WO2017115001A1 - Method for the identification of individuals susceptible to diabetes - Google Patents

Abstract

The invention relates to a method for obtaining data that can be used to predict, or establish a prognosis for the risk of an individual developing metabolic syndrome or a disease associated with metabolic syndrome, preferably diabetes, and to a kit and the use of same.

Description

 METHOD OF IDENTIFICATION OF INDIVIDUALS PROPOSED TO SUFFER

 DIABETES

FIELD OF THE INVENTION The present invention is within the field of medicine, microbiology and nutrition, and specifically refers to a method for predicting or forecasting the probability of an individual suffering from metabolic diseases, and preferably diabetes.

STATE OF THE PREVIOUS TECHNIQUE Obesity is characterized by chronic subclinical inflammation that affects the activity of insulin in its metabolically sensitive tissues (liver tissues, muscle and adipose tissue). Recent studies in the last ten years have shown that this metabolic inflammation is characterized by a moderate excess of cytokine production, including interleukin (IL) IL-6, IL-1 or tumor necrosis factor alpha (TNF alpha), which injures Cellular insulin signals and contributes to insulin resistance and diabetes. But recent research has highlighted the links between intestinal microbiota, obesity and insulin resistance. The growing evidence suggests that the intestinal microbiota contributes to the metabolism of the intestine through communication with adipose tissue influencing the development of metabolic disorders associated with obesity. The intestinal microbiota can contribute to the development of inflammation and insulin resistance by two different mechanisms, either the intestinal microbiota using its metabolic activities that could participate in the extraction of calories from ingested food substances, its storage in the tissue adipose host and increased adipokin production and levels of free fatty acids in plasma, or by chronic inflammation that could induce, or both.

On the other hand, it has been shown that the intestinal microbiota influences intestinal permeability in obese mice, thus promoting the translocation of bacterial products and stimulating the characteristic inflammation of low obesity and insulin resistance. It has been proven that the microbiota profile associated with human obesity is also associated with local and systemic inflammation, although no relationship has been found between the composition of the obese microbiota and intestinal permeability, suggesting that the composition of the microbiota associated with obesity has a pro-inflammatory effect.

The physiological function of the human appendix is largely unknown, but several hypotheses involve interactions between lymphoid tissue that exists in abundance in Appendix 1. and the microbiota contained within the appendix.

Guinane et al. In a recent study they concluded that the human appendix, although sharing a substantial amount of microbes with the intestinal tract, has its own defined microbiome. This microbial composition of the human appendix is subject to extreme variability and comprises a diversity of biota that can play an important role in human health.

According to our results, Meadows described that Firmicutes are related to weight gain and insulin resistance, since they provide an additional source of calories due to the breakage of polysaccharides that are not otherwise digestible in mammals ( Meadows, R. (201 1), Gut Bacteria May Override Genetic Protections against Diabetes, PLoS Biology 9, e1001215, doi: 10.1371 / journal.pbio.1001215) 30. Verdam et al. (Obesity (Silver Spring). 2013; 21: E607-15) similarly, showed that a decrease in Bacteriodetes and an increase in Firmicutes is associated with the presence of obesity and inflammation in humans (Verdam et al. Obesity (Silver Spring). 2013; 21: E607-15) Fusobacterium spp. they have also been considered as pro-inflammatory bacteria that participate in the onset and proliferation of human colorectal cancer (Tjalsma et al. Nat Rev Microbiol. 2012; 10: 575-82).

It would be important to develop a diagnostic method that identifies individuals whose microbiota makes them prone to insulin resistance, as well as the expression of genes related to inflammation and macrophage infiltration into adipose tissue. It would also be important to develop a probiotic composition for the treatment of diseases related to insulin resistance, obesity, and metabolic syndrome, including diabetes.

BRIEF DESCRIPTION OF THE INVENTION

A first invention solves the problem described above with respect to identifying individuals whose microbiota makes them prone to insulin resistance, providing a method comprising: a) obtaining a biological sample isolated from the intestine of said individual, and b) determining the groups taxonomic compounds that make up the intestinal microbiota in the sample isolated from step (a), c) classify the individual from step (a), in the group of individuals with a probability at least 2 times greater, preferably 3 times greater, and more preferably 4 times higher, if you have metabolic syndrome or a disease related to metabolic syndrome, if you have: i) a percentage of Firmicutes and / or Fusobacteria at least 2 times higher, preferably 3 times higher, and more preferably 3.4 times higher than a reference individual, and / or ii) a percentage of Pseudomonaceae, Prevotellaceae, Fusobacteriaceae, Pseudomonas, Prevotella, Catenibacterium, Veillonella and / or Fusobacterium at least 3 times higher, preferably 5 times higher, more preferably 6 times higher, and even more preferably 7 times higher than a reference individual and / or iii) a percentage of Bacteroidetes and Proteobacteria at least 1.5 times lower, more preferably 1.75 times less, and even more preferably 2.1 times lower than that of an individual reference, and / or iv) a percentage of Bacteroidaceae, Lachnospiraceae, Ruminococcaceae, enterobacteria, Bacteroides and Blautia at least 1.5 times lower, more preferably 1.75 times less, and even more preferably 2.1 times lower than that of a reference individual, the reference individual being an individual with morbid obesity sensitive to insulin.

A second invention solves the problem described above referring to a probiotic composition by providing a composition comprising: i) Bacterial strains of the families that are selected from the list comprising

Bacteroidaceae, Lachnospiraceae, Ruminococcaceae, Enterobacteriaceae, Erysipelorichaceae, Odoribacteraceae, Porphyromonadaceae, and / or ii) bacterial strains of the Bacteroides and Blautia genera, and / or

iii) cellular components, metabolites, secreted molecules or any combination thereof, obtained from strain i), strain ii), or both, or from a combination of microorganisms comprising at least one strain i), strain ii), or both, or any combination thereof, for use in the preparation of a medicament for the prevention, relief and / or treatment of overweight, obesity, insulin resistance and / or metabolic syndrome and / or a disease related to the metabolic syndrome. DETAILED DESCRIPTION OF THE INVENTION

The aOTUs of the present invention have studied that the taxonomic groups that make up the intestinal microbiota can be used to predict or predict the risk of an individual suffering from metabolic syndrome or a disease related to metabolic syndrome.

Therefore, a first aspect of the first invention relates to a method of obtaining useful data to predict or predict the risk of an individual suffering from metabolic syndrome or a disease related to metabolic syndrome, hereafter referred to as the first method of invention, comprising: a) obtaining a biological sample isolated from the intestine of said individual, and b) determining the taxonomic groups that make up the intestinal microbiota in the sample isolated from step (a).

Preferably, the biological sample isolated from the individual's intestine is a sample of the cecal appendix. In another preferred embodiment, the disease related to the metabolic syndrome is selected from the list comprising: overweight, obesity, adipocyte hypertrophy, liver steatosis or fatty liver, dyslipidemia, hyperglycemia, insulin resistance and diabetes, metabolic syndrome, hypertension, diseases cardiovascular, immune system dysfunction, or any combination thereof. The determination of the taxonomic groups that make up the intestinal microbiota of step (b) can be performed by any procedure known in the state of the art.

In a preferred embodiment of this aspect of the invention, the determination of the taxonomic groups that make up the intestinal microbiota of step (b) is performed by PCR. In another preferred embodiment of this aspect of the invention, the determination of the taxonomic groups that make up the intestinal microbiota of step (b) further comprises pyrosequencing techniques.

In another preferred embodiment of this aspect of the invention the determination of the taxonomic groups that make up the intestinal microbiota of step (b) comprises a Gradient Denaturing Gel Electrophoresis (DGGE). In another preferred embodiment of this aspect of the invention, the determination of the taxonomic groups that make up the intestinal microbiota of step (b) is performed by antibodies, preferably fluorescent. In another preferred embodiment of this aspect of the invention, the determination of the taxonomic groups that make up the intestinal microbiota of step (b) is performed by fluorescent in situ hybridization (FISH) techniques.

In another preferred embodiment of this aspect of the invention, step (b) further comprises measuring the microbial activity of the taxonomic groups that make up the intestinal microbiota. Preferably, microbial activity is measured, but not limited to, by stable radioisotopes, microelectrodes and / or isotopes.

In this report "taxonomic group" means the group of microorganisms classified in a certain taxonomic category. Normally a taxonomic group that classifies microorganisms covers one or several smaller groups, subordinated to the larger one. A taxonomic category constitutes a classification group. The taxonomic ranges or categories normally used in taxonomy are: Domain, Kingdom, Edge or Division, Class, Order, Family, Genus, Species.

A second aspect of the first invention relates to a method to predict or predict the risk of an individual suffering from metabolic syndrome or a disease related to metabolic syndrome, hereafter referred to as the second method of the invention, which comprises determining taxonomic groups. which make up the intestinal microbiota in an isolated biological sample as described in the first method of the invention, and further comprises: c) classifying the individual from step (a), in the group of individuals with a probability at least 2 times greater, preferably 3 times greater, and more preferably 4 times greater, of suffering from metabolic syndrome or a disease related to metabolic syndrome, if it has: i) a percentage of Firmicutes and / or Fusobacteria at least 2 times higher, preferably 3 times higher, and more preferably 3.4 times higher than that of a reference individual, and / or ii) a percentage of Pseudomonaceae, Prevotellaceae, Fus obacteriaceae, Pseudomonas, Prevotella, Catenibacterium, Veillonella and / or Fusobacterium at least 3 times higher, preferably 5 times higher, more preferably 6 times higher, and even more preferably 7 times higher than that of a reference individual and / or iii) a percentage of Bacteroidetes and Proteobacteria at least 1.5 times lower, more preferably 1.75 times less, and even more preferably 2.1 times lower than that of a reference individual, and / or iv) a percentage of Bacteroidaceae, Lachnospiraceae, Ruminococcaceae, Enterobacteria, Bacteroides and Blautia at least 1.5 times lower, more preferably 1, 75 times less, and even more preferably 2.1 times lower than that of a reference individual, the reference individual being an individual with morbid obesity sensitive to insulin.

In an even more preferred embodiment, morbidly obese subjects sensitive to insulin have a HOMA-IR value <3. This cut-off point was established from the mean ± 2 Standard Deviations of a healthy control population

In another preferred embodiment, the biological sample isolated from the individual's intestine is a sample of the cecal appendix.

In another preferred embodiment, the disease related to the metabolic syndrome is selected from the list comprising: overweight, obesity, adipocyte hypertrophy, liver steatosis or fatty liver, dyslipidemia, hyperglycemia, insulin resistance and diabetes, metabolic syndrome, hypertension, diseases cardiovascular, immune system dysfunction, or any combination thereof.

In an even more preferred embodiment, the disease is diabetes, and even more preferably, type II diabetes.

Steps (b) and / or (c) of the method described above can be totally or partially automated, for example, by means of a robotic sensor device for detecting the presence in step (b) or computerized classification in step (c).

An "isolated biological sample" includes, but is not limited to, cells, tissues and / or biological fluids of an organism, obtained by any method known to a person skilled in the art. Preferably, the isolated biological sample is from the cecal appendix.

In this report it is understood as "cecal appendix" or vermiform appendix to the no-outlet cylinder connected to the intestine blind. In humans, this appendix is an evolutionary vestige that contains a certain bacterial diversity. Preferably, the sample of the cecal appendix comprises all the parts of the tissue that comprise it.

In this report, Firmicutes is understood as the microorganisms that make up this Phylum. Almost all the bacteria of this Phylum are Gram positive although it includes Gram negative and others that lack a cell wall. The group is divided into several classes: Bacilli, facultative or obligated aerobes, Clostridia, anaerobic organisms, Mollicutes etc. In phylogenetic trees, the first two groups appear to be paraphyletic, so most likely they can be restructured. Currently, more than 274 genres of the Firmicutes edge are recognized. The most important classes are: • Bacilli: Order Bacillales: Bacillus, Listeria, Paenibacillus and Staphylococcus. Lactobacillales order: Enterococcus, Lactobacillus, Lactococcus, Leuconostoc, Oenococcus, Pediococcus and Streptococcus

• Clostridia: Order Clostridium, Desulforudis, Heliobacterium and Peptostreptococcus.

 Within this class are Catenibacterium, Lachnospiraceae and Ruminococcaceae.

• Molí cutes: Mycoplasma, Phytoplasma, Spiroplasma and Ureaplasma

• Erysipelotrichi: Erysipelothrix

• Negativicutes: Selenomonas and Sporomusa. The genus Veillonella is also found.

The genus Blautia is found within Firmicutes. In this report it is understood as Phylobacteria at the edge of anaerobic Gram-negative bound bacteria with lipopolysaccharides. They are bacilli that are found as commensals or pathogens. Families with their most important genera are:

• Leptotrichiaceae: Sebaldella, Sneathia, Streptobacillus, Leptotrichia

• Fusobacteriaceae: Cetobacterium, Fusobacterium, llyobacter, Propionigenium and Psychrilyobacter.

In this report "Pseudomonadaceae" means the family of bacteria that includes Pseudomonas, Commamonas, Cellvibrio, Azotobacter. These genera contain: Azomonas, Azorhizophilus, and Azotobacter. The family Pseudomonadaceae belongs to the domain Bacteria, kingdom Bacteria phylum Proteobacteria, class Gammaproteobacteria, order Pseudomonadales.

In this report "Prevotellacae" means the family of bacteria that belongs to the Bacteroidetes phylum, Bacteroidetes class, order Bacteroidales. They are among the most common cultivable microorganisms of the rumen and back intestine of cattle and sheep, where they help the breakdown of proteins and carbohydrates. They are also present in humans. One of the genres that belong to this family is P revotell a.

In this report Proteobacteria (Proteobacteria) is understood as one of the main groups of bacteria. They include a wide variety of pathogens, such as Escherichia, Salmonella, Vibrio, Helicobacter, Neisseria gonorrhoeae, Burkholderia glumae and many others. Others are free-living, and include many of the bacteria responsible for nitrogen fixation. The most important sub-profiles and classes are: • Subfilo Rhodobacteria: Class Alphaproteobacteria, Betaproteobacteria, Gammaproteobacteria (Order Enterobacteriales and Familia Enterobacteriaceae) and Zetaproteobacteria.

• Subfilo Thiobacteria: Deltaproteobacteria, Epsilonproteobacteria. · Other classes, depending on the aOTUres, would be: Acidobacteria, Chrysiogenetes, Deferribacteres, Aquificae and Elusimicrobia.

The term "individual", as used in the description, refers to animals, preferably mammals, and more preferably, humans. The term "individual" in this report is synonymous with "patient", and is not intended to be limiting in any way, and may be of any age, sex and physical condition.

A third aspect of the first invention relates to a kit or device, hereinafter kit or device of the invention, comprising the elements necessary to identify the taxonomic groups that make up the intestinal microbiota in an isolated sample.

In a preferred embodiment, the kit or device of the invention comprises primers, probes and / or antibodies capable of identifying taxonomic groups by characterizing the 16S region of the rRNA, and where:

- primers or primers are polynucleotide sequences of between 10 and 30 base pairs, more preferably between 15 and 25 base pairs, even more preferably between 18 and

22 base pairs, and still much more preferably about 20 base pairs, having an identity of at least 80%, more preferably at least 90%, even more preferably at least 95%, still much more preferably at least 98%, and particularly 100%, with a fragment of the sequences complementary to SEQ ID NO: 1 (XX), and / or SEQ ID NO: 2 (XXXX);

- the probes are polynucleotide sequences of between 80 and 1100 base pairs, more preferably between 100 and 1000 base pairs, and even more preferably between 200 and 500 base pairs;

- the antibodies are capable of specifically binding to a region formed by any of the amino acid sequences SEQ ID NO: 2

In a preferred embodiment the kit or device of the invention comprises primers for amplifying variable regions of the 16S rRNA gene. Preferably the primers comprise the sequences SEQ ID NO: 3 (primer HDA1) (5'- GACTCCTACGGGAGGCAGCAGT-3 ') and SEQ ID NO: 4 (HDA2 primer) (5'-3- GTATTACCGCGGCTGCTGGCAC'). Direct primers were designed with the adapter sequence A SEQ ID NO: 5 (CGTATCGCCTCCCTCGCGCCA) plus a key sequence SEQ ID NO: 6 (TCAG) and reverse primers with the adapter sequence B SEQ ID NO: 7 (CTATGCGCCTTGCCAGCCCG) plus a sequence SEQ ID NO: 8 (TCGA). 454- adapters were included in the direct primer followed by a 10 bp Multiplex-specific identifier (MID).

In another preferred embodiment of this aspect of the invention, the primers, probes or antibodies are modified or labeled, for example, but not limited to, by radioactive or immunological screening.

In a preferred embodiment of this aspect of the invention, the kit may contain oligonucleotides designed from a known 16S rRNA sequence of microbiota microorganisms, and / or capable of hybridizing with the sequence of said genes for subsequent PCR amplification. . In a particular embodiment the PCR program was created as follows 95 ° C 10 min and 30 cycles of 95 ° C 1 min, 50 ° C 1 min, 1.5 min 72 ° C followed by 72 ° C for 10 minOTUs. After agarose gel electrophoresis, the PCR products were purified twice using Agencourt AMPure Kit (Beckman Coulter, Milano, Italy) and quantified using the Quant-iT ™ PicoGreen® dsDNA Assay Kit (Invitrogen, Burlington, ON) and An equimolar pool was obtained before further processing and sequencing on a GS 454 junior platform in accordance with the manufacturer's protocols through the use of a titanium chemistry (Roche Applied Science, Indianapolis, IN).

In another preferred embodiment, the kit or device of the invention further comprises the elements necessary to perform a massive sequencing, preferably a pyrosequencing. Preferably, the oligonucleotides have modifications in some of their nucleotides, such as, but not limited to, nucleotides having any of their atoms with a radioactive isotope, usually ³² P or tritium, immunologically labeled nucleotides, such as with a molecule of digoxigenin, and / or immobilized in a membrane. Several possibilities are known in the state of the art. The kit of the invention may include positive and / or negative controls. The kit may also contain, without any limitation, buffers, protein extraction solutions, agents to prevent contamination, inhibitors of protein degradation, etc.

On the other hand, the kit can include all the supports and containers necessary for commissioning and optimization. Preferably, the kit further comprises instructions for carrying out the methods of the invention. It is also possible that the oligonucleotide (s) are immobilized in spots on a (preferably solid) surface. In one of its embodiments, the kit comprises a microarray, or microarray of the invention. An RNA microarray is a matrix on a solid substrate (usually a glass holder or a cell of a thin silicon film) that evaluates large amounts of different RNAs that are detectable by specific probes immobilized on spots on a solid substrate. Each spot contains a specific nucleic acid sequence, usually a DNA sequence, such as probes (or indicators). Although the number of spots is not limited in any way, there is a preferred embodiment in which the microarray is customized for the methods of the invention. In one embodiment, said custom matrix comprises fifty spots or less, such as thirty spots or less, including twenty spots or less. Therefore, another aspect of the invention relates to a microarray comprising oligonucleotides designed from a known sequence or an mRNA of the genes, and / or capable of hybridizing with the gene sequences. Thus, for example, oligonucleotide sequences can be constructed on the surface of a chip by sequential elongation of a growing chain with a single nucleotide using photolithography. Thus, the oligonucleotides are anchored at the 3 'end by a method of selective activation of nucleotides, protected by a photolabile reagent, by the selective incidence of light through a photomask. The photomask can be physical or virtual.

Thus, oligonucleotide probes can be between 10 and 100 nucleotides, more preferably, between 20 and 70 nucleotides, and even more preferably, between 24 and 30 nucleotides.

Synthesis in situ on a solid support (for example, glass) could be done using ink-jet technology, which requires longer probes. The supports could be, but not limited to, filters or membranes of NC or nylon (charged), silicon, or glass slides for microscopes covered with aminosilanes, polylysine, aldehydes or epoxy. The probe is each of the chip samples. The target is the sample to be analyzed: messenger RNA, total RNA, a PCR fragment, etc. A fourth aspect of the first invention relates to the use of the kit or device of the invention for obtaining useful data to predict or predict the risk of an individual suffering from metabolic syndrome or a disease related to metabolic syndrome.

In a preferred embodiment, the disease related to the metabolic syndrome is selected from the list comprising: overweight, obesity, adipocyte hypertrophy, hepatic steatosis or fatty liver, dyslipidemia, hyperglycemia, insulin resistance and diabetes, metabolic syndrome, hypertension, cardiovascular diseases, immune system dysfunction, or any combination thereof.

In another even more preferred embodiment, the disease is diabetes, and even more preferably, type II diabetes. A fifth aspect of the invention relates to a computer program comprising program instructions to make a computer carry out the process according to any of the methods of the invention.

In particular, the invention encompasses computer programs arranged on or within a carrier. The carrier can be any entity or device capable of supporting the program. When the program is incorporated into a signal that can be directly transported by a cable or other device or medium, the carrier may be constituted by said cable or other device or means. As a variant, the carrier could be an integrated circuit in which the program is included, the integrated circuit being adapted to execute, or to be used in the execution of, the corresponding processes. For example, the programs could be incorporated into a storage medium, such as a ROM, a CD ROM or a semiconductor ROM, a USB memory, or a magnetic recording medium, for example, a floppy disk or a disk Lasted. Alternatively, the programs could be supported on a transmissible carrier signal. For example, it could be an electrical or optical signal that could be transported through an electrical or optical cable, by radio or by any other means.

The invention also extends to computer programs adapted so that any processing means can implement the methods of the invention. Such programs may have the form of source code, object code, an intermediate source of code and object code, for example, as in partially compiled form, or in any other form suitable for use in the implementation of the processes according to the invention . Computer programs also cover cloud applications based on that procedure.

A sixth aspect of the first invention relates to a computer-readable storage medium comprising program instructions capable of having a computer perform the steps of any of the methods of the invention.

A seventh aspect of the first invention relates to a transmissible signal comprising program instructions capable of having a computer perform the steps of any of the methods of the invention. A nucleic acid or polynucleotide sequence may comprise the five bases that appear biologically (adenine, guanine, thymine, cytosine and uracil) and / or bases other than the five that appear biologically. These bases can serve different purposes, for example, to stabilize or destabilize hybridization; to stimulate or inhibit probe degradation; or as junction points for detectable debris or screening debris. For example, a polynucleotide of the invention may contain one or more modified, non-standard, derivatized base moieties, including, but not limited to, N ⁶ -methyl-adenine, N ⁶ -tert-butyl-benzyl-adenine, imidazole, Substituted imidazoles, 5-fluorouracil, 5-bromouracil, 5- chlorouracil, 5-iodouracil, hypoxanthine, xanthine, 4-acetylcytosine, 5- (carboxyhydroxymethyl) uracil, 5-carboxymethylaminomethyl-2-thiouridine, 5-carboxymethylamino, dihydroxymethylamino, dihydroxymethylaminomethyl D- galactosylqueosine, inosine, N6-isopentenyladenine, 1- methylguanine, 1-methylinosine, 2,2-dimethylguanine, 2-methylladenine, 2-methylguanine, 3-methylcytosine, 5-methylcytosine, N6-methylladenine, 7-methylguanine methylaminomethyluracil, 5-methoxyaminomethyl-2-thiouracil, beta-D-mannosylkeosine, 5'-methoxycarboxymethyluracil, 5-methoxy uracil, 2-methylthio-N6-isopentenyladenine, uracil-5-oxyacetic acid, wybOTUxosine, pesudoucino, pesudoucino, pesudoucino, pesudoucino, pesudoucino, pesudoucino, pesudoucino, pesudoucino, pesudoucino, pesudoucino, pesudoucino, pesudoucino, pesudosycin , 5-methyl-2-thiouracil, 2-thiouracil, 2-thiouracil, 4-thiour acyl, 5-methyluracil (i.e. thymine), uracil-5-oxyacetic acid methyl ester, 3- (3-amino-3-N-2-carboxypropyl) uracil, (acp3) w, 2,6-diaminopurine, and 5-propynyl pyrimidine. Other examples of modified, non-standard, or derivatized base moieties can be found in US Pat. Nos. 6,001.61 1; 5,955,589; 5,844,106; 5,789,562; 5,750,343; 5,728,525; and 5,679,785. In addition, a nucleic acid or polynucleotide sequence may comprise one or more modified sugar moieties including, but not limited to, arabinose, 2-fluoroarabinous, xylulose, and a hexose.

The terms "polynucleotide" and "nucleic acid" are used interchangeably herein, referring to polymeric forms of nucleotides of any length, both ribonucleotides (RNA or RNA) and deoxyribonucleotides (DNA or DNA).

The terms "amino acid sequence", "peptide", "oligopeptide", "polypeptide" and "protein" are used interchangeably herein, and refer to a polymeric form of amino acids of any length, which may be coding or non-coding, Chemically or biochemically modified.

The present invention means biologically active variant or fragment, those variants or fragments of the indicated peptides that have the same physiological, metabolic or immunological effect, or have the same utility as those described. That is, they are functionally equivalent. Such effects can be determined by conventional methods. The term "identity", as used herein, refers to the proportion of identical nucleotides or amino acids between two nucleotide or amino acid sequences that are compared. Sequence comparison methods are known in the state of the art, and include, but are not limited to, the GAG program, including GAP (Devereux et al., Nucleic Acids Research 12: 287 (1984) Genetics Computer Group University of Wisconsin, Madison, (Wl); BLAST, BLASTP or BLASTN, and FASTA (Altschul et al., 1999. J. Mol. Biol. 215: 403-410.

As I have expressed in the section entitled "Brief description of the invention", the present specification additionally provides a probiotic composition. In this sense, a first aspect of the second invention relates to the use of a composition, hereafter referred to as the composition of the invention, comprising: i) Bacterial strains of the families that are selected from the list comprising

Bacteroidaceae, Lachnospiraceae, Ruminococcaceae, Enterobacteriaceae, Erysipelorichaceae, Odoribacteraceae, Porphyromonadaceae, and / or ii) bacterial strains of the genera Bacteroides and Blautia, and / or iii) cellular components, metabolites, secreted molecules or any combination thereof, obtained from strain i), strain ii), or both, or from a combination of microorganisms comprising at least one strain i), strain ii), or both, or any combination thereof, for use in the preparation of a medicine for the prevention, relief and / or treatment of overweight, obesity, insulin resistance and / or metabolic syndrome and / or a disease related to metabolic syndrome.

In a preferred embodiment of this aspect of the invention the disease related to the metabolic syndrome is selected from the list comprising: overweight, obesity, adipocyte hypertrophy, liver steatosis or fatty liver, dyslipidemia, hyperglycemia, insulin resistance, prediabetes, diabetes , metabolic syndrome, hypertension, cardiovascular diseases, immune system dysfunction, or any combination thereof.

In another preferred embodiment of this aspect of the invention, the disease is prediabetes.

In another preferred embodiment of this aspect of the invention, the disease is type diabetes. The composition, defined generally, is a set of components that is formed at least by the strain of the invention in any concentration; or at least by the cellular components, metabolites, secreted molecules of the strain of the invention or any combination thereof; or by a combination thereof. The composition of the invention can additionally comprise at least one lactic or bifidobacterial bacteria of intestinal, food or environmental origin. The lactic bacterium is selected from the list comprising, but not limited to, a bacterium of the genus Bifidobacterium, Lactobacillus, Lactococcus, Enterococcus, Propionibacterium, Leuconostoc, Weissella, Pediococcus or Streptococcus, or any combination thereof. In addition, it can additionally comprise at least one strain of fungus or yeast such as, but not limited to, belonging to the genus Saccharomyces, Candida, Pichia, Debaryomyces, Torulopsis, Aspergillus, Rhizopus, Mucor or Penicillium.

The cells comprising the composition may be non-viable or viable and be at any stage of the state of development or growth (latent, exponential, stationary, etc.), regardless of the morphology present. Preferably, said additional microorganism comprises at least one intestinal bacterium or a lactic bacterium.

Optionally, the composition of the invention may further comprise at least one bioactive component, active substance, active ingredient or therapeutic agent, such as other components of food, plant products and / or drugs. The term "bioactive component" refers to a compound with biological activity in the scope of the patent that can improve or complement the activity of a strain or a combination of bacterial strains described above, of the composition of the invention, including ingredients or food components (for example and without limitation: polyunsaturated fatty acids, conjugated linoleic acid, prebiotics, fiber, guar gum, glucomannan, chitosan, copper picolinate, calcium, etc.), plants, extracts or plant components (for example and without limiting polyphenols, ephedrine or extracts of Ephedra spp., green tea [Camellia sinensis], bitter orange [Citrus aurantium]) and drugs (for example, but not limited to, statins, orlistat, sibutramine, liraglutide etc.) .

Bacteroidaceae Pribram 1933, (Skerman (VBD), McGowan (V.) and Sneath (PHA) (editors): Approved Lists of Bacterial Ñames. Int. J. Syst. Bacteriol., 1980, 30, 225-420) is a family of cellular organisms belonging to the Superreino Bacteria, SuperPhylum Bacteroidetes / Chlorobi group; Phylum Bacteroidetes; Bacteroidia class; Bacteroidales order. The type genus is Bacteroides Castellani & Chalmers 1919 In another preferred embodiment of this aspect of the invention, the bacterium is selected from the Bacteroidaceae family from the genera Bacteroides, Acetofilamentum, Acetomicrobium, Acetothermus, Anaerorhabdum, Capsularis, or any combination thereof. Even more preferably, the genus is Bacteroides. In another preferred embodiment, the genus is Bacteroides and even more preferably the species is selected from the list consisting of B. acidifaciens, B. barnesiae, B. caccae, B. cellulosilyticus, B. chinchillae, B. clarus, B. coprocola , B. coprophilus, B. coprosuis, B. denticanum, B. dorei, B. eggerthii, B. faecichinchillae, B. faecis, B. finegoldii, B. fluxus, B. fragilis, B. galacturonicus, B. gallinarum, B Graminisolvens, B. helcogenes, B. heparinolyticus, B. intestinalis, B. massiliensis, B. nordii, B. oleiciplenus, B. ovatus, B. paurosaccharolyticus, B. plebeius, B. propionicifaciens, B. pyogenes, B. reticulotermitis , B. rodentium, B. salanitronis, B. salyersiae, B. sartorii, B. stercorirosoris, B. stercoris, B. thetaiotaomicron, B. uniformis, B. vulgatus, B. xylanisolvens, B. xylanolyticus, B. zoogleoformans, B Acidifaciens, or any combination thereof. In another preferred embodiment of this aspect of the invention, the bacterium is selected from the family Lachnospiraceae from the genera Acetitomaculum, Anaerofilum, Anaerostipes, Butyrivibrio, Catenibacterium, Catonella, Coprococcus, Johnsonella, Lachnobacterium, Lachnospira, Oribaculum, Pseudobutyrivibrio, Rosesebyribibrio Ruminococcus, Shuttleworthia, Sporobacterium or any combination thereof. In another preferred embodiment of this aspect of the invention, the bacterium is selected from the Ruminococcaceae family from the genera Acetanaerobacterium, Acetivibrio, Anaerobacterium, Anaerofilum, Anaerotruncus, Candidatus Soleaferrea _s Caproiciproducens, Ercella, Ethanoligenens, Faecaliphacterium, Fastmiosphere, Fastmiosphere

Hydrogenoanaerobacterium, Mageeibacillus, Oscillospira, Papillibacter, Pseudobacteroides, Ruminiclostridium, Ruminococcus, Saccharofermentans, Sporobacter, Subdoligranulum, or any combination thereof.

The family Ruminococcaceae Rainey 2010, the type is the genus Ruminococcus Sijpesteijn 1948 (Approved Lists 1980). VALIDATION LIST no. 132. Int. J. Syst. Evol Microbiol., 2010, 60, 469-472. [RAINEY (F.A.): Family VIII. Ruminococcaceae fam. Nov. In: P. DE VOS, G.M. GARRITY, D. JONES, N.R. KRIEG, W. LUDWIG, F.A. RAINEY, K.H. SCHLEIFER and W.B. WHITMAN (editors): Bergey's Manual of Systematic Bacteriology, second edition, vol. 3 (The Firmicutes), Springer, Dordrecht, Heidelberg, London, New York, 2009, p. 1016.]

In another preferred embodiment of this aspect of the invention, the bacterium is selected from the Enterobacteriaceae family from the genera Alishewanella, Alterococcus, Aquamonas, Aranicola, Arsenophonus, Azotivirga, Blochmannia, Brenneria, Buchnera, Budvicia, Buttiauxella, Cedecea, Citrobacter Dickeya, Edwardsiella, Enterobacter, Erwinia, Escherichia, Ewingella, Grimontella, Hafnia, Klebsiella, Kluyvera, Leclercia, Leminorella, Moellerella, Morganella, Obesumbacterium, Pantoea, Paracolobactrum, Pectobacterium, Phlomobacter, Photorhabdus, Plesiomonas, Pragia, Proteus, Providencia, Rahnella, Raoultella, Salmonella, Samsonia, Serratia, Shigella, Sodalis, Tatumella, Trabulsiella, Wigglesworthia, Xenorhabdus, Yersinia, Yokenella or any combination thereof.

In this memory the family Enterobacteriaceae Rahn 1937, is defined as in the current state of the art. The type genus is Escherichia Castellani and Chalmers 1919 (Approved Lists 1980). SKERMAN (V.B.D.), McGOWAN (V.) and SNEATH (P.H.A.) (editors): Approved Lists of Bacterial Ñames. Int. J. Syst. Bacteriol., 1980, 30, 225-420 (Approved Lists of Bacterial Ñames in IJSEM Online - Approved Lists of Bacterial Ñames Amended edition). [RAHN (O.): New principies for the classification of bacteria. Zentralblatt fur Bakteriologie, Parasitenkunde, Infektionskrankheiten und Hygiene. Abteilung II, 1937, 96, 273-286.]

In this report the family Erysipelotrichaceae Verbarg et al. 2004, It is described as in the known state of the art. The type is the genus Erysipelothrix Rosenbach 1909 (Approved Lists 1980).

Etymology: N.L. fem. n. Erysipelothrix, type genus of the family; suff. -aceae, ending denoting a family; N.L. fem. pl. n. Erysipelotrichaceae, the family of Erysipelothrix.

Reference: VERBARG (S.), RHEIMS (H.), EMUS (S.), FRÜHLING (A.), KROPPENSTEDT (R.M.), STACKEBRANDT (E.) and SCHUMANN (P.): Erysipelothrix inopinata sp. nov., isolated in the course of sterile filtration of vegetable peptone broth, and description of Erysipelotrichaceae fam. Nov. Int. J. Syst. Evol Microbiol., 2004, 54, 221-225.

The family Porphyromonadaceae Krieg 2012, is understood as normally in the state of the art. The type genus is Porphyromonas Shah and Collins 1988.

Etymology: N.L. fem. n. Porphyromonas, type genus of the family; suff. - aceae, ending to denote a family; N.L. fem. pl. n. Porphyromonadaceae, the Porphyromonas family.

References: VALIDATION LIST no. 143. Int. J. Syst. Evol Microbiol., 2012, 62, 1-4. [KRIEG (NR): Family IV. Porphyromonadaceae fam. Nov. In NR KRIEG, JT STALEY, DR BROWN, BP HEDLUND, BJ PASTER, NL WARD, W. LUDWIG and WB WHITMAN (editors), Bergey's Manual of Systematic Bacteriology, second edition, vol. 4 (The Bacteroidetes, Spirochaetes, Tenericutes (Mollicutes), Acidobacteria, Fibrobacteres, Fusobacteria, Dictyoglomi, Gemmatimonadetes, Lentisphaerae, Verrucomicrobia, Chlamydiae, and Planctomycetes), Springer, New York, 2011, p. 61.] The organisms of the Porphyromonadaceae family are cellular organisms of the Superein Bacteria; Superphylum Bacteroidetes / Chlorobi group; Phylum Bacteroidetes; Bacteroidia class; Bacteroidales order.

In another preferred embodiment of this aspect of the invention, the bacterium is selected from the Porphyromonadaceae family from the Porphyromonas and Dysgonomonas genera.

In another preferred embodiment of this aspect of the invention, the bacterium is selected within the genus Blautia, and even more specifically from among the species Blautia coccoides, Blautia faecis, Blautia glucerasea, Blautia hansenii, Blautia hydrogenotrophica, Blautia luti, Blautia obeum, Blautia product, Blautia schinkii, Blautia stercoris, Blautia wexierae, or any combination thereof.

In another even more preferred embodiment, the composition of the invention comprises organisms of the species Prevotella stercorea, Mitsuokella multiacida, Veilloneilla dispar and Lactobacillus rhamnosus, or any combination thereof, and even more preferably the composition has a combination of organisms of the species Prevotella stercorea, Mitsuokella multiacida, Veilloneilla dispar and Lactobacillus rhamnosus simultaneously. Even more preferably, the composition of the invention comprises, as living organisms, only those belonging to said species.

In another preferred embodiment of the invention the composition is a pharmaceutical composition, hereinafter pharmaceutical composition of the invention. In addition, the pharmaceutical composition of the invention further comprises a pharmaceutically acceptable carrier and / or excipient.

Even more preferably the pharmaceutical composition of the invention further comprises another active ingredient. Said active principle can be selected among others, but not limited to, among statins, orlistat, sibutramine, liraglutide, or combinations thereof. The pharmaceutical composition is a set of components that is formed at least by the strain of the invention in any concentration; or at least by the cellular components, metabolites, secreted molecules of the strain of the invention or any of its combinations, which has at least one application in the improvement of the physical or physiological or psychological well-being of a subject, which implies an improvement of the state general health or reduction of disease risk. Said pharmaceutical composition may be a medicine.

The term medicament has a more limited meaning than the meaning of "pharmaceutical composition", as defined in the present invention, since the medicament necessarily implies a preventive or therapeutic effect. The medicament referred to in the present invention can be for human or veterinary use. The "medicine for human use" is any substance or combination of substances that is presented as having properties for the treatment or prevention of diseases in humans or that can be used in humans or administered to humans in order to restore, correct or modify physiological functions by exercising a pharmacological, immunological or metabolic action, or to establish a medical diagnosis . The "veterinary medicinal product" is any substance or combination of substances that is presented as having curative or preventive properties with respect to animal diseases or that can be administered to the animal in order to restore, correct or modify its physiological functions by exercising a pharmacological, immunological or metabolic action, or to establish a veterinary diagnosis. "Premixes for medicated feed" prepared to be incorporated into a feed will also be considered "veterinary medicinal products".

The term "excipient" refers to a substance that aids the absorption of any of the components of the composition of the present invention, stabilizes said components or aids in the preparation of the pharmaceutical composition in the sense of giving it consistency or providing flavors that Make it more enjoyable. Thus, the excipients could have the function of keeping the components together such as starches, sugars or cellulose, sweetening function, dye function, drug protection function such as to isolate it from air and / or moisture, function filling a tablet, capsule or any other form of presentation such as dibasic calcium phosphate, a disintegrating function to facilitate the dissolution of the components and their absorption in the intestine, without excluding other types of excipients not mentioned in this paragraph. Therefore, the term "excipient" is defined as that matter which, included in the galenic forms, is added to the active principles or to their associations to enable their preparation and stability, modify their organoleptic properties or determine the physicochemical properties of the Pharmaceutical composition and its bioavailability. The "pharmaceutically acceptable" excipient must allow the activity of the compounds of the pharmaceutical composition, that is, to be compatible with said components.

The "galenic form or pharmaceutical form" is the provision to which the active ingredients and excipients are adapted to constitute a medicament. It is defined by the combination of the way in which the pharmaceutical composition is presented by the manufacturer and the way in which it is administered.

The "vehicle" or carrier is preferably an inert substance. The function of the vehicle is to facilitate the incorporation of other compounds, allow a better dosage and administration or give consistency and form to the pharmaceutical composition. Therefore, the carrier is a substance that is used in the medicament to dilute any of the components of the pharmaceutical composition of the present invention to a certain volume or weight; or that even undiluted said components is capable of allowing a better dosage and administration or give consistency and form to the medication. When the liquid presentation form, the pharmaceutically acceptable carrier is the diluent.

In addition, the excipient and the vehicle must be pharmacologically acceptable, that is, the excipient and the vehicle are allowed and evaluated so as not to cause damage to the organisms to which it is administered.

In each case the form of presentation of the pharmaceutical composition and, therefore, that of the drug, will be adapted to the type of administration used, therefore, the composition of the present invention can be presented in the form of solutions or any other form of Clinically permitted administration and in a therapeutically effective amount. The pharmaceutical composition of the invention can be formulated in solid, semi-solid, liquid or gaseous forms, such as tablet, capsule, powder, granule, ointment, solution, suppository, injection, inhalant, gel, microsphere or aerosol. According to an even more preferred embodiment of the present invention, the pharmaceutical composition is presented in a form adapted to oral administration. The form adapted to oral administration refers to a physical state that can allow oral administration. Said form adapted to oral administration is selected from the list comprising, but not limited to, drops, syrup, herbal tea, elixir, suspension, extemporaneous suspension, drinkable vial, tablet, capsule, granulate, seal, pill, tablet, tablet, tablet or lyophilized. Another possibility is that the pharmaceutical composition is presented in a form adapted to sublingual, nasal, intracatecal, bronchial, lymphatic, rectal, transdermal, inhaled or parenteral administration. The strain of the invention; the cellular components, metabolites, secreted molecules or any combination thereof, obtained from the strain of the invention, or the composition of the invention; they can be associated, for example, but not limited to liposomes or micelles.

In the sense used in this description, the term "therapeutically effective amount" refers to that amount of the component of the pharmaceutical composition that when administered to a mammal, preferably a human, is sufficient to produce prevention and / or treatment. , as defined below, of a disease or pathological condition of interest in the mammal, preferably a human. Said component of the pharmaceutical composition refers to the strain of the invention; or to cellular components, metabolites, secreted molecules; or a combination thereof, and which may optionally be comprised in said composition in combination with an additional bioactive component, and which contribute to the therapeutic effect of the pharmaceutical composition. The therapeutically effective amount will vary, for example, according to the activity of the strain of the invention; of the additional microorganism or additional microorganisms comprising the composition of the invention; of cellular components, metabolites, secreted molecules or any combination thereof, in any form of presentation; the therapeutically effective amount will also vary according to the metabolic stability and duration of action of the compound; the age, body weight, general state of health, sex and diet of the patient; the mode and time of administration; the rate of excretion, the combination of drugs; the severity of the disorder or the particular pathological condition; and the subject who undergoes therapy, but can be determined by a specialist in the art according to their own knowledge and that description.

In another preferred embodiment of the invention the composition is a food composition of the "medical food" type, hereinafter food composition of the invention. Preferably, the food composition of the invention, also called nutritional composition, is selected from a food (which can be a food for specific nutritional purposes or a medicinal food), a supplement, a nutraceutical, a probiotic or a symbiotic.

The food composition of the invention comprises the compound of the invention in an amount effective for the prevention, improvement, relief and / or treatment of obesity and / or metabolic syndrome or a disease related to metabolic syndrome, in mammals, including a human being. Preferred food compositions are selected from the list consisting of: a beverage, milk, yogurt, cheese, fermented milk, flavored milk beverage, soy milk, pre-cooked cereals, bread, cakes, butter, margarine, sauces, frying oils , vegetable oils, corn oil, olive oil, soybean oil, palm oil, sunflower oil, cottonseed oil, condiments, salad dressings, fruit juices, syrups, desserts, glazes and fillings, frozen products Soft, sweet, gum and intermediate foods. The food composition of the invention can be a nutritional or dietary supplement. In another preferred embodiment, the nutritional or dietary supplement comprises a sterile composition containing the compound of the invention, preferably provided with a gastric acid resistant coating, being a delayed release composition. In another preferred embodiment, the food composition, including the compound of the invention and / or the nutritional or dietary supplement comprises appropriate "carriers" such as diluents, adjuvants, excipients or carriers with which the compound of the invention is administered. Suitable suitable excipients include, but are not limited to starch, glucose, fructose, lactose, sucrose, gelatin, malt, rice, flour, calcium sulfate, silica gel, sodium stearate, glycerol monostearate, talc, sodium chloride, skim milk powder, glycerol, propylene, glycol, water, ethanol, and the like. Such nutritional supplements can be used to combat problems hepatic, and help maintain the health or healthy lifestyle of the mammal, preferably a human being.

The term "food composition" or "nutritional composition" as used in the present invention refers to that food that, regardless of providing nutrients to the subject who takes it, beneficially affects one or more functions of the organism, so that It provides a better state of health and well-being. As a consequence, said nutritional composition may be intended for the prevention and / or treatment of a disease or to reduce the risk factors of the disease.

The term "supplement", synonymous with any of the terms "dietary supplement", "nutritional supplement", "food supplement" or "food supplement" is a component or components intended to supplement food, and may be a food. Some examples of dietary supplements are, but are not limited to, vitamins, minerals, botanicals, amino acids and components of foods such as enzymes and glandular extracts. They are not presented as substitutes for a conventional food or as a single component of a food or food diet, but as a complement to the diet.

The term "nutraceutical" as used in the present invention refers to substances isolated from a food and used in a dosage form that have a beneficial effect on health. Said nutraceutical can be a supplement. The term "probiotic" as used in the present invention refers to microorganisms that when supplied in adequate amounts exert beneficial effects on the health of the host organism.

The term "symbiotic" as used in the present invention refers to those foods that contain a mixture of prebiotics and probiotics. As a general rule, they contain a prebiotic component that favors the growth and / or metabolic activity and, in short, the effect of the probiotic with which it is combined, as for example and without limitation it can be the association of fructooligosaccharides or galactooligosaccharides to an intestinal bacteria such as example a strain of the species B. uniformis.

According to a more preferred embodiment of the above, the food is selected from the list comprising: dairy product, vegetable product, meat product, snack, chocolate, beverage or infant food. The dairy product is selected from the list comprising, but not limited to, product derived from fermented milk (for example, but not limited to yogurt or cheese) or unfermented (for example, but not limited to, ice cream, butter, margarine, whey ). The vegetable product is, for example, but not limited to, a cereal in any form of presentation, fermented or unfermented. The drink can be, but not limited to, any fruit juice or unfermented milk.

The term "treatment", as understood in the present invention, refers to combating the effects caused by a disease or pathological condition of interest in a subject (preferably mammal, and more preferably a human) that includes:

(i) inhibit the disease or pathological condition, that is, stop its development;

(ii) alleviate the disease or the pathological condition, that is, cause the regression of the disease or the pathological condition or its symptomatology;

(iii) stabilize the disease or pathological condition. The term "prevention" as understood in the present invention is to prevent the onset of the disease, that is, to prevent the disease or pathological condition from occurring in a subject (preferably mammal, and more preferably a human), in particularly, when said subject has a predisposition for the pathological condition.

The term "overweight" refers to a pathology characterized in that the subject has a body mass index (BMI) equal to or greater than 25. BMI is a measure of association between the weight and height of an individual. The BMI has the following formula for its calculation: Mass (Kg) / height2 (m). Overweight is characterized by a BMI between ≥ 25 to <30.

The term "obesity" refers to a pathology characterized in that the subject has a BMI is equal to or greater than 30. Obesity is classified in different levels, considering that subjects with BMI> 40 suffer from morbid obesity. Other parameters used to determine if an individual suffers from central obesity are the absolute waist circumference (the subject suffers from obesity when it is> 102 cm in men [central obesity] and> 88 cm in women) or the waist-hip index (the subject suffers obesity when it is> 0.9 for men and> 0.85 for women). An alternative way to determine obesity is to measure the percentage of body fat (the subject is obese when he has approximately> 25% body fat in a man and approximately> 30% body fat in women).

Throughout the description and the claims the word "comprises" and its variants are not intended to exclude other technical characteristics, additives, components or steps. For those skilled in the art, other objects, advantages and features of the invention will be derived partly from the description and partly from the practice of the invention. The following examples and figures are provided by way of illustration, and are not intended to be limiting of the present invention. Throughout the description and the claims the word "comprises" and its variants are not intended to exclude other technical characteristics, additives, components or steps. For those skilled in the art, other objects, advantages and features of the invention will be derived partly from the description and partly from the practice of the invention. The following examples and drawings are provided by way of illustration, and are not intended to be limiting of the present invention.

EXAMPLES OF THE INVENTION

Material and methods

Appendix samples of 5 IR-MO (insulin resistant morbidly obese) patients and 5 NIR-MO (insulin sensitive morbidly obese) patients matched by BMI (body mass index), age, sex and race (Table 1) They were obtained during gastric bypass surgery. The samples were washed, fragmented, and frozen in liquid nitrogen before being stored at -80 ° C. Individuals affected by liver disease and thyroid dysfunction were specifically excluded by biochemical processing. Other exclusion criteria for the included patients were the following: type 2 diabetes mellitus treated with insulin or oral antidiabetics, cardiovascular diseases in the 6 months prior to the inclusion of a study, arthritis, evidence of acute or chronic inflammatory disease , infectious diseases, or those individuals who were receiving medications that could alter the lipid profile or metabolic parameters at the time of inclusion in the study, renal involvement and the patient's decision not to participate in the study. Subjects were invited to participate in the Endocrinology Service of the Virgen de la Victoria Hospital in Malaga (Malaga, Spain). Written informed consent was obtained in all cases and the protocol was approved by the Ethical Committee of the Virgen de la Victoria Hospital.

Analysis of the biochemical variables

Blood samples were taken after the overnight fast. The serum was separated into aliquots and immediately frozen at -80 ° C. Serum glucose levels, cholesterol, triglycerides and HDL cholesterol were analyzed using a Dimension Analyzer (Dade Behring Inc., Deerfield, IL) by enzymatic methods (Randox Laboratories Ltd., UK). LDL cholesterol was calculated from the Friedewald equation. Gamma-glutamyl transpeptidase, glutamate oxaloacetate transaminase and pyruvic glutamic transaminase (Wako Bioproducts, Richmond, VA, USA) were measured using standard enzymatic methods. In addition, insulin was quantified by RIA provided by BioSource SA (Nivelles, Belgium). High sensitivity C-reactive protein (CRP) levels were measured by ELISA BLK Diagnostic kit (Badalona, Spain). Leptin and adiponectin were analyzed by (ELISA) enzyme immunoassay kits (DSL, Webster, TX, and DRG Diagnostics GmbH, Germany, respectively). GLP-1 was measured by a human GLP-1 enzyme immunoassay (EIA) kit from Phoenix Pharmaceuticals (Karisruhe, Germany). PYY was measured using a human PYY EIA kit from Phoenix Pharmaceuticals (Karisruhe, Germany). HOMA-IR was calculated from fasting insulin and glucose with the following equation: HOMA-IR = fasting insulin (mlll / ml) / fasting glucose (mol / L) /22.5.

Anthropometric measures

Body weight, height, waist and hip were measured according to standardized procedures. The BMI is calculated as the weight (kilograms) divided by the height (meters) squared.

visceral adipose tissue mRNA

VAT was obtained during bariatric surgery in morbidly obese patients. The biopsy samples were washed in physiological saline buffer and immediately frozen in liquid nitrogen until analysis. Frozen adipose tissue was homogenized with an Ultra-Turrax 8 (Ika, Staufen, Germany). Total RNA was extracted using the RNeasy midi lipid tissue kit (QIAGEN Science, Hilden, Germany), and the total RNA was treated with RNase-free 55 U deoxyribonuclease (QIAGEN Science, Hilden, Germany) following the manufacturer's instructions. RNA purity was determined by absorbance at 260/280 ratio on the Nanodrop ND-1000 spectrophotometer (Thermo Fisher Scientific Inc. of Waltham, MA). The integrity of the total purified RNA is verified by electrophoresis in denaturing agarose gel and staining with ethidium bromide. Total RNA was reverse transcribed into cDNA by using a high capacity cDNA reverse transcription kit with RNase inhibitor (Applied Biosystems, Foster City, CA). The cDNA was used for quantitative real-time PCR with duplicates. The amplifications were performed with a 96-well optical reaction MicroAmpH plate (Applied Biosystems, Foster City, CA) in a Fast Real-Time System ABI 7500 PCR (Applied Biosystems, Foster City, CA). Commercially available and previously validated TaqMan ® primer / probe assemblies were used as follows: cyclophilin A (4333763, RefSeq NM_002046.3), used as an endogenous control for the target gene in each reaction, TNF alpha (Hs00174128_m1, RefSeq NM_000594.2), IL-6 (Hs00174131_m1, RefSeq NM_000600.2), IL-1 β (Hs00174097_m1, RefSeq NM_000576.2), CD1 1 b [integrin aM (complement component 3 receptor subunit 3)] (Hs01064804_m1, RefSeq NM_000632.3), the insulin receptor substrate 1 (IRS-1) (Hs00178563_m1, RefSeq.NM_005544.2), insulin receptor substrate 2 (IRS-2) (Hs00275843_s1, RefSeq. NM_003749.2). A threshold cycle (Ct value) was obtained for each amplification curve and a Ct value was first calculated by subtracting the Ct value for human cyclophilin A from cDNA from the Ct value for each sample and transcription. Times of changes compared to the endogenous control were then determined by calculating 2 ^"Δα .

RNA extraction from cecal appendix

Total RNA was extracted from cecal appendix samples using a commercially available TriPure isolation reagent (Roche). The extracted RNAs will be treated with DNase (DNase Set RNase free; Qiagen). The RNA concentration was determined by absorbance at 260 nm (A260), and the purity was estimated by determining the A260 / A280 ratio with a Nanodrop spectrophotometer (Nanodrop Technologies, Wilmington, DE). The integrity of the total purified RNA is verified by electrophoresis in denaturing agarose gel and staining with ethidium bromide. cDNA will be synthesized using transcriptase superscripts II and random hexamers inverse primers as described in the manufacturer's protocol (Invitrogen Corp).

PCR amplification and sequence analysis of 16S rDNA

Variable regions 2 and 3 of the rRNA were amplified using mixture of Takara Ex Taq PCR (Takara Bio USA, Madison, Wl) and PCR primers HDA1 (5'- GACTCCTACGGGAGGCAGCAGT-3 ') and HDA2 (5'-3- GTATTACCGCGGCTGCTGGCAC '). Direct primers were designed with the adapter sequence A (CGTATCGCCTCCCTCGCGCCA) plus a key sequence (TCAG) and reverse primers with the adapter sequence B (CTATGCGCCTTGCCAGCCCG) plus a key sequence (TCGA). 454-adapters were included in the direct primer followed by a 10 bp Multiplex-specific identifier (MID). The PCR program was created as follows 95 ° C 10 min and 30 cycles of 95 ° C 1 min, 50 ° C 1 min, 1.5 min 72uC followed by 72uC for 10 minOTUs. After agarose gel electrophoresis, the PCR products were purified twice using Agencourt AMPure Kit (Beckman Coulter, Milano, Italy) and quantified using the Quant-iT ™ PicoGreen® dsDNA Assay Kit (Invitrogen, Burlington, ON) and An equimolar pool was obtained before further processing and sequencing on a GS 454 junior platform in accordance with the manufacturer's protocols through the use of a titanium chemistry (Roche Applied Science, Indianapolis, IN).

Bioinformatic analysis Pyrosequencing data was analyzed using the QIIME 1.8.0 software. The raw readings were first filtered following the 454 amplicon processing. The readings obtained after pyrosequencing were demultiplexed and filtered again using the QIIME splitjibrary.py script. In order to guarantee a higher level of accuracy, the readings were excluded from the analysis if they had an average quality score of less than 25, if there were so-called ambiguous bases, if there were primer mismatches and if they were shorter than 100 bp. The analysis of the pipeline used to analyze the 16S gene was as follows:

Those sequences that passed the quality filter were selected;

 - Operational taxonomic units (Otus) were collected by grouping sequences in a similarity of> 97% and the representative sequences, chosen as the most abundant in each group, were submitted to the UCLUST to obtain the taxonomy allocation and relative abundance of each OTU using the 16S rRNA Greengenes gene database.

 - Alpha and beta diversity were evaluated through QIIME as recently described (De Filippis et aal., 2013. PLoS One. 8: e70222.).

Statistic analysis

The abundance group was achieved with the g-test with the group_significance.py script inside QIIME in order to check if the presence / abundance of any OTUs was significantly associated with a specific group. The weighted UniFrac distance matrix was used to perform the ANOSIM statistical test through the QIIME compare_category.py script, in order to verify if there were differences between the two types of patients. The comparison between the results of morbidly obese patients with and without IR was performed with the Mann-Whitney test. Spearman's correlation coefficients were calculated to estimate the correlations between the variables. Statistical analyzes were performed with the SPSS statistical package version 15.0 (SPSS Inc., Chicago, IL, USA). Values were considered statistically significant when p <0.05. The results are presented as the mean ± standard deviation.

RESULTS

Biochemical and clinical characteristics together with the expression of genes in visceral adipose tissue in both study groups. The metabolic and anthropometric characteristics of the two study groups are shown in Table 1. Plasma levels of triglycerides, insulin, glucose, CRP, leptin and HOMA-IR values were significantly higher in the IR-MO group than in the IR-MO group. the NIR group MO (P <0.05). Conversely, GLP-1, PYY and the level of adiponectin was significantly higher in the NIR-MO group compared to the IR-MO group (P <0.05).

On the other hand, higher levels of mRNA expression in visceral adipose tissue of IL6, IL1 B, TNF-alpha, IRS2 and CD11 b have also been found in the IR-MO group with respect to the NIR-MO group (P <0, 05). Only IRS1 expression levels in fat viscera tissue were significantly higher in the NIR-MO group (P <0.05).

Analysis of the diversity of microbial communities among the study groups.

A total of 45,820 sequences of good quality 16S rRNA genes with an average of 4,582 ± 2,674.45 sequences per sample passed the filters applied through QIIME. To obtain a detailed structural view of the microbiome of each subject enrolled in this study, an operative analysis of taxonomic unit (OTU) has been developed. The microbiota after QIIME was composed of 1,128 OTUS with a relative abundance greater than 1% in at least two samples (97% similarity of cut).

Prior to the evaluation of the measures of alpha and beta diversity, the samples were normalized to 302 sec, which corresponded to the lowest number of quality readings obtained from any individual sample in the data set. The IR-MO group had a higher number of OTUs than the NIR-MO group (mean = 303 versus average = 282, respectively, P> 0.05).

The average diversity (Shannon index) and community wealth (Chao index) were calculated to estimate alpha diversity. The indices of each Chao and Shannon group suggested a similar bacterial richness and diversity in the appendix samples of the NIR-MO group compared to those of the IR-MO group, without significant differences (P = 0.89 and P = 0, 59, respectively) (Table 2). As noted, the distance began to stabilize at approximately 100 readings, suggesting that a larger number of readings per sample would not have provided a broader catalog of bacterial rate.

The Unweighted PCoA Principal UniFrac analysis based on the relative abundance of OTUs for each sample showed useful information about the phylogenetic relationship between the bacterial appendix microbiota in both study groups. All samples of the IR-MO group were not totally separated from the NIR-MO group in coordinate combinations, as demonstrated by the two main components of scores that represent 23% and 16% of the total variations. ANOSIM with permutations revealed no significant differences between the groups (P = 0.46), indicating that there is no notable separation between the two groups (Figure 1).

Pyrosequencing of the 16S rRNA gene from samples of patients with and without insulin resistance.

In this study, there were variations in the composition of the appendix microbiota of the IR-MO and NIR-MO groups at different bacterial levels. At phyla level most of the OTUs belonged to Bacteroidetes (37.25% vs. 51, 67% IR NIR, P = 0.02), Firmicutes was the next most abundant (47.98% vs. 21, 45% IR NIR, P <0.001), followed by Proteobacteria (7.23 IR% vs. 25.90% NIR, P <0.001) and Fusobacteria (7.35% vs. 1.56% IR NIR, P <0.001), which exhibited significant differences between both the IR-MO and the NIR-MO study groups. The remainder of the bacterial population belonged to another 9 phyla that had a relative abundance of less than 1% (Figure 2). In addition, the proportion of Firmicutes / Bacteroidetes was significantly different between the two study groups (1.28% vs. 0.41% IR NIR, P <0.001).

Within the twenty-two families detected among all groups, sixteen families were detected with a relative abundance greater than 1% in at least one group. With respect to the IR-MO group, we have found a significant increase in Pseudomonaceae (27.83% vs. 20.72% IR NIR, P <0.001), Prevotellaceae (7.89% vs. 0.46% IR NIR, P = 0.01), and on the other hand in the only family within the edges Fusobacteria, Fusobacteriaceae (P <0.001); and a significant decrease in the abundance of Bacteroidaceae (49.92% vs. 70.41% IR NIR, P = 0.03), Lachnospiraceae (36, 1 1% vs. 43.26% IR NIR, P <0.001) , Ruminococcaceae (34.85% vs. 43.61% IR NIR, P <0.001) and Enterobacteriaceae (20.00% vs. 36.04% IR NIR, P <0.001). On the other hand, no significant differences were found between both study groups in other abundant families, including Erysipelorichaceae (5.56% vs. 5.08% IR NIR, P = 0.064), Odoribacteraceae (7.25% vs. 8.04% IR NIR, P = 0.659 ), Porphyromonadaceae (0.48% vs. 2.65% IR NIR, P = 0.108), Christensenellaceae (3.03% vs. 0.70% IR NIR, P = 0.783), Rikenellaceae (34.30% vs. 17.53% IR NIR , P = 0.297), Alcaligenaceae (20.87 IR% vs. 4.68% NIR, P = 589), Succinovibrionaceae (19, 13% vs. 1.5% IR NIR, P = 0.982), Veillonellaceae (14.39% vs. 5.08% IR NIR, P = 0.984), and Peptococcaceae (1.26% IR vs. 0.53% NIR, P = 0.668) (Figure 3). Significant differences in the microbial composition at the gender level have also been found between the study groups. A total of twenty-eight genera were identified between the samples in the appendix, with six significantly different genera between the NIR-MO and IR-MO groups. Pseudomonas (27.83% vs. 20.72% IR NIR, P <0.001), Catenibacterium (3.54% vs. 0.88% IR NIR, P = 0.027), Prevotella (7.89% vs. 0.46% IR NIR, P = 0.01), Veillonella (2.27% IR vs. 0% NIR, P <0.001) and Fusobacterium (P < 0.001), reached more significant abundance in the IR-MO group within the constitutive genera more than 1% of the phyclic bacteria in the samples of the appendix. On the other hand, Bacteroides (49.76% vs. 67.85% IR NIR, P = 0.05) and Blautia (5.56% vs. 8.41% IR NIR, P = 0.013) exhibited a significantly greater abundance in patients N IR-MO compared to patients IR-MO. In addition, Odoribacter (6.12% vs. 5.48% IR NIR, P = 0.702), Sutterella (20.87% vs. 4.68% IR NIR, P = 0.589), Succinovibrio (19, 13% vs. 0% IR NIR, P = 1,000), Lachnospira (2.02% vs. 1.75% IR NIR, P = 0.356), Oscillospira (4.04% vs. 1.05% IR, P = 0.770), and Ruminococcus (3.03% vs. 0.35% IR NIR, P = 0.637), are the dominant genera in the IR-MO group, while Butyricimonas (1.13% vs. 2.56% IR NIR, P = 0.395), Parabacteroides (0.48% vs. 2.65% IR NIR, P = 0.107), Megamonas ( 0.25 vs. 1.75% IR NIR, P = 0.650) and Phascolarctobacterium (1.26% vs. 3.33% IR NIR, P = 0.956) dominated in the NIR-MO group. The differences in the abundance of all these minority genera between the NIR-MO IR-MO groups and were not significant (P> 0.05 in all cases) (Figure 4).

QIIME software generally provides reliable phylogenetic assignments in DNA sequences up to the taxonomic level of gender. However, it has been able to detect the following taxa: Prevotella stercorea, Mitsuokella multacida and Veilloneilla uneven in the IR-MO group.

Relationship between the composition of the intestinal microbiota, the clinical parameters and the gene expression inflammation in the visceral adipose tissue of both study groups.

In patients with IR-MO, a significant univariate correlation was found between the abundance of specific bacterial groups and plasma glucose levels (r = -0.918 Butyricimonas, P = 0.028), plasma insulin levels (Bifidobacterium r = -0.975, P = 0.005), IL6 expression levels {Prevotella r = 0.921, p = 0.026), IL1 B {Firmicutes r = 0.963, P = 0.009), TNF alpha (Succinovibrio r = 0.975, P = 0.005) and CD11 b (Veillonella r = 0.894, P = 0.041). No significant correlation was found in the NIR-MO group (P <0.05).

Discussion

This study is the first to use appendix samples to establish that IR-MO and NIR-MO patients are associated with a specific intestinal microbial profile using next generation sequencing technologies. Although they are available in the microbial composition of the appendix, it has been postulated that this organ could serve as a microbial reservoir to repopulate the gastrointestinal tract in times of need. The tissue Associated lymphoid of the appendix has been recognized to provide an ideal environment for the growth of bacteria in biofilms that act as an enteric reservoir. In this study to analyze the relationship between the composition of the microbiota and the presence of insulin resistance in morbidly obese patients, factors such as BMI, race, gender and age of study subjects have been taken into account .

The results of the inventors indicate that IR-MO patients have not increased bacterial diversity since there is no separate cluster when compared to the NIR-MO group, clearly indicated by OTU-based PCoA. But the pyrosequencing analysis of the 16S rRNA gene sequences of the relative abundances of predominant, familial and genus taxa in appendix samples revealed large differences between the NIR-MO and IR-MO patients. These results suggest that the dominant microbiota is different in IR-mo patients compared to NIR-MO patients. Alterations of the intestinal microbiota have also been suggested to occur in other human diseases such as Crohn's disease patients, patients with ulcerative colitis, children with celiac disease, and babies suffering from allergic inflammation.

On the other hand, morbidly obese patients with an IR microbiota phenotype had a higher rate of systemic inflammation with a significant increase in C-reactive protein and leptin levels, and a decrease in serum adiponectin levels. Recent data have shown that variations in the intestinal microbiota were associated with pro-inflammatory changes in adipose gene expression. This study has also found a significant increase in the level of expression of inflammatory markers such as IL6, IL1 B and TNF alpha in the visceral adipose tissue of IR-MO patients. On the other hand there is a positive and significant correlation of the abundance of Prevotella, Succinovibrio and Firmicutes with the level of visceral adipose tissue expression of IL6, TNF alpha and IL1 B respectively. A few years ago, Burcellin et al. He suggested that the so-called "metabolic infection" might exist, suggesting that the intestinal microbiota could be an important factor in low degree of systemic inflammation and the development of insulin resistance. In this study using animal models, aOTUres showed that before the onset of diabetes, and shortly after the mice were switched to a high-fat diet, intestinal bacteria translocated from the intestine to adipose tissue and blood in which they could induce a low grade inflammation. It has also been described that TNF alpha is capable of phosphorylating the serine residue substrate (IRS-1) from the insulin receptor, leading to its inactivation. Therefore, the presence of a local dysbiosis in the appendix and the inflammation caused by these intestinal bacteria of the IR-MO group could be pathological and could be related to the development of IR in morbidly obese patients. The significant increase in Prevotella abundance suggests an evolution of a degrading nichemucin in the IR-MO group. The degradation of mucin by bacteria is often considered as an initial stage in pathogenesis, as it would disturb the protection of the host mucous surfaces and potentially lead to an alteration of the epithelial barrier with an increase in intestinal permeability and facilitate Bacterial translocation and induction of inflammation in the host, as we think possibly occurs in IR-MO patients. In addition, the significant increase in CD11 b visceral adipose tissue expression in the IR-MO group may be due to this increase in permeability that trigger an immune response, inflammation, and infiltration of immune cells in liver and adipose tissue. . On the other hand, the inventors have observed a significant positive correlation between the expression visceral adipose tissue of CD1 1 b and the relative abundance of Veillonella in the IR-MO group. These bacteria are capable of fermenting glucose and lactate to propionate, acetate and succinate; however, these short fatty acids do not induce the synthesis of mucin, which could result in a reduction of the tight junction set generating an increase in the permeability of the intestine. This situation is capable of inducing insulin resistance and also reducing levels of secreted intestinal hormones, such as GLP-1 and PYY as described in IR-MO patients in the present study. A possible mechanism to explain the significant decrease in GLP1 and PYY secretion in IR-MO patients may be that their secretion would be modulated by the AGCC produced by their altered intestinal microbiota. The significant decrease in the abundance of Lachnospiraceae and Ruminococcaceae found in this study in the IR-MO group is very relevant because both families are capable of degrading complex polysaccharides to short-chain fatty acids including acetate, butyrate and propionate that can be used. for energy by the host. In addition, these SCFA act as anti-inflammatory molecules, capable of inhibiting the activation of NF-kB in the host immune cells by binding to G-protein coupled receptors (GPR43 and GPR41), thereby blocking the inflammatory responses and TNF IL6 suppression and release. In addition, previous studies have also shown that butyrate induces mucin synthesis, decreases bacterial transport through the epithelium and decreases the permeability of the intestinal epithelium by increasing the expression of tight-binding proteins.

The production of butyrate by intestinal bacteria seems to play an important role in blood glucose regulation and lipid metabolism, as shown by fecal transplant studies. In the present study, negative and significant correlations have been found between the abundance of bacteria such as Butyricimonas (which are the producers of butyrate with anti-inflammatory effects) and Bifidobacterium with plasma glucose and insulin levels, respectively, in the IR-MO patients. In previous studies, Bifidobacterium levels have also been linked to improved glucose metabolism, insulin resistance and low-grade inflammation. Also I know improved insulin sensitivity after administering donor butyrate intestinal microbiota to male subjects with metabolic syndrome.

The results of the present invention also demonstrate that the abundance of bacteria that can act as opportunistic pathogens such as Pseudomonas and Sutterella are high in the appendix of IR-MO patients relative to NIR-MO patients.

In conclusion, the data of the present invention demonstrate that the appendix dysbiosis occurs in morbidly obese patients in the pre-diabetes stage, such as insulin resistance. On the other hand, IR-MO patients show a loss of essential bacteria to maintain intestinal integrity along with an increase in mucin in the degrading bacteria and opportunistic butyrate producing pathogens. Finally, the significant increase in the expression of inflammatory cytokine genes and the infiltration of macrophages in adipose tissue caused by the microbiota present in the IR-MO group may suggest that these specific bacteria could initiate inflammation and associated insulin resistance. With obesity These findings could be useful for developing strategies to control the development of insulin resistance by modifying the intestinal microbiota.

Table 1. Biochemical and clinical characteristics of both study groups together with the expression of inflammatory cytokine macrophage infiltration genes in visceral adipoo tissue.

NIR-MO patients IR-MO * P patients

N = 5 N = 5

Age (years) 48.0 ± 10.5 44.40 ± 8.64 0.570 BMI (kg / m ² ) 59.18 ± 4.71 58.20 ± 4.12 0.735

Waist circumference (cm) 146.60 ± 11.71 151.40 ± 14.56 0.580

Hip circumference (cm) 162.67 ± 14.36 162.20 ± 17.03 0.964

SBP (mmHg) 132.00 ± 23.28 141.0 ± 27.87 0.595

DBP (mmHg) 82.40 ± 10.90 86.60 ± 10.13 0.546

Total cholesterol (mg / dl) 211.60 ± 16.34 207.80 ± 18.70 0.741

HDL cholesterol (mg / dl) 51.60 ± 1 1.80 47.40 ± 1 1.30 0.581 LDL cholesterol (mg / dl) 130.23 ± 17.67 127.33 ± 19.12 0.810

Triglycerides (mg / dl) 89.04 ± 13.46 159.39 ± 15.9 0.001

Insulin (mg / dl) 8.92 ± 1.74 26.93 ± 3.85 0.001

Glucose (mg / dl) 94.40 ± 4.36 104.80 ± 3.63 0.003

HOMA-IR 2.18 ± 0.53 8.34 ± 1.44 0.001

GOT (U / 1) 27.50 ± 6.47 20.40 ± 5.77 0.104

GPT (U / 1) 39.00 ± 15.05 42.80 ± 16.76 0.716

GGT (U / 1) 47.27 ± 16.00 42.20 ± 13.84 0.649

CRP (mg / L) 3.62 ± 0.91 5.82 ± 0.52 0.002

Leptin (ng / ml) 59.25 ± 1 1.75 95.08 ± 15.88 0.001

Adiponectin (ug / ml) 13.52 ± 3.54 7.44 ± 1.44 0.007

PYY 0.55 ± 0.17 0.34 ± 0.10 0.044

GLP1 88.80 ± 9.67 56.40 ± 1 1.52 0.001

IL6_V 0.07 ± 0.02 0.27 ± 0.07 0.001

IL1 B_V 0.08 ± 0.02 0.28 ± 0.07 0.001

TNF_alpha_V 0.002 ± 0.0009 0.006 ± 0.002 0.004

IRS1_V 0.014 ± 0.001 0.005 ± 0.001 0.001

IRS2_V 0.59 ± 0.15 0.63 ± 0.08 0.633

CD11 b V 0.12 ± 0.04 0.35 ± 0.10 0.001

Values are represented as mean ± SD. N = 5 subjects per group. DBP, diastolic blood pressure, SBP, systolic blood pressure; GGT.Gamma-glutamyl transferase; GOT, Glutamic oxaloacetic transaminase; GPT, Glutamic pyruvic transaminase, CRP, C-reactive protein. Values significantly different from * P <0.05.

Table 2. Estimated wealth index (Chaol) and diversity index (Shannon) among the microbial communities obtained from the IR-MO and NIR-MO samples. IR-MO patients (n = 5) NIR-MO patients (n = 5) P

Chao 1 99.19 ± 29.03 102.0 ± 36.51 0 ~ 89

Shannon 3.69 ± 0.91 3.34 ± 0.92 0.59

The Chao wealth estimator and the Shannon diversity estimator were calculated at 3 distance.

Claims

1. - Method to predict or predict the risk of an individual suffering from metabolic syndrome or a disease related to the metabolic syndrome selected from the list consisting of: overweight, obesity, dyslipidemia, hyperglycemia, insulin resistance and diabetes, which includes determining the taxonomic groups that make up the intestinal microbiota in an isolated biological sample of the individual, and: b) classify the individual in the group of individuals with a probability at least 2 times greater than suffering from metabolic syndrome or a disease related to metabolic syndrome, if presents: i) a percentage of Pseudomonaceae, Prevotellaceae, Fusobacteriaceae, Pseudomonas, Prevotella, Catenibacterium, Veillonella and Fusobacterium at least 3 times higher than that of a reference individual; iii) a percentage of Bacteroidetes and Proteobacteria at least 1.5 times lower than that of a reference individual; and iv) a percentage of Bacteroidaceae, Lachnospiraceae, Ruminococcaceae, enterobacteria, Bacteroides and Blautia at least 1.5 times lower than that of a reference individual, the reference individual being an individual with morbid obesity sensitive to insulin.

2. - The method according to claim 1, wherein the isolated biological sample of the individual is a sample of the cecal appendix.

3. - The method according to any of claims 1-2, wherein the determination of the taxonomic groups that make up the intestinal microbiota is performed by a PCR technique.

4. - A kit comprising primers, probes and / or antibodies capable of identifying taxonomic groups by characterizing the 16S region of the rRNA, and where:

- primers or primers are poly nucleotide sequences of between 10 and 30 base pairs that have an identity of at least 80%, with a fragment of the sequences complementary to SEQ ID NO: 1;

- the probes are polynucleotide sequences of between 80 and 1,100 base pairs, and have an identity of at least 80% with a fragment of the sequences complementary to SEQ ID NO; one

5. - The kit according to claim 4 comprising the sequence primers HDA1 (5'-GACTCCTACGGGAGGCAGCAGT-3 ') and HDA2 (5'-3-GTATTACCGCGGCTGCTGGCAC').

35

REPLACEMENT SHEET (RULE 26)

6. - The kit according to any of claims 4 or 5, which additionally comprises the sequence SEQ ID NO: 5 (CGTATCGCCTCCCTCGCGCCA), SEQ ID NO: 6 (TCAG), SEQ ID NO: 7 (CTATGCGCCTTGCCAGCCCG) and SEQ ID NO: 8 (TCGA).

7. - The use of the kit or device according to any of claims 4 to 6, for obtaining useful data to predict or predict the risk of an individual suffering from metabolic syndrome or a disease related to metabolic syndrome.

8. - The use of the kit or device according to claim 9, wherein the disease related to the metabolic syndrome is selected from the list comprising: overweight, obesity, adipocyte hypertrophy, hepatic or fatty liver steatosis, dyslipidemia, hyperglycemia, resistance to insulin and diabetes, metabolic syndrome, hypertension, cardiovascular diseases, immune system dysfunction, or any combination thereof.

9. - The use of the kit according to any of claims 9 or 10, wherein the disease is diabetes, and even more preferably, type II diabetes.

36

 REPLACEMENT SHEET (RULE 26)