WO2017081049A1

WO2017081049A1 - In vivo collection and localized quantification and profiling of circulating cells, proteins and nucleic acids

Info

Publication number: WO2017081049A1
Application number: PCT/EP2016/077068
Authority: WO
Inventors: Annika AHLFORD; Amin El-Heliebi; Mats Nilsson Bernitz
Original assignee: Medizinische Universität Graz; Biocyclica Holding Ab
Priority date: 2015-11-11
Filing date: 2016-11-09
Publication date: 2017-05-18
Also published as: EP3373822A1; CN108430336A

Abstract

The present invention relates to localized multiplex detection of RNA or proteins in situ within circulating cells that are captured in vivo by a collection device, or detection of free circulating nucleic acids captured by the same device. The device comprises a functional, three-dimensional capture surface equipped with detection receptors and the molecular assays are based on highly specific padlock probe ligation or proximity ligation assay (PLA) followed by rolling circle amplification (RCA).

Description

IN VIVO COLLECTION AND LOCALIZED QUANTIFICATION AND PROFILING OF CIRCULATING

CELLS, PROTEINS AND NUCLEIC ACIDS

TECHNICAL FIELD

The present invention relates to the technical field of in vitro diagnostics. BACKGROUND

It is desira ble to detect m NA in situ directly within single cells in a specific and quantitative manner as expression levels of particular transcripts may vary within a heterogeneous population of cells. Additionally, single molecu le sensitivity, ultimately down to single nucleotide resolution, is vital for studying sequence variation including point mutations, allelic inactivation or splice and copy number variation of expressed transcripts. Differences in the relative expression of allelic transcripts or presence of single nucleotide sequence variants have been identified as important diagnostic disease biomarkers, particu larly for diagnosis of different cancers. Current assays for bulk analysis of a larger num ber of cells may not detect molecu les in rare cells and do not provide information on the cellular origin of each molecule. Hence, these methods do not accurately reflect possible deviations in expression in single cells compared to average expression levels in a heterogeneous cell population. It is possible to detect single mRNA molecules at single cell level, for example by fluorescent in situ hybridization (FISH) or by performing polymerase chain reaction (PCR) on laser-capture microdissected material. Resolving of highly similar sequences and sequence variants is however not possible with FISH and microdissection is cum bersome and not applica ble in diagnostics. Both methods are additionally limited to the analysis of a single/low num ber of markers at a time. Padlock probe-based assays rely on nucleic acid target detection through highly specific probe hybridization following a target-dependent circularization event (Nilsson et al., 1994). In detail, Padlock probes consist of oligonucleotides with complementary sequences at each end (Larsson C, Nat Methods 2010). Upon binding to a target nucleic acid sequence, the padlock probe forms a DNA-circle. The DNA-circle becomes ligated and the anchored sequence serves as primer for the following rolling-circle amplification (RCA). The RCA is an isothermal PCR which amplifies the circular templates hundred-fold resulting in rolling-circle products (RCPs) (Ali M M et al., HYPERLIN K "https://www.ncbi.nlm.nih.gov/pu bmed/24643375" \o "Chemical Society reviews." Chem Soc Rev. 2014). The RCPs can be then readily targeted by fluorescent hybridization probes. The high specificity of the ligation reaction and low level of interaction between probes permits multiplex interrogation of multiple markers. The amplification products are quantified in a digital fashion by hybridization of fluorescent probes and detection with a microscope. The molecular principle has been established for multiplex detection of mRNA targets in situ (Larsson C. et al, Nature Methods 2010; Grundberg I. et al, Oncotarget 2013; patent: IB2012/000995) in which each single target molecule gives rise to one detecta ble distinct amplification product directly in cells and tissue sections and consequently provides spatial information i.e. the location of expressed transcripts at a single-cell level. The high specificity of the ligation reaction enables target discrimination down to single nucleotide resolution, allowing direct resolving of sequence variation.

The technique has been further developed for highly multiplex in situ transcript analysis by combining the RCA procedure with next generation sequencing chemistry, allowing for parallel barcode sequencing directly in single cells (Ke R. et al, Nature Methods 2013). For barcode sequencing an anchor primer is hybridized at the RCP, directly adjacent to interrogation probes which consist of 9-mers with eight random and one fixed position (G, C, A, or T). Each interrogation probe is la beled with a different fluorophore. After ligation, the sample is imaged and each RCP shows the color of the corresponding fixed base. The first set of interrogation probes is then washed away and a new set of interrogation probes is applied with a new fixed position (one base pair shift). These steps of ligation, imaging and washing are iterated until all barcode-bases have been read (Ke R. et al, Nature Methods 2013).

Further, a method called proximity ligation assay (PLA) has been established for highly specific in situ analysis of protein targets or protein interactions and modifications (Soderberg O. et al, Nature Methods 2006). It requires target antigen recognition by two primary antibodies to which secondary antibodies are bound that each have a short single-stranded DNA molecule attached to them (PLA probes). Upon antibody binding, the PLA probes are in close proximity and the DNA strands can interact with each other and two additional oligonucleotides to form a circular DNA complex that may be ligated. The circle can next be amplified by RCA and detected as described above. As PLA requires two target specific binding events to take place in order to generate an amplifiable and detectable molecule, it offers improved specificity for protein detection as compared to standard methods such as ELISA. In addition, protocols for co-detection of specific mRNA expression and protein phosphorylation have been established based on the PLA and padlock probe principles (Weibrecht I. et al, PlosOne 2011). A number of methods have been developed for in vitro collection of circulating tumor cells (CTC) and tumor nucleic acids from a drawn blood sample. In the Cell Search® CTC test from Janssen, cancer cells are separated from blood cells in 7.5ml of blood by immune-based binding via cell specific surface molecules to magnetic beads, followed by antibody-based cell staining and enumeration (Allard WJ. et al, Clin Cancer Res. 2004; https://www.cellsearchctc.com/; US patent: US5466574). The method is currently the gold standard for in vitro CTC diagnostics. In the same manner, the Ephesia system consists of a micro device that relies on immune capture of cells to self-assembled magnetic bead arrays, also facilitating direct cell analysis on the beads (Saliba AE. et al, PNAS 2010; Autebert J. et al, LabChip 2015).

The Ephesia system has recently been successfully applied for in situ PLA assays performed directly in collected CTCs (Tulukcuoglu Guneri E. et al, Proceedings from μΤΑ5 2014). Many cell types and biomarker molecules are however present at low concentrations in body fluids. As an example, the average number of CTCs is in the order of 1 CTC/ml blood. As only a limited sample volume can be obtained from a patient (<10ml), this limits the usability of the described in vitro systems such as

CellSeach®and Ephesia for clinical diagnostics. To overcome the limitation of low blood volumes, an in vivo collection device is necessary.

The company Gilupi GmbH developed an in vivo collection device providing enrichment of sample material by exposing specific detection receptors on the device surface to an extended blood volume directly in the vein (see US2012/0237944A1). The enrichment device has the characteristics of a functionalized catheter and the three-dimensional functionalized wire surface is configured for maximal enrichment. The estimated blood volume coming into contact with the in vivo collection device is estimated at 1.5-3 liters (Saucedo-Zeni N, Int J Oncol. 2012 Oct;41(4):1241-50. doi: 10.3892/ijo.2012.1557.) Antibodies, peptides, aptamers and nucleic acid sequences, with affinity to cell surfaces or that bind free circulating nucleic acids, are examples of potential detection receptors. Saucedo et al demonstrated the principle by functionalizing a structured medical guidewire with antibodies directed to the epithelial cell surface adhesion molecule (EpCAM), which is commonly expressed in cancer cells (Saucedo-Zeni N. et al, Int. J. Oncol., 2012). They performed in vivo capture of CTCs in 12 patients with breast cancer and 12 with non-small cell lung cancer for 30 minutes and successfully enriched a median of 5.5 (0-50) and 16 (2-515) EpCAM positive cells, respectively. Thus the in vivo collection approach is efficient in enriching circulating cells and molecules with great potential for cancer in vitro diagnostics (IVD). Indeed, today the second generation Gilupi CellCollector has passed CE marking, being the first in vivo cell collection device holding a worldwide IVD CE marking. However, the analysis of the CTCs was so far limited to the capturing and counting of the cells on the collector device and did not include a further step of molecular testing for biomarkers of the CTCs. In the light of the above, there is still a need for further diagnostic methods for the characterization of low amounts of body material samples that allow the testing for one or more biomarkers.

It is thus an objective of the present invention to provide such methods. SUMMARY OF THE INVENTION

The objective is achieved by the method of the present invention, which is the first to combine in vivo sample collection devices and localized molecular analysis directly on the in vivo collection device. The device comprises a functional, three-dimensional capture surface equipped with detection receptors. For the profiling of nucleic acids, padlock probes are specifically ligated to the target while the proximity ligation assay (PLA) is employed to target protein biomarkers. Subsequently, rolling circle amplification (RCA) amplifies the targets to magnify the signal of each probing event. This generates long, tandemly repeated copies of DNA that coil up to form up to Ιμιη objects and which are detectable for example in a standard fluorescent microscope. One advantage of the present invention is that the inventive method allows for multiplex quantification and profiling of nucleic acid and protein biomarkers in situ at a single cell level combined with conventional cell staining protocols on the in vivo collector for cell enumeration, and to resolve cell morphology. Additionally, the same principle facilitates molecular analysis of free circulating nucleic acids. Highly multiplex profiling of transcripts is possible by implementing state-of-the-art next generation in situ barcode sequencing. The present invention thus opens up for simplified yet sophisticated IVD testing of sequence variation or variation in transcriptional expression in fields such as oncology, where it provides information on tumor cell heterogeneity of CTCs as well as a detailed biomarker profile of CTCs that may provide relevant information for personalized medicine therapy approaches. The occurrence of CTCs in a patient along with its mutation status is vital to allow monitoring of tumor progression after treatment. Importantly, the format is streamlined to match clinical practice.

The present invention also relates to a kit for the in vitro detection of a target molecule in a sample. DETAILED DESCRIPTION OF THE INVENTION

The present invention relates to a method for detecting a target molecule in a sample, wherein the sample comprises body material of a subject on a collector device for in vivo and/ or in vitro enrichment of sample material, comprising the steps of: a) providing a sample comprising body material of the subject on the collector device; b) detecting the target molecule in said body material on the collector device, wherein the detection comprises a step of rolling circle amplification (RCA).

In a preferred embodiment, the method is an in-vitro method. In another preferred embodiment, the body material of the subject on the collector device is obtained by in-vivo enrichment of said body material of a subject on the collector device.

In another preferred embodiment, the body material on the collector device is derived form a body fluid. It is particularly preferred that the body material is selected from a group consisting of blood, blood plasma, blood serum, cerebrospinal fluid, saliva and lymph. In a more preferred embodiment, the body material is blood or lymph.

In another preferred embodiment, the collector device for in vivo and/or in vitro enrichment of sample material provides a three-dimensional structure. It is also preferred that the collector device is suitable for insertion into a human blood or lymph vessel, and the dimensions of the collector device are thus sufficiently small compared to the blood or lymph vessel to allow the insertion. In another preferred embodiment, the collector device provides a rod shape, a spiraled shaped or a web-shaped tubular-like shape. In addition, it is preferred that the collector device provides a jagged and/or flat surface. Moreover, it is preferred that the collector device provides a functionalized surface, wherein the surface is modified by immobilization of capture molecules, also called a detection receptors, e.g. an antibody or a nucleic acid, that may have sufficient affinity for the targeted body material so that the collector device is capable of selectively binding the targeted body material. The collector device for in vivo and/or in vitro enrichment does not comprise magnetic beads or bead arrays such as the abovementioned CellSearch or Ephesia system. In a preferred embodiment, the collector device is a collector device described in WO 2010/145824 Al. It is particularly preferred that the collector device is a detection device for in vivo and/or in vitro enrichment of sample material, preferably comprising a biocompatible polymer and a functional surface equipped with detection receptors, the biocompatible polymer preferably forming the functional surface and the functional surface preferably comprising a three- dimensional structure preferably having mutually facing functional portions which preferably form at least one intermediate space that can be penetrated by a sample liquid, the detection device preferably comprising a carrier wherein the carrier preferably comprises a coating of metal that is applied to the carrier by means of a galvanic process and wherein preferably the biocompatible polymer comprises saturated atom groups and covalently bonded detection receptors. In a preferred embodiment, the collector device is a collection wire.

In another preferred embodiment, the collector device is a Gilupi CellCollector^®.

In another preferred embodiment, the collector device is the CellCollector^® Detector CANCE 01, DC01.

In another preferred embodiment, the method according to the present invention comprises in step a) at least one step of fixation of the body material on the collector device. The fixation may occur using a fixation agent. Common fixation agents are known in the art and include acetone and/or formaldehyde. In one embodiment, the fixation agent comprises formaldehyde. In a preferred embodiment, the fixation agent is an aqueous solution comprising formaldehyde, preferably comprising from 1 to 10 % m/V formaldehyde and even more preferably 3.7% formaldehyde. The fixation agent may be applied to the body material on the collector device for an incubation time that is sufficient to fix the body material on the collector device. For example, the incubation time may be from 1 minute to 10 days, preferably from 2 minutes to 72 hours, more preferably from 3 minutes to 1 hour.

In another preferred embodiment, the body material on the collector device in washed at least once after the above-described fixation step with a wash solution. It is preferred that the wash solution is a nuclease free aqueous solution. Preferable the solution is pre-treated with diethylpyrocarbonate (DEPC) to remove nuclease activities. It is even more preferred that the wash solution is an aqueous solution that is pretreated with DEPC and comprises Phosphate-buffered saline (PBS). Additionally, the wash solution may comprise Tween 20. In one embodiment, the body material, preferably cells, are permeabilized with a suitable permeabilization solution after the steps of fixation and washing. The permeabilization solution may be any solution capable of permeabilizing the body material, e.g. by permeabilizing the cell membranes to allow an improved accessibility of intracellular target molecules which remain fixed on the collector device despite the washing and the permea bilization step. In a preferred embodiment, the permea bilization solution comprises an acid, and preferably from 0.01 to 1M protons derived from the acid. It is even more preferred that the acid is HCI. In another preferred embodiment, the permea bilization solution comprises an acid and an aqueous solution that is pretreated with DEPC. It is even more preferred that the permeabilization solution comprises 0.1 M HCI and an aqueous solution that is pretreated with DEPC In another embodiment, the step of permeabilization is followed by at least one washing step described above.

In another preferred embodiment, the body material is selected from the group of cells, circulating DNA, circulating NA or protein. It is particularly preferred that the body material is cells. It is even more preferred that the body material is circulating tumor cells.

In another preferred embodiment, the target molecule is at least one specific DNA, RNA or protein molecule. It is understood that in the context of the present invention, that the term "target molecule" also comprises more than one target molecule since one of the advantages of the method according to the present invention is that the method is suitable for a multiplexed detection of several target molecules. For example, the target molecule may be a first protein of interest and a second protein of interest or may even include more than two different proteins of interest. It is apparent that the multiplex detection of more than one target molecule requires respective steps of a multiplex detection commonly known to the skilled person, e.g. by using probes specific for a first target molecule that are labelled with a fluorescent label that can be detected at an emission wavelength that is different from the probes specific for a second target molecule and its fluorescent label. The multiplex detection of the target molecule is also exemplified in the Example, wherein two targets PSA and AR-V7 are visualized by different colors of the fluorescent detection probes (in this specific case green and red). Moreover, the term target molecule may also include a protein-protein or protein-DNA or protein-RNA complex or a posttranslationally modified target molecule. The complexes as well as the posttranslational modification may be detected using a proximity ligation assay. In a preferred embodiment, the target molecule is at least one protein of interest. Proteins of interest may for example be proteins that are mutated, overexpressed or suppressed in a specific disease for which the protein may serve as a biomarker.

In another preferred embodiment, the target molecule is at least one RNA sequence of interest. It is further preferred that the RNA is selected from the group of mRNA, tRNA, rRNA or snRNA. It is more preferred that the RNA is mRNA. RNA of interest may be RNA which sequence or expression level may be used as a biomarker for a specific state of disease.

In another preferred embodiment, the target molecule is at least one DNA sequence of interest. DNA sequences of interest may for example be sequences encoding a specific mutation or an abnormal amount of DNA sequence that may indicate gene duplication or deletion and therewith associated altered gene expression or chromosomal alterations.

In one embodiment, it is also possible that one of the, at least one, target molecules is a protein of interest and another target molecule is an RNA and/or DNA of interest, wherein the multiplex detection allows the detection of different types of target molecules.

In one embodiment of the present invention, the body material is cells and the target molecule is intracellular RNA. In this embodiment the detection step b) comprises a step of converting RNA in situ to complementary DNA (cDNA) by using random primers or specific primers before performing the step of RCA. In this embodiment, it is particularly preferred that the intracellular RNA is mRNA.

It is further preferred that the cDNA sequence(s) are probed in situ with a complementary padlock probe(s) following a circularization event of the probe(s) by ligation and amplification of the probe(s) by RCA. The random primers comprise random sequences and may be used for converting any RNA into cDNA while the specific primers are suitable for specifically reverse-transcribing the target RNA of interest.

In another preferred embodiment of the present invention, the body material is cells and the target molecule is intracellular RNA, and in step b) the intracellular RNA sequence(s) are probed in situ with a complementary padlock probe(s) following a circularization event of the probe(s) by ligation and amplification of the probe(s) by RCA. In this embodiment, the probing occurs directly with the intracellular RNA sequence(s), i.e. without a previous step of reverse-transcription of the target RNA to cDNA. In another preferred embodiment, the body material is circulating DNA and in step b) the circulating DNA sequence(s) are probed with a complementary padlock probe(s) following a circularization event of the probe(s) by ligation and amplification of the probe(s) by RCA.

In another preferred embodiment, the body material is circulating RNA and wherein in step b) the circulating RNA sequence(s) are probed with a complementary padlock probe(s) following a circularization event of the probe(s) by ligation and amplification of the probe(s) by RCA.

In another embodiment, the body material is cells and the target molecules are at least one intracellular or cell surface protein and the detection step b) comprises a step of proximity ligation detection. Proximity ligation as in a proximity ligation assay (PLA) is a commonly known detection method that even allows for the detection of protein-protein interactions or the detection of posttranslational modifications of a target protein of interest. It requires target antigen recognition by two primary antibodies to which secondary antibodies are bound that each have a short single- stranded DNA strand attached to them (PLA probes). Upon antibody binding, the PLA probes are in close proximity and the DNA strands can interact with each other and two additional oligonucleotides to form a circular DNA complex that may be ligated. The circle can next be amplified by RCA and detected as described a bove. Consequently, the detectable signal is dependent on the proximity of the PLA probes and thus, only protein-protein interactions or specific posttranslational modifications will be detected.

In yet another preferred embodiment, the body material is protein and the target molecules are at least one protein and the detection step b) comprises a step of proximity ligation detection. In another preferred embodiment of the present invention, the step b) of the inventive method comprises after the step of RCA, a step of hybridization of the RCP with labelled complementary probes. These probes are DNA-based probes. The label may be any label commonly used in molecular biology, such as a fluorescent label or a chromogenic label. A fluorescent label is particularly preferred. Non-limiting examples of the label include fluorescein, green fluorescent protein or derivatives thereof, cyanine dyes, Alexa Fluor dyes, Texas Red, rhodamine, Atto 550, Atto 488 and Atto647N. In a preferred embodiment, the label is Atto 550, Atto 488, or Atto647N.

In another preferred embodiment, step b) comprises after the step of RCA a step of next generation sequencing chemistry. The sequencing step may be based on principles such as sequencing by hybridization, sequencing by synthesis or sequencing by ligation. In one preferred embodiment, the sequencing principle is sequencing by ligation, preferably for highly multiplex single molecule sequencing or in situ transcript analysis by combining RCA procedures with barcode sequencing.

In one preferred embodiment, the body material is circulating DNA or circulating RNA and the detection receptors are oligonucleotides complementary to said circulating DNA or circulating RNA.

The present invention also relates to a kit for the in vitro detection of a target molecule in a sample, wherein the kit comprises: a) a collector device as described above that is suitable for the in vivo and/or in vitro enrichment of sample material; the collector device is preferably already functionalized with detection receptors for capturing a particular target body material of interest; and at least one of the following items: b) instructions for detection of the target molecule in body material of a subject on the collector device according to the method of the present invention; c) at least one reagent for performing steps of ligation and amplification by RCA, e.g. DNA polymerase, a suitable reaction buffer, dNTPs, ampligase, ligase and the like; d) at least one reagent for performing steps of proximity ligation assays, e.g. single stranded DNA- labelled primary or secondary antibodies or reaction buffer suitable for performing the proximity ligation assay; e) at least one specific complementary padlock probe(s) for probing the target sequence after circularization event of the probe(s) by ligation and amplification of the probe(s) by RCA, wherein preferably, the probe(s) are suitable for multiplex detection if desired; optionally also hybridisation buffer suitable for RCP hybridisation of the padlock probes with the target sequence; f) at least one reagent for converting RNA in situ to cDNA, e.g. reverse transcriptase, dNTPs as well as a suitable reaction buffer for the reverse transcriptase to be sufficiently active; and/or random primers or target-molecule specific primers; and g) at least one reagent for next generation sequencing chemistry, such as anchor primer(s), interrogation probe mix, T4 ligase and/or Uracil-DNA Glycosylase with suitable reaction buffer for the ligation and hydrolysis reaction. As used herein, the term "collector device" or "collector device for in vivo and/or in vitro enrichment of a sample material" refers to a collector device that is suitable for in vivo and/or in vitro enrichment. This means that the collector device may be insertable into a blood or lymph vessel. Thus, the collector device may be similar to a catheter. As regards the term "in vivo enrichment", the collector device can be inserted into blood or lymph vessels and target body material that circulates through the vessel, such as CTCs, will stick to the collector and thereby gets enriched on a surface of the collector device. The same principle also applies for the in vitro enrichment.

As used herein, the term "body material" comprises any type of biological material that can be analyzed in vitro. Non-limiting examples of body material include cells, NA, DNA, polysaccharides and proteins. The body materials may be derived from blood, lymph, saliva, urine, cerebrospinal fluid, tissue sample, biopsy samples and the like.

As used herein, the term "rolling circle amplification" (RCA) describes a process of unidirectional nucleic acid replication that can rapidly synthesize multiple copies of DNA or RNA, such as circular padlock probes, plasmids, the genomes of bacteriophages, and the circular RNA genome of viroids.

Typically, the circularized padlock uses an anchored sequence as primer. The 3^' end is elongated by a phi29 polymerase using the circularized padlock as template sequence. Upon encountering of double stranded DNA, the 5^' end of the DNA is displaced by the strand displacement activity of phi29 polymerase and DNA replication continues along the circularized padlock. Thus, RCA relates to an isothermal PCR which amplifies the circular templates hundred-fold resulting in rolling-circle products (RCPs).

Non-limiting examples of RCA are described by (Ali MM et al., HYPERLINK "https://www.ncbi.nlm.nih.gov/pubmed/24643375" \o "Chemical Society reviews." Chem Soc Rev. 2014.) The RCPs may then readily be targeted by a detection method.

The high specificity of the ligation reaction and low level of interaction between probes permits multiplex interrogation of multiple markers. The amplification products are quantified in a digital fashion by hybridization of fluorescent probes and detection with a microscope. The molecular principle has been established for multiplex detection of mRNA targets in situ (Larsson C. et al, Nature Methods 2010; Grundberg I. et al, Oncotarget 2013; patent: IB2012/000995) in which each single target molecule gives rise to one detecta ble distinct amplification product directly in cells and tissue sections and consequently provides spatial information i.e. the location of expressed transcripts at a single-cell level. The high specificity of the ligation reaction enables target discrimination down to single nucleotide resolution, allowing direct resolving of sequence variation.

As used herein the term "target molecule" relates to any specific molecule of interest. Typically, the target molecule is a molecule that can be used as a molecular biomarker. The target molecule may thus be any type of molecule, e.g. a protein, RNA, DNA, or polysaccharide.

As used herein, the term "body fluid" relates to liquids originating from inside the bodies of living people. Body fluids include fluids that are excreted or secreted from the body. Non-limiting examples of body fluids are amniotic fluid, aqueous humour and vitreous humour, bile, blood, blood serum, breast milk, cerebrospinal fluid, cerumen (earwax), chyle, chyme, endolymph and perilymph, exudates, feces, female ejaculate, gastric acid, gastric juice, lymph, mucus (including nasal drainage and phlegm), pericardial fluid, peritoneal fluid, pleural fluid, pus, rheum, saliva, sebum (skin oil), serous fluid, semen, smegma, sputum, synovial fluid, sweat, tears, urine, vaginal secretion or vomit. As used herein, the terms "circulating DNA" or "circulating RNA" refers to extracellular DNA or RNA molecules present in a body material such as a body fluid, e.g. blood or lymph.

As used herein, "padlock probes" are single-stranded DNA molecules, preferably with two 20- nucleotide long segments, complementary to the target, connected by, preferably a 40-nucleotide long, linker sequence. When the target complementary regions are hybridized to the DNA target, the padlock probes become circularized.

As used herein, the term "next generation sequencing chemistry" relates to, but is not limited to, highly multiplex in situ transcript analysis by combining RCA procedures with barcode sequencing. Reagents that may be used for next generation sequencing include, but are not limited to, anchor primer, interrogation probe mix, T4 ligase and Uracil-DNA Glycosylase with suitable reaction buffer for the ligation and hydrolysis reaction.

The present invention also relates to the following items: (1). A method for analysis of in vivo collected body material from body fluids using a collector device and detection of target molecules in said body material by rolling circle amplification (RCA) directly on the collector,

(2) . The method of item (1) wherein said body fluids being blood,

(3) . The method of item (1) wherein said body fluids being lymph,

(4). The method of item (1) wherein said body material being cells,

(5) . The method of item (1) wherein said body material being circulating DNA,

(6) . The method of item (1) wherein said body material being circulating RNA,

(7) . The method of item (1) wherein said body material being protein,

(8) . The method of item (4) wherein the target molecules being intracellular RNA and the said detection method comprises a step of converting messenger RNA in situ to complementary

DNA generated by random primers,

(9) . The method of item (4) wherein the target molecules being intracellular RNA and the said detection method of target molecules comprises a step of converting messenger RNA in situ to complementary DNA generated by specific primers,

(10). The method of item (8) and (9) wherein the said cDNA sequence(s) are probed in situ in the cells with a complementary padlock probe(s) following a circularization event of the probe(s) by ligation and amplification of the probe(s) by RCA,

(11) . The method of item (4) wherein the said intracellular RNA sequence(s) are directly probed in situ with a complementary padlock probe(s) following a circularization event of the probe(s) by ligation and amplification of the probe(s) by RCA,

(12) . The method of item (5) wherein the said DNA sequence(s) are probed with a complementary padlock probe(s) following a circularization event of the probe(s) by ligation and amplification of the probe(s) by RCA,

(13) . The method of item (6) wherein the said RNA sequence(s) are probed with a complementary padlock probe(s) following a circularization event of the probe(s) by ligation and amplification of the probe(s) by RCA,

(14) . The method of item (4) wherein the target molecules being intracellular/cell surface proteins that are recognized in situ with one or two target specific affinity molecules conjugated with DNA strands, which, when in proximity interact with two circle- forming DNA oligonucleotides following a circularization event of the probe(s) by ligation and amplification of the probe(s) by RCA,

(15) . The method of item (7) wherein the said proteins are recognized with one or two target specific affinity molecules conjugated with DNA strands, which, when in proximity interact with two circle-forming DNA oligonucleotides following a circularization event of the probe(s) by ligation and amplification of the probe(s) by RCA,

(16). An analysis method wherein the said RCA products of item (10), (11) and (14) are detected in situ in the cells on the collector device through hybridization of labelled complementary probes,

(17). An analysis method wherein the said RCA products of item (12), (13) and (15) are detected on the collector device through hybridization of labelled complementary probes, (18). An analysis method wherein the said RCA products of item (10), (11) and (14) are detected in situ in the cells on the collector device by next generation sequencing chemistry,

(19). An analysis method wherein the said RCA products of item (12), (13) and (15) are detected on the collector device by next generation sequencing chemistry,

(20) . The said collector probe of item (1) comprising a functional, three-dimensional surface equipped with detection receptors,

(21) . The said detection receptors of item (20) being antibodies with affinity for the said cells of item 4,

(22) . The said detection receptors of item (20) being antibodies with affinity for the said protein(s) of item (7),

(23) . The said detection receptors of item (20) being oligonucleotides complementary to the said DNA of item (5),

(24). The said detection receptors of item (20) being oligonucleotides complementary to the said RNA of item (6),

(25). The combining of the said method of item (1) with conventional cell staining protocols.

The invention is not to be limited in scope by the specific embodiments disclosed in the examples that are intended as illustrations of a few aspects of the invention and any embodiments that are functionally equivalent are within the scope of this invention. Indeed, various modifications of the inventions in addition to those shown and described herein will become apparent to those skilled in the art and are intended to fall within the scope of the appended claims. A number of references have been cited, the entire disclosures of which are incorporated herein by reference for all purposes. BRIEF DESCRIPTION OF THE FIGURES

Figure 1: In situ detection of mRNA transcripts of VCaP prostate cancer cells captured by a collection wire. A) Collection wire with a functionalized surface with captured VCaP cells. B) Overview of captured cells. C) Enlargement of square of B) Rolling circle products (RCPs) are visualized by three different fluorescent detection probes (red, green and yellow). Each color represents different mRNA transcripts, originating from Androgen Receptor full length (AR-FL, yellow spots), Androgen Receptor Splice Variant 7 (AR-V7, green spots) as well as Prostate-Specific Antigen (PSA, red spots). The cell nuclei are stained in blue with DAPI. For a better overview, as examples for the colored spots, some of the differently colored spots are pointed to with a respective number-coded arrrow with the numbers 1 (AR- Full length), 2 (AR-V7) and 3 (PSA) (arrow points to the respective spot). EXAMPLES

As described above, the invention relates to the in vivo collection and localized quantification and profiling of circulating cells, proteins and nucleic acids. Below we exemplify the invention by analyzing genetic variation that plays a role in prostate cancer. The described approach involves collection of suspended cells from a prostate cancer cell-line and in situ quantification of the full length version or a cancer-related splice variant of the gene encoding the androgen receptor (AR). Additional it includes quantification of the expression of the prostate-specific antigen (PSA), a glycoprotein also called kallikrein-3 which is encoded by the KLK3 gene in humans. PSA is produced by the prostate gland and elevated levels may indicate abnormal conditions of the prostate, including prostate cancer. The collected cells are fixed on the collection wire and washed. The messenger RNA (mRNA) in the cells is next converted to complementary DNA (cDNA) by reverse transcription following a post-fixation step. After this the RNA is digested and specific padlock probes are hybridized and ligated to their target sequence. The circularized probes serve as a template for amplification by rolling circle amplification (RCA) generating large (> Ιμιη), single stranded coils of DNA. By hybridizing fluorescent oligonucleotides to the RCA products, the labelled coils are detectable and quantifiable on the collection wire with a microscope. To visualize the cells, the cell nuclei are stained with DAPI, a fluorescent stain that binds to A-T rich DNA regions. The number of cancer cells is determined and occurrence of PSA and proportion of full length and spliced AR transcripts is assessed.

Cell collection and preparation

The human prostate cancer cell line VCaP was maintained in DMEM media supplemented with 10% fetal calf serum, 4.5g/l D-Glucose, L-Glutamine, Pyruvate, lOOU/ml penicillin and 100 μg/ml streptomycin (all cell culture supplies from Gibco, Thermo Fisher Scientific, USA). A suspension of cells were prepared to a final cell concentration of 2x10^s cells/ml in phosphate buffered saline (PBS) containing 3% bovine serum albumine (BSA). For binding of the VCaP cells, the collection wire ( CellCollector^® Detector CANCE 01, DCOl, Gilupi, Germany) was transferred into a glass Pasteur pipette (Poulten & Graf, Germany) and incubated with the cell suspension for 10 minutes. The cells attached to the collection wire were then fixed for 10 minutes with 3.7 % m/V formaldehyde (Labonord, France). The cells were washed in 1.5ml DEPC-PBS-Tween, permeabilized in 1.5ml 0.1M HCI-DEPC-H20 followed by 2 washes in 1.5ml DEPC-PBS-Tween. All washing steps were performed in Eppendorf tubes at room temperature for 5 minutes each.

In situ AR and PSA transcript detection

All oligonucleotides in the experiments were designed using the CLC Main Workbench software (CLC Bio Workbench Version 7.6, Qiagen; Netherlands) according to the guidelines published by Weibrecht et al. (Weibrecht et al, Nat. protoc, 2013). Padlock probes were ordered 5^' phosphorylated (Integrated DNA Technologies; USA). Detection probes were purchased from Biomers (Biomers; Germany) and LNA primers from Exiqon (Exiqon; Denmark). All oligonucleotide sequences are shown in Table 1. Sequences were obtained from the National Center for Biotechnology Information (NCBI) with the GenBank accession numbers NM_000044.3 (AR), FJ235916.1 (AR-Variant 7) and NM_001030047 (PSA). All incubation steps of the protocol were performed in Volac glass pasteur pipettes and all wash steps were performed in Eppendorf tubes. cDNA was synthesized by incubation of the collection wire in a humid chamber at 45C° for 2.5h in 40μΙ reaction mixture containing ΙμΜ of each cDNA primer (Exiqon), 5U μΙ^"1 of TranscriptMe reverse transcriptase (DNAGdansk, Poland), 500 μΜ dNTP (ThermoFisher, USA), 0.2 μg μΙ^"1 BSA (NEB), 1 U μ ¹ RiboLock RNase Inhibitor (ThermoFisher) and TranscriptMe reaction buffer (all units are displayed as final concentrations). After incubation the cells were postfixed for 10 min at room temperature with 3% formaldehyde (Sigma, USA) in DEPC-PBS followed by washing 2 times in DEPC- PBS Tween for 2min.

To create single-stranded target cDNA that enables padlock probe hybridization, the RNA strand of the created RNA-DNA hybrids was degraded with RNase H and this took place in the same step as hybridization and ligation of the padlock probes. The reaction was carried out with 100 nM of each padlock probe in a mix of 0.5 U μΙ^"1 Ampligase (Epicentre, USA), 0.4 U μ ¹ RNase H (DNAGdansk), 50 mM KCI, and 20% formamide in Ampligase buffer. Incubation was performed at 37 °C for 30 min, followed by 45 min at 45 °C. Next the wires were washed once with 2xSSC-Tween at 37 °C for 5 min and twice with lxDEPC-PBS Tween for 2 min. Isothermal RCA was performed with 1 U μΙ^"1 Φ29 DNA polymerase (ThermoFisher) in the supplied reaction buffer with 250 μΜ dNTP, 0.2 μg μΙ^"1 BSA, and 5% glycerol. Incubation was carried out for 1.5 h at 37 °C or overnight at room temperature. After RCA the wires were washed with DEPC-PBS Tween for 2 min. RCA products were visualized using 100 nM of each corresponding detection probe in a hybridization buffer (0.6 M NaCI, 60 mM Tris-HCI pH 7, and 20% Formamide) (Sigma) for 30 min at 37°C followed by 2 washes for 2 min with DEPC-PBS Tween. To stain the cell nuclei, the wires were incubated with a DEPC-PBS solution containing 5mg ml^"1 DAPI for 5 min and then washed 2 additional times with DEPC-PBS Tween for 2 min. The cells on the wire were dehydrated using a series of 70%, 85%, and 99.5% ethanol for 2 min each and air dried. The collection wire was transferred onto an object slide and fixed with a tape for scanning.

The Scanning was performed using the Zeiss Observer.Zl inverted microscope (Carl Zeiss, Germany) with a 40x objective and the AxioVision software (Carl Zeiss, Version 4.8.2.0). Z-Stacks were combined in one layer by a maximum intensity projection with ZEN 2012 black software (Carl Zeiss, Version 8.1). Contrast and brightness of each image were optimized for better visualization with ZEN 2012 black software (Carl Zeiss). Detected signals were verified to be positive by evaluating all other fluorescent channels, as false positive signals are typically visible in multiple wavelengths (Weibrecht et al, Nat. protoc, 2013).

Figure 1 illustrates VCaP cells enriched on the collection wire (A and B). The blow-up in panel C focuses on a group of collected cells. Cell nuclei are visualized in blue and RCA products as bright distinct spots originating from full length transcripts, AR-FL1, of the androgen receptor gene (red spots) and from the splice variant transcripts AR-V7 (green spots) as well as RCA products originating from PSA transcripts (yellow spots).

Table 1. Oligonucleotide sequences

Name Sequences (5^' - 3^')

Primers

A -FL_LNA_1 C+CA+TC+TG+GT+CG+TCCACGTGTAAGTT

AR-V7_LNA_1 T+CT+G G +TC+ AT+TT+TG AG ATG CTTG C

PSA LNA 1 G+AG+GT+CCA+CAC+ACT+GAAGTTT

Padlock probes

GGGCCAAGGCCTTGCCTGGCCTCAATGCACATGTTTGGCTCCTAAAGTCGGA

plp_AR-FLl*

AGTACTACTCTCTCTTGTACACGTGGTCAAGT

AAAAATTCCGGGTTGTTCCTTTTACGACCTCAATGCTGCTGCTGTACTACTCTT

plp_AR-V7

CGGATGACTCTGGGAG

ACCAGAGGAGTTCTTGTCCTAGTAATCAGTAGCCGTGACTATCGACTGGTTCA

plp_PSA_l

AAGCTGGGGCAGCATTGA

Detection probes

Linl6_Atto550 Atto 550-CCTC AATG CTGCTG CTGTACTAC

Lin33_Atto488 Atto 488-CCTCAATGCACATGTTTGGCTCC

B2 DO Atto647N Atto 647 N - AGTAGCCGTG ACTATCG ACT

+ = the following base is locked nucleic acid (LNA) modified

underlined: target complementary sequence

bold: detection probe complementary sequence

Atto550, Atto488 and Atto647N are fluorescent labels

*published in Kiflemariam S., et al., J Pathol, 2014 REFERENCES

Allard WJ. et al., "Tumor cells circulate in the peripheral blood of all major carcinomas but not in healthy subjects or patients with nonmalignant diseases", Clin. Cancer Res., 10:6897-904, 2004

Autebert J. et al., "High purity microfluidic sorting and analysis of circulating tumor cells: towards routine mutation detection", 15:2090-101, LabChip, 2015

Grundberg I. et al., "In situ mutation detection and visualization of intratumor heterogeneity for cancer research and diagnostics", Oncotarget, 4:2407-18, 2013 Ke R. et al., "In situ sequencing for RNA analysis in preserved tissue and cells", Nature Methods, 10:857-60, 2013

Larsson C. et al., "In situ detection and genotyping of individual mRNA molecules", Nat Methods, 7:395-7, 2010

Liberti P. et al., "Apparatus and methods for magnetic separation featuring external magnetic means", US5466574 A, 1993

Liicke K. et al., "Detection device for the in vivo and/or in vitro enrichment of sample material", US20120237944 Al, 2010

Nilsson M. et al., "Padlock Probes: Circularizing Oligonucleotides for Localized DNA Detection," Science, 265:2085-2088, 1994. Nilsson Bernitz M. et al., "Method for Localized In Situ Detection of mRNA", PCT/IB2012/000995, 2012

Saliba AE. et al., "Microfluidic sorting and multimodal typing of cancer cells in self-assembled magnetic arrays", PNAS, 107:14524-9, 2010

Saucedo-Zeni N. et al., "A novel method for the in vivo isolation of circulating tumor cells from peripheral blood of cancer patients using a functionalized and structured medical wire", Int. J. Oncol., 41:1241-50, 2012

Soderberg O. et al., "Direct observation of individual endogenous protein complexes in situ by proximity ligation", Nature Methods, 3:995-1000, 2006 Tulukcuoglu Guneri E. et al., "Ephesia: combining microfluidics and proximity ligation assay to analyze protein-protein interactions in single circulating tumor cells: an new tool for pharmaceutical research and personalized medicine", Proceedings from μΤΑ5, 2014

Weibrecht I. et al., "Simultaneous visualization of both signaling cascade activity and end-point gene expression in single cells", PlosOne, 6:e20148, 2011

Weibrecht I. et al., "In situ detection of individual mRNA molecules and protein complexes or post- translational modifications using padlock probes combined with the in situ proximity ligation assay", Nat. protoc, 8:355-72, 2013

Claims

WHAT IS CLAIMED:

1. An in vitro method for detecting a target molecule in a sample, wherein the sample comprises body material of a subject on a collector device for in vivo and/ or in vitro enrichment of sample material, comprising the steps of: a) providing a sample comprising body material of the subject on the collector device; b) detecting the target molecule in said body material on the collector device, wherein the detection comprises a step of rolling circle amplification (RCA).

2. The method of claim 1, wherein the body material on the collector device is derived from a body fluid.

3. The method of claim 2, wherein the body fluid is blood or lymph.

4. The method of any one of claim 1 to 3, wherein the body material is selected from a group of cells, circulating DNA, circulating RNA or protein.

5. The method of any one of claims 1 to 4, wherein the target molecule is at least one specific DNA, RNA or protein molecule.

6. The method of any one of claim 1 to 5, wherein the body material is cells and the target molecule is intracellular RNA, and wherein the detection of step b) comprises a step of converting RNA in situ to complementary DNA (cDNA) by using random primers or specific primers before performing the step of RCA.

7. The method of claim 6, wherein the RNA is mRNA.

8. The method of claims 6 or 7, wherein the cDNA sequence(s) are probed in situ with a complementary padlock probe(s) following a circularization event of the probe(s) by ligation and amplification of the probe(s) by RCA.

9. The method of any one of claims 1 to 5, wherein the body material is cells and the target molecule is intracellular RNA, and wherein in step b) the intracellular RNA sequence(s) are probed in situ with a complementary padlock probe(s) following a circularization event of the probe(s) by ligation and amplification of the probe(s) by RCA.

10. The method of any one of claim 1 to 5, wherein the body material is circulating DNA and wherein in step b) the circulating DNA sequence(s) are probed with a complementary padlock probe(s) following a circularization event of the probe(s) by ligation and amplification of the probe(s) by RCA.

11. The method of any one of claims 1 to 5, wherein the body material is circulating RNA and wherein in step b) the circulating RNA sequence(s) are probed with a complementary padlock probe(s) following a circularization event of the probe(s) by ligation and amplification of the probe(s) by RCA.

12. The method of any one of claims 1 to 5, wherein the body material is cells and the target molecules are at least one intracellular or cell surface protein and the detection step b) comprises a step of proximity ligation detection.

13. The method of any one of claims 1 to 5, wherein the body material is protein and the target molecules are at least one protein and the detection step b) comprises a step of proximity ligation detection.

14. The method of any one of claims 1 to 13, wherein step b) comprises after the step of RCA a step of hybridization with labelled complementary probes.

15. The method of any one of claims 1 to 13, wherein step b) comprises after the step of RCA a step of next generation sequencing chemistry.

16. The method of any one of claim 1 to 15, wherein the collector device comprises a functional, three-dimensional surface and/or detection receptors.

17. The method of claim 16, wherein the detection receptors are antibodies with affinity for the body material.

18. The method of claim 16, wherein the body material is circulating DNA or circulating

RNA and the detection receptors are oligonucleotides complementary to said circulating DNA or circulating RNA.

19. The method of any one of claim 1 to 9 and 12 to 17, wherein the body material is circulating tumor cells.

20. A kit for the in vitro detection of a target molecule in a sample, wherein the kit comprises: a) a collector device; and at least one of the following additional items: b) instructions for detecting the target molecule in body material of a subject on the collector device, wherein the detection comprises a step of RCA; c) reagents for performing steps of ligation and amplification by RCA; d) reagents for performing proximity ligation detection; e) complementary padlock probe(s) for probing the target sequence after circularization event of the probe(s) by ligation and amplification of the probe(s) by RCA; f) reagents for converting RNA in situ to cDNA; g) random primers or target-molecule specific primers; or h) reagents for next generation sequencing chemistry.