein coupled receptors
  • butyrate induces mucin synthesis, decreases bacterial transport through the epithelium and decreases the permeability of the intestinal epithelium by increasing the expression of tight-binding proteins.
  • butyrate by intestinal bacteria seems to play an important role in blood glucose regulation and lipid metabolism, as shown by fecal transplant studies.
  • negative and significant correlations have been found between the abundance of bacteria such as Butyricimonas (which are the producers of butyrate with anti-inflammatory effects) and Bifidobacterium with plasma glucose and insulin levels, respectively, in the IR-MO patients.
  • Butyricimonas which are the producers of butyrate with anti-inflammatory effects
  • Bifidobacterium levels have also been linked to improved glucose metabolism, insulin resistance and low-grade inflammation. Also I know improved insulin sensitivity after administering donor butyrate intestinal microbiota to male subjects with metabolic syndrome.
  • results of the present invention demonstrate that the abundance of bacteria that can act as opportunistic pathogens such as Pseudomonas and Sutterella are high in the appendix of IR-MO patients relative to NIR-MO patients.
  • the data of the present invention demonstrate that the appendix dysbiosis occurs in morbidly obese patients in the pre-diabetes stage, such as insulin resistance.
  • IR-MO patients show a loss of essential bacteria to maintain intestinal integrity along with an increase in mucin in the degrading bacteria and opportunistic butyrate producing pathogens.
  • the significant increase in the expression of inflammatory cytokine genes and the infiltration of macrophages in adipose tissue caused by the microbiota present in the IR-MO group may suggest that these specific bacteria could initiate inflammation and associated insulin resistance. With obesity These findings could be useful for developing strategies to control the development of insulin resistance by modifying the intestinal microbiota.
  • Triglycerides (mg / dl) 89.04 ⁇ 13.46 159.39 ⁇ 15.9 0.001
  • Insulin (mg / dl) 8.92 ⁇ 1.74 26.93 ⁇ 3.85 0.001
  • Adiponectin (ug / ml) 13.52 ⁇ 3.54 7.44 ⁇ 1.44 0.007
  • IRS1_V 0.014 ⁇ 0.001 0.005 ⁇ 0.001 0.001
  • IRS2_V 0.59 ⁇ 0.15 0.63 ⁇ 0.08 0.633
  • DBP diastolic blood pressure
  • SBP systolic blood pressure
  • GGT Gamma-glutamyl transferase
  • GOT Glutamic oxaloacetic transaminase
  • GPT Glutamic pyruvic transaminase
  • CRP C-reactive protein
  • the Chao wealth estimator and the Shannon diversity estimator were calculated at 3 distance.

Abstract

L'invention concerne un procédé d'obtention de données utiles pour prédire ou pronostiquer le risque d'un individu d'être atteint d'un syndrome métabolique ou d'une maladie liée au syndrome métabolique, de préférence le diabète, un nécessaire et son utilisation.
PCT/ES2017/070003 2015-12-31 2017-01-02 Procédé d'identification d'individus susceptibles d'être atteints de diabète WO2017115001A1 (fr)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
ESP201531946 2015-12-31
ESP201531945 2015-12-31
ES201531946 2015-12-31
ES201531945 2015-12-31

Publications (1)

Publication Number Publication Date
WO2017115001A1 true WO2017115001A1 (fr) 2017-07-06

Family

ID=59225901

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/ES2017/070003 WO2017115001A1 (fr) 2015-12-31 2017-01-02 Procédé d'identification d'individus susceptibles d'être atteints de diabète

Country Status (1)

Country Link
WO (1) WO2017115001A1 (fr)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10869903B2 (en) 2014-11-25 2020-12-22 Evelo Biosciences, Inc. Probiotic and prebiotic compositions, and methods of use thereof for treatment and prevention of graft versus host disease

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2011140208A2 (fr) * 2010-05-04 2011-11-10 University Of Florida Research Foundation, Inc. Méthodes et compositions utilisables en vue du diagnostic et du traitement d'affections auto-immunes

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2011140208A2 (fr) * 2010-05-04 2011-11-10 University Of Florida Research Foundation, Inc. Méthodes et compositions utilisables en vue du diagnostic et du traitement d'affections auto-immunes

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
KRYCH L. ET AL.: "Gut microbial markers are associated with diabetes onset, regulatory imbalance, and IFN- y level in NOD Mice.", GUT MICROBES, vol. 6, no. 2, 3 February 2015 (2015-02-03), pages 101 - 109, XP055396757 *
MORENO- INDIA S I. ET AL.: "Insulin resistance is associated with specific gut microbiota in appendix samples from morbidly obese patients.", AM J TRANSL RES., vol. 8, no. 12, 30 December 2016 (2016-12-30), pages 5672 - 5684, XP055396756 *
MURRI M. ET AL.: "Gut microbiota in children with type 1 diabetes differs from that in healthy children: a case-control study.", BMC MEDICINE, vol. 11, no. 46, 21 February 2013 (2013-02-21), XP021147032 *
SERINO M. ET AL.: "The gut microbiota profile is associated with insulin action in humans.", ACTA DIABETOL., vol. 50, 19 June 2012 (2012-06-19), pages 753 - 761, XP055396758 *

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10869903B2 (en) 2014-11-25 2020-12-22 Evelo Biosciences, Inc. Probiotic and prebiotic compositions, and methods of use thereof for treatment and prevention of graft versus host disease
US10980845B2 (en) 2014-11-25 2021-04-20 Evelo Biosciences, Inc. Probiotic and prebiotic compositions, and methods of use thereof for modulation of the microbiome
US11607432B2 (en) 2014-11-25 2023-03-21 Evelo Biosciences, Inc. Probiotic compositions containing clostridiales for inhibiting inflammation
US11612622B2 (en) 2014-11-25 2023-03-28 Evelo Biosciences, Inc. Probiotic compositions containing clostridiales for inhibiting inflammation
US11672834B2 (en) 2014-11-25 2023-06-13 Evelo Biosciences, Inc. Probiotic and prebiotic compositions, and methods of use thereof for modulation of the microbiome

Similar Documents

Publication Publication Date Title
US11590176B2 (en) Compositions of microbiota and methods related thereto
JP6517429B2 (ja) 細菌株を含む組成物
ES2884049T3 (es) Bacterias de la familia christensenellaceae para su uso como un medicamento, en particular para tratar el sobrepeso, la obesidad, las enfermedades cardiometabólicas y las enfermedades inflamatorias del intestino
ES2764785T3 (es) Bacteroides cect 7771 y su uso en la prevención y tratamiento de sobrepeso, obesidad y alteraciones metabólicas e inmunológicas
US9623055B2 (en) Method for preventing and/or treating insulin resistance
EA037687B1 (ru) ФАРМАЦЕВТИЧЕСКАЯ КОМПОЗИЦИЯ, СОДЕРЖАЩАЯ БАКТЕРИИ РОДА Blautia
EA035949B1 (ru) Применение композиции, содержащей бактериальный штамм вида blautia hydrogenotrophica, и способ лечения или предотвращения висцеральной гиперчувствительности
US10064895B2 (en) Compositions and methods for treating a pathogenic metabolic condition of the gut microbiota and derived diseases
US20230181653A1 (en) Compositions for metabolic health
WO2017115001A1 (fr) Procédé d'identification d'individus susceptibles d'être atteints de diabète
JP2024518084A (ja) 疾患を治療するための組成物及び方法
US20210268037A1 (en) Anaerostipes hadrus for use in promoting health
WO2023092141A2 (fr) Compositions pour santé métabolique
Class et al. Patent application title: Use of Bifidobacterium Animalis for Treating or Preventing Body Weight Gain and Insulin Resistance Inventors: Jian Shen (Shanghai, CN) Jingjing Wang (Shanghai, CN) Liping Zhao (Shanghai, CN) Martin Saul Obin (West Newton, MA, US) Muriel Derrien (Bures Sur Yvette, FR) Emilie Rocher (Massy, FR) Johan Van Hylckama Vlieg (Marly Le Roi, FR) Assignees: TUFTS UNIVERSITY COMPAGNIE GERVAIS DANONE

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 17733934

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 17733934

Country of ref document: EP

Kind code of ref document: A1