WO2017046192A1

WO2017046192A1 - Confirmation test for primary nucleic acid amplification products in a continuous reaction preparation and direct evaluation by means of electrophoretic methods

Info

Publication number: WO2017046192A1
Application number: PCT/EP2016/071747
Authority: WO
Inventors: Werner Brabetz
Original assignee: Biotype Diagnostic Gmbh
Priority date: 2015-09-18
Filing date: 2016-09-15
Publication date: 2017-03-23

Abstract

The invention relates to a method for confirming amplified nucleic acid target sequences (target sequence), preferably from human samples, during a multiplication reaction in a collective and continuous reaction preparation as a one-pot process, wherein the confirmation of the target sequence amplification product is obtained by means of the template amplification product. The template sequence is amplified and optionally labeled by means of the 5' cleavage products of the at least one target-sequence-specific FEN probe. The cleavage product of the at least one target-sequence-specific FEN probe is obtained only if the FEN probe hybridizes to a complementary sequence segment of the at least one target sequence by means of the target-sequence-specific 3' sequence of the FEN probe. The detection of the obtained plurality of template amplification products occurs distinctly and preferably by means of electrophoretic methods.

Description

Confirmatory test for primary nucleic acid amplificates in a continuous reaction mixture and immediate evaluation by means of electrophoretic methods

The present invention relates to a method for confirming amplified nucleic acid target sequences (target sequence), preferably from human samples, during a amplification reaction in a collective and continuous reaction batch as a one-pot process, wherein confirmation of the target sequence amplicon is obtained via the template amplificate. In this case, the template sequence is amplified by means of the 5 ^' cleavage products of the at least one target sequence-specific FEN probe and optionally labeled. The 5 ^' cleavage product of the at least one target sequence-specific FEN probe is obtained only when the FEN probe hybridizes with its target sequence-specific 3 ^' sequence to a complementary sequence portion of the at least one target sequence. The detection of the obtained plurality of template amplificates is effected distinctly and preferably by means of electrophoretic methods.

Nucleic Acid Amplification Technologies (NAT), most notably the polymerase chain reaction (PCR), are now an integral part of molecular genetic diagnostics. Several parameters can also be detected simultaneously in so-called multiplex methods. In order to increase the specificity and, in particular, to ensure the quality of molecular nucleic acid detection of pathogens, a confirmatory test for the amplification products is required (MIQ-1 201 1, Rili-BÄK-B3 2013). For this purpose, for example, in homogeneous test methods (so-called one-pot methods or reactions such as, for example, real-time PCR), DNA probes are used which hybridize sequence-specifically with a DNA half-strand of the DNA amplificate and with a fluorophore pair which is expressed via FRET ( Förster resonance energy transfer) interacts, are marked. The FRET is modulated or repealed by sequence-specific hybridization, resulting in a signal that can be measured using a real-time thermal cycler. A preferred probe format are so-called hydrolysis probes, which upon hybridization are cleaved by the intrinsic nuclease activity of the Taq DNA polymerase, thereby separating the fluorophore pair.

As an alternative to homogeneous tests, the NAT can be followed by subsequent steps such as hybridization of the DNA amplicons to immobilized probes (eg reverse-line blot, DNA chip, DNA bead assay), Southern hybridization, DNA sequencing or as a confirmatory test Nested PCR can be performed. However, these strategies require additional confirmatory test steps, which are more time and cost intensive and involve the risk of contamination.

Contamination of the amplificates occurs when an aliquot is taken from the PCR reaction mixture and / or when converting this aliquot into a new reaction mixture for the downstream process for confirming the amplificates. Contamination includes, in particular, the contamination of the amplificate with foreign DNA or amplificates from samples processed in parallel (cross contamination). Contamination has a huge impact on the quality of the confirmatory test. Taking into account the highly sensitive scope of such confirmatory tests, such as diagnostics, tumor diagnostics, diagnostics of serious infectious agents and their resistance, a confirmatory test decides on the diagnosis and the resulting therapy of a patient. Misdiagnoses lead to wrong therapies, consequential damages to the patient as well as increased costs for the health system.

Therefore, a reliable confirmation test is essential. This should be simple and robust, so that error rates are reduced as much as possible. The confirmation of NAT amplificates by means of fluorescent dyes which bind double-stranded DNA sequence-nonspecifically (eg SYBR Green I) or solely via the size determination of the primary amplicons by downstream DNA electrophoresis (flat gel or capillary gel electrophoresis) are not recognized methods according to the cited guidelines.

A disadvantage of homogeneous test methods is the relatively low multiplexing capability of real-time thermal cyclers, which currently have only 3-6 different detection channels.

In contrast, using modern Kapillargelelektrophoreseautomaten such as the Applied Biosystems ^® 3500 Genetic Analyzer (Thermo Fisher Scientific Inc. Applied Biosystems Div., Foster City, US-CA) are resolved by differences in length of the amplified products and 5 different detection channels at the same time significantly more than 50 parameters , The DNA amplificates to be analyzed must carry a covalently bound fluorescent label, which is usually introduced during the PCR via 5'-fluorescently labeled primers. A PCR confirmatory test succeeds for these capillary gel electrophoresis machines only by multi-stage methods, which of the PCR or Multiplex PCR are connected downstream, such as. B the SNaPshot Multiplex System ^®, an enzymatic single base extension primer unlabeled probe by means of fluorescence-labeled 2 ', 3'-dideoxyribonucleoside triphosphates (Thermo Fisher Scientific Inc- Applied Biosystems Div., Foster City, CA US).

Therefore, it was an object of the present invention to provide confirmatory tests for NAT that address and / or simplify the particular multiplexing capabilities of automated capillary gel electrophoresis diagnostic test procedures associated with conducting appropriate confirmatory tests.

The object of the present invention is to provide a continuous and collective reaction mixture for the amplification of target sequences, in particular from human samples such as blood, plasma, bone and / or tissue, and at the same time for the subsequent confirmatory test. It is also the object to provide a method, in particular a one-pot method, for the amplification and confirmation of the respective target sequence using the aforementioned reaction mixture. In this case, intermediate steps for further processing of the resulting amplificates, such as purification and / or additional probe hybridizations in separate vessels should be avoided. Thus, another object of the present invention is to avoid the risk of contamination with foreign DNA, RNA, proteins, peptides and / or chemicals, and further to provide a simplified and faster method. A method is to be provided which avoids the aforementioned disadvantages and risks of the prior art and at the same time combines the advantages and potentials of existing multiplex detection methods. Therefore, a further object is the provision of a method for amplifying at least one target sequence, in particular from a human sample of a patient, and a continuous confirmation of the at least one target sequence and detection by means of an electrophoretic method, such as flat gel electrophoresis or capillary gel electrophoresis. Thus, a further object of the present invention is to provide a process which can be supplied with a continuous reaction mixture and the resulting amplificates variable detection method, in particular with a liquid phase, without processing steps. The aim is to provide a method for diagnostics, in particular human diagnostics, which has a lower error rate in confirming the respective amplificate, since the risk of contamination is reduced or even prevented. It is also intended to provide a confirmatory method with high sensitivity for low quality samples and / or very small amount of usable DNA. The reaction mixture, the multiplex kit and the confirmation method should be simple and location-independent (point-of-need) can be used and performed at the same high quality. An essential goal is to provide a confirmatory test that meets the requirements of at least the guideline MIQ-1 201 1 for nucleic acid amplification techniques and / or the guideline of the German Medical Association B3 (Rili BÄK-B3) for the direct detection and characterization of infectious agents also meet the requirements of the respective amendments to the Directive.

Therefore, the present invention provides a method characterized by the confirmatory assay according to the invention (synonymous = confirmatory method), in which a homogeneous PCR or multiplex PCR is performed without additional pipetting steps (one-pot method). The essential advantages of the present invention are that it provides a one-pot method for confirming target sequences, and that the homogeneous assay format of the present invention provides the ability to quantify the starting nucleic acids, as described below. As a result, a further advantage of the present invention is that samples with only a very small proportion of usable DNA starting material and / or degraded DNA starting materials can nevertheless be used as the target sequence and can be confirmed and detected according to the invention.

The preferably used probes are so-called hydrolysis probes which are contained directly in the PCR reaction mixture and after hybridization to the target sequence are cleaved by the intrinsic nuclease activity of the Taq DNA polymerase. As a result, z. B. in HIV diagnostics, the viral load of the patient and after medication therapy success can be determined. The confirmatory method according to the invention has the particular advantage that FEN probes according to the invention, which may still be present in excess at the end of the amplification reaction, in particular PCR, are not reactive. Thus, these excess FEN probes do not hinder the confirmation and detection of the resulting template amplifications.

The confirmation method according to the invention thus has the advantage of being more sensitive by the exponential signal amplification and allows a higher degree of multiplexing.

Furthermore, the confirmatory test can be designed as standardized universal reaction steps independent of the target nucleic acid to be amplified. The latter allows the development of a test-independent development tool consisting of universal PCRs and / or universal primer extension reaction. The reaction products (synonyms = amplificates, template amplifications) of the confirmatory test are compatible with the standard procedures for detection by capillary gel electrophoresis. In the case of the Qiagen ModaPlex system, in particular, a homogeneous confirmation test for PCR or multiplex PCR for quantitative real-time detection in combination with high-resolution capillary gel electrophoresis is presented.

The solution according to the invention will be described below. Selected exemplary embodiments show ways to achieve the solution according to the invention and explain the basic principle and mode of operation of the present invention, wherein the examples presented here are not to be construed restrictively.

A first subject of the present invention is a confirmation, in particular a confirmation method, of at least one amplified nucleic acid target sequence, in particular DNA and / or cDNA, which is referred to below as target sequence, during a amplification reaction in a collective and continuous reaction mixture comprising a reaction mixture

at least one target sequence to be detected,

at least two target sequence-specific primers (P1, P2, P _1-n ) which are suitable for amplifying the at least one target sequence,

at least one target sequence-specific, in particular intermolecular, labeled and / or unlabeled FLAP endonuclease probe (FEN probe FEN1, FEN _1-n ), wherein the at least one, in particular single-stranded, FEN probe comprises

A target sequence-specific 3 'sequence, in particular DNA 3 ^' sequence, which is complementary to a sequence segment of the at least one target sequence within a region selected from the at least first primer (P1) and the at least second primer (P2) on the Target sequence is limited, in particular P1 and P2 hybridize with the target sequence (see FIG. 1)

A protecting group at the 3 'end of the target sequence-specific 3' sequence, in particular as a polymerase blocker, preferably the 3 ^' -OH group is absent, and a target sequence unspecific 5' sequence, in particular DNA 5 ^' sequence, the optionally has a fluorescent label and

at least one artificial template sequence, in particular artificial nucleic acid sequence,

the confirmatory method comprises the steps per cycle of the amplification reaction Hybridization of the target sequence-specific 3 'sequence of the at least one FEN probe (FEN _1-n ) to a complementary sequence of the at least one target sequence to be detected,

Cleavage of the at least one FEN probe (FEN _1-n ),

Obtaining at least one free 5 ^' cleavage product (Si- _n ) each comprising the target sequence unspecific 5' sequence,

Hybridization of the at least one 5 ^' cleavage product (Si- _n ) of the at least one FEN probe to a complementary sequence of the at least one artificial template sequence, in particular to the template sequence of a denatured duplex, in particular a single strand,

in particular elongation of the preferably single-stranded artificial

Template sequence of at least one hybridized 5 ^' cleavage product (S1)

Amplifying the at least one artificial template sequence with the at least one 5 ^' cleavage product (Si- _n ) of the at least one FEN probe, and

optional labeling of the at least one artificial template sequence during amplification by the at least one 5 ^' cleavage product of the at least one FEN probe, and

in particular, at least one optionally labeled artificial template sequence amplificate (synonymous = artificial template amplificate, template amplificate) and

in particular detection of the at least one optionally marked template sequence amplificate, preferably the optionally labeled template sequence amplificate is detected in a liquid phase, more preferably by means of an electrophoretic method.

The method described above with the continuous and collective reaction mixture for the amplification of the target sequence and confirmation of the resulting target sequence amplificates by means of an amplification and optional labeling of a template sequence can be synonymously referred to as a one-pot method, since the abovementioned reactions take place without processing steps and without temporal or spatial separation. The skilled person understands that all other components such. As buffer system, nucleotides, salts, etc., which are required for a successful PCR, are also included in the reaction mixture. Upon receipt of the optionally labeled template sequence amplification, detection may be performed at any time and location with the desired procedure and device. A target sequence is a nucleic acid sequence within a sample (synonymous = material to be examined), which in the context of an analysis or diagnostics z. Specific detection of an individual (forensics, genealogy), a species (eg pathogen, genetically modified organism), disease or other biological feature. The sample includes all conceivable starting materials with biological content such. As vegetable, animal and human fluids, extracellular circulating fluids, especially blood, plasma, serum and / or lymph, digestive juices, especially saliva, gastric juice, juice of the pancreas and / or bile, secretions and excretions, especially sweat, urine, faeces, ejaculate , Vaginal secretions, tear fluid, nasal secretions and / or breast milk and / or other fluids or secretions, in particular amniotic fluid, earwax, brain water and / or pus and tissue, nails, hair and / or bone components, foodstuffs, environmental isolates, etc., and / or synthetic nucleic acids (eg, barcode sequences and other targeted DNA tagging from other articles), and may include one or more target sequences. Sample also includes biopsy and smear material. Preferably, the sample is a human sample.

In the aforementioned method, the target sequence is preferably a DNA, in particular natural DNA and / or cDNA (English complementary DNA, German complementary DNA), which was synthesized by means of a reverse transcriptase from RNA, such as mRNA or ncRNA. In particular in medical diagnostics, ribonucleic acids which can be used from samples are transcribed into cDNA in order subsequently to supply them as the target sequence to the analysis, in particular the method according to the invention.

According to the invention, the target sequence is amplified in a amplification reaction (synonymously = amplified), preferably in a amplification reaction of a polymerase chain reaction (PCR) or an isothermal nucleic acid amplification technology (iNAT). The PCR is known to the person skilled in the art. Nucleic acid amplification technologies (NAT) refer to enzymatic processes for the in vitro amplification of nucleic acids, in particular of target sequences according to the invention. These may require thermal cycling (eg, PCR) or be isothermal (iNAT). The method according to the invention can be used to confirm both variants. Further embodiments of the aforementioned methods iNAT are LAMP (loop-mediated isothermal amplification), HDA (helicase-dependent amplification), RPA (recombinase polymerase amplification), SIBA (Beach Invasion Based Amplification), RCA (rolling circle amplification). According to the invention, flap endonuclease probes, referred to for short as FEN probes, comprise molecules comprising one, in particular single-stranded, nucleic acid sequence which has at least two functional regions. The two functional regions are a 5 'sequence that is not complementary to a sequence portion of the at least one target sequence (short called target sequence non-specific 5' sequence) and a 3 ^' sequence that is complementary to a sequence portion of the at least one target sequence (short Called target sequence-specific 3 'sequence). The sequence portion lies within a region bounded by the at least first primer (P1) and the at least second primer (P2) on the target sequence. These FEN probes (FEN _1-n ) hybridize to the target sequence to form a FEN-cleavable 5 'flaps, represented by the target sequence unspecific 5' sequence. The term flap refers to bifurcated unpaired structures within or at the end (3 'or 5') of a DNA double helix. These structures recognize the flap endonuclease (FEN) as a substrate as shown in FIGS. 1 and 2. The 3'-OH end of the FEN probe according to the invention is protected by a so-called polymerase blocker against the extension by a DNA polymerase. Upon exposure to a FEN (flap endonucleases), the FEN probe is cleaved to give a free 5 ^' cleavage product.

FEN1 is short for a FEN probe and FEN1 and FEN2 stands for two FEN probes. Similarly, S1 represents a 5 ^' cleavage product and S1 and S2 represent two 5 ^' cleavage products. The term FEN _1-n stands for at least one to variably many FEN probes or S for a corresponding number of 5 ^' cleavage products (Si- _n ) of the respective FEN probe, where n is an integer. In particular, n is an integer and preferably equal to 2, 3, 4, 5, 6, 7, 8, 9 or 10 (FEN1 -10 equals ten, especially different, FEN probes), etc. to less than or equal to 50 FEN probes. The highest possible number of FEN probes in a reaction mixture according to the invention is dependent on the method used for detection. The number of detection channels in the device used and the maximum distinct resolution of different, in particular artificial, and optionally marked template amplificates limits the maximum usable number of FEN probes according to the invention.

For the confirmation test, detection by means of the ModaPlex system (Qiagen) greater than or equal to 5 to less than or equal to 50, less than or equal to 45, 40, 35 and less than or equal to 30 FEN probe are preferably used in the reaction mixture according to the invention. The embodiments according to the invention of the FEN probes and combinations with the at least one further primer (M1) apply correspondingly to the ModaPlex system. In a further embodiment of the confirmatory test according to the invention, up to 1000, preferably less than or equal to 950, less than or equal to 900, less than or equal to 850 and less than or equal to 800 different FEN probes (FEN _1-n ) can be used. Due to the separation efficiency of a suitable device for sequences in a range of 70 to 350 base pairs and in combination with at least four channels, the aforementioned number of FEN probes can be combined. A suitable device is the Applied Biosystems ^® 3500 Genetic Analyzer.

The protecting group has the function of a polymerase blocker, with the protecting group protecting the 3 'end of an oligonucleotide from being extended by a DNA polymerase. In this case, a recognition reaction between the 3 ^' end of the 3' sequence of the at least one FEN probe and a polymerase is prevented, so that the 3 ^' end does not function as a primer. This can be achieved according to the invention by the absence of the 3'-OH group (3'-dideoxynucleotide), by chemical modification of the 3'-OH group comprising 3'-phosphate, 3'-spacer C3 (3'-hydroxypropyl phosphate), Amino, A-alkyl, 3'-inverted nucleotide, etc. and / or by additional nucleotides which do not pair with the target sequence.

Flap endonucleases (FEN) are structural and strand-specific endonucleases which cleave the single-stranded DNA or RNA sequence from a forked unpaired 5 'end (5' flap) of a DNA double helix (Lyamichev et al., 1993). FEN occur in all living organisms and, in conjunction with other enzymes, in particular during DNA replication, dissolve the so-called Okazaki fragments (RNA-DNA hybrids) on the remaining strand of the replication fork (DNA repair function). Eubacterial FEN together with a DNA polymerase of the type Pol 1 (synonym = Pol A) form a protein unit (eg Pol 1 of Escherichia coli, Thermus aquaticus, T. thermophilus, Aquifex spp.). Archaebacterial (eg Archaeoglobus fulgidus, Pyrococcus spp., Methanocaldococcus jannaschii, Methanothermobacter thermoautotrophicum) and eukaryotic FEN (eg Homo sapiens) are independent proteins. The artificial template sequence (also called template sequence or template in the reaction mixture) is a nucleic acid sequence that is bioinformatic designed with the minimum requirement that it does not match any specific primer and probe binding sites of the target sequences used in multiplexing. Thus, the artificial template sequence does not have complementary sequences to the specific primer and probe binding sites of the target sequences. In particular, it may not be used for any target sequence-specific primer of the multiplex as a DNA Act die. The ends of the artificial template sequence or its complementary strand carry binding sites for different 5 'cleavage products of at least one FEN probe, preferably two FEN probes, or for at least one 5' cleavage product of a FEN probe and an additional artificial primer (M1). The 5 'cleavage product of a FEN probe has a free 3'-OH end and has the function of a primer which is complementary to the 5' to 3 'sequence of an artificial template sequence or to the counterpart of the artificial template sequence and is an essential component of the art Confirmation test according to the invention. A further primer (M1) (referred to in the examples as WB127) denotes a primer which shows no cross-hybridization with all target sequences of the multiplex, is complementary to a sequence segment of a complementary strand of the artificial template sequence and with the complementary strand of at least one artificial template sequence one by DNA polymerase forms extensible DNA double helix.

Multiplex describes the duplication and confirmation of multiple target sequences in a single reaction. Examples of multiplexing methods are human genetic fingerprinting through genotyping of 20 and more short tandem repeats, differential diagnosis of various somatic mutations in tumors, elucidation of organ-specific infections (eg, lung, intestine, sexually transmitted infections) by detection of specific Pathogen groups and / or the amplification of nucleic acid libraries (panels). The method according to the invention is preferably a multiplex method, which can be used for any desired type-identical or analogous to the examples mentioned-of a detection.

In one embodiment of the confirmatory method according to the invention, the protective group at the 3 ^' end of the 3' sequence of the at least one, in particular single-stranded, FEN probe comprises a nucleic acid sequence instead of a 3 ^' OH group, in particular a DNA sequence greater than or equal to 1 base less than 5 bases, which is not complementary to the target sequence. Preferably, the sequence comprises 1, 2, 3, 4 or 5 bases. Particularly preferred are 1 or 2 bases.

In a further embodiment of the confirmatory method according to the invention, the reaction mixture furthermore comprises at least one enzyme suitable for cleaving the at least one FEN probe, which is selected from an FEN as intrinsic constituent of a DNA polymerase or / as an enzyme separated from a polymerase. The reaction mixture according to the invention preferably comprises at least one polymerase having intrinsic endonuclease activity, which is selected from eubacterial FENs which together with a DNA polymerase of type Pol 1 (synonymous = Pol A) form a protein unit. Therefore, this polymerase has an intrinsic, ie intrinsic, FEN activity. Such FEN are in the species z. Escherichia coli, Thermus aquaticus, T. thermophilus and / or Aquifex spp. whose polymerases can each be used according to the invention. For the purposes of the invention, a Taq DNA polymerase with intrinsic FEN activity from Thermus aquaticus is particularly preferably used. Alternatively, the reaction mixture according to the invention may comprise a polymerase and a separate FEN, the FEN preferably being selected from archaebacterial FEN and / or eukaryotic FEN. In subsequent species Archaeoglobus fulgidus, Pyrococcus spp., Methanocaldococcus jannaschii, Methanothermobacter thermoautotrophicum and / or Homo sapiens, the FEN is an independent protein which can be used according to the invention. Preferably in combination with a polymerase. Especially preferred are thermostable DNA polymerases and thermostable FEN.

In a further embodiment, it is conceivable that a polymerase with intrinsic FEN activity is used and in addition a separate FEN is added. This is advantageous if the polymerase has excellent activity, but its FEN activity is not reliable, too low, and / or has other unfavorable biochemical characteristics (eg, flap substrate specificity, pH, salt ion, and temperature optimum) , Then, a combination of the at least one suitable polymerase, with or without intrinsic FEN activity, with at least one or more FEN is preferable. The combination of the abovementioned enzymes depends on the sample to be investigated and / or the other components of the reaction mixture according to the invention in individual cases.

In a further embodiment of the confirmation method according to the invention, the abovementioned reaction mixture furthermore comprises at least one FEN-amplifier oligonucleotide (for example Can_ENH1, Can_ENH2, Can_ENH3 and / or Can_ENH4), in particular for increasing the intrinsic FEN activity of a polymerase, preferably the Taq DNA polymerase. Preferably, the addition of the FEN-amplifier oligonucleotides (ENH _1-n ) increases the intrinsic FEN activity of a polymerase, preferably the Taq DNA polymerase, at least quantitatively and optionally qualitatively. The at least one FEN amplifier oligonucleotide (ENH _1-n ) overlaps its sequence at the 3 ^" end by at least one base with the target sequence specific 3 'sequence at the 5 ^' binding site of the at least one FEN probe, as also shown in Fig. 1. In ENH _1-n , n is an integer. In particular, n is an integer and preferably equal to 2, 3, 4, 5, 6, 7, 8, 9 or 10. Examples of FEN-amplifier oligonucleotides according to the invention are Can_ENH1, Can_ENH2, Can_ENH3 and / or Can_ENH4.

In a preferred embodiment, the reaction mixture according to the invention comprises at least one FEN probe (FEN1) and at least one FEN-amplifier oligonucleotide (eg Can_ENH1, Can_ENH2, Can_ENH3 and / or Can_ENH4). An example according to the invention is shown in Table 2. Surprisingly, the combination of only one FEN probe, z. Can_FEN2, and only one FEN enhancer oligonucleotide, e.g. B. Can_ENH2, in the confirmatory test with an electrophoretic detection method, a 5-fold stronger signal (4954 RFU) compared to a confirmatory test with only one FEN probe or two FEN probes, eg. Can_FEN2 and Can_FEN1 (900/931 RFU). Accordingly, a difference in the Qiagen ModaPlex system is clear. While no signal is detectable with only one or two FEN probes, the aforementioned combination resulted in a clear C _t value of 26.36.

Thus, in the confirmatory method according to the invention, the addition of the at least one FEN-amplifier oligonucleotide (eg Can_ENH1, Can_ENH2, Can_ENH3 and / or, Can_ENH4) surprisingly results in at least a 5-fold amplification of the signal of the at least one template sequence amplicon obtained.

An FEN enhancer oligonucleotide (ENH _1-n ) hybridizes to the target sequence immediately upstream of the target sequence-specific 3 'sequence of a FEN probe. In this case, the 3 'end of the FEN amplifier oligonucleotide overlaps with the portion of the FEN probe which is paired with the target sequence exactly to the double helix by at least one nucleotide. The 3 'sequence of the FEN amplifier oligonucleotide overlapping with the FEN probe does not necessarily have to hybridize with the target sequence but can form an unpaired 3' flap (Kaiser et al., 1999). This arrangement results in a significant increase in the cleavage activity of the intrinsic FEN of a polymerase, preferably the Taq DNA polymerase. For other FEN enzymes, other structural properties of the FEN enhancer oligonucleotides are conceivable.

In a further embodiment of the confirmatory method according to the invention, the reaction mixture according to the invention and described above further comprises at least two FEN probes (FEN1 and FEN2) each comprising a target sequence-specific 3 'sequence. In In a preferred embodiment of the confirmatory method according to the invention, the 5 ^' end of the target sequence unspecific 5' sequence of the at least one FEN probe comprises a fluorescent label. Preferably, the fluorophore or fluorescent dye is covalently bound to the 5 ^' end of the target sequence unspecific 5' sequence. When using at least two FEN probes, one FEN probe or both FEN probes may have a fluorescent label. The advantage of fluorescence labeling of the FEN probe is that during the amplification of the template sequence with the fluorescence-labeled 5 ^' cleavage products (S1, S2, Si- _n ) the fluorescent label is transferred to the template sequence and thus a detection via a fluorescence signal, preferably in an electrophoretic method is possible. When combining labeled and unlabeled FEN probes, according to the invention a distinct detection of the artificial template amplificates obtained, in particular at least two or more, can take place via the size and / or the labeling of the template amplificates.

Thus, according to the invention, a reaction mixture which comprises

at least one target sequence to be detected,

at least two FEN probes according to the invention which, with their respective sequence-specific 3 ^' sequences, are complementary to a different sequence segment of the at least one target sequence, as shown by way of example in FIG. 1, and at least one artificial template sequence,

wherein the at least two FEN probes are labeled, both unmarked or only one is labeled.

Thus, in the confirmatory assay of the present invention, the at least two FEN probes hybridize to their respective sequences complementary to the target sequence. By cleavage of the FEN probes, at least two 5 ^' cleavage products (S1, S2, Si- _n ) are obtained which serve as primers for the amplification of the at least one artificial template sequence. This measures an amplifiable signal indicating detection of the amplified target sequence.

The signal is detected by measuring the template amplitudes obtained on the basis of their size and / or on the basis of an emitting fluorescence signal. The fluorescence signal is transferred to the at least one template amplicon during amplification by the 5 ^' cleavage products (Si- _n ) carrying the fluorophore. In a further embodiment of the confirmatory method according to the invention, the reaction mixture comprises at least two artificial template sequences which differ in sequence and / or sequence length and which respectively have complementary sequences to at least one 5 ^' cleavage product (Si- _n ) of the respective FEN probe or comprise at least one further primer (M1). After amplification, the template amplicons may differ in sequence, sequence length and / or conformation, and optionally in the label.

During electrophoretic detection, the conformation of the amplified artificial template sequence includes linear single-stranded, linear double-stranded or three-dimensional template sequence structures, depending on the chemical cycling conditions (native or denaturing). For example, the direct sequence of more than 4 purine or Pyrimidindesoxyribonukleotiden in the artificial Matrizensequenz after their amplification under native electrophoretic running conditions to a bent conformation of the double helix and thus lead to a significantly different from the sequence length running behavior (Stellwagen 2009). Furthermore, the running behavior of amplicons in capillary gel electrophoresis can be changed by using so-called mobility modifiers. Here, during the synthesis of the FEN probe and / or of the at least one further primer (M1), hexaethylene glycol building blocks and / or other non-nucleotide building blocks are additionally introduced at the 5'-end of the nucleotide sequence (Grossmann et al. 1994).

By varying the sequence and / or sequence length, in particular and / or conformation, the artificial Matrizensequenzen used and the use of mobility transducers, the separation efficiency of the electrophoretic method is increased because z. B. has a three-dimensional conformation deviating from a linear structure running behavior in a gel electrophoresis. The separation efficiency and the number of fluorescence channels defines the possible number of molecules that can be separated and detected simultaneously.

Through careful design and validation, it is thus possible to generate groups of artificial template sequences which are each tuned to a specific electrophoretic method and can then be used universally for various multiplex amplification and confirmation methods. So z. For example, for the Qiagen ModaPlex system, a set of template sequences is designed for each detection channel which migrate between the internal standards of 10 base pairs (= bp), 249 bp and 306 bp electrophoretically with ideal distances of approximately 10 bp between the signals.

Thus, the reaction mixture according to the invention comprises in one embodiment

at least one target sequence to be detected,

at least two FEN probes according to the invention (FEN1, FEN2, FEN _1-n ) which, with their respective sequence-specific 3 ^' sequences, are complementary to a different sequence segment of the at least one target sequence, as shown by way of example in FIG

at least two artificial template sequences each comprising complementary sequences to at least one 5 ^' cleavage product (S1, S2, Si- _n ) of the respective FEN probe (FEN1 and FEN2) or

at least two artificial template sequences each comprising a complementary sequence to at least one further primer (M1) and to one of the two FEN probes (FEN1, FEN2, FEN1 _-n ).

In a further embodiment of the confirmatory method according to the invention, the functional sequence length of the at least one labeled FEN probe (FEN _1-n ) comprises

(according to alternative a), in particular for use in combination with a capillary gel electrophoresis, preferably with the sequence Machine Applied Biosystems Applied Biosystems ^® 3500 Genetic Analyzer), greater than or equal to 20 bases to less than or equal to 60 bases, greater than or equal 25 bases to less than or equal 57 bases , greater than or equal to 25 bases to less than or equal to 55 bases, greater than or equal to 25 bases less than or equal to 53 bases, greater than or equal to 30 bases less than or equal to 50 bases, greater than or equal to 35 bases less than or equal to 50 bases

according to alternative b), in particular for use in combination with a capillary gel electrophoresis and a simultaneous quantitative PCR, preferably with the ModaPlex system of Firm Qiagen (Qiagen ModaPlex system), greater than or equal to 20 bases to less than or equal to 100 bases, greater than or equal to 25 bases to less equal to 57 bases, greater than or equal to 25 bases to less than or equal to 55 bases, greater than or equal to 25 bases less than or equal to 53 bases, greater than or equal to 30 bases less than or equal to 50 bases, greater than or equal to 35 bases less than or equal to 50 bases,

which in the confirmatory test, in particular during the amplification of the template sequence, transmit a fluorescent signal to the template amplificate, so that in a fluorescence signal of the template amplificates is measured in the abovementioned capillary gel electrophoreses. Preferably, the fluorescent signal is located at the 5 ^' end of the target sequence unspecific 5' sequence of the at least one FEN probe. According to alternative a), up to 1000, preferably less than or equal to 950, less than or equal to 900, less than or equal to 850, and less than or equal to 800 different FEN probes can be used. According to alternative b) less than or equal to 70, preferably less than or equal to 60, 55, 50, 45, 40 to less than or equal to 30 different FEN probes can be used. The fluorescence signal is a fluorophore which emits light of a specific wavelength of greater than or equal to 400 nm to less than or equal to 800 nm. The fluorescence colors or fluorophores are preferably selected from 6FAM, BTG, BTY, BTO for blue (440-490 nm) green (490-540 nm), yellow (540-600 nm), orange (600-630) and red (630 -800 nm). Further fluorescent dyes are known to the person skilled in the art and can be chosen freely in combination with the FEN probe according to the invention. Taking into account the detection method used, device-specific restrictions must be considered when designing the FEN probes. Fluorescent dyes include uranine, rhodamine, fluorescein, DAPI, coumarins, allophycocyanin, 7-aminoactinomycin, indocyanine green / ICG, calcein, coumarin, cyanines, quinine bisulfate, ethidium bromide, fluorescein arsenical helix binder, GFP - Green Fluorescent Protein, quadrains (squaric acid dyes) Base of N, N-dialkylanilines, 1, 3,2-dioxaborines (complexes of boric acid derivatives with 1,3-dicarbonyl compounds), SYBR Green I, Syto® Green, Syto® Red, Syto® Orange, safranine, stilbene and rhodamine. Other suitable fluorescent dyes or fluorophores known to those skilled in and selects them from the available fluorophores from current suppliers, such as biomers.net GmbH, Atto-tec GmbH, Dyomics GmbH and Themo Fischer Scientific - Molecular Probes. In a further embodiment of the confirmation method according to the invention, the reaction mixture comprises, in particular for increasing the amplification, at least quantitatively and optionally qualitatively, the at least one artificial template sequence,

at least one FEN probe according to the invention, in the manner described above, and at least one further primer (M1),

at least one FEN probe according to the invention (see above), at least one FEN enhancer oligonucleotide (eg Can_ENH1, Can_ENH2, Can_ENH3 and / or Can_ENH4), as already described above, and at least one further primer (M1), or

at least two FEN probes according to the invention, as described above, at least one FEN-amplifier oligonucleotide (ENH1-n) and at least one further primer (M1), or

at least two FEN probes according to the invention, at least two FEN enhancer oligonucleotides (ENH1-n) and at least one further primer (M1),

wherein the at least one further primer (M1) is complementary to a sequence segment of the complementary strand of the at least one artificial template sequence, and

the at least second FEN probe has a target sequence specific 3 'sequence other than the first FEN probe which is complementary to a sequence within a region of the at least one target sequence selected from the at least first primer (P1) and the at least second primer ( P2) and whose cleavage product (S2) differs from the cleavage product (S1) of the first FEN probe and is complementary to a sequence segment of the backbone of the at least one artificial template sequence. The first cleavage product (S1) is correspondingly complementary to the 3 ^' sequence in (3-> 5 ^" ) of the template sequence An example of this embodiment is shown in FIG.

Surprisingly, it has been found in the present invention that each of the aforementioned combinations results in a significant enhancement of the signal of the at least one template amplicon obtained, respectively, compared to the signal obtained with a reaction mixture with one or two FEN probes in the confirmatory method of the invention (see Table 2 and 3). In a preferred embodiment according to the above-described alternative a), in the reaction mixture the combination of the at least one FEN amplifier oligonucleotide and another primer (M1) in the confirmatory method according to the invention leads to a significant amplification of the detection signal, preferably to at least a 30-fold amplified signal. of the at least one obtained, in particular labeled, template sequence amplificate in comparison to the use of one or two FEN probes (Table 2, 900 or 931 RFU).

The signals obtained with the aforementioned embodiments are shown in Tables 2 and 3. The combination of one FEN probe and one additional primer (M1), with a value of 5900 RFU (Table 2), shows significant signal enhancement compared to the confirmatory test with only one or two FEN probes (900/931 RFU) more than 6 times stronger Signal. When determining the C _t values, a clear signal is also detected with this embodiment (Table 3, C _t value: nb / 27.62). The combination of a FEN probe, an FEN-amplifier oligonucleotide (ENH _1-n ) and a further primer (M1) with a value of 42130 RFU leads to a further increase of the signal of the template amplification (Table 2) compared to the confirmatory test with only one or two FEN probes (900/931 RFU) more than 46 times. When determining the Ct values, a clear signal is likewise detected with this embodiment (Table 3, C _t value: nb / 24.62), which, however, shows no significant difference to the abovementioned combination (FEN probe + M1). Similar values are achieved with the combination of two FEN probes (FEN1 and FEN2), a FEN amplifier oligonucleotide and another primer (M1) (30747 RFU / C _t value 25.15). A combination of two FEN probes and two FEN amplifier oligonucleotides with values of 651 1 and 3500 RFU leads to an amplification of up to 7 times the signal of the preferably fluorescence-labeled template amplicon, which is detected in a capillary gel electrophoresis.

All of the above embodiments demonstrate the feasibility of the confirmatory test, which takes place in a collective and continuous reaction approach for the amplification of the target sequence and the amplification and optional labeling of the template sequence (one-pot method). Depending on the combination of the FEN probe (s) with one or more FEN enhancer oligonucleotides (ENH _1-n ) and / or another primer (M1), a significant enhancement of the signal is achieved. These surprising results prove the inventive solution to the task. These embodiments, in particular the combination with at least one FEN enhancer and / or a further primer (M1), offer variable solutions for a continuous reaction mixture for the amplification and confirmatory test of target sequences, in particular from human samples such as blood, plasma, serum, bone and tissue and reduces the risk of contamination with foreign DNA, RNA, proteins, peptides and / or chemicals. The signal has excellent quality and strength, providing a simplified and improved one-pot diagnostic procedure, including the confirmatory test. In particular, a diagnostic method that meets the requirements of directive MIQ-1 201 1 for nucleic acid amplification techniques and / or the guideline of the German Medical Association B3 (Rili BÄK-B3) for the direct detection and characterization of infectious agents as well as the requirements of the respective Amendments to the directive. In a further embodiment of the confirmatory method according to the invention, the target sequence-specific 3 'sequence of the at least first and / or hybridize at least second FEN probe to its respective complementary, in particular single-stranded, target sequence of the same molecule or to two different target sequence molecules, so that complexes are obtained according to FIG. 1, wherein both FEN probes hybridize to the same target sequence molecule or two different arrangements. In a first arrangement, the first target sequence-specific 3 'sequence hybridizes to a first target sequence molecule and in the second arrangement, the second target sequence-specific 3' sequence hybridizes to a second target sequence molecule. Preferably, the two target sequence molecules are different, and more preferably at least two different target sequences in a sample, especially in a human sample as defined above.

The essential difference of the confirmatory method of the invention is that the confirmation of the at least one amplified target sequence is the at least one optionally labeled artificial template sequence amplificate amplified or amplified and labeled by the 5 ^' cleavage product (S1, Si- _n ) of the at least one FEN probe has been.

The resulting optionally labeled (in particular fluorescently labeled) template matrix artificial amplificate can be detected at any time and in any location, so that it can be stored until detection. If the aforementioned artificial template sequence amplificate can be detected, the confirmatory method was successful. Thus confirmation process of the invention at the point-of-need can be performed and the detection in a place with the appropriate resources happen (for .B. Availability of a ModaPlex system, Applied Biosystems ^® 3500 Genetic Analyzer or other device).

Therefore, a further subject of the present invention is at least one optionally labeled (in particular fluorescently labeled) artificial template sequence amplificate, in particular obtained or obtainable in a confirmatory method according to the invention. In a further embodiment of the confirmatory method according to the invention, the at least one optionally marked template sequence amplificate is detected by means of an electrophoretic method, which is preferably selected from flat gel electrophoresis or capillary gel electrophoresis. Preferably, an agarose gel or acrylamide gel is used for the flat gel electrophoresis. Capillary gel electrophoreses are apparatuses with glass capillaries (eg Applied Biosystems® 3500 Genetic Analyzer, Qiagen QIAxcel Advanced Instrument, Advanced Analytical Fragment Analyzer ™ Automated CE System) or microfluidic chips (eg. Agilent 2100 Bioanalyzer, Caliper Life Sciences LabChip ^®, Shimadzu MultiNA Microchip Electrophoresis System, Bio-Rad Laboratories Experion Automated Electrophoresis Station ™) to name. In a particular embodiment (Qiagen ModaPlex system), the signal is simultaneously quantified during the detection of the signal, in particular the optionally marked template sequence amplificates. With at least two optionally marked die sequence amplificates, all are detected distinctly by means of the electrophoretic method.

In a further embodiment of the confirmatory method according to the invention, which is preferably a multiplex method, the reaction mixture comprises

At least two or more target sequences to be detected, preferably different target sequences contained in one, in particular human, sample,

A combination of at least two or more FEN probes (FEN 1, FEN2, FEN _1-n ), which differ in their sequence, sequence length and / or labeling with one another, which in each case are in particular complementary to the different target sequences, and

At least two or more different artificial template sequences each comprising a complementary sequence to the at least two 5 ^' cleavage products (S1, S2, Si- _n ) of the at least two FEN probes, in particular each is a detection for each one target sequence and

wherein in the confirmatory method, each cycle of the amplification reaction

at least two or more different optionally labeled artificial template sequence amplificates are obtained,

each amplified target sequence is confirmed by at least one optionally labeled artificial template sequence amplicon, and

the at least two or more optionally labeled artificial template sequence amplificates are detected and quantified in an electrophoretic method. For two or more target sequences to be detected, two or more FEN probes (FEN 1, FEN2, FEN _1-n ) are used, which differ from each other at least in the 3 ^' sequence. Furthermore, the 5 ^' ends of the FEN probes also differ from each other. Accordingly, the two or more artificial template sequences differ, preferably differing in length or in their electrophoretic behavior by greater than or equal to 5, greater than or equal to 6, greater than or equal to 7, greater than or equal to 8, greater than or equal to 9 or greater than or equal to 10 base pairs. The number of different target sequences, FEN probes and / or further primers and the corresponding number of different artificial template sequence amplificates determines the multiplexing level of the method according to the invention. Preferably, at least 5, more preferably greater than or equal to 10, greater than or equal to 1 1, 12, 13, 14, 15, less than or equal 1000, less than or equal to 900, 85, 800, 750, 700, 650, 600 and less than or equal to 500, in particular 400, 300, 200, 100, 90, 85, 80, 75, 70, 65, 60, different artificial template sequence amplifications confirmed and distinctly detected. These can detect a variable number of target sequences in a sample, in particular a sample with an unknown number of different target sequences. Depending on the combination according to the invention of different FEN probes with different artificial template amplificates, the multiplex degree is determined. According to the above-described alternative a), up to 1000, preferably less than or equal to 950, less than or equal to 900, less than or equal to 850, and less than or equal to 800 different FEN probes with correspondingly the same number of different artificial template sequences can be used. According to alternative b) smaller than 70, preferably smaller than or equal to 60, 55, 50, 45, 40 to less than or equal to 30 different FEN probes with correspondingly the same number of different artificial template sequences can be used. The preferred embodiments of the FEN probes and of the combinations of FEN probe (s), FEN amplifier oligonucleotides (ENH _1-n ) and / or further primers (M1) apply here accordingly. Likewise, the preferred embodiments of the fluorescent dyes and FEN enzymes, polymerases with or without intrinsic FEN activity apply here accordingly and can be combined in the multiplex process according to specific requirements in individual cases.

Another object of the present invention is a mixture, preferably a liquid mixture in a suitable buffer comprising at least two or more (FEN1, FEN2 FEN _1-n ) mutually different target sequence-specific FLAP endonuclease probe (synonymous = FEN-probe mixture), each comprising FEN probe

A target sequence-specific 3 'sequence which is complementary to a sequence portion of the at least one target sequence within a region bounded by the at least first primer (P1) and the at least second primer (P2) on the target sequence, wherein the at least two FEN probes differ from each other at least in the 3 ^' sequence and / or 3 ^' sequence length, • at the 3 ^' end of the target sequence-specific 3' sequence, a protecting group, in particular as a polymerase blocker, and

A target sequence unspecific 5 'sequence. The FEN probes in the above mixture may be labeled, unlabeled or present as a mixture of labeled and unlabeled FEN probes. The label is preferably located at the respective 5 ^' end of the target sequence unspecific 5' sequence and comprises a fluorescent label, in particular a fluorophore. Suitable fluorophores and fluorescent dyes have been described above and may be combined in the mixture of two or more FEN probes (FEN1, FEN2, FEN1 _-n ). The FEN-probe mixture may comprise a suitable combination of different embodiments of the FEN probes according to the invention. The embodiments have been described above. This ensures the distinct confirmation of an arbitrary number of target sequences and a distinct detection of the corresponding number of template amplifications.

Another object of the present invention is a mixture, preferably a liquid mixture in a suitable buffer, comprising at least two or more different artificial Matrizensequenzen (synonymous = template mixture), which is at least in the sequence length, preferably greater than or equal to 5, greater than or equal to 6, greater equal to 7, greater than or equal to 8, greater than or equal to 9, greater than or equal to 10 base pairs, and / or the sequence, and optionally the label, to each other.

A further subject of the present invention is a multiplex kit, in particular for use in the confirmatory method according to the invention, comprising a combination of at least one (FEN1) or more FEN probes (FEN _1-n ) which differ in their sequence, sequence length and / or label, and each includes FEN probe

A target sequence-specific 3 'sequence which is complementary to a sequence segment of at least one target sequence within a region bounded by at least one first primer (P1) and at least one second primer (P2) on the target sequence,

• at the 3'-end of the target sequence-specific 3 'sequence a protecting group, in particular as polymerase blocker, preferably lacks the ^3' OH group, and

A target sequence unspecific 5 'sequence, preferably a FEN probe mixture according to the invention, and at least one or more different artificial template sequences, which differ in their sequence and / or sequence length, in particular and / or conformation, and which respectively complementary sequences to at least one 5 ^' cleavage product (S1, Si _-n ) of the at least one FEN probe or to at least one further primer, preferably a template mixture according to the invention.

In a further embodiment, the multiplex kit comprises at least two FEN probes (FEN1 and FEN2, FEN _1-n ), and / or at least one further primer (M1). In a further embodiment of the multiplex kit, the at least one FEN probe has a fluorescent label of the type described according to the invention.

In particular, the multiplex kit according to the invention, preferably in a spatially separate arrangement or as a ready-mix, buffer system, nucleotides, salts, etc. and all other components required for a successful PCR. These are known to the person skilled in the art and / or are specified by the device manufacturer of the devices used for amplification and / or detection. The multiplex kit according to the invention is preferably provided ready for use for the diagnosis of a, in particular human, sample. A further subject of the present invention is a composition comprising a combination of at least two different target sequence-specific flap endonuclease probe (FEN probe FEN1, FEN2, FEN _1-n ), each comprising FEN probe

A target sequence-specific 3 'sequence which is complementary to a sequence portion of the at least one target sequence within a region bounded by the at least first primer (P1) and the at least second primer (P2) on the target sequence, wherein the at least two FEN probes differ from each other at least in the 3 ^' sequence and / or 3 ^' sequence length,

• at the 3 ^' end of the target sequence-specific 3' sequence, a protecting group, in particular as a polymerase blocker, and

A target sequence unspecific 5 'sequence, and

at least two artificial template sequences which differ at least in sequence length by at least 10 base pairs and / or the sequence and optionally the label from each other, each of the 5 ^' cleavage products (Si- _n ) of the FEN probes having a complementary sequence to one sequence segment each has an artificial Matrizensequenz or its counterpart strand. Therefore, another object of the present invention is a liquid mixture comprising

a PCR buffer, especially with a suitable pH,

Nucleotides,

at least one (FEN 1) or more FEN probes (FEN _1-n ), which differ in their sequence, sequence length and / or label with each other, and each FEN probe comprises

At the 3 'end of the target sequence-specific 3' sequence, a protecting group, in particular as a polymerase blocker, preferably the 3 ^' -OH group, and a target sequence unspecific 5' sequence, and

at least one or more different artificial template sequences which differ in their sequence and / or sequence length and which each comprise complementary sequences to at least one 5 ^' cleavage product (S1, Si- _n ) of the at least one FEN probe or to at least one further primer , and

optional additives and additives known to those skilled in the art.

The confirmatory method according to the invention as well as the multiplex kit according to the invention is preferably a method and / or kit for the diagnosis and confirmation of the diagnosis of bacteria, parasites, fungi and / or viruses. In particular for the detection of Chlamydia, Streptococcus, Legionella, Listeria, MRSA, Mycobacterium, Salmonella, Toxoplasma, Candida, Hepatitis, HIV, Influenza, Varicella Zoster, Parvovirus and / or Enteroviruses.

Recently, a DNA analyzer (US7445893, US7081339, US7674582, US8182995, Hlousek et al., 2012) demonstrating the properties of a real-time quantitative PCR and PCR was presented with Qiagen ModaPlex Systems (Qiagen Mansfield Inc., Mansfield, MA) a capillary gel electrophoresis combined in one instrument. However, the PCR amplificates are analyzed in real time by electrokinetic injection into the capillary gel electrophoresis with subsequent signal quantification from the PCR mixture at intervals of 2 or more PCR cycles. The results are presented as real-time PCR amplification curves and threshold cycles (C _t ) are calculated (Figure 3). A PCR confirmation test for this automated analyzer must be performed due to the closed Analysis system carried out homogeneously in the PCR approach. The present invention for the first time offers such a homogeneous, continuous PCR approach for use with the Qiagen ModaPlex system.

Therefore, a further subject of the present invention is the use of the method according to the invention and / or of the multiplex kit according to the invention in a device for carrying out a quantitative real-time PCR and a capillary gel electrophoresis, in particular in a ModaPlex system.

Description of the Figures (FIG.

FIG. 1: Relative arrangement of the PCR primers used, FEN probes, FEN amplifier oligonucleotides and additional primers. A) The relative binding sites of the PCR primers (Can_Set003_SP1 1, Can_Set002_ASP1), FEN probes (Can_FEN1,

Can_FEN2) and FEN enhancer oligonucleotides (Can_ENH1 -4) relative to the 18s rDNA region of C. albicans are shown. The 5 '^ 3' strand corresponds to Genbank accession number AY497754. X is unlabeled, Y is 6-carboxyfluorescein. B) The target sequence-independent 5 'sequence regions (dashed arrows) of the FEN probes Can_FEN1 and Can_FEN2 bind to the artificial one after their cleavage

Matrix sequence Alpha 1. The DNA sequence of the unlabelled primer WB127F is identical to the cleaved 5 'sequence region of the FEN probe Can_FEN1. The figures are not drawn to scale. Polymerase blockers (3'-C3-carbon spacer) are shown as full-surface checks. 3 'nucleotides of the FEN enhancer oligonucleotides that overlap the target sequence specific regions of the FEN probes are shown as open circles. Arrows refer to oligonucleotides which can act as primers.

Figure 2: Hybridization of the FEN probes (Can_FEN1, 2) and FEN enhancer oligonucleotides (Can_EHN1-4) with their target sequences. A) The sequences of

Can_FEN1 and the corresponding FEN enhancer oligonucleotides Can_ENH1 and Can_ENH3 are shown. B) The sequences of Can_FEN2 and the corresponding FEN amplifier oligonucleotides Can_ENH2 and Can_ENH4 are shown. The target sequence corresponds to the opposite strand of the 18s rDNA region of C. albicans with the Genbank accession number AY497754. 6FAM, 6-carboxyfluorescein;

Spacer 3, polymerase blocker 3'-C3 carbon spacer. Fig. 3: Analysis of an artificial amplicon, which was formed depending on the cleavage product of the FEN-Can_FEN2 probe, by means of the Applied Biosystems ^® 3500 Genetic Analyzer. The PCR consisted of 50 pg genomic DNA from C. albicans, the

PCR primers Can_Set003_SP1 1 and Can_Set002_ASP1, the FEN probe Can_FEN2, the FEN amplifier oligonucleotide Can_ENH2, the additional primer WB127 and the artificial template sequence Alpha 1. For further details see text. An aliquot of 1 μΙ_ of a 1:20 dilution of the PCR amplicon was analyzed. A) 6FAM analysis channel with the amplification product of Alpha 1. B) Length standard in

Analysis channel BTO. RFU, relative fluorescence units.

4: Analysis of an artificial amplificate, which was formed as a function of the cleavage product of the FEN probe Can_FEN2, by means of the Qiagen ModaPlex system. The PCR consisted of 50 μg of genomic DNA from C. albicans, the PCR primers

Can_Set003_SP1 1 and Can_Set002_ASP1, the FEN probe Can_FEN2, the FEN amplifier oligonucleotide Can_ENH2, the additional primer WB127 and the artificial template sequence Alpha 1. Further details see text. The large graph shows the electropherogram for the 35th cycle, with relative fluorescence units (RFU) plotted over the data points. C1 10, C249 and C306 refer to the internal amplification standards in the 6FAM channel, which were used as references for the determination of fragment lengths and for the quantification of the alpha 1 ammount (labeled alpha). The internal graph shows the evaluation of the quantification of the Alpha 1 supplement over 12 injections, where the decadic logarithm of the peak area in RFU is plotted against the cycle number. A C _t value of

24.36 was determined.

In the following, selected examples for achieving the solution according to the invention are explained, wherein the examples presented here are not to be construed restrictively. Examples

Example 1: Confirmation of a PCR amplicon using a Flap endonuclease (FEN) probe and an artificial template sequence with the Applied Biosystems ^® 3500 Genetic Analyzer

material and methods

DNA purification from Candida albicans DSM 1386: The reference strain was obtained from the DSMZ - German Collection for Microorganisms and Cell Cultures GmbH (Braunschweig, DE). Yeast cells were cultured at 25 ° C on Sabouraud glucose agar with chloramphenicol (Bio-Rad Laboratories GmbH, Munich, DE). Cells were harvested with a sterile spatula and resuspended in sterile phosphate buffered saline (PBS, 137mM NaCl, 2.7mM KCl, 10mM Na ₂ HP0 ₄ , 1, 8mM KH ₂ PO ₄ , pH 7.4). The DNA purification was performed using the QIAamp ^® DNA Mini Kit (Qiagen GmbH, Hilden, Germany) according to manufacturer's instructions and the following change: The samples were treated for cell disruption using ATL buffer and proteinase K from the manufacturer and at least 12 h at 50 ° C incubated. The purified DNA was quantified by UV-VIS spectroscopy using an Eppendorf BioPhotometer ^® ^® (Eppendorf AG, Hamburg, Germany).

Design and Synthesis of PCR Primers, FEN Probes, FEN Enhancer Oligonucleotides, and the Universal Template Sequence: A portion of the C. albicans 18s rDNA gene (Genbank accession number AY497754) was selected as the target sequence. A 127 base long artificial template sequence alpha 1 was derived in part from the / acZa sequence of the pUC19 plasmid (Genbank accession number L09137). The PCR primers, probes and FEN FEN amplifier oligonucleotides with the software Vector NTI ^® (Thermo Fisher Scientific Inc. - Life Technologies Div, Darmstadt, DE.) And Mfold (Zuker 2003) designed. The primer attachment temperatures (T _a ) of the FEN probes (Can_FEN1 and Can_FEN2) and FEN enhancer oligonucleotides (Can_ENH1, Can_ENH2, Can_ENH3, Can_ENH4) were at least 5 ° C higher than the T _{a of} the PCR primers, similar to the design rules for hydrolysis probes (Heid et at. 1996).

As FEN amplifier oligonucleotides, oligonucleotides were designed 3'-upstream of the FEN probes, which at the 3 'end with one (Can_ENH3, Can_ENH4) or two (Can_ENH1, Can_ENH2) nucleotides to the target sequence-specific 5' binding site of the FEN probe overlapped and additionally contained at its 3 'end a non-mating base (3' flap) (Lyamichev et al., 1993, Xu et al., 2001) (Figure 2).

The relative location of the PCR primers, FEN probes and FEN enhancer oligonucleotides on the target sequence is shown in FIG. Figure 2 shows the DNA sequences of the FEN probes and FEN enhancer oligonucleotides as well as their binding sites on the target DNA.

All oligonucleotides were obtained in HPLC-purified grade from biomers.net GmbH (Ulm, DE).

Table 1: Primers, FEN probes, FEN enhancer oligonucleotides, and artificial template sequence. The Primera bond temperature (T _a) with the software Vector NTI ^® ^(Thermo Fisher Scientific Inc. - Life Technologies, Darmstadt, DE) using the default settings. Underlining sequences correspond to the 5 'ends of the flap endonuclease (FEN) probes, which after cleavage as PCR primers bind to the artificial template sequence alpha 1 or its countersequence. 6FAM, 6-carboxyfluorescein; X, unmarked, Y, 6FAM, spacer 3, 3'-C3 carbon spacer.

Name sequence (5 '->3' end) and modification T _a [° C]

Can_Set00

G GTAG G ATAGTG G C CTAC C ATG G 1 1 1 58.7 3_SP1 1

Can_Set00

CCGACCGTCCCTATTAATCATTACGAT 60.4 2_ASP1

X-TTAACTATG CG GCATCAGAG CAG ATTG GAGG G CAAGTCTG G

Can_FEN1 66.9

TGCCAGC spacer 3

Y CAACAGTTGCGCAGCCTGAATGCGTACTGGACCCAGCCGA

Can_FEN2 67.7

GCC spacer 3

WB127F TTAACTATG C G G CATC AG AG C AG A 57.8

Can_F1 AACCTTGGGCTTGGCTGGC 58.6

Can_ENH2 CTTGGCTGGCCGGTCCATCTTTTGAG 68.0

Can_ENH1 TTGGAATGAGTACAATGTAAATACCTTAACGAGGAACAAG 66.0

Can_ENH3 TTG GAATGAGTACAATGTAAATACCTTAAC GAG GAAC AG 65,4

Can_ENH4 CTTGGCTGGCCGGTCCATCTTTTGG 66,8

TTAACTATGCGGCATCAGAGCAGATTGTACTGAGAGTGCACCA not

Alphal TATGCGGTGTGAAATACCGCACAGATGCGTAAGGAGAAAATA Anwendung¬

CCGCATCAGGCGCCATTCGCCATTCAGGCTGCGCAACTGTTG bar Polymerase chain reaction (PCR): The PCR was carried out in a volume of 25 μl and contained Ifachen REMA buffer (with final concentrations of 0.2 mM dNTPs and 1.5 mM MgCl ₂ ; Biotype Diagnostic GmbH, Dresden, DE), 2 , 5 Units Multi Taq2 DNA Polymerase (with Hotstart function, Biotype Diagnostic GmbH, Dresden, DE), 10-50 pg of chromosomal DNA from C. albicans, 4 nM to 4 μΜ artificial template sequence Alpha 1, 0.3 μΜ PCR primer and 0.3 μΜ FEN probes. FEN enhancer oligonucleotides (ENH, ENH _1-n ) and / or primer WB127 were also optionally used in a final concentration of 0.3 μΜ (for DNA sequences, see Tables 1 and 2). Zero controls were performed without chromosomal DNA from C. albicans. In addition, experiments with Klentaq ^* ! , an N-terminal deletion variant of Taq DNA polymerase lacking FEN activity (US5436149, DNA Polymerase Technology Inc., St. Louis, US-MO). An Eppendorf MasterCycler ^® ep gradient thermal cycler (Eppendorf AG, Hamburg, Germany) was used. The temperature change consisted of 4 minutes of hot start activation at 96 ° C and 35 cycles of 30 seconds at 96 ° C, 60 seconds at 60 ° C and 60 seconds at 72 ° C. Finally, an extension step was performed at 72 ° C for 10 minutes, and the reactions were then stored at 4 ° C until further analysis.

Capillary gel electrophoresis using the Applied Biosystems ^® 3500 Genetic Analyzer (Thermo Fisher Scientific - Applied Biosystems Div, Foster City, CA US.): The

The automated analyzer was used with the 3500 POP-7 ™ polymer (Performance Optimized Polymer) according to the manufacturer's instructions and with the following adjustments: The spectral calibration of the device was carried out with the virtual filter set AnyöDye in combination with the matrix standard BT5 (fluorescent colors 6FAM, BTG, BTY, BTR, BTO, for blue, green, yellow, red and orange) (Biotype Diagnostic GmbH, Dresden, DE). Aliquots of 1 μΙ_ of PCR or dilutions thereof were digested with 12 μΙ_ HiDi formamide (Thermo Fisher Scientific - Applied Biosystems Div., Foster City, US-CA) and 0.5 μΙ length standard SST-BTO (Biotype Diagnostic GmbH, Dresden, DE ), incubated for 3 min at 95 ° C and then stored at room temperature in the autosampler until electrokinetic injection (10,000 V, 5 s) at room temperature. The analysis unit of the automatic analyzer records relative fluorescence units (RFU) over the fragment length (bases, b) (see FIG. 3). The device configuration allows a maximum of a semi-quantitative evaluation (up to 20% fluctuations between the injections of the same samples). Results and discussion

First, the optimal primer binding temperature T _a of 60 ° C for the C. albicans PCR and the PCR primer pair Can_Set003_SP1 1 and Can_Set002_ASP1 in a T _a gradient between 55 ° C and 65 ° C was determined. A specific band corresponding to the calculated length of 539 bp could be visualized by ethidium bromide staining after agarose gel electrophoresis (not shown). Thereafter, the optimal concentration for the universal DNA template Alpha 1 was determined in PCRs, which in addition to the PCR primer pair 0.3 μΜ of the FEN probe Can_FEN2 with 6FAM labeling at the 5 'end and 4 nM to 4 μΜ of the artificial template sequence Alphal contained. The results were evaluated 3500 Genetic Analyzer by Applied Biosystems ^®.

A dilution between 20 nM to 160 nM gave good results.

Table 2: Analysis of the PCR products with the Applied Biosystems ^® 3500 Genetic Analyzer. All PCR were performed with 50 μg of chromosomal DNA from C. albicans, 40 nM Alpha 1, 0.3 μM Can_Set003_SP1 1 and 0.3 μM Can_Set002_ASP1. In each case 1 μl of a 1:20 dilution of the PCR amplificates was used. RFU, relative fluorescence units of the signal surfaces.

Subsequently, PCRs were carried out, which always contained 40 nM Alphal and 0.3 μΜ of the FEN probe Can_FEN2 with 5'-6FAM labeling. In addition, in certain PCRs, the unlabeled FEN probe Can_FEN1, FEN enhancer oligonucleotides and / or the primer WB127F, which binds to the 5 'end of the alpha 1 counterstrand (see also Figure 1 and Table 1), were tested. The results are summarized in Table 2. The 127 bp amplificate, which was expected with the artificial template sequence Alpha 1, could be confirmed (FIG. 3). Control approaches without genomic DNA or with KlenTaql DNA polymerase instead of Taq DNA polymerase did not show any amplicons (not shown). The amplification of the artificial template sequence Alpha 1 was thus dependent on the FEN activity of the Taq DNA polymerase.

As shown in Table 2, the signal could not be significantly increased by the addition of a second FEN probe whose 5 'cleavage product binds to the 5' end of the alpha 1 counterstrand. By adding only the FEN amplifiers Can_ENH2 or Can_ENH4, signals approx. 5.5-6.5 times higher could be achieved. The addition of a FEN amplifier and the primer WB127F surprisingly resulted in approximately 34-46 times higher signals.

Example 2 Confirmation of a PCR Amplificate Using a FEN Probe and an Artificial Template Sequence with the Qiagen ModaPlex System

material and methods

Chromosomal DNA, oligonucleotides and PCR: The DNA purification from C. albicans DSM 1386, the design and synthesis of the oligonucleotides and the PCR was already described in Example 1 (see also Table 1).

ModaPlex System (QIAGEN Mansfield Inc., Mansfield, MA): The automated analyzer is a modular instrument consisting of a PCR thermal cycler, autosampler, capillary gel electrophoresis and a fluorescence detector with two analysis channels (US7445893, US7081339, US7674582, US8182995 Hlousek et al., 2012). The analyzer was operated completely with the reagents of the manufacturer and according to his instructions.

The PCR was set up with the manufacturer's chemicals, the final concentrations of the PCR primers, FEN probes and FEN amplifier oligonucleotides corresponding to Example 1. The artificial template sequence Alpha 1 was used at a final concentration of 40 nM. The PCR program included 15 min of hot-start activation at 95 ° C followed of 35 cycles at 95 ° C for 30 s, 62 ° C for 90 s and 72 ° C for 60 s. Real-time analysis by capillary gel electrophoresis was performed 12 times in the elongation phase at 72 ° C by electrokinetic injection (10,000 V, 15 s) from the 13th to the 35th cycles (every other cycle). The detection unit records relative fluorescence units (RFUs) above the data points in the form of an electropherogram (Figure 4). In addition, a 2D gel view of capillary gel electrophoresis (not shown in Figure 4) and a real-time PCR amplification curve with C _t (Threshold Cycles) are calculated (Figure 4). For the calculation of fragment lengths and for qualification, in each sample 3 internal PCR calibrators per analysis channel are also amplified (C1 10, C249 and C306 for the 6FAM analysis channel in FIG. 4).

Results and discussion

The results are summarized in Table 3. No C _t values could be calculated when only FEN probes were used. The addition of FEN-amplifier oligonucleotides or primer WB127F resulted in _Ct values which were comparable to the relative results, the 3500 Genetic Analyzer has been made with the Applied Biosystems ^®. The addition of the FEN amplifier oligonucleotide Can-ENH2 and of the primer WB127F also gave the best result with the same initial concentration of chromosomal DNA (C _t = 24.36).

Table 3: Analysis of the PCR products with the Qiagen ModPlex system. All PCRs were performed with 50 μg of chromosomal DNA from C. albicans, 40 nM Alpha 1, 0.3 μM Can_Set003_SP1 1 and 0.3 μM Can_Set002_ASP1, n.b., not calculated.

Quoted literature:

Grossman PD, Bloch W, Brinson E, Chang CC, Eggerding FA, Fung S, lovannisci DM, Woo S, Winn-Deen ES (1994). High density multiplex detection of nucleic acid sequences: oligonucleotide ligation assay and sequence-coded separation. Nucleic Acids Res 22: 4527-4534.

Heid CA, Stevens J, Livak KJ, Williams PM (1996). Real time quantitative PCR. Genome Res 6, 986-994.

Hlousek L, Voronov S, Diankov V, Leblang AB, Wells PJ, Ford DM, Nolling J, Hart KW,

Espinoza PA, Bristol MR, Tsongalis GJ, Yen-Lieberman B, Slepnev VI, Kong LI, Lee MC (2012). Automated high multiplex qPCR platform for simultaneous detection and quantification of multiple nucleic acid targets. Biotechniques 52: 316-324.

Kaiser MW, Lyamicheva N, Ma W, Miller C, Neri B, Fors L, Lyamichev VI (1999). A comparison of eubacterial and archaeal structure-specific 5'-exonucleases. J Biol Chem 274:

From 21,387 to 21,394.

Lyamichev V, Brow MA, Dahlberg JE (1993). Structure-specific endonucleolytic cleavage of nucleic acid by eubacterial DNA polymerases. Science 260: 778-783.

MIQ-1 (2011). Microbiological-Infectiological Quality Standards (MiQ) - Nucleic Acid Amplification Techniques (NAT) Guidelines of the DGHM in cooperation with BÄMI, DGP, DGPI, DMykG, DSTIG, DTG, DW, ESGMD / ESCMID, GfV, INSTAND, SGM (Reischl U et al., Urban & Fischer, Munich, ISBN-13 978-3-437-41535-5).

Rili-BÄK-B3 (2013). Guideline of the German Medical Association for the Quality Assurance of Laboratory Medical Examinations (Rili-BÄK). Part B3: Direct detection and characterization of infectious agents. Deutsches Ärzteblatt 1 10: A 575-A 582.

Stellwagen NC (2009). Electrophoresis of DNA in agarose gels, polyacrylamide gels and in free solution. Electrophoresis 30 Suppl 1: S188-195.

Xu Y, Potapova O, Leschziner AE, Grindley ND, Joyce CM (2001). Contacts between the 5 'nuclease of DNA polymerase I and its DNA substrates. J Biol Chem 276, 30167-30177.

Zuker M (2003). Mfold web server for nucleic acid folding and hybridization prediction. Nucl Acids Res 31: 3406-3415.

Claims

Confirmation of at least one amplified nucleic acid target sequence (target sequence) during a amplification reaction in a collective and continuous reaction mixture comprising a reaction mixture comprising at least one target sequence to be detected, at least two target sequence-specific primers (P1, P2, P1-n) which are used to amplify the at least a target sequence, at least one target sequence-specific FLAP endonuclease probe (FEN probe FEN1, FEN1-n), wherein the at least one FEN probe comprises a target sequence-specific 3 'sequence which is complementary to a sequence segment of the at least one Target sequence within a region delimited by the at least first primer (P1) and the at least second primer (P2) on the target sequence, a protective group at the 3 'end of the target sequence-specific 3' sequence and a target sequence-unspecific 5 'sequence, and at least one artificial template sequence, the Confirmation method comprises, per cycle of the amplification reaction, the steps of hybridizing the target sequence-specific 3 'sequence of the at least one FEN probe to a complementary sequence of the at least one target sequence to be detected, cleaving the at least one FEN probe, obtaining at least one free 5' cleavage product (Si-n) each comprising the target sequence unspecific 5 'sequence, hybridization of the at least one 5' cleavage product (Si-n) of the at least one FEN probe to a complementary sequence of the at least one artificial template sequence, amplification of the at least one artificial Template sequence with the at least one 5'-cleavage product (Si-n) of the at least one FEN probe, and optionally labeling of the at least one artificial template sequence during the amplification by the at least one 5'-cleavage product (Si-n) of the at least one FEN probe Probe. Confirmation method according to claim 1, wherein the protecting group at the 3 'end of the target sequence-specific 3' sequence of the at least one FEN probe instead of the 3'-OH group comprises a DNA sequence greater than or equal to 1 base to less than 5 bases, which is not complementary to the target sequence. The confirmatory method according to claim 1 or 2, wherein the reaction mixture further comprises at least one enzyme capable of cleaving the at least one FEN probe selected from an FEN as an intrinsic component of a DNA polymerase or as an enzyme separated from a polymerase. A confirmatory method according to any one of claims 1 to 3, wherein the reaction mixture further comprises at least one FEN enhancer oligonucleotide (ENH1-n) whose sequence at the 3 "end is at least one base with the target sequence specific 3 'sequence at the 5' end Confirmation method according to one of claims 1 to 4, wherein the reaction mixture further comprises at least two FEN probes (FEN 1, FEN2, FEN1-n), each of which has a target sequence-specific 3'- A confirmation method according to any one of claims 1 to 5, wherein the reaction mixture comprises at least two artificial template sequences which differ in sequence and / or sequence length and which respectively have complementary sequences to at least one 5 'cleavage product (Si-n) of the respective ones A confirmation probe according to any one of claims 1 to 6, wherein the functional sequence length d it comprises at least one labeled FEN probe according to alternative a) greater than or equal to 20 bases to less than or equal to 60 bases or to alternative b) greater than or equal to 20 bases to less than or equal to 100 bases. A confirmatory method according to any one of claims 1 to 7, wherein the reaction mixture comprises at least one FEN probe and at least one further primer (M1), at least one FEN probe, at least one FEN enhancer oligonucleotide (ENH1-n) and at least one further primer (M1), or at least two FEN probes, at least one FEN amplifier oligonucleotide (ENH1-n) and at least one further primer (M1), wherein the further primer (M1) is complementary to a sequence portion of the complementary strand of the at least one artificial template sequence and the at least second FEN probe has a target sequence-specific 3 'sequence other than the first FEN probe which is complementary to a sequence within a region of the at least one target sequence selected from the at least first primer (P1) and the at least the second primer (P2) is limited and whose cleavage product (S2) differs from the cleavage product (S1) of the first FEN probe and complementary to a S equiangular section of the backbone of the at least one artificial Matrizensequenz. A confirmatory method according to any one of claims 1 to 8, wherein the target sequence specific 3 'sequence of the at least first and / or the at least second FEN probe hybridizes to their respective complementary target sequence of the same molecule or to two different target sequence molecules. The confirmatory method of any one of claims 1 to 9, wherein the 5 'end of the target sequence unspecific 5' sequence of the at least one FEN probe comprises a fluorescent label.

1 . The confirmatory method of any one of claims 1 to 10, wherein the confirmation of the at least one amplified target sequence is the at least one optionally labeled artificial template sequence amplificate amplified or amplified and labeled by the 5 ^' cleavage product (Si- _n ) of the at least one FEN probe ,

2. A confirmation method according to any one of claims 1 to 1 1, wherein the at least one optionally marked Matrizensquenzamplifikat by means of an electrophoretic

Method is detected.

The confirmatory method of claim 12, wherein the electrophoretic method is selected from flat gel electrophoresis or capillary gel electrophoresis.

The confirmatory method according to any one of claims 1 to 13, wherein the reaction mixture comprises

At least two or more target sequences to be detected,

A combination of at least two or more FEN probes (FEN 1, FEN 2, FEN _1-n ), which differ in their sequence, sequence length and / or labeling, and

At least two or more different artificial template sequences, each comprising a complementary sequence to the at least two 5 ^' cleavage products (S1, S2, Si- _n ) of the at least two FEN probes, and

wherein in the confirmatory method, each cycle of the amplification reaction

the at least two or more optionally marked artificial ones

Stem sequence amplificates can be detected and quantified in an electrophoretic procedure.

5. FEN probe mixture comprising at least two or more (FEN 1, FEN2 FEN _1-n ) mutually different target sequence-specific flap endonuclease probe (FEN-probe mixture), each comprising FEN probe each

• at the 3'-end of the target sequence-specific 3'-sequence a protecting group and

A target sequence unspecific 5 'sequence. The FEN-probe mixture of claim 15, wherein the FEN probes are labeled or unlabelled at their respective 5 ^' ends of the target sequence unspecific 5' sequence or as a mixture of labeled and unlabeled FEN probes (FEN 1, FEN 2, FEN _1-n ) are present.

Multiplex kit comprising a combination of

at least one or more FEN probes (FEN _1-n ), which are in their

Sequence length and / or mark differ from each other, and includes each FEN probe

• at the 3 'end of the target sequence-specific 3' sequence a protecting group and

A target sequence unspecific 5 'sequence, and

at least one or more different artificial template sequences which differ in their sequence and / or sequence length and which each comprise complementary sequences to at least one 5 ^' cleavage product (Si- _n ) of the at least one FEN probe or to at least one further primer.