WO2017044776A1 - Single-guide rna (sgrna) with improved knockout efficiency - Google Patents
Single-guide rna (sgrna) with improved knockout efficiency Download PDFInfo
- Publication number
- WO2017044776A1 WO2017044776A1 PCT/US2016/050989 US2016050989W WO2017044776A1 WO 2017044776 A1 WO2017044776 A1 WO 2017044776A1 US 2016050989 W US2016050989 W US 2016050989W WO 2017044776 A1 WO2017044776 A1 WO 2017044776A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- sgrna
- modified
- mutated
- cells
- duplex region
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/111—General methods applicable to biologically active non-coding nucleic acids
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/20—Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPR]
Definitions
- the present invention relates in general to the field of modification of gene expression, and more particularly, to compositions and methods for designing single-guide RNA (sgRNA) with improved knockout efficiency.
- sgRNA single-guide RNA
- SpCas9 Streptococcus pyogenes Cas9 nuclease
- sgRNAs single-guide RNAs
- RNA molecules such as siRNA, shRNA, miRNA mimics and inhibitors, IncRNA, antisense RNA, aptamers, ribozymes, and sgRNA molecules.
- the present invention includes a modified single-guide RNA (sgRNA) template with improved knockout efficiency specific for a target gene comprising an sgRNA construct comprising at least one of a mutated duplex region wherein a length of the duplex region is extended, or a mutated poly T region at the beginning of the duplex region, wherein the sgRNA has a greater target gene knockout efficiency in cells.
- the modified duplex region changes the pause site for a pol III RNAse polymerase at the continuous Thymine RNA segment.
- the modified duplex region comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 extra nucleotides in each strand of the modified duplex region.
- the cells are mammalian cells. In another aspect, the cells are the human cells.
- the sgRNA comprises both the mutated duplex region and mutation of the poly T region. In another aspect, the sgRNA is part of a gene library. In another aspect, the sgRNA is defined further as being in an sgRNA expression vector. In another aspect, the sgRNA is defined further as being in a transgene vector. In another aspect, the sgRNA comprises SEQ ID NOS:l to 4. In another aspect, the sgRNA comprises both a mutated duplex region wherein a length of the duplex region is extended and a mutated poly T region at the beginning of the duplex region. In another aspect, the mutant sgRNA is selected from SEQ ID NOS:3 to 133 or 140.
- the present invention includes a method designing a modified single- guide RNA (sgRNA) template with improved knockout efficiency for a specific target gene comprising: identifying a target gene; and modifying an sgRNA that is specific for the target gene by at least one of increasing the length of the duplex region or mutating a poly T region at the end of the duplex region of the modified sgRNA, wherein the modified sgRNA has a higher target gene knockout efficiency in cells than the unmodified sgRNA.
- the modified duplex region changes the pause site for a pol III RNAse polymerase at the continuous Thymine RNA segment.
- the modified duplex region comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 extra nucleotides in each strand of the modified duplex region.
- the cells are mammalian cells. In another aspect, the cells are human cells.
- the sgRNA comprises both the mutated duplex region and mutation of the poly T region. In another aspect, the sgRNA is part of a gene library. In another aspect, the sgRNA is defined further as being in a sgRNA expression vector. In another aspect, the sgRNA is defined further as being in a transgene vector. In another aspect, the sgRNA comprises SEQ ID NOS:3 to 133 or 140.
- the sgRNA comprises both a mutated duplex region wherein a length of the duplex region is extended and a mutated poly T region at the beginning of the duplex region.
- the mutant sgRNA is selected from SEQ ID NOS:3 to 133 or 140.
- the present invention includes a method of determining the knockdown effectiveness against a target gene by a mutated candidate sgRNA, the method comprising: (a) obtaining one or more mutated candidate sgRNAs, wherein the sgRNA has been mutated by at least one of at least one of increasing the length of the duplex region or mutating poly T region at the end of the duplex region; (b) expressing the mutated sgRNAs in a first cell that expresses the target gene, and a non-mutated sgRNA to a second subset of the patients, and expressing a non-mutated sgRNA in a second cell; and (c) determining if the mutated candidate sgRNA knocked down expression of the target gene in the first cell to a greater extent than the non-mutated sgRNA in the second cell.
- the mutant sgRNA is selected from SEQ ID NOS:3 to l33 or 140.
- the present invention includes a mutant single-guide RNA (sgRNA) template with improved knockout efficiency specific for a target gene comprising a target- specific sequence and a modified sequence, wherein the sequence comprises at least one of a mutated duplex region wherein a length of the duplex region is extended, or a mutated poly T region at the end of the duplex region, wherein the sgRNA has a greater target gene knockout efficiency in cells.
- the mutant sgRNA is inserted into an sgRNA expression vector.
- the mutant sgRNA is selected from SEQ ID NOS:3 to 133 or 140. Description of the Drawings
- FIGS. 1A to ID show that the knockout efficiency can be increased by extending the duplex and disrupting the continuous sequence of Ts.
- FIG. 1A is a schematic of the duplex extension (SEQ ID NOS: 127, 2-7. Green, the 3' 34 nt, which is not required for sgRNA functionality in vitro but is required in cells; red, the extended base pairs.
- FIG. IB shows the extension of the duplex increased knockout efficiency. Constructs harboring sgRNAs targeting the CCR5 gene were co- transfected with a Cas9-expressing plasmid into TZM-bl cells. An sgRNA targeting the HIV genome served as mock control.
- FIG. 1C shows the equivalent results from FIG. IB at protein level that was repeated for another sgRNA, sp2. The difference with FIG. IB is that the cells were not sorted, but the CCR5 disruption rate was measured in GFP-positive cells.
- FIG. ID shows that a mutation of the Pol III pause signal significantly increased knockout efficiency SEQ ID NOS:8, 14-17.
- the mutated nucleotides are shown in bold.
- FIGS. 2A and 2B show that the knockout efficiency can be further increased by combining duplex extension with disruption of the continuous sequence of Ts SEQ ID NOS:18, 19, 20, 21, 29.
- FIG. 2A shows the effect of duplex extension when mutating the fourth T to an A in four sgRNAs, SEQ ID NOS:8, 14-17.
- FIG. 2B shows the effect of mutation of Ts at the indicated positions to A, C, or G when also extending the duplex by 5 bp.
- FIGS. 3 A to 3C show that the optimized sgRNA structure is superior to the original version.
- FIG. 3 A shows the CCR5 knockout efficiency as determined for the indicated sgRNAs targeting CCR5 with either an optimized sgRNA structure or the original structure. The knockout efficiency was determined in the same way as in FIG. IB.
- FIG. 3 A shows the CCR5 knockout efficiency as determined for the indicated sgRNAs targeting CCR5 with either an optimized sgRNA structure or the original structure. The knockout efficiency was determined in the same way as in FIG. IB.
- FIG. 3B shows CD4 knockout efficiency as determined for the indicated
- T ⁇ C and T ⁇ G mutations are superior to the T ⁇ A mutation. Eleven sgRNAs targeting CCR5 were randomly selected. The knockout efficiency of sgRNAs with different mutations at position 4 in the sequence of continuous Ts were determined as in FIG. 1C.
- FIGS. 4A and 4B show that the efficiency of gene deletion is increased dramatically using optimized sgRNAs.
- FIG. 4A is a schematic of the CCR5 gene deletion.
- FIG. 4B shows the sgRNA pairs targeting CCR5 with the original or optimized structures were co-transfected into TZM-bl cells with a Cas9-expressing plasmid. The gene-deletion efficiency was determined by amplifying the CCR5 gene fragment. Note that the truncated fragments of CCR5, with a smaller size than wild type CCR5, are a consequence of gene deletion using paired sgRNAs. The numbers below each lane indicate the percentage deletion.
- FIGS. 5A to 5E show how modifications increase knockout efficiency.
- FIG. 5A to 5E show how modifications increase knockout efficiency.
- FIG. 5A shows the knockout efficiency of sp3 from FIG. 2A with the indicated modifications was determined as in FIG. IB. Mut represents mutation, O represents original.
- FIG. 5B shows the sgRNA levels determined by real-time PCR. The relative expression level was normalized to U6 small RNA.
- FIG. 5C shows in vitro transcribed sgRNA formed dimers (upper panel), which can be transformed into monomers by a heating and quick cooling step.
- FIG. 5D shows that sp7 from FIG. 3B was transcribed in vitro and preloaded into Cas9. The complex was electroporated into activated primary CD4+ T cells. Knockout efficiency was determined as in FIG. 3B.
- FIG. 5E shows the in vitro transcribed sp7 was electroporated into TZM-Cas9 cells. Knockout efficiency was determined as in FIG. 3B.
- FIGS. 6A to 6B shows the testing effect of modifications by lentiviral infection.
- FIG. 6A shows that TZM-bl cells or FIG. 6B JLTRG-R5 cells were infected with Cas9-expressing lentivirus, and cells stably expressing Cas9 were selected.
- FIG. 7 is a schematic of an optimized sgRNA structure (SEQ ID NO: 140).
- the duplex extension is highlighted in red, and the mutation is marked in bold.
- the duplex extension can be 4-6 nt, and the mutation can be C or G, which showed similar knockout efficiency in most cases.
- bp base pair
- CRISPR clustered regularly interspaced short palindromic repeat
- PCR polymerase chain reaction
- sgRNA single-guide RNA
- GFP green fluorescent protein.
- FACS fluorescence-activated cell sorting.
- crRNA CRISPR RNA.
- tracrRNA trans-activating crRNA.
- modified with reference to nucleic acid sequences includes changes such as insertions, deletions, substitutions, fusions with related or unrelated sequences that are designed into the sgRNA, or may be the result of polymorphisms, alleles and other structural types, or making a library of modifications and selecting individual or groups of members of that library. Alterations encompass genomic DNA and RNA sequences that may differ with respect to their hybridization properties using a given hybridization probe. Alterations of polynucleotide sequences for sgRNAs, or fragments thereof, include those that increase, decrease, or have no effect on functionality.
- gene is used to refer to a functional protein, polypeptide or peptide-encoding unit. As will be understood by those in the art, this functional term includes both genomic sequences, cDNA sequences, or fragments or combinations thereof, as well as gene products, including those that may have been altered by the hand of man. Purified genes, nucleic acids, protein and the like are used to refer to these entities when identified and separated from at least one contaminating nucleic acid or protein with which it is ordinarily associated.
- the term "vector" is used in reference to nucleic acid molecules that transfer DNA segment(s) from one cell to another.
- the vector may be further defined as one designed to propagate the modified sgRNA sequences of the present invention, or as a transcription and expression vector that includes a promoter operatively linked to the modified sgRNA sequences ro generate the sgRNAs, or one designed to cause such a promoter to be introduced.
- the vector may exist in a state independent of the host cell chromosome, or may be integrated into the host cell chromosome.
- host cell refers to cells that have been engineered to contain the modified sgRNA disclosed herein, and include archeal, prokaryotic, or eukaryotic. Thus, engineered, or recombinant cells, are distinguishable from naturally occurring cells that do not contain recombinantly introduced genes through recombinant techniques.
- the term "homology” refers to the extent to which two nucleic acids are complementary. There may be partial or complete homology. A partially complementary sequence is one that at least partially inhibits a completely complementary sequence from hybridizing to a target nucleic acid and is referred to using the functional term "substantially homologous.” The degree or extent of hybridization may be examined using a hybridization or other assay (such as a competitive PCR assay) and is meant, as will be known to those of skill in the art, to include specific interaction even at low stringency.
- a single-guide RNA (sgRNA) molecule is one of two components of the CRISPR-Cas9 genome-editing technology, which is one of the most commonly used tools in biological research and has been actively pursued as a therapeutic tool for treating various diseases.
- the current sgRNA design template is based mainly on an in vitro study. In cells, the inventors showed that sgRNA sequence requirements are different and that extending the duplex length and mutating the four continuous Ts can significantly improve knockout efficiency. Thus, the present invention establishes a new general sgRNA design template with improved knockout efficiency.
- compositions and methods of making and designing described herein improve the knockout efficiency of CRISPR-Cas9 technology.
- CRISPR-Cas9 technology can knock out any gene or correct mutations in any gene with ease, it has become one of the most powerful and commonly used tools in biological research. It also has great potential for the development of therapies targeting various diseases involving gene expression, such as HIV infection, Huntington's disease, cystic fibrosis etc.
- therapies targeting various diseases involving gene expression, such as HIV infection, Huntington's disease, cystic fibrosis etc.
- CRISPR-Cas9 technology there are many companies providing services based on CRISPR-Cas9 technology, and at least one startup company, aims to use the technology to develop therapies. The method described here improves the knockout efficiency of this technology.
- CRISPR-Cas9 This powerful and revolutionary technology has already become one of the most commonly used tools in biological research. Almost all of the major companies, including Life Technologies, Sigma, and Santa Cruz Biotechnology, provide services based on this technology. Moreover, CRISPR-Cas9 technology has been actively pursued as a therapeutic tool for treating various diseases. A CRISPR-Cas9 system with increased knockout efficiency will be of great interest.
- the current commonly used single-guide RNA (sgRNA) has a shortened duplex structure compared with the native bacterial crRNA-tracrRNA duplex.
- the inventors show that modifying the sgRNA by extending the duplex length by ⁇ 5 bp and mutating the fourth T of the continuous sequence of Ts (which is the pause signal for RNA polymerase III [pol III]) to C or G significantly, and sometimes dramatically, improves knockout efficiency in cells.
- CRISPR clustered regularly interspaced short palindromic repeats
- This system is composed of two components: the nuclease Cas9 and the guide RNA.
- the native Type-II CRISPR guide RNA is composed of a 42-nt crRNA and an 89-nt tracrRNA [6].
- Jinek et al. systematically studied the minimal sequence requirement of the guide RNA in vitro and linked two minimal sequences together to create the short-version single-guide RNA (sgRNA, +48nt) [6].
- sgRNAs with a mutated continuous sequence of Ts and extended duplex significantly enhance the imaging efficiency of a dCas9 (a mutated version of Cas9 lacking nickase activity )-GFP fusion protein in cells [10], suggesting that changing these two elements enhances dCas9 binding to target sites and might also increase the knockout efficiency of Cas9.
- the inventors systematically investigated and discovered the effect of changing these two elements on knockout efficiency and found that overall, extending the duplex and mutating the continuous sequence of Ts significantly improved knockout efficiency.
- the current most commonly used sgRNA design has the duplex shortened by 10 bp compared with the native crRNA-tracrRNA duplex (FIG. 1A), which does not seem to reduce its functionality in vitro [6].
- Hsu et al. also showed that extending the duplex appeared to have no effect on knockout efficiency in cells [9].
- Chen et al. showed that extending the duplex significantly enhances imaging efficiency of the dCas9-GFP fusion protein in cells [10].
- the inventors suspected that extending the duplex might increase knockout efficiency in cells.
- the continuous sequence of Ts after the guide sequence is the pause signal for RNA polymerase III (pol III) [11].
- poly III RNA polymerase III
- the inventors suspected that mutating the continuous sequence of Ts might also improve knockout efficiency in cells. Accordingly, the inventors mutated this sequence at different positions and determined the knockout efficiency of the mutants (FIG. ID). The knockout efficiency was increased in all mutants, and the mutation at position 4 had the greatest effect.
- FIG. 2A the inventors systematically investigated the effect of extending the duplex while mutating the fourth T in the sequence of Ts (FIG. 2A). Consistent with the result shown in FIG. IB, for all four sgRNAs tested mutating the fourth T increased the knockout efficiency significantly (FIG. 2A). On top of the increase due to mutation, extending the duplex also increased the knockout efficiency, reaching a peak at around 5 bp but then declining with longer extensions, although the pattern appears to be slightly different for different sgRNAs (FIG. 2A), showing that modifying both elements significantly enhances the imaging efficiency of a dCas9-GFP fusion protein in cells [10].
- mutating T ⁇ C or G generally had higher knockout efficiency than mutating T ⁇ A at various positions (FIG. 2B). Thus, mutating T ⁇ C or G at position 4 yielded the highest knockout efficiency.
- the inventors also tested eight sgRNAs targeting the CD4 gene in Jurkat cells. Consistent with the results observed in TZM-bl cells for the CCR5 gene, the optimized sgRNA design also significantly increased the efficiency of knocking out the CD4 gene in the Jurkat cell line (FIG. 3B). Thus, the optimized sgRNA structure appears to generally increase knockout efficiency.
- the beneficial effect of extending the duplex generally reached a peak at around 5 bp of added length (FIG. 2A).
- the inventors extended the duplex by 4 bp or 6 bp and compared the resulting knockout efficiencies for the 16 sgRNAs in FIG. 3 A. Extending the duplex by 4 bp or 6 bp appeared to yield similar knockout efficiency as 5 bp in most cases (data not shown).
- Creation of a frame-shift mutation with an sgRNA is generally insufficient to investigate the loss of function of noncoding genes, such as long noncoding RNAs (lncRNAs) or microRNA genes.
- lncRNAs long noncoding RNAs
- a better strategy is to excise all or part of the gene of interest, which requires cutting at two positions simultaneously and linking the two breakpoints together.
- Mutating the contiguous Ts is likely to increase the production of sgRNAs.
- the inventors measured the RNA level of different sgRNA structures. First, the inventors checked the CCR5 knockout efficiency of the sgRNA with the extended duplex or a mutated continuous sequence of Ts or with both. The inventors found that both modifications individually increased knockout efficiency, and in combination further increased knockout efficiency (FIG. 5A). Next, the inventors measured the sgRNA levels in transfected cells. Mutating the continuous sequence of Ts significantly increased the sgRNA level, and it appears that extending the duplex also slightly increased the sgRNA level (FIG. 5B).
- the inventors transfected activated CD4+ T cells with Cas9 protein preloaded with in vzYro-transcribed sgRNAs, which excludes the effect of RNA-level change because in this case the amount of sgRNA remains the same.
- the results using the in vitro-transcribed sgRNAs were highly variable, because these molecules form dimers to variable extent which interfered with their functionality (FIG. 5C).
- Cas9 can only bind to the monomers but not the dimers, in which the sgRNA structure is not maintained. T he ratio of monomers to dimers was not fixed between samples, which led to highly variable results.
- the inventors performed all these studies with transient plasmid transfection, in which the copy number of the Cas9 and the sgRNA can vary considerably.
- Low MOI infection of lentivirus vector harboring the Cas9 or the sgRNA should provide relatively consistent copy numbers of Cas9 and sgRNA in infected cells. Therefore, to determine sgRNA functionality more rigorously, the inventors first created cell lines stably expressing C as 9 by infecting TZM-bl or JLTRG-R5 cells with lentivirus harboring a Cas9-expressing cassette and selecting the cells stably expressing Cas9. These cells were then infected with lentivirus harboring sgRNAs with different structures at low MOI.
- the inventors systematically investigated the effect of extending the duplex and mutating the continuous sequence of Ts, providing guidance for optimizing sgRNA structure. These results clearly show that extending the duplex and mutating the continuous sequence of Ts at position 4 to C or G significantly increases knockout efficiency in most cases, and the extent of the improvement in knockout efficiency is striking (FIGS. 3A to 3C and 4A to 4B).
- the general optimized sgRNA structure is illustrated in FIG. 7.
- the TZM-bl cell line (cat. #8129) was obtained from the NIH AIDS Reagent Program and cultured in Dulbecco's modified Eagle's medium (DMEM, Life Technologies) with high glucose.
- the Jurkat (E6-1) cell line (cat. #177) was also obtained from the NIH AIDS Reagent Program and cultured in RPMI medium (Life Technologies). Both media were supplemented with 10% fetal bovine serum (FBS, Life Technologies) and penicillin/streptomycin/L-glutamine (Life Technologies). All cells were maintained at 37 °C and 5% CO2 in a humidified incubator.
- Anti-CCR5 antibody (APC-conjugated, cat. #550856, clone 3A9) was purchased from BD Biosciences.
- Anti-CD4 antibody (APC-conjugated, cat. #317416, clone OKT4) was purchased from Biolegend.
- Anti-CD4 antibody (FITC-conjugated, cat. #35-0049-T100, clone RPA-T4) was purchased from TONBO Bioscience.
- spCas9 protein were custom made (Novoprotein Scientific) and were stored at lmg/ml concentration in -80 ° C.
- Plasmid construction Plasmid construction. sgRNA fragments were inserted into pLB vectors (Addgene plasmid #11619) [21] at the Hpa I and Xho I sites. Cloned pLB-sgRNA constructs were sequenced to confirm that the sequence inserted was correct. The oligo sequences are listed in Table SI. The sgRNAs were started with either A or G, which is the preferred initiation nucleic acid for U6 promoter [22]. Plasmids were purified with the EZNA Endo-free Mini-prep kit (Omega Biotech). pSpCas9(BB) (pX330) (cat.
- lentiCas9-Blast #52962 [17] was purchased from Addgene.
- pX261-dU6 was constructed from pX261-U6-DR-hEmxl-DR-Cbh- NLS-hSpCas9-NLS-Hl-shorttracr-PGK-puro (Addgene plasmid #42337) [4] by deleting a 398- bp fragment by Ndel digestion, followed by Klenow reaction and blunt end ligation to delete part of the U6 expression cassette. Determining knockout efficiency.
- TZM-bl cells (9x10 4 per well) were seeded into 24-well plates overnight before transfection and washed twice with DPBS, and 300 ⁇ of pre-warmed Opti-Mem I medium was added to each well.
- pLB-sgRNA plasmids (0.5 ⁇ g at a concentration of 0.1 ⁇ g/ul) were mixed with 0.5 ⁇ g of the Cas9 plasmid pX330 pre-mixed in 100 ⁇ of Opti- Mem I medium.
- Two microliters of Lipofectamine 2000 transfection agent in 100 ⁇ of Opti- Mem I medium per well were added to the diluted plasmids, followed by a 20-minute incubation. The complex was added to the cells, and the medium was changed to complete medium after a 6-hour incubation at 37 °C in 5% CO2. Cells were collected for flow cytometry analysis 48 hours after transfection.
- Jurkat cells were transfected with 0.5 ⁇ g of the pX330 plasmid and 0.5 ⁇ g of pLB-sgRNA constructs using the Neon 10- ⁇ 1 transfection kit (Life Technologies), according to the manufacturer's instructions, and 2xl0 5 cells were used per 10- ⁇ 1 tip. Parameters were set to 1325 V, 10 ms, and 3 pulses. Cells were collected for flow cytometry analysis 72 hours after transfection.
- GFP GFP is a marker expressed by the pLB vector, serving as positive control for transfection
- TZM-bl cells (2.5x10 5 per well) were seeded into 6- well plates overnight before transfection. Cells were transfected with 1.5 ⁇ g of pLB-sgRNA plasmids and 1.5 ⁇ g of the Cas9 plasmid pX330 with Lipofectamine 2000 (Life Technologies, cat. #11668019), according to the manufacturer's instructions. Cells were collected 48 hours after transfection. GFP-positive cells were sorted with a FACSAria II cell sorter (BD Bioscience), followed by small RNA extraction with the miRNeasy Mini kit (Qiagen, cat. # 217004).
- TZM-bl cells were transfected with Lipofectamine 2000 in 6-well plates, according to the manufacturer's instructions. Cells were collected 48 hours after transfection. GFP-positive cells were sorted using a FACSAria II cell sorter (BD Bioscience), followed by genomic DNA extraction with the QIAamp DNA Blood Mini kit. CCR5 gene fragments were amplified with the primers CCR5- DS-F (5'- ACACTCTTTCCCTACACGACGCTCTTCCGATCT
- TCTACCTGCTCAACCTGGCC -3' SEQ ID NO : 136) and CCR5-DS-R (5'- GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCAAGTCCCACTGGGCGGC-3 ) SEQ ID NO: 137.
- the resulting PCR products were amplified for a 2 nd round of PCR with individual index primers.
- the amplicons were run on a 2.5% agarose gel and purified with the QIAquick Gel Extraction kit (QIAGEN, cat. # 28704). Equal amounts of amplicons were mixed and sequenced with a MiSeq sequencer (Illumina).
- Lenti-Cas9-Blast and the Viral Power packaging mix were co-transfected into 293T cells with the calcium phosphate transfection protocol. Supernatant was collected and filtered through a 0.45- ⁇ filter before being used for infection of TZM-bl cells and JLTRG-R5 cells (NIH AIDS REAGENT PROGRAM # 11586). Cells (2xl0 6 ) were seeded into a 10-cm dish. After overnight culture, cells were infected with 1 ml viral supernatant with 5 ng/ml polybrene for 3 hours.
- the cells Forty-eight hours after infection, the cells were treated with 10 ⁇ g/ml blasticidin (Life Technology, cat. # R210-01) for 3 days.
- the surviving cells were labeled as TZM-Cas9 or JLTRG-R5-Cas9 cells.
- pLB-sgRNAs were packaged into lentivirus in a similar manner as Lenti-Cas9-Blast.
- CD4+ T cells were isolated from PBMC with StemSepTM Human CD4+ T Cell Enrichment Kit (StemCell Technologies, cat. #14052), and activated with Dynabeads® Human T- Activator CD3/CD28 (Life Technology, cat. # 1113 ID) for 5 days in the presence of 20 U/ml IL-2 (NIH AIDS Reagents Program, Cat. #136), 10% FCS, and lx Penicillin-Streptomycin- Glutamine solution (Life Technology, cat. # 10378-016).
- sgRNAs were transcribed with HiScribe T7High Yield RNA Synthesis kit (NEB) according to the manufacturer's instructions, followed by purification with the RNeasy Mini kit (Qiagen, cat. # 217004). Before each use, sgRNAs were heated to 95 °C for 3 minutes in a PCR tube and immediately transferred to a water/ice bath for 2 minute to obtain pure monomers. Activated primary CD4+ T cells were electroporated using the Neon transfection system (lOOul tip, Life Technologies, cat. # MPK10096) with 10 ⁇ g of spCas9 protein that was preloaded with 300 pmol sgRNA (mixed and incubated at room temperature for 10 minutes).
- Neon transfection system laOOul tip, Life Technologies, cat. # MPK10096
- Cells (lxlO 6 ) resuspended in 100 ⁇ R buffer were mixed with a protein: RNA mix, followed by Neon electroporation (1500 V, 10 ms, 3 pulses), according to the manufacturer's instructions. After 48 hours, the cells were stained with CD4 antibody and subjected to FACS analysis.
- TZM-Cas9 cells were electroporated by Neon transfection system (lOul tip)(Life Technology cat. # MPK1096) with 30pmol sgRNA. 5xl0 4 cells re-suspended in lOul R buffer were mixed with RNA, followed by Neon electroporation (1005V 35ms 2pulse) according to the manufacturer's instructions. After 48 hours, the cells were stained with CD4 antibody and subject to FACS analysis.
- TZM-bl cells were co-transfected with sgRNA pairs (0.25 ⁇ g each) along with 0.5 ⁇ g of the Cas9-expressing plasmid pX261 -dU6.sgRNA Pairl (CCR5 sp7+spl4), Pair2 (CCR5 sp7+spl 8), Pair3 (CCR5 spl0+spl4), and Pair4 (CCR5 spl 0+spl 8).
- the sgRNA sequences are found in the Table 1. Twenty-four hours after transfection, the cells were treated with 0.8 ⁇ g/ml puromycin for 48 hrs, followed by recovery in medium without puromycin for 5 days.
- Genomic DNA was extracted from cells with the GenEluteTM Mammalian Genomic DNA Miniprep kit (Sigma-Aldrich, cat. #G1N70).
- CCR5 gene fragments were amplified from70 ⁇ g of genomic DNA using Premix Ex Taq (Takara, cat. #RR003A) with forward primer 5'- ATGGATTATC AAGTGTCAAGTCCAA-3 ' SEQ ID NO : 138 and reverse primer 5'- AGGGAGCCC AGAAGAGAAAATAAAC-3 ' SEQ ID NO: 139 for the CCR5 gene.
- the PCR was stopped at different cycle numbers to check the amount of amplicon and ensure that the amplification was in exponential phase.
- PCR amplicons were analyzed on a 1% agarose gel.
- compositions of the invention can be used to achieve methods of the invention.
- the words “comprising” (and any form of comprising, such as “comprise” and “comprises"), “having” (and any form of having, such as “have” and “has”), “including” (and any form of including, such as “includes” and “include”) or “containing” (and any form of containing, such as “contains” and “contain”) are inclusive or open-ended and do not exclude additional, unrecited elements or method steps.
- “comprising” may be replaced with “consisting essentially of or “consisting of.
- the phrase “consisting essentially of requires the specified integer(s) or steps as well as those that do not materially affect the character or function of the claimed invention.
- the term “consisting” is used to indicate the presence of the recited integer (e.g., a feature, an element, a characteristic, a property, a method/process step or a limitation) or group of integers (e.g., feature(s), element(s), characteristic(s), propertie(s), method/process steps or limitation(s)) only.
- A, B, C, or combinations thereof refers to all permutations and combinations of the listed items preceding the term.
- A, B, C, or combinations thereof is intended to include at least one of: A, B, C, AB, AC, BC, or ABC, and if order is important in a particular context, also BA, CA, CB, CBA, BCA, ACB, BAC, or CAB.
- expressly included are combinations that contain repeats of one or more item or term, such as BB, AAA, AB, BBC, AAABCCCC, CBBAAA, CABABB, and so forth.
- BB BB
- AAA AAA
- AB BBC
- AAABCCCCCC CBBAAA
- CABABB CABABB
- words of approximation such as, without limitation, "about”, “substantial” or “substantially” refers to a condition that when so modified is understood to not necessarily be absolute or perfect but would be considered close enough to those of ordinary skill in the art to warrant designating the condition as being present.
- the extent to which the description may vary will depend on how great a change can be instituted and still have one of ordinary skilled in the art recognize the modified feature as still having the required characteristics and capabilities of the unmodified feature.
- a numerical value herein that is modified by a word of approximation such as "about” may vary from the stated value by at least ⁇ 1, 2, 3, 4, 5, 6, 7, 10, 12 or 15%.
- compositions and/or methods disclosed and claimed herein can be made and executed without undue experimentation in light of the present disclosure. While the compositions and methods of this invention have been described in terms of preferred embodiments, it will be apparent to those of skill in the art that variations may be applied to the compositions and/or methods and in the steps or in the sequence of steps of the method described herein without departing from the concept, spirit and scope of the invention. All such similar substitutes and modifications apparent to those skilled in the art are deemed to be within the spirit, scope and concept of the invention as defined by the appended claims.
Landscapes
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical & Material Sciences (AREA)
- Molecular Biology (AREA)
- Organic Chemistry (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Wood Science & Technology (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
The present invention includes a modified single-guide RNA (sgRNA) template with improved knockout efficiency specific for a target gene comprising an sgRNA construct comprising at least one of a mutated duplex region wherein a length of the duplex region is extended, or a mutated poly T region at the beginning of the duplex region, wherein the sgRNA has a greater target gene knockout efficiency in cells.
Description
SINGLE-GUIDE RNA (SGRNA) WITH IMPROVED KNOCKOUT EFFICIENCY
Technical Field of the Invention
The present invention relates in general to the field of modification of gene expression, and more particularly, to compositions and methods for designing single-guide RNA (sgRNA) with improved knockout efficiency.
Background of the Invention
Without limiting the scope of the invention, its background is described in connection with designing gene knockout compositions and methods.
Hsu, et al, in an article entitled "DNA targeting specificity of RNA-guided Cas9 nucleases" Nature Biotechnology, 31, 827-832, (2013), is said to teach that the Streptococcus pyogenes Cas9 (SpCas9) nuclease can be efficiently targeted to genomic loci by means of single-guide RNAs (sgRNAs) to enable genome editing. They find that SpCas9 tolerates mismatches between guide RNA and target DNA at different positions in a sequence-dependent manner, sensitive to the number, position and distribution of mismatches, and that cleavage is unaffected by DNA methylation.
One such patent is PCT Patent Application Publication No. WO 2014/110006A1, filed by Leake, et al, entitled "Templates, libraries, kits and methods for generating molecules", is said to teach collections of templates for molecules such as RNA, templates, devices, kits and methods for generating molecules from these collections. The invention is said to include methods for efficiently and effectively obtaining selected RNA molecules such as siRNA, shRNA, miRNA mimics and inhibitors, IncRNA, antisense RNA, aptamers, ribozymes, and sgRNA molecules.
Chinese Patent Application No. CN 103820441 A, filed by Hu and Huang, entitled "Method for human CTLA4 gene specific knockout through CRISPR-Cas9 (clustered regularly interspaced short palindromic repeat) and sgRNA (single guide RNA) for specially targeting CTLA4 gene" is said to teach a method for human CTLA4 gene specific knockout through CRISPR-Cas9 and sgRNA for specially targeting a CTLA4 gene, and provides a method for human CTLA4 gene specific knockout through CRISPR-Cas9 and sgRNA(single guide RNA)for specially targeting a CTLA4 gene.
Summary of the Invention
In one embodiment, the present invention includes a modified single-guide RNA (sgRNA) template with improved knockout efficiency specific for a target gene comprising an sgRNA construct comprising at least one of a mutated duplex region wherein a length of the duplex region is extended, or a mutated poly T region at the beginning of the duplex region, wherein the sgRNA has a greater target gene knockout efficiency in cells. In one aspect, the modified duplex region changes the pause site for a pol III RNAse polymerase at the continuous Thymine RNA segment. In another aspect, the modified duplex region comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 extra nucleotides in each strand of the modified duplex region. In another aspect, the cells are mammalian cells. In another aspect, the cells are the human cells. In another aspect, the sgRNA comprises both the mutated duplex region and mutation of the poly T region. In another aspect, the sgRNA is part of a gene library. In another aspect, the sgRNA is defined further as being in an sgRNA expression vector. In another aspect, the sgRNA is defined further as being in a transgene vector. In another aspect, the sgRNA comprises SEQ ID NOS:l to 4. In another aspect, the sgRNA comprises both a mutated duplex region wherein a length of the duplex region is extended and a mutated poly T region at the beginning of the duplex region. In another aspect, the mutant sgRNA is selected from SEQ ID NOS:3 to 133 or 140.
In another embodiment, the present invention includes a method designing a modified single- guide RNA (sgRNA) template with improved knockout efficiency for a specific target gene comprising: identifying a target gene; and modifying an sgRNA that is specific for the target gene by at least one of increasing the length of the duplex region or mutating a poly T region at the end of the duplex region of the modified sgRNA, wherein the modified sgRNA has a higher target gene knockout efficiency in cells than the unmodified sgRNA. In another aspect, the modified duplex region changes the pause site for a pol III RNAse polymerase at the continuous Thymine RNA segment. In another aspect, the modified duplex region comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 extra nucleotides in each strand of the modified duplex region. In another aspect, the cells are mammalian cells. In another aspect, the cells are human cells. In another aspect, the sgRNA comprises both the mutated duplex region and mutation of the poly T region. In another aspect, the sgRNA is part of a gene library. In another aspect, the sgRNA is defined further as being in a sgRNA expression vector. In another aspect, the sgRNA is defined further as being in a transgene vector. In another aspect, the sgRNA comprises SEQ ID NOS:3 to 133 or 140. In another aspect, the sgRNA comprises both a mutated duplex region wherein a length
of the duplex region is extended and a mutated poly T region at the beginning of the duplex region. In another aspect, the mutant sgRNA is selected from SEQ ID NOS:3 to 133 or 140.
In yet another embodiment, the present invention includes a method of determining the knockdown effectiveness against a target gene by a mutated candidate sgRNA, the method comprising: (a) obtaining one or more mutated candidate sgRNAs, wherein the sgRNA has been mutated by at least one of at least one of increasing the length of the duplex region or mutating poly T region at the end of the duplex region; (b) expressing the mutated sgRNAs in a first cell that expresses the target gene, and a non-mutated sgRNA to a second subset of the patients, and expressing a non-mutated sgRNA in a second cell; and (c) determining if the mutated candidate sgRNA knocked down expression of the target gene in the first cell to a greater extent than the non-mutated sgRNA in the second cell. In another aspect, the mutant sgRNA is selected from SEQ ID NOS:3 to l33 or 140.
In yet another embodiment, the present invention includes a mutant single-guide RNA (sgRNA) template with improved knockout efficiency specific for a target gene comprising a target- specific sequence and a modified sequence, wherein the sequence comprises at least one of a mutated duplex region wherein a length of the duplex region is extended, or a mutated poly T region at the end of the duplex region, wherein the sgRNA has a greater target gene knockout efficiency in cells. In another aspect, the mutant sgRNA is inserted into an sgRNA expression vector. In another aspect, the mutant sgRNA is selected from SEQ ID NOS:3 to 133 or 140. Description of the Drawings
For a more complete understanding of the features and advantages of the present invention, reference is now made to the detailed description of the invention along with the accompanying figures and in which:
FIGS. 1A to ID show that the knockout efficiency can be increased by extending the duplex and disrupting the continuous sequence of Ts. FIG. 1A is a schematic of the duplex extension (SEQ ID NOS: 127, 2-7. Green, the 3' 34 nt, which is not required for sgRNA functionality in vitro but is required in cells; red, the extended base pairs. FIG. IB shows the extension of the duplex increased knockout efficiency. Constructs harboring sgRNAs targeting the CCR5 gene were co- transfected with a Cas9-expressing plasmid into TZM-bl cells. An sgRNA targeting the HIV genome served as mock control. The GFP-positive cells were sorted out 48 hours after transfection, and the gene modification rates were determined at the protein and DNA levels, respectively. Protein level disruption: The expression of CCR5 was determined by flow
cytometry analysis. DNA level modification rate: The genomic DNA was extracted, and the target sites were amplified and deep-sequenced with a MiSeq sequencer. FIG. 1C shows the equivalent results from FIG. IB at protein level that was repeated for another sgRNA, sp2. The difference with FIG. IB is that the cells were not sorted, but the CCR5 disruption rate was measured in GFP-positive cells. FIG. ID shows that a mutation of the Pol III pause signal significantly increased knockout efficiency SEQ ID NOS:8, 14-17. The mutated nucleotides are shown in bold. The graphs represent biological repeats from one of three independent experiments with similar results, shown as mean ± s.d. (n=3). Significance was calculated using Student's t-test. *P<0.05; **P <0.01; ***P<0.005; ****P<0.001.
FIGS. 2A and 2B show that the knockout efficiency can be further increased by combining duplex extension with disruption of the continuous sequence of Ts SEQ ID NOS:18, 19, 20, 21, 29. FIG. 2A shows the effect of duplex extension when mutating the fourth T to an A in four sgRNAs, SEQ ID NOS:8, 14-17. FIG. 2B shows the effect of mutation of Ts at the indicated positions to A, C, or G when also extending the duplex by 5 bp.
FIGS. 3 A to 3C show that the optimized sgRNA structure is superior to the original version. FIG. 3 A shows the CCR5 knockout efficiency as determined for the indicated sgRNAs targeting CCR5 with either an optimized sgRNA structure or the original structure. The knockout efficiency was determined in the same way as in FIG. IB. FIG. 3B shows CD4 knockout efficiency as determined for the indicated sgRNAs targeting the CD4 gene, with two versions of the sgRNA structure in Jurkat cells. Cells were analyzed for CD4 expression by flow cytometry 72 hours after transfection. The graphs in both Fig. 2A, 2B represent biological repeats shown as mean ± s.d. (n=3). FIG. 3C shows that T→C and T→G mutations are superior to the T→A mutation. Eleven sgRNAs targeting CCR5 were randomly selected. The knockout efficiency of sgRNAs with different mutations at position 4 in the sequence of continuous Ts were determined as in FIG. 1C.
FIGS. 4A and 4B show that the efficiency of gene deletion is increased dramatically using optimized sgRNAs. FIG. 4A is a schematic of the CCR5 gene deletion. FIG. 4B shows the sgRNA pairs targeting CCR5 with the original or optimized structures were co-transfected into TZM-bl cells with a Cas9-expressing plasmid. The gene-deletion efficiency was determined by amplifying the CCR5 gene fragment. Note that the truncated fragments of CCR5, with a smaller size than wild type CCR5, are a consequence of gene deletion using paired sgRNAs. The numbers below each lane indicate the percentage deletion.
FIGS. 5A to 5E show how modifications increase knockout efficiency. FIG. 5A shows the knockout efficiency of sp3 from FIG. 2A with the indicated modifications was determined as in FIG. IB. Mut represents mutation, O represents original. FIG. 5B shows the sgRNA levels determined by real-time PCR. The relative expression level was normalized to U6 small RNA. FIG. 5C shows in vitro transcribed sgRNA formed dimers (upper panel), which can be transformed into monomers by a heating and quick cooling step. FIG. 5D shows that sp7 from FIG. 3B was transcribed in vitro and preloaded into Cas9. The complex was electroporated into activated primary CD4+ T cells. Knockout efficiency was determined as in FIG. 3B. FIG. 5E shows the in vitro transcribed sp7 was electroporated into TZM-Cas9 cells. Knockout efficiency was determined as in FIG. 3B.
FIGS. 6A to 6B shows the testing effect of modifications by lentiviral infection. FIG. 6A shows that TZM-bl cells or FIG. 6B JLTRG-R5 cells were infected with Cas9-expressing lentivirus, and cells stably expressing Cas9 were selected. The indicated sgRNA (sp3 from FIG. 2A)- expressing cassettes were packaged into lentivirus and used to infect cells stably expressing Cas9 at MOI=0.5. Knockout efficiency was determined as in FIG. IB on the indicated days.
FIG. 7 is a schematic of an optimized sgRNA structure (SEQ ID NO: 140). The duplex extension is highlighted in red, and the mutation is marked in bold. The duplex extension can be 4-6 nt, and the mutation can be C or G, which showed similar knockout efficiency in most cases.
Description of the Invention
While the making and using of various embodiments of the present invention are discussed in detail below, it should be appreciated that the present invention provides many applicable inventive concepts that can be embodied in a wide variety of specific contexts. The specific embodiments discussed herein are merely illustrative of specific ways to make and use the invention and do not delimit the scope of the invention.
To facilitate the understanding of this invention, a number of terms are defined below. Terms defined herein have meanings as commonly understood by a person of ordinary skill in the areas relevant to the present invention. Terms such as "a", "an" and "the" are not intended to refer to only a singular entity, but include the general class of which a specific example may be used for illustration. The terminology herein is used to describe specific embodiments of the invention, but their usage does not delimit the invention, except as outlined in the claims.
Abbreviations: bp, base pair; CRISPR, clustered regularly interspaced short palindromic repeat; PCR, polymerase chain reaction; sgRNA, single-guide RNA. GFP, green fluorescent protein.
FACS, fluorescence-activated cell sorting. crRNA, CRISPR RNA. tracrRNA, trans-activating crRNA.
The terms "modified", "altered", or "alterations" with reference to nucleic acid sequences includes changes such as insertions, deletions, substitutions, fusions with related or unrelated sequences that are designed into the sgRNA, or may be the result of polymorphisms, alleles and other structural types, or making a library of modifications and selecting individual or groups of members of that library. Alterations encompass genomic DNA and RNA sequences that may differ with respect to their hybridization properties using a given hybridization probe. Alterations of polynucleotide sequences for sgRNAs, or fragments thereof, include those that increase, decrease, or have no effect on functionality.
The term "gene" is used to refer to a functional protein, polypeptide or peptide-encoding unit. As will be understood by those in the art, this functional term includes both genomic sequences, cDNA sequences, or fragments or combinations thereof, as well as gene products, including those that may have been altered by the hand of man. Purified genes, nucleic acids, protein and the like are used to refer to these entities when identified and separated from at least one contaminating nucleic acid or protein with which it is ordinarily associated.
As used herein, the term "vector" is used in reference to nucleic acid molecules that transfer DNA segment(s) from one cell to another. The vector may be further defined as one designed to propagate the modified sgRNA sequences of the present invention, or as a transcription and expression vector that includes a promoter operatively linked to the modified sgRNA sequences ro generate the sgRNAs, or one designed to cause such a promoter to be introduced. The vector may exist in a state independent of the host cell chromosome, or may be integrated into the host cell chromosome.
The term "host cell" refers to cells that have been engineered to contain the modified sgRNA disclosed herein, and include archeal, prokaryotic, or eukaryotic. Thus, engineered, or recombinant cells, are distinguishable from naturally occurring cells that do not contain recombinantly introduced genes through recombinant techniques.
The term "homology" refers to the extent to which two nucleic acids are complementary. There may be partial or complete homology. A partially complementary sequence is one that at least partially inhibits a completely complementary sequence from hybridizing to a target nucleic acid and is referred to using the functional term "substantially homologous." The degree or extent of hybridization may be examined using a hybridization or other assay (such as a competitive PCR
assay) and is meant, as will be known to those of skill in the art, to include specific interaction even at low stringency.
A single-guide RNA (sgRNA) molecule is one of two components of the CRISPR-Cas9 genome-editing technology, which is one of the most commonly used tools in biological research and has been actively pursued as a therapeutic tool for treating various diseases. The current sgRNA design template is based mainly on an in vitro study. In cells, the inventors showed that sgRNA sequence requirements are different and that extending the duplex length and mutating the four continuous Ts can significantly improve knockout efficiency. Thus, the present invention establishes a new general sgRNA design template with improved knockout efficiency.
Unlike previous sgRNA design templates that knocked out the target gene with lower efficiency (complicating the design of gene knockout experiments and potentially lessening the efficacy of gene knockout therapies), the compositions and methods of making and designing described herein improve the knockout efficiency of CRISPR-Cas9 technology.
Since CRISPR-Cas9 technology can knock out any gene or correct mutations in any gene with ease, it has become one of the most powerful and commonly used tools in biological research. It also has great potential for the development of therapies targeting various diseases involving gene expression, such as HIV infection, Huntington's disease, cystic fibrosis etc. Currently, there are many companies providing services based on CRISPR-Cas9 technology, and at least one startup company, aims to use the technology to develop therapies. The method described here improves the knockout efficiency of this technology.
After the human genome project, the sequence of every gene in the human genome is now known. However, the function of most genes is still not clear. One of the most common strategies for studying the function of a particular gene is to knock it out in a model organism. However, until recently, gene knockout could only be done in certain animals, and the cost has been very high. The CRISPR-Cas9 system has now emerged as a powerful genome-editing technology that can knock out any gene in cultured cells with ease.
This powerful and revolutionary technology has already become one of the most commonly used tools in biological research. Almost all of the major companies, including Life Technologies, Sigma, and Santa Cruz Biotechnology, provide services based on this technology. Moreover, CRISPR-Cas9 technology has been actively pursued as a therapeutic tool for treating various diseases. A CRISPR-Cas9 system with increased knockout efficiency will be of great interest.
The current commonly used single-guide RNA (sgRNA) has a shortened duplex structure compared with the native bacterial crRNA-tracrRNA duplex. Here the inventors show that modifying the sgRNA by extending the duplex length by ~5 bp and mutating the fourth T of the continuous sequence of Ts (which is the pause signal for RNA polymerase III [pol III]) to C or G significantly, and sometimes dramatically, improves knockout efficiency in cells.
The clustered regularly interspaced short palindromic repeats (CRISPR) system has recently been developed into a powerful genome-editing technology [1-6]. This system is composed of two components: the nuclease Cas9 and the guide RNA. After maturation, the native Type-II CRISPR guide RNA is composed of a 42-nt crRNA and an 89-nt tracrRNA [6]. Jinek et al. systematically studied the minimal sequence requirement of the guide RNA in vitro and linked two minimal sequences together to create the short-version single-guide RNA (sgRNA, +48nt) [6]. However, a longer version of the sgRNA (+85 nt), which is 37 nt longer at the 5' end, was shown to be much more efficient [7-9] and is now commonly used. This commonly used sgRNA has a shortened duplex compared with the native guide RNA. In addition, there is a continuous sequence of Ts, which is the pause signal for RNA polymerase III; this signal could potentially reduce transcription efficiency and knockout efficiency. Hsu et al. showed that changing these two elements did not have a significant effect on knockout efficiency and concluded that the sgRNA (+85 nt) without mutations and duplex extension is the most active sgRNA architecture [9]. However, Chen et al. reported that sgRNAs with a mutated continuous sequence of Ts and extended duplex significantly enhance the imaging efficiency of a dCas9 (a mutated version of Cas9 lacking nickase activity )-GFP fusion protein in cells [10], suggesting that changing these two elements enhances dCas9 binding to target sites and might also increase the knockout efficiency of Cas9. In the present invention the inventors systematically investigated and discovered the effect of changing these two elements on knockout efficiency and found that overall, extending the duplex and mutating the continuous sequence of Ts significantly improved knockout efficiency.
The current most commonly used sgRNA design has the duplex shortened by 10 bp compared with the native crRNA-tracrRNA duplex (FIG. 1A), which does not seem to reduce its functionality in vitro [6]. Hsu et al. also showed that extending the duplex appeared to have no effect on knockout efficiency in cells [9]. However, Chen et al. showed that extending the duplex significantly enhances imaging efficiency of the dCas9-GFP fusion protein in cells [10]. The inventors suspected that extending the duplex might increase knockout efficiency in cells. The inventors extended the duplex in two sgRNAs targeting the CCR5 gene, as shown in FIG.
1A, and determined the knockout efficiency of these mutants in TZM-bl cells. It was found that extending the duplex by 1, 3, 5, 8, or 10 bp significantly increased the knockout efficiency in both sgRNAs tested, and extending the duplex by 5 bp appeared to yield the highest efficiency at the protein level. The modification rate at the DNA level was also confirmed by deep sequencing of target sites, and the results correlated well with the results determined at the protein level (FIG. IB). Since measuring the modification rate by deep sequencing is more expensive and labor intensive, the inventors used FACS to determine the CCR5 disruption rate in this study. When the effect of extending the duplex was tested for another sgRNA (sp2), the results were consistent with those for spl (FIG. 1C). Thus, extending the duplex appears to increase the knockout efficiency of the CRISPR-Cas9 system.
Because the continuous sequence of Ts after the guide sequence is the pause signal for RNA polymerase III (pol III) [11], the effect of its disruption in sgRNAs has been previously studied [9, 10]. The inventors suspected that mutating the continuous sequence of Ts might also improve knockout efficiency in cells. Accordingly, the inventors mutated this sequence at different positions and determined the knockout efficiency of the mutants (FIG. ID). The knockout efficiency was increased in all mutants, and the mutation at position 4 had the greatest effect.
Next, the inventors systematically investigated the effect of extending the duplex while mutating the fourth T in the sequence of Ts (FIG. 2A). Consistent with the result shown in FIG. IB, for all four sgRNAs tested mutating the fourth T increased the knockout efficiency significantly (FIG. 2A). On top of the increase due to mutation, extending the duplex also increased the knockout efficiency, reaching a peak at around 5 bp but then declining with longer extensions, although the pattern appears to be slightly different for different sgRNAs (FIG. 2A), showing that modifying both elements significantly enhances the imaging efficiency of a dCas9-GFP fusion protein in cells [10].
The inventors previously tested the effect of mutating T→A on knockout efficiency without extending the duplex (FIG. 1C). Next, the inventors tested the effect of mutating T— »A, C, or G while also extending the duplex. It was found that mutations at position 4 generally had the highest knockout efficiency, although mutating T→C at position 1 had a similar effectiveness. In addition, mutating T→C or G generally had higher knockout efficiency than mutating T→A at various positions (FIG. 2B). Thus, mutating T→C or G at position 4 yielded the highest knockout efficiency.
Based on these results, mutating T→G or C at position 4 and extending the duplex by ~5 bp appears to achieve the optimal sgRNA structure, with the highest knockout efficiency. Therefore, the inventors compared the knockout efficiency of the original and optimized structures for 16 sgRNAs targeting CCR5. A typical optimized structure had a T→G mutation at position 4 and extended the duplex by 5 bp. In 15 out of 16 sgRNAs, the optimized structure increased the knockout efficiency significantly and for splO, 14, 15, 17, and 18 did so dramatically (FIG. 3A).
To exclude the possibility that the increase in knockout efficiency using the optimized sgRNA structure is limited to TZM-bl cells or the CCR5 gene, the inventors also tested eight sgRNAs targeting the CD4 gene in Jurkat cells. Consistent with the results observed in TZM-bl cells for the CCR5 gene, the optimized sgRNA design also significantly increased the efficiency of knocking out the CD4 gene in the Jurkat cell line (FIG. 3B). Thus, the optimized sgRNA structure appears to generally increase knockout efficiency.
The beneficial effect of extending the duplex generally reached a peak at around 5 bp of added length (FIG. 2A). To test whether extending the duplex by 5 bp is superior to extending it by 4 bp or 6 bp, the inventors extended the duplex by 4 bp or 6 bp and compared the resulting knockout efficiencies for the 16 sgRNAs in FIG. 3 A. Extending the duplex by 4 bp or 6 bp appeared to yield similar knockout efficiency as 5 bp in most cases (data not shown).
Previously, Chen et al. showed that mutating T→A at position 4 in combination with extending the duplex by 5 bp significantly enhanced the imaging efficiency of the dCas9-GFP fusion protein in cells [10]. The results herein show that extending the duplex by 4-6 bp and mutating T→C or G at position 4 significantly increased knockout efficiency. To compare the effect of two sgRNA designs on increasing the knockout efficiency, the inventors randomly selected 10 sgRNAs targeting CCR5 and compared their knockout efficiencies with different mutations. As shown in FIG. 3D, all of the T→C and most (9 out of 10) of the T→G mutations had significantly higher knockout efficiency than the T→A mutation. It is noteworthy that, although in most cases the T→C mutation had a similar level of knockout efficiency as the T→G mutation, it had a significantly higher knockout efficiency in spl l (+11%, P=0.006) and spl9 sgRNAs (+6%, P=0.026) (FIG. 3D), suggesting that the T→C mutation might be the best choice. Creation of a frame-shift mutation with an sgRNA is generally insufficient to investigate the loss of function of noncoding genes, such as long noncoding RNAs (lncRNAs) or microRNA genes. A better strategy is to excise all or part of the gene of interest, which requires cutting at two
positions simultaneously and linking the two breakpoints together. The efficiency of generating this type of deletion mutation is very low with current sgRNA design templates; however, the deletion efficiency was improved dramatically (around 10 fold) in all four pairs of sgRNAs tested here (FIGS. 4A and 4B). If the original sgRNA structure, in which the deletion efficiency ranged from 1.6- 6.3% (Fig. 2c), was used to delete target genes, one would have to screen hundreds of colonies to identify the colonies with the deletion, which is a daunting task. Using the optimized sgRNAs, in which the deletion efficiency ranged from 17.7- 55.9% (FIGS. 4A and 4B), the number of colonies that would need to be screened to identify those with the deletion would be with the limits of feasibility. Thus, the optimized sgRNA template would simplify the genome-editing procedure thereby enhancing its potential utility.
Mutating the contiguous Ts is likely to increase the production of sgRNAs. Thus, to understand how modifications increase the knockout efficiency, the inventors measured the RNA level of different sgRNA structures. First, the inventors checked the CCR5 knockout efficiency of the sgRNA with the extended duplex or a mutated continuous sequence of Ts or with both. The inventors found that both modifications individually increased knockout efficiency, and in combination further increased knockout efficiency (FIG. 5A). Next, the inventors measured the sgRNA levels in transfected cells. Mutating the continuous sequence of Ts significantly increased the sgRNA level, and it appears that extending the duplex also slightly increased the sgRNA level (FIG. 5B). To ascertain if increased sgRNA production or the sgRNA structure or both is responsible for increased knockout efficacy, the inventors transfected activated CD4+ T cells with Cas9 protein preloaded with in vzYro-transcribed sgRNAs, which excludes the effect of RNA-level change because in this case the amount of sgRNA remains the same. In initial experiments, the results using the in vitro-transcribed sgRNAs were highly variable, because these molecules form dimers to variable extent which interfered with their functionality (FIG. 5C). Cas9 can only bind to the monomers but not the dimers, in which the sgRNA structure is not maintained. T he ratio of monomers to dimers was not fixed between samples, which led to highly variable results. However, this problem was solved by a heating and quick cooling step (FIG. 5C), as the inventors have previously shown for other small RNAs with duplex structures [12]. With pure monomer sgRNAs, it appeared that Cas9 preloaded with sgRNAs with an extended duplex has higher knockout efficiency (FIG. 5D), suggesting that the structural change of extending the duplex can by itself increase Cas9 functionality. Next, the inventors transfected in vitro transcribed sgRNAs into cells stably expressing Cas9 and showed that extending the duplex by itself increases knockout efficiency (FIG. 5E), most likely because of the structural change, not by RNA level change.
The inventors performed all these studies with transient plasmid transfection, in which the copy number of the Cas9 and the sgRNA can vary considerably. Low MOI infection of lentivirus vector harboring the Cas9 or the sgRNA should provide relatively consistent copy numbers of Cas9 and sgRNA in infected cells. Therefore, to determine sgRNA functionality more rigorously, the inventors first created cell lines stably expressing C as 9 by infecting TZM-bl or JLTRG-R5 cells with lentivirus harboring a Cas9-expressing cassette and selecting the cells stably expressing Cas9. These cells were then infected with lentivirus harboring sgRNAs with different structures at low MOI. The results were similar to the studies done with plasmids in both cell lines. In fact, the difference between structures shown for lentiviral infection was even greater than what the inventors observed with plasmids (FIG. 6), suggesting that the optimized sgRNA are indeed superior to commonly used sgRNA (+85nt). These results also demonstrate that the optimized sgRNAs would perform better for CRISPR-Cas9-based genome-wide pooled screenings, which use lentivirus to deliver sgRNAs at low MOI [13-20].
To achieve the present invention, the inventors systematically investigated the effect of extending the duplex and mutating the continuous sequence of Ts, providing guidance for optimizing sgRNA structure. These results clearly show that extending the duplex and mutating the continuous sequence of Ts at position 4 to C or G significantly increases knockout efficiency in most cases, and the extent of the improvement in knockout efficiency is striking (FIGS. 3A to 3C and 4A to 4B). The general optimized sgRNA structure is illustrated in FIG. 7.
With the optimized structure, most sgRNAs showed high knockout efficiency. Out of a total of 24 sgRNAs with an optimized sgRNA structure tested, 18 showed >50% knockout efficiency. By contrast, only 4 sgRNAs showed >50% knockout efficiency using the original sgRNA structure (FIG. 3A, 3B). This optimized sgRNA template not only reduces concerns that knockout experiments might not work due to low sgRNA functionality, but also significantly increases the efficiency of more challenging genome-editing procedures, such as gene deletion.
Previously, Hsu et al. showed that extending the duplex by 10 bp in combination with mutating the continuous sequence of Ts did not increase knockout efficiency [9]. The results herein show that extending the duplex can significantly increase knockout efficiency, but after reaching a peak at around 5 bp, the effect declines, which might explain this discrepancy. The findings here are consistent with Chen et al. 's study, in which they showed that extending the duplex and mutating the continuous sequence of Ts enhances the imaging efficiency of the dCas9-GFP fusion protein in cells [10]. However, the effects of these two modifications appear to be different. Mutating the continuous sequence of Ts significantly increased the sgRNA production
(FIG. 5B), which may be the result of increased transcription efficiency due to the disrupted pause signal (although not a limitation of the present invention) [11]. The results with in vitro transcribed sgRNAs suggest that extending the duplex by itself also increases Cas9 functionality because of the structural change (FIG. 5D and 5E), since any effect of the RNA level was excluded in these studies. When sgRNA is expressed inside the cells, both effects contribute to increase the functionality. It is possible, but not a limitation of the present invention, that the modified sgRNA structure might enhance binding to Cas9 or increase its stability. Further work is needed to determine how exactly sgRNA structure increases functionality.
Extending the duplex by ~5 bp combined with mutating the continuous sequence of Ts at position 4 to C or G significantly increased CRISPR-Cas9 gene knockout efficiency.
Reagents. The TZM-bl cell line (cat. #8129) was obtained from the NIH AIDS Reagent Program and cultured in Dulbecco's modified Eagle's medium (DMEM, Life Technologies) with high glucose. The Jurkat (E6-1) cell line (cat. #177) was also obtained from the NIH AIDS Reagent Program and cultured in RPMI medium (Life Technologies). Both media were supplemented with 10% fetal bovine serum (FBS, Life Technologies) and penicillin/streptomycin/L-glutamine (Life Technologies). All cells were maintained at 37 °C and 5% CO2 in a humidified incubator.
Anti-CCR5 antibody (APC-conjugated, cat. #550856, clone 3A9) was purchased from BD Biosciences. Anti-CD4 antibody (APC-conjugated, cat. #317416, clone OKT4) was purchased from Biolegend. Anti-CD4 antibody (FITC-conjugated, cat. #35-0049-T100, clone RPA-T4) was purchased from TONBO Bioscience. spCas9 protein were custom made (Novoprotein Scientific) and were stored at lmg/ml concentration in -80 ° C.
Plasmid construction. sgRNA fragments were inserted into pLB vectors (Addgene plasmid #11619) [21] at the Hpa I and Xho I sites. Cloned pLB-sgRNA constructs were sequenced to confirm that the sequence inserted was correct. The oligo sequences are listed in Table SI. The sgRNAs were started with either A or G, which is the preferred initiation nucleic acid for U6 promoter [22]. Plasmids were purified with the EZNA Endo-free Mini-prep kit (Omega Biotech). pSpCas9(BB) (pX330) (cat. #42230) [4] and lentiCas9-Blast (#52962) [17] was purchased from Addgene. pX261-dU6 was constructed from pX261-U6-DR-hEmxl-DR-Cbh- NLS-hSpCas9-NLS-Hl-shorttracr-PGK-puro (Addgene plasmid #42337) [4] by deleting a 398- bp fragment by Ndel digestion, followed by Klenow reaction and blunt end ligation to delete part of the U6 expression cassette.
Determining knockout efficiency. TZM-bl cells (9x104 per well) were seeded into 24-well plates overnight before transfection and washed twice with DPBS, and 300 μΐ of pre-warmed Opti-Mem I medium was added to each well. pLB-sgRNA plasmids (0.5 μg at a concentration of 0.1 μg/ul) were mixed with 0.5 μg of the Cas9 plasmid pX330 pre-mixed in 100 μΐ of Opti- Mem I medium. Two microliters of Lipofectamine 2000 transfection agent in 100 μΐ of Opti- Mem I medium per well were added to the diluted plasmids, followed by a 20-minute incubation. The complex was added to the cells, and the medium was changed to complete medium after a 6-hour incubation at 37 °C in 5% CO2. Cells were collected for flow cytometry analysis 48 hours after transfection.
Jurkat cells were transfected with 0.5 μg of the pX330 plasmid and 0.5 μg of pLB-sgRNA constructs using the Neon 10-μ1 transfection kit (Life Technologies), according to the manufacturer's instructions, and 2xl05 cells were used per 10-μ1 tip. Parameters were set to 1325 V, 10 ms, and 3 pulses. Cells were collected for flow cytometry analysis 72 hours after transfection.
Cells were stained with either anti-CCR5 antibody for TZM-bl cells or anti-CD4 antibody for Jurkat cells, followed by analysis with a FACScanto II cell analyzer (BD Bioscience). Only GFP-positive cells (GFP is a marker expressed by the pLB vector, serving as positive control for transfection) were analyzed for knockout efficiency.
Determining the sgRNA expression level. TZM-bl cells (2.5x105 per well) were seeded into 6- well plates overnight before transfection. Cells were transfected with 1.5 μg of pLB-sgRNA plasmids and 1.5 μg of the Cas9 plasmid pX330 with Lipofectamine 2000 (Life Technologies, cat. #11668019), according to the manufacturer's instructions. Cells were collected 48 hours after transfection. GFP-positive cells were sorted with a FACSAria II cell sorter (BD Bioscience), followed by small RNA extraction with the miRNeasy Mini kit (Qiagen, cat. # 217004). One microgram of extracted RNA was reverse -ranscribed with Superscript® III Reverse Transcriptase reaction (Life Technology, cat. #18080-051), according to the manufacturer's instructions. The cDNAs were quantified with Syber Green qPCR MasterMix (ABI, cat. #4309155) with primers (Forward; 5 ' -GTGTTC ATCTTTGGTTTTGTGTTT-3 ' ( SEQ ID NO: 134) and Reverse 5'- CGGTGCCACTTTTTCAAGTT-3' (SEQ ID NO: 135) ). U6B was used as the internal control.
Evaluating target site modification at the DNA level by next-generation sequencing. TZM-bl cells were transfected with Lipofectamine 2000 in 6-well plates, according to the manufacturer's instructions. Cells were collected 48 hours after transfection. GFP-positive cells were sorted
using a FACSAria II cell sorter (BD Bioscience), followed by genomic DNA extraction with the QIAamp DNA Blood Mini kit. CCR5 gene fragments were amplified with the primers CCR5- DS-F (5'- ACACTCTTTCCCTACACGACGCTCTTCCGATCT
TCTACCTGCTCAACCTGGCC -3' ( SEQ ID NO : 136) and CCR5-DS-R (5'- GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCAAGTCCCACTGGGCGGC-3 ) SEQ ID NO: 137. The resulting PCR products were amplified for a 2nd round of PCR with individual index primers. The amplicons were run on a 2.5% agarose gel and purified with the QIAquick Gel Extraction kit (QIAGEN, cat. # 28704). Equal amounts of amplicons were mixed and sequenced with a MiSeq sequencer (Illumina).
Evaluating CCR5 disruption efficiency with lentiviral delivery of sgRNA. Lenti-Cas9-Blast and the Viral Power packaging mix (Life Technology, cat. # K4975-00) were co-transfected into 293T cells with the calcium phosphate transfection protocol. Supernatant was collected and filtered through a 0.45-μιτι filter before being used for infection of TZM-bl cells and JLTRG-R5 cells (NIH AIDS REAGENT PROGRAM # 11586). Cells (2xl06) were seeded into a 10-cm dish. After overnight culture, cells were infected with 1 ml viral supernatant with 5 ng/ml polybrene for 3 hours. Forty-eight hours after infection, the cells were treated with 10 μg/ml blasticidin (Life Technology, cat. # R210-01) for 3 days. The surviving cells were labeled as TZM-Cas9 or JLTRG-R5-Cas9 cells.
pLB-sgRNAs were packaged into lentivirus in a similar manner as Lenti-Cas9-Blast. TZM-Cas9 or JLTRG-R5-Cas9 cells (lxlO5) were seeded into 24-well plates and infected at MOI=0.5. A portion of the cells were collected at different time points and analyzed by FACS to determine the CCR5 disruption rate. The rate of occurrence of GFP-positive cells was -30% for TZM-bl- Cas9 cells or -10% for JLTRG-R5-Cas9 cells.
Knockout of CD4 in primary CD4+ T cells with Cas9 preloaded with in vitro-transcribed sgRNA. CD4+ T cells were isolated from PBMC with StemSep™ Human CD4+ T Cell Enrichment Kit (StemCell Technologies, cat. #14052), and activated with Dynabeads® Human T- Activator CD3/CD28 (Life Technology, cat. # 1113 ID) for 5 days in the presence of 20 U/ml IL-2 (NIH AIDS Reagents Program, Cat. #136), 10% FCS, and lx Penicillin-Streptomycin- Glutamine solution (Life Technology, cat. # 10378-016).
sgRNAs were transcribed with HiScribe T7High Yield RNA Synthesis kit (NEB) according to the manufacturer's instructions, followed by purification with the RNeasy Mini kit (Qiagen, cat. # 217004). Before each use, sgRNAs were heated to 95 °C for 3 minutes in a PCR tube and immediately transferred to a water/ice bath for 2 minute to obtain pure monomers.
Activated primary CD4+ T cells were electroporated using the Neon transfection system (lOOul tip, Life Technologies, cat. # MPK10096) with 10 μg of spCas9 protein that was preloaded with 300 pmol sgRNA (mixed and incubated at room temperature for 10 minutes). Cells (lxlO6) resuspended in 100 μΐ R buffer were mixed with a protein: RNA mix, followed by Neon electroporation (1500 V, 10 ms, 3 pulses), according to the manufacturer's instructions. After 48 hours, the cells were stained with CD4 antibody and subjected to FACS analysis.
TZM-Cas9 cells were electroporated by Neon transfection system (lOul tip)(Life Technology cat. # MPK1096) with 30pmol sgRNA. 5xl04 cells re-suspended in lOul R buffer were mixed with RNA, followed by Neon electroporation (1005V 35ms 2pulse) according to the manufacturer's instructions. After 48 hours, the cells were stained with CD4 antibody and subject to FACS analysis.
Gene deletion assay. TZM-bl cells were co-transfected with sgRNA pairs (0.25 μg each) along with 0.5 μg of the Cas9-expressing plasmid pX261 -dU6.sgRNA Pairl (CCR5 sp7+spl4), Pair2 (CCR5 sp7+spl 8), Pair3 (CCR5 spl0+spl4), and Pair4 (CCR5 spl 0+spl 8). The sgRNA sequences are found in the Table 1. Twenty-four hours after transfection, the cells were treated with 0.8 μg/ml puromycin for 48 hrs, followed by recovery in medium without puromycin for 5 days. Genomic DNA was extracted from cells with the GenElute™ Mammalian Genomic DNA Miniprep kit (Sigma-Aldrich, cat. #G1N70). CCR5 gene fragments were amplified from70 μg of genomic DNA using Premix Ex Taq (Takara, cat. #RR003A) with forward primer 5'- ATGGATTATC AAGTGTCAAGTCCAA-3 ' SEQ ID NO : 138 and reverse primer 5'- AGGGAGCCC AGAAGAGAAAATAAAC-3 ' SEQ ID NO: 139 for the CCR5 gene. The PCR was stopped at different cycle numbers to check the amount of amplicon and ensure that the amplification was in exponential phase. PCR amplicons were analyzed on a 1% agarose gel.
Statistical analysis. Student's /-test (two-tailed, assuming equal variances for all experimental data sets) was used to compare two groups of independent samples.
Table 1. sgRNA sequences
SEQ ID
sgRNAs Sequence NO:
GATTATGGAAAACAGATGGCGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTA
Control-sgRNA GTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCttttt 1
Ori
CCR gin
Fig GGACAGTAAGAAGGAAAAACGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTA
5 al GTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCttttt 2 1A
spl 0+1 GGACAGTAAGAAGGAAAAACGTTTTAGAGCTAtGAAAaTAGCAAGTTAAAATAAGGC
bp TAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCttttt 3
0+3 GGACAGTAAGAAGGAAAAACGTTTTAGAGCTAtgcGAAAgcaTAGCAAGTTAAAATA bp AGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCttttt 4
0+5 GGACAGTAAGAAGGAAAAACGTTTTAGAGCTAtgctgGAAAcagcaTAGCAAGTTAA bp AATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCttttt 5
GGACAGTAAGAAGGAAAAACGTTTTAGAGCTAtgctgtttGAAAaaacagcaTAGCA
0+8 AGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCtt bp ttt 6
0+1 GGACAGTAAGAAGGAAAAACGTTTTAGAGCTAtgctgttttgGAAAcaaaacagcaT 0 AGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGT bp GCttttt 7
Ori
gin GTGAGTAGAGCGGAGGCAGGGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTA al GTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCttttt 8
0+1 GTGAGTAGAGCGGAGGCAGGGTTTTAGAGCTAtGAAAaTAGCAAGTTAAAATAAGGC bp TAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCttttt 9
0+3 GTGAGTAGAGCGGAGGCAGGGTTTTAGAGCTAtgcGAAAgcaTAGCAAGTTAAAATA
CCR bp AGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCttttt 10
5 0+5 GTGAGTAGAGCGGAGGCAGGGTTTTAGAGCTAtgctgGAAAcagcaTAGCAAGTTAA sp2 bp AATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCttttt 11
GTGAGTAGAGCGGAGGCAGGGTTTTAGAGCTAtgctgtttGAAAaaacagcaTAGCA
0+8 AGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCtt bp ttt 12
0+1 GTGAGTAGAGCGGAGGCAGGGTTTTAGAGCTAtgctgttttgGAAAcaaaacagcaT 0 AGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGT bp GCttttt 13
GGACAGTAAGAAGGAAAAACGaTTTAGAGCTAGAAATAGCAAGTTAAAtTAAGGCTA
Ml GTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCttttt 14
CCR GGACAGTAAGAAGGAAAAACGTaTTAGAGCTAGAAATAGCAAGTTAAtATAAGGCTAig M2 GTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCttttt 15
5
ID GGACAGTAAGAAGGAAAAACGTTaTAGAGCTAGAAATAGCAAGTTAtAATAAGGCTA spl M3 GTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCttttt 16
GGACAGTAAGAAGGAAAAACGTTTaAGAGCTAGAAATAGCAAGTTtAAATAAGGCTA
M4 GTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCttttt 17
Ori
gin GGACAGTAAGAAGGAAAAACGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTA al GTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCttttt 18
GGACAGTAAGAAGGAAAAACGTTTaAGAGCTAGAAATAGCAAGTTtAAATAAGGCTA
M GTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCttttt 19
M+l GGACAGTAAGAAGGAAAAACGTTTaAGAGCTAtGAAAaTAGCAAGTTtAAATAAGGC bp TAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCttttt 20
M+2 GGACAGTAAGAAGGAAAAACGTTTaAGAGCTAtgGAAAcaTAGCAAGTTtAAATAAG bp GCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCttttt 21
M+3 GGACAGTAAGAAGGAAAAACGTTTaAGAGCTAtgcGAAAgcaTAGCAAGTTtAAATA
CCR
ig bp AGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCttttt 22
5
2A M+4 GGACAGTAAGAAGGAAAAACGTTTaAGAGCTAtgetGAAAagcaTAGCAAGTTtAAA spl bp TAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCttttt 23
M+5 GGACAGTAAGAAGGAAAAACGTTTaAGAGCTAtgctgGAAAcagcaTAGCAAGTTtA bp AATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCttttt 24
M+6 GGACAGTAAGAAGGAAAAACGTTTaAGAGCTAtgctgtGAAAacagcaTAGCAAGTT bp tAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCttttt 25
GGACAGTAAGAAGGAAAAACGTTTaAGAGCTAtgctg11GAAAaacagcaTAGCAAG
M+7 TTtAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCtttt bp t 26
GGACAGTAAGAAGGAAAAACGTTTaAGAGCTAtgctg111GAAAaaacagcaTAGCA
M+8 AGTTtAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCtt bp ttt 27
GGACAGTAAGAAGGAAAAACGTTTaAGAGCTAtgctgttttGAAAaaaacagcaTAG
M+9 CAAGTTtAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC bp ttttt 28
GGACAGTAAGAAGGAAAAACGTTTaAGAGCTAtgctgttttgGAAAcaaaacagcaT
M+1 AGCAAGTTtAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGT Obp GCttttt 29
Ori
gin GTGAGTAGAGCGGAGGCAGGGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTA al GTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCttttt 30
GTGAGTAGAGCGGAGGCAGGGTTTaAGAGCTAGAAATAGCAAGTTtAAATAAGGCTA
M GTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCttttt 31
M+1 GTGAGTAGAGCGGAGGCAGGGTTTaAGAGCTAtGAAAaTAGCAAGTTtAAATAAGGC bp TAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCttttt 32
M+2 GTGAGTAGAGCGGAGGCAGGGTTTaAGAGCTAtgGAAAcaTAGCAAGTTtAAATAAG bp GCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCttttt 33
M+3 GTGAGTAGAGCGGAGGCAGGGTTTaAGAGCTAtgcGAAAgcaTAGCAAGTTtAAATA bp AGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCttttt 34
M+4 GTGAGTAGAGCGGAGGCAGGGTTTaAGAGCTAtgctGAAAagcaTAGCAAGTTtAAA bp
CCR TAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCttttt 35
M+5
5 GTGAGTAGAGCGGAGGCAGGGTTTaAGAGCTAtgctgGAAAcagcaTAGCAAGTTtA sp2 bp AATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCttttt 36
M+6 GTGAGTAGAGCGGAGGCAGGGTTTaAGAGCTAtgctgtGAAAacagcaTAGCAAGTT bp tAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCttttt 37
GTGAGTAGAGCGGAGGCAGGGTTTaAGAGCTAtgctgttGAAAaacagcaTAGCAAG
M+7 TTtAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCtttt bp t 38
GTGAGTAGAGCGGAGGCAGGGTTTaAGAGCTAtgctgtttGAAAaaacagcaTAGCA
M+8 AGTTtAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCtt bp ttt 39
GTGAGTAGAGCGGAGGCAGGGTTTaAGAGCTAtgctgttttGAAAaaaacagcaTAG
M+9 CAAGTTtAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC bp ttttt 40
GTGAGTAGAGCGGAGGCAGGGTTTaAGAGCTAtgctgttttgGAAAcaaaacagcaT
M+1 AGCAAGTTtAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGT Obp GCttttt 41
Ori
gin GTGTTCATCTTTGGTTTTGTGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTA al GTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCttttt 42
GTGTTCATCTTTGGTTTTGTGTTTaAGAGCTAGAAATAGCAAGTTtAAATAAGGCTA
M GTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCttttt 43
M+1 GTGTTCATCTTTGGTTTTGTGTTTaAGAGCTAtGAAAaTAGCAAGTTtAAATAAGGC bp TAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCttttt 44
M+2 GTGTTCATCTTTGGTTTTGTGTTTaAGAGCTAtgGAAAcaTAGCAAGTTtAAATAAG bp GCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCttttt 45
CCR M+3 GTGTTCATCTTTGGTTTTGTGTTTaAGAGCTAtgcGAAAgcaTAGCAAGTTtAAATA 5 bp AGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCttttt 46 sp3 M+4 GTGTTCATCTTTGGTTTTGTGTTTaAGAGCTAtgctGAAAagcaTAGCAAGTTtAAA bp TAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCttttt 47
M+5 GTGTTCATCTTTGGTTTTGTGTTTaAGAGCTAtgctgGAAAcagcaTAGCAAGTTtA bp AATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCttttt 48
M+6 GTGTTCATCTTTGGTTTTGTGTTTaAGAGCTAtgctgtGAAAacagcaTAGCAAGTT bp tAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCttttt 49
GTGTTCATCTTTGGTTTTGTGTTTaAGAGCTAtgctgttGAAAaacagcaTAGCAAG
M+7 TTtAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCtttt bp t 50
GTGTTCATCTTTGGTTTTGTGTTTaAGAGCTAtgctgtttGAAAaaacagcaTAGCA
M+8 AGTTtAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCtt 51
bp ttt
GTGTTCATCTTTGGTTTTGTGTTTaAGAGCTAtgctgttttGAAAaaaacagcaTAG
M+9 CAAGTTtAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC bp ttttt 52
GTGTTCATCTTTGGTTTTGTGTTTaAGAGCTAtgctgttttgGAAAcaaaacagcaT
M+1 AGCAAGTTtAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGT Obp GCttttt 53
Ori
gin GTTTGCTTTAAAAGCCAGGAGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTA al GTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCttttt 54
GTTTGCTTTAAAAGCCAGGAGTTTaAGAGCTAGAAATAGCAAGTTtAAATAAGGCTA
M GTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCttttt 55
M+1 GTTTGCTTTAAAAGCCAGGAGTTTaAGAGCTAtGAAAaTAGCAAGTTtAAATAAGGC bp TAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCttttt 56
M+2 GTTTGCTTTAAAAGCCAGGAGTTTaAGAGCTAtgGAAAcaTAGCAAGTTtAAATAAG bp GCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCttttt 57
M+3 GTTTGCTTTAAAAGCCAGGAGTTTaAGAGCTAtgcGAAAgcaTAGCAAGTTtAAATA bp AGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCttttt 58
M+4 GTTTGCTTTAAAAGCCAGGAGTTTaAGAGCTAtgctGAAAagcaTAGCAAGTTtAAA bp
CCR TAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCttttt 59
M+5
5 GTTTGCTTTAAAAGCCAGGAGTTTaAGAGCTAtgctgGAAAcagcaTAGCAAGTTtA sp4 bp AATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCttttt 60
M+6 GTTTGCTTTAAAAGCCAGGAGTTTaAGAGCTAtgctgtGAAAacagcaTAGCAAGTT bp tAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCttttt 61
GTTTGCTTTAAAAGCCAGGAGTTTaAGAGCTAtgctgttGAAAaacagcaTAGCAAG
M+7 TTtAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCtttt bp t 62
GTTTGCTTTAAAAGCCAGGAGTTTaAGAGCTAtgctgtttGAAAaaacagcaTAGCA
M+8 AGTTtAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCtt bp ttt 63
GTTTGCTTTAAAAGCCAGGAGTTTaAGAGCTAtgctgttttGAAAaaaacagcaTAG
M+9 CAAGTTtAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC bp ttttt 64
GTTTGCTTTAAAAGCCAGGAGTTTaAGAGCTAtgctgttttgGAAAcaaaacagcaT
M+1 AGCAAGTTtAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGT Obp GCttttt 65
GGACAGTAAGAAGGAAAAACGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTA
Original GTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCttttt 66
GGACAGTAAGAAGGAAAAACGaTTTAGAGCTAtgctgGAAAcagcaTAGCAAGTTAA
1 AtTAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCttttt 67
CCR GGACAGTAAGAAGGAAAAACGTaTTAGAGCTAtgctgGAAAcagcaTAGCAAGTTAA 5 2 tATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCttttt 68 spl GGACAGTAAGAAGGAAAAACGTTaTAGAGCTAtgctgGAAAcagcaTAGCAAGTTAt T2A 3 AATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCttttt 69
GGACAGTAAGAAGGAAAAACGTTTaAGAGCTAtgctgGAAAcagcaTAGCAAGTTtA
4 AATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCttttt 70
GGACAGTAAGAAGGAAAAACGcTTTAGAGCTAtgctgGAAAcagcaTAGCAAGTTAA
1 AgTAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCttttt 71
CCR GGACAGTAAGAAGGAAAAACGTcTTAGAGCTAtgctgGAAAcagcaTAGCAAGTTAA 5 2 gATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCttttt 72 spl GGACAGTAAGAAGGAAAAACGTTcTAGAGCTAtgctgGAAAcagcaTAGCAAGTTAg T2C 3 AATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCttttt 73
GGACAGTAAGAAGGAAAAACGTTTcAGAGCTAtgctgGAAAcagcaTAGCAAGTTgA
4 AATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCttttt 74
CCR GGACAGTAAGAAGGAAAAACGgTTTAGAGCTAtgctgGAAAcagcaTAGCAAGTTAA
1 AcTAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCttttt 75
5
GGACAGTAAGAAGGAAAAACGTgTTAGAGCTAtgctgGAAAcagcaTAGCAAGTTAA spl 2 cATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCttttt 76
T2G GGACAGTAAGAAGGAAAAACGTTgTAGAGCTAtgctgGAAAcagcaTAGCAAGTTAc
3 AATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCttttt 77
GGACAGTAAGAAGGAAAAACGTTTgAGAGCTAtgctgGAAAcagcaTAGCAAGTTcA
4 AATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCttttt 78
GTTTGCTTTAAAAGCCAGGAGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTA
sp4 GTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCttttt 79
AACACCAGTGAGTAGAGCGGGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTA
sp5 GTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCttttt 80
ATGAACACCAGTGAGTAGAGGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTA
sp6 GTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCttttt 81
GCAGCATAGTGAGCCCAGAAGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTA
sp7 GTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCttttt 82
GGCAGCATAGTGAGCCCAGAGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTA
sp8 GTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCttttt 83
ATTTCCAAAGTCCCACTGGGGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTA
sp9 GTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCttttt 84 spl GCTGCCGCCCAGTGGGACTTGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTA
CCR 0 GTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCttttt 85
5 spl GGTACCTATCGATTGTCAGGGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTA sgR 1 GTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCttttt 86 NAs spl ACACAGCATGGACGACAGCCGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTA Ori 2 GTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCttttt 87 gin spl AAAGCCAGGACGGTCACCTTGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTA al 3 GTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCttttt 88 spl AAGCCAGGACGGTCACCTTTGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTA
4 GTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCttttt 89 spl AGCCAGGACGGTCACCTTTGGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTA
5 GTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCttttt 90 spl GACAAGTGTGATCACTTGGGGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTA 6 GTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCttttt 91 spl ATCTGGTAAAGATGATTCCTGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTA 7 GTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCttttt 92 spl GATCTGGTAAAGATGATTCCGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTA 8 GTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCttttt 93 spl GCTGTGTTTGCGTCTCTCCCGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTA 9 GTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCttttt 94
GTTTGCTTTAAAAGCCAGGAGTTTgAGAGCTAtgctgGAAAcagcaTAGCAAGTTcA sp4 AATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCttttt 95
AACACCAGTGAGTAGAGCGGGTTTgAGAGCTAtgctgGAAAcagcaTAGCAAGTTcA sp5 AATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCttttt 96
ATGAACACCAGTGAGTAGAGGTTTgAGAGCTAtgctgGAAAcagcaTAGCAAGTTcA sp6 AATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCttttt 97
GCAGCATAGTGAGCCCAGAAGTTTgAGAGCTAtgctgGAAAcagcaTAGCAAGTTcA
CCR sp7 AATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCttttt 98
5 GGCAGCATAGTGAGCCCAGAGTTTgAGAGCTAtgctgGAAAcagcaTAGCAAGTTcA sgR sp8 AATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCttttt 99 NAs ATTTCCAAAGTCCCACTGGGGTTTgAGAGCTAtgctgGAAAcagcaTAGCAAGTTcA Opt sp9 AATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCttttt 100 imi spl GCTGCCGCCCAGTGGGACTTGTTTgAGAGCTAtgctgGAAAcagcaTAGCAAGTTcA zed 0 AATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCttttt 101 spl GGTACCTATCGATTGTCAGGGTTTgAGAGCTAtgctgGAAAcagcaTAGCAAGTTcA 1 AATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCttttt 102 spl ACACAGCATGGACGACAGCCGTTTgAGAGCTAtgctgGAAAcagcaTAGCAAGTTcA 2 AATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCttttt 103 spl AAAGCCAGGACGGTCACCTTGTTTgAGAGCTAtgctgGAAAcagcaTAGCAAGTTcA
3 AATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCttttt 104
spl AAGCCAGGACGGTCACCTTTGTTTgAGAGCTAtgctgGAAAcagcaTAGCAAGTTcA
4 AATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCttttt 105 spl AGCCAGGACGGTCACCTTTGGTTTgAGAGCTAtgctgGAAAcagcaTAGCAAGTTcA
5 AATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCttttt 106 spl GACAAGTGTGATCACTTGGGGTTTgAGAGCTAtgctgGAAAcagcaTAGCAAGTTcA 6 AATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCttttt 107 spl ATCTGGTAAAGATGATTCCTGTTTgAGAGCTAtgctgGAAAcagcaTAGCAAGTTcA 7 AATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCttttt 108 spl GATCTGGTAAAGATGATTCCGTTTgAGAGCTAtgctgGAAAcagcaTAGCAAGTTcA 8 AATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCttttt 109 spl GCTGTGTTTGCGTCTCTCCCGTTTgAGAGCTAtgctgGAAAcagcaTAGCAAGTTcA 9 AATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCttttt 110
GCGCGATCATTCAGCTTGGAGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTA
spl GTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCttttt 111
GTCAGCGCGATCATTCAGCTGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTA
sp2 GTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCttttt 112
AGTGCCTAAAAGGGACTCCCGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTA
CD4 sp3 GTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCttttt 113 sgR ACCAGAAGCAAGTGCCTAAAGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTA NAs sp4 GTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCttttt 114
Ori AGAAGAGCATACAATTCCACGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTA gin sp5 GTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCttttt 115 al AAGTGGTGCTGGGCAAAAAAGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTA sp6 GTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCttttt 116
GATTTCCCAGAATCTTTATCGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTA
sp7 GTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCttttt 117
GGAATTGTATGCTCTTCTTCGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTA
Fig sp8 GTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCttttt 118
2b GCGCGATCATTCAGCTTGGAGTTTgAGAGCTAtgctgtGAAAacagcaTAGCAAGTT spl cAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCttttt 119
GTCAGCGCGATCATTCAGCTGTTTgAGAGCTAtgctgtGAAAacagcaTAGCAAGTT sp2 cAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCttttt 120
AGTGCCTAAAAGGGACTCCCGTTTgAGAGCTAtgctgtGAAAacagcaTAGCAAGTT
CD4 sp3 cAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCttttt 121 sgR ACCAGAAGCAAGTGCCTAAAGTTTgAGAGCTAtgctgtGAAAacagcaTAGCAAGTT NAs sp4 cAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCttttt 122
Opt AGAAGAGCATACAATTCCACGTTTgAGAGCTAtgctgtGAAAacagcaTAGCAAGTT imi sp5 cAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCttttt 123 zed AAGTGGTGCTGGGCAAAAAAGTTTgAGAGCTAtgctgtGAAAacagcaTAGCAAGTT sp6 cAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCttttt 124
GATTTCCCAGAATCTTTATCGTTTgAGAGCTAtgctgtGAAAacagcaTAGCAAGTT sp7 cAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCttttt 125
GGAATTGTATGCTCTTCTTCGTTTgAGAGCTAtgctgtGAAAacagcaTAGCAAGTT sp8 cAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCttttt 126 crR
NA NNNNNNNNNNNNNNNNNNNNGUUUUAGAGCUAUGCUGUUUUG 127
Ori
gin GGACAGTAAGAAGGAAAAACGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTA al GTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCttttt 128
0+1 GGACAGTAAGAAGGAAAAACGTTTTAGAGCTAtGAAAaTAGCAAGTTAAAATAAGGC bp TAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCttttt 129
0+3 GGACAGTAAGAAGGAAAAACGTTTTAGAGCTAtgcGAAAgcaTAGCAAGTTAAAATA
Fig CCR bp AGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCttttt 130 la spl 0+5 GGACAGTAAGAAGGAAAAACGTTTTAGAGCTAtgctgGAAAcagcaTAGCAAGTTAA bp AATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCttttt 131
0+8 GGACAGTAAGAAGGAAAAACGTTTTAGAGCTAtgctgtttGAAAaaacagcaTAGCA bp AGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCtt 132
ttt
GGACAGTAAGAAGGAAAAACGTTTTAGAGCTAtgctgttttgGAAAcaaaacagcaT
0+1 AGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGT Obp GCttttt 133
GTGTTCATCTTTGGTTTTGTGTTT 134
CGGTGCCACTTTTTCAAGTT 135
ACACTCTTTCCCTACACGACGCTCTTCCGATCTTCTACCTGCTCAACCTGGCC 136
GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCAAGTCCCACTGGGCGGC 137
ATGGATTATCAAGTGTCAAGTCCAA 138
AGGGAGCCCAGAAGAGAAAATAAAC 139
NNNNNNNNNNNNNNNNNNNNGUUCAGAGCUAUGCUGGAAACAGCAUAGCAAGUUGAA AUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCAGGCAGUCGGUGCUUUUUU 140
It is contemplated that any embodiment discussed in this specification can be implemented with respect to any method, kit, reagent, or composition of the invention, and vice versa. Furthermore, compositions of the invention can be used to achieve methods of the invention.
It will be understood that particular embodiments described herein are shown by way of illustration and not as limitations of the invention. The principal features of this invention can be employed in various embodiments without departing from the scope of the invention. Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, numerous equivalents to the specific procedures described herein. Such equivalents are considered to be within the scope of this invention and are covered by the claims.
All publications and patent applications mentioned in the specification are indicative of the level of skill of those skilled in the art to which this invention pertains. All publications and patent applications are herein incorporated by reference to the same extent as if each individual publication or patent application was specifically and individually indicated to be incorporated by reference.
The use of the word "a" or "an" when used in conjunction with the term "comprising" in the claims and/or the specification may mean "one," but it is also consistent with the meaning of "one or more," "at least one," and "one or more than one." The use of the term "or" in the claims is used to mean "and/or" unless explicitly indicated to refer to altematives only or the alternatives are mutually exclusive, although the disclosure supports a definition that refers to only alternatives and "and/or." Throughout this application, the term "about" is used to indicate
that a value includes the inherent variation of error for the device, the method being employed to determine the value, or the variation that exists among the study subjects.
As used in this specification and claim(s), the words "comprising" (and any form of comprising, such as "comprise" and "comprises"), "having" (and any form of having, such as "have" and "has"), "including" (and any form of including, such as "includes" and "include") or "containing" (and any form of containing, such as "contains" and "contain") are inclusive or open-ended and do not exclude additional, unrecited elements or method steps. In embodiments of any of the compositions and methods provided herein, "comprising" may be replaced with "consisting essentially of or "consisting of. As used herein, the phrase "consisting essentially of requires the specified integer(s) or steps as well as those that do not materially affect the character or function of the claimed invention. As used herein, the term "consisting" is used to indicate the presence of the recited integer (e.g., a feature, an element, a characteristic, a property, a method/process step or a limitation) or group of integers (e.g., feature(s), element(s), characteristic(s), propertie(s), method/process steps or limitation(s)) only.
The term "or combinations thereof as used herein refers to all permutations and combinations of the listed items preceding the term. For example, "A, B, C, or combinations thereof is intended to include at least one of: A, B, C, AB, AC, BC, or ABC, and if order is important in a particular context, also BA, CA, CB, CBA, BCA, ACB, BAC, or CAB. Continuing with this example, expressly included are combinations that contain repeats of one or more item or term, such as BB, AAA, AB, BBC, AAABCCCC, CBBAAA, CABABB, and so forth. The skilled artisan will understand that typically there is no limit on the number of items or terms in any combination, unless otherwise apparent from the context.
As used herein, words of approximation such as, without limitation, "about", "substantial" or "substantially" refers to a condition that when so modified is understood to not necessarily be absolute or perfect but would be considered close enough to those of ordinary skill in the art to warrant designating the condition as being present. The extent to which the description may vary will depend on how great a change can be instituted and still have one of ordinary skilled in the art recognize the modified feature as still having the required characteristics and capabilities of the unmodified feature. In general, but subject to the preceding discussion, a numerical value herein that is modified by a word of approximation such as "about" may vary from the stated value by at least ±1, 2, 3, 4, 5, 6, 7, 10, 12 or 15%.
Additionally, the section headings herein are provided for consistency with the suggestions under 37 CFR 1.77 or otherwise to provide organizational cues. These headings shall not limit
or characterize the invention(s) set out in any claims that may issue from this disclosure. Specifically and by way of example, although the headings refer to a "Field of Invention," such claims should not be limited by the language under this heading to describe the so-called technical field. Further, a description of technology in the "Background of the Invention" section is not to be construed as an admission that technology is prior art to any invention(s) in this disclosure. Neither is the "Summary" to be considered a characterization of the invention(s) set forth in issued claims. Furthermore, any reference in this disclosure to "invention" in the singular should not be used to argue that there is only a single point of novelty in this disclosure. Multiple inventions may be set forth according to the limitations of the multiple claims issuing from this disclosure, and such claims accordingly define the invention(s), and their equivalents, that are protected thereby. In all instances, the scope of such claims shall be considered on their own merits in light of this disclosure, but should not be constrained by the headings set forth herein.
All of the compositions and/or methods disclosed and claimed herein can be made and executed without undue experimentation in light of the present disclosure. While the compositions and methods of this invention have been described in terms of preferred embodiments, it will be apparent to those of skill in the art that variations may be applied to the compositions and/or methods and in the steps or in the sequence of steps of the method described herein without departing from the concept, spirit and scope of the invention. All such similar substitutes and modifications apparent to those skilled in the art are deemed to be within the spirit, scope and concept of the invention as defined by the appended claims.
REFERENCES
1. Mali P, Yang L, Esvelt KM, Aach J, Guell M, DiCarlo JE, Norville JE, Church GM: RNA-guided human genome engineering via Cas9. Science 2013, 339:823-826.
2. Jinek M, East A, Cheng A, Lin S, Ma E, Doudna J: RNA-programmed genome editing in human cells. Elife 2013, 2:e00471.
3. Hwang WY, Fu Y, Reyon D, Maeder ML, Tsai SQ, Sander JD, Peterson RT, Yeh JR, Joung JK: Efficient genome editing in zebrafish using a CRISPR-Cas system. Nat Biotechnol 2013, 31 :227-229.
4. Cong L, Ran FA, Cox D, Lin S, Barretto R, Habib N, Hsu PD, Wu X, Jiang W,
Marraffini LA, Zhang F: Multiplex genome engineering using CRISPR/Cas systems. Science 2013, 339:819-823.
5. Cho SW, Kim S, Kim JM, Kim JS: Targeted genome engineering in human cells with the Cas9 RNA-guided endonuclease. Nat Biotechnol 2013, 31 :230-232.
6. Jinek M, Chylinski K, Fonfara I, Hauer M, Doudna JA, Charpentier E: A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity. Science 2012, 337: 816- 821.
7. Nishimasu H, Ran FA, Hsu PD, Konermann S, Shehata SI, Dohmae N, Ishitani R, Zhang F, Nureki O: Crystal structure of Cas9 in complex with guide RNA and target DNA. Cell 2014, 156:935-949.
8. Anders C, Niewoehner O, Duerst A, Jinek M: Structural basis of PAM-dependent target DNA recognition by the Cas9 endonuclease. Nature 2014, 513:569-573.
9. Hsu PD, Scott DA, Weinstein JA, Ran FA, Konermann S, Agarwala V, Li Y, Fine EJ, Wu X, Shalem O, et al: DNA targeting specificity of RNA-guided Cas9 nucleases. Nat
Biotechnol 2013.
10. Chen B, Gilbert LA, Cimini BA, Schnitzbauer J, Zhang W, Li GW, Park J, Blackburn EH, Weissman JS, Qi LS, Huang B: Dynamic imaging of genomic loci in living human cells by an optimized CRISPR/Cas system. Cell 2013, 155: 1479-1491.
11. Nielsen S, Yuzenkova Y, Zenkin N: Mechanism of eukaryotic RNA polymerase III transcription termination. Science 2013, 340: 1577-1580.
12. Ma H, Zhang J, Wu H: Designing Ago2-specific siRNA/shRNA to Avoid Competition with Endogenous miRNAs. Mol Ther Nucleic Acids 2014, 3:el76.
13. Ma H, Dang Y, Wu Y, Jia G, Anaya E, Zhang J, Abraham S, Choi JG, Shi G, Qi L, et al: A CRISPR-Based Screen Identifies Genes Essential for West-Nile-Virus-Induced Cell Death. Cell Rep 2015, 12:673-683.
14. Zhou Y, Zhu S, Cai C, Yuan P, Li C, Huang Y, Wei W: High-throughput screening of a CRISPR/Cas9 library for functional genomics in human cells. Nature 2014, 509:487-491.
15. Wang T, Wei JJ, Sabatini DM, Lander ES: Genetic screens in human cells using the CRISPR-Cas9 system. Science 2014, 343:80-84.
16. Shalem O, Sanjana NE, Hartenian E, Shi X, Scott DA, Mikkelsen TS, Heckl D, Ebert BL, Root DE, Doench JG, Zhang F: Genome-scale CRISPR-Cas9 knockout screening in human cells. Science 2014, 343:84-87.
17. Sanjana NE, Shalem O, Zhang F: Improved vectors and genome-wide libraries for CRISPR screening. Nat Methods 2014, 11 :783-784.
18. Konermann S, Brigham MD, Trevino AE, Joung J, Abudayyeh 00, Barcena C, Hsu PD, Habib N, Gootenberg JS, Nishimasu H, et al: Genome-scale transcriptional activation by an engineered CRISPR-Cas9 complex. Nature 2014.
19. Koike-Yusa H, Li Y, Tan EP, Velasco-Herrera Mdel C, Yusa K: Genome-wide recessive genetic screening in mammalian cells with a lentiviral CRISPR-guide RNA library. Nat Biotechnol 2014, 32:267-273.
20. Gilbert LA, Horlbeck MA, Adamson B, Villalta JE, Chen Y, Whitehead EH, Guimaraes C, Panning B, Ploegh HL, Bassik MC, et al: Genome-Scale CRISPR-Mediated Control of Gene
Repression and Activation. Cell 2014, 159:647-661.
21. Kissler S, Stern P, Takahashi K, Hunter K, Peterson LB, Wicker LS: In vivo RNA interference demonstrates a role for Nrampl in modifying susceptibility to type 1 diabetes. Nat Genet 2006, 38:479-483.
22. Ma H, Wu Y, Dang Y, Choi JG, Zhang J, Wu H: Pol III Promoters to Express Small RNAs: Delineation of Transcription Initiation. Mol Ther Nucleic Acids 2014, 3:el61.
Claims
1. A modified single-guide RNA (sgRNA) template with improved knockout efficiency specific for a target gene comprising an sgRNA construct comprising at least one of a mutated duplex region wherein a length of the duplex region is extended, or a mutated poly T region at the beginning of the duplex region, wherein the sgRNA has a greater target gene knockout efficiency in cells.
2. The modified sgRNA of claim 0, wherein the modified duplex region changes the pause site for a pol III RNAse polymerase at the continuous Thymine RNA segment.
3. The modified sgRNA of claim 0, wherein the modified duplex region comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 extra nucleotides in each strand of the modified duplex region.
4. The modified sgRNA of claim 0, wherein the cells are mammalian cells.
5. The modified sgRNA of claim 0, wherein the cells are human cells.
6. The modified sgRNA of claim 0, wherein the sgRNA comprises both the mutated duplex region and mutation of the poly T region.
7. The modified sgRNA of claim 0, wherein the sgRNA is part of a gene library.
8. The modified sgRNA of claim 0, wherein the sgRNA is defined further as being in an sgRNA expression vector.
9. The modified sgRNA of claim 0, wherein the sgRNA is defined further as being in a transgene vector.
10. The modified sgRNA of claim 0, wherein the sgRNA comprises SEQ ID NOS :3 to 133, or 140.
11. The modified sgRNA of claim 0, wherein the sgRNA comprises both a mutated duplex region wherein a length of the duplex region is extended and a mutated poly T region at the beginning of the duplex region.
12. A method designing a modified single-guide RNA (sgRNA) template with improved knockout efficiency for a specific target gene comprising:
identifying a target gene; and
modifying an sgRNA that is specific for the target gene by at least one of increasing the length of the duplex region or mutating a poly T region at the end of the duplex region of the
modified sgRNA, wherein the modified sgRNA has a higher target gene knockout efficiency in cells than the unmodified sgRNA.
13. The method of claim 12, wherein the modified duplex region changes the pause site for a pol III RNAse polymerase at the continuous Thymine RNA segment.
14. The method of claim 12, wherein the modified duplex region comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 extra nucleotides in each strand of the modified duplex region.
15. The method of claim 12, wherein the cells are mammalian cells.
16. The method of claim 12, wherein the cells are human cells.
17. The method of claim 12, wherein the sgRNA comprises both the mutated duplex region and mutation of the poly T region.
18. The method of claim 12, wherein the sgRNA is part of a gene library.
19. The method of claim 12, wherein the sgRNA is defined further as being in a sgRNA expression vector.
20. The method of claim 12, wherein the sgRNA is defined further as being in a transgene vector.
21. The method of claim 12, wherein the sgRNA comprises SEQ ID NOS: 1 to 4.
22. The method of claim 12, wherein the sgRNA comprises both a mutated duplex region wherein a length of the duplex region is extended and a mutated poly T region at the beginning of the duplex region.
23. The method of claim 12, wherein the mutant sgRNA is selected from SEQ ID NOS:3 to 133, or 140.
24. A method of determining the knockdown effectiveness against a target gene by a mutated candidate sgRNA, the method comprising:
(a) obtaining one or more mutated candidate sgRNAs, wherein the sgRNA has been mutated by at least one of at least one of increasing the length of the duplex region or mutating poly T region at the end of the duplex region;
(b) expressing the mutated sgRNAs in a first cell that expresses the target gene, and a non-mutated sgRNA to a second subset of the patients, and expressing a non-mutated sgRNA in a second cell; and
(c) determining if the mutated candidate sgRNA knocked down expression of the target gene in the first cell to a greater extent than the non-mutated sgRNA in the second cell.
25. A mutant single-guide RNA (sgRNA) with improved knockout efficiency specific for a target gene comprising a target-specific sequence and a modified sequence, wherein the sequence comprises at least one of a mutated duplex region wherein a length of the duplex region is extended, or a mutated poly T region at the end of the duplex region, wherein the sgRNA has a greater target gene knockout efficiency in cells.
26. The mutant sgRNA of claim 25, wherein the mutant sgRNA is inserted into an sgRNA expression vector.
27. The mutant sgRNA of claim 25, wherein the mutant sgRNA is selected from SEQ ID NOS :3 to 133 or 140.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201562216463P | 2015-09-10 | 2015-09-10 | |
| US62/216,463 | 2015-09-10 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2017044776A1 true WO2017044776A1 (en) | 2017-03-16 |
Family
ID=58240928
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2016/050989 Ceased WO2017044776A1 (en) | 2015-09-10 | 2016-09-09 | Single-guide rna (sgrna) with improved knockout efficiency |
Country Status (1)
| Country | Link |
|---|---|
| WO (1) | WO2017044776A1 (en) |
Cited By (47)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US9999671B2 (en) | 2013-09-06 | 2018-06-19 | President And Fellows Of Harvard College | Delivery of negatively charged proteins using cationic lipids |
| US10077453B2 (en) | 2014-07-30 | 2018-09-18 | President And Fellows Of Harvard College | CAS9 proteins including ligand-dependent inteins |
| WO2018195555A1 (en) * | 2017-04-21 | 2018-10-25 | The Board Of Trustees Of The Leland Stanford Junior University | Crispr/cas 9-mediated integration of polynucleotides by sequential homologous recombination of aav donor vectors |
| US10113163B2 (en) | 2016-08-03 | 2018-10-30 | President And Fellows Of Harvard College | Adenosine nucleobase editors and uses thereof |
| US10167457B2 (en) | 2015-10-23 | 2019-01-01 | President And Fellows Of Harvard College | Nucleobase editors and uses thereof |
| WO2019087113A1 (en) * | 2017-11-01 | 2019-05-09 | Novartis Ag | Synthetic rnas and methods of use |
| US10323236B2 (en) | 2011-07-22 | 2019-06-18 | President And Fellows Of Harvard College | Evaluation and improvement of nuclease cleavage specificity |
| CN110241117A (en) * | 2019-06-13 | 2019-09-17 | 西安交通大学 | A kind of high activity sgRNA skeleton, sgRNA skeleton carrier and its application of double alkali yl mutation |
| US10465176B2 (en) | 2013-12-12 | 2019-11-05 | President And Fellows Of Harvard College | Cas variants for gene editing |
| US10508298B2 (en) | 2013-08-09 | 2019-12-17 | President And Fellows Of Harvard College | Methods for identifying a target site of a CAS9 nuclease |
| US10597679B2 (en) | 2013-09-06 | 2020-03-24 | President And Fellows Of Harvard College | Switchable Cas9 nucleases and uses thereof |
| US10745677B2 (en) | 2016-12-23 | 2020-08-18 | President And Fellows Of Harvard College | Editing of CCR5 receptor gene to protect against HIV infection |
| US10858639B2 (en) | 2013-09-06 | 2020-12-08 | President And Fellows Of Harvard College | CAS9 variants and uses thereof |
| EP3640333A4 (en) * | 2017-07-14 | 2020-12-30 | Cure Genetics Co., Ltd | EDITING SYSTEM AND PROCEDURE |
| US20210017518A1 (en) * | 2017-12-19 | 2021-01-21 | City Of Hope | Modified tracrrnas grnas, and uses thereof |
| EP3630975A4 (en) * | 2017-05-26 | 2021-03-10 | North Carolina State University | RNA GUIDES MODIFIED TO MODULATE CAS9 ACTIVITY AND USAGE PROCEDURES |
| US11046948B2 (en) | 2013-08-22 | 2021-06-29 | President And Fellows Of Harvard College | Engineered transcription activator-like effector (TALE) domains and uses thereof |
| WO2021263179A1 (en) * | 2020-06-26 | 2021-12-30 | The Board Of Trustees Of The Leland Stanford Junior University | Targeting the human ccr5 locus as a safe harbor for the expression of therapeutic proteins |
| US11268082B2 (en) | 2017-03-23 | 2022-03-08 | President And Fellows Of Harvard College | Nucleobase editors comprising nucleic acid programmable DNA binding proteins |
| US11306324B2 (en) | 2016-10-14 | 2022-04-19 | President And Fellows Of Harvard College | AAV delivery of nucleobase editors |
| US11319532B2 (en) | 2017-08-30 | 2022-05-03 | President And Fellows Of Harvard College | High efficiency base editors comprising Gam |
| JP2022525651A (en) * | 2019-03-19 | 2022-05-18 | シアトル チルドレンズ ホスピタル (ディービーエイ シアトル チルドレンズ リサーチ インスティテュート) | Methods and Compositions for Producing CD4 Deficient CAR T Cells and Anti-CD4 CAR T Cells and Their Use |
| JP2022538789A (en) * | 2019-06-14 | 2022-09-06 | アーバー バイオテクノロジーズ, インコーポレイテッド | Novel CRISPR DNA targeting enzymes and systems |
| US11447770B1 (en) | 2019-03-19 | 2022-09-20 | The Broad Institute, Inc. | Methods and compositions for prime editing nucleotide sequences |
| WO2022243540A1 (en) * | 2021-05-21 | 2022-11-24 | Aarhus Universitet | Lentivirus-derived nanoparticles comprising crispr/cas9 ribonucleoprotein complexes |
| EP4095246A1 (en) * | 2021-05-27 | 2022-11-30 | Max-Planck-Gesellschaft zur Förderung der Wissenschaften e.V. | Novel crispr grnas |
| US11542509B2 (en) | 2016-08-24 | 2023-01-03 | President And Fellows Of Harvard College | Incorporation of unnatural amino acids into proteins using base editing |
| US11542496B2 (en) | 2017-03-10 | 2023-01-03 | President And Fellows Of Harvard College | Cytosine to guanine base editor |
| US11560566B2 (en) | 2017-05-12 | 2023-01-24 | President And Fellows Of Harvard College | Aptazyme-embedded guide RNAs for use with CRISPR-Cas9 in genome editing and transcriptional activation |
| US11661590B2 (en) | 2016-08-09 | 2023-05-30 | President And Fellows Of Harvard College | Programmable CAS9-recombinase fusion proteins and uses thereof |
| US11732274B2 (en) | 2017-07-28 | 2023-08-22 | President And Fellows Of Harvard College | Methods and compositions for evolving base editors using phage-assisted continuous evolution (PACE) |
| US11795443B2 (en) | 2017-10-16 | 2023-10-24 | The Broad Institute, Inc. | Uses of adenosine base editors |
| US11866726B2 (en) | 2017-07-14 | 2024-01-09 | Editas Medicine, Inc. | Systems and methods for targeted integration and genome editing and detection thereof using integrated priming sites |
| US11898179B2 (en) | 2017-03-09 | 2024-02-13 | President And Fellows Of Harvard College | Suppression of pain by gene editing |
| US11912985B2 (en) | 2020-05-08 | 2024-02-27 | The Broad Institute, Inc. | Methods and compositions for simultaneous editing of both strands of a target double-stranded nucleotide sequence |
| WO2024231575A1 (en) * | 2023-05-11 | 2024-11-14 | Evox Therapeutics Limited | Improved crispr/cas guide rna (grna) |
| US12157760B2 (en) | 2018-05-23 | 2024-12-03 | The Broad Institute, Inc. | Base editors and uses thereof |
| WO2024227047A3 (en) * | 2023-04-28 | 2024-12-19 | Beam Therapeutics Inc. | Modified guide rna |
| US12281338B2 (en) | 2018-10-29 | 2025-04-22 | The Broad Institute, Inc. | Nucleobase editors comprising GeoCas9 and uses thereof |
| US12338436B2 (en) | 2018-06-29 | 2025-06-24 | Editas Medicine, Inc. | Synthetic guide molecules, compositions and methods relating thereto |
| US12351837B2 (en) | 2019-01-23 | 2025-07-08 | The Broad Institute, Inc. | Supernegatively charged proteins and uses thereof |
| US12390514B2 (en) | 2017-03-09 | 2025-08-19 | President And Fellows Of Harvard College | Cancer vaccine |
| US12390538B2 (en) | 2023-05-15 | 2025-08-19 | Nchroma Bio, Inc. | Compositions and methods for epigenetic regulation of HBV gene expression |
| US12406749B2 (en) | 2017-12-15 | 2025-09-02 | The Broad Institute, Inc. | Systems and methods for predicting repair outcomes in genetic engineering |
| US12435330B2 (en) | 2019-10-10 | 2025-10-07 | The Broad Institute, Inc. | Methods and compositions for prime editing RNA |
| US12473543B2 (en) | 2019-04-17 | 2025-11-18 | The Broad Institute, Inc. | Adenine base editors with reduced off-target effects |
| US12522807B2 (en) | 2018-07-09 | 2026-01-13 | The Broad Institute, Inc. | RNA programmable epigenetic RNA modifiers and uses thereof |
Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2013176772A1 (en) * | 2012-05-25 | 2013-11-28 | The Regents Of The University Of California | Methods and compositions for rna-directed target dna modification and for rna-directed modulation of transcription |
| WO2014093694A1 (en) * | 2012-12-12 | 2014-06-19 | The Broad Institute, Inc. | Crispr-cas nickase systems, methods and compositions for sequence manipulation in eukaryotes |
| WO2014093718A1 (en) * | 2012-12-12 | 2014-06-19 | The Broad Institute, Inc. | Methods, systems, and apparatus for identifying target sequences for cas enzymes or crispr-cas systems for target sequences and conveying results thereof |
| WO2014144592A2 (en) * | 2013-03-15 | 2014-09-18 | The General Hospital Corporation | Using truncated guide rnas (tru-grnas) to increase specificity for rna-guided genome editing |
| WO2014150624A1 (en) * | 2013-03-14 | 2014-09-25 | Caribou Biosciences, Inc. | Compositions and methods of nucleic acid-targeting nucleic acids |
| WO2015089473A1 (en) * | 2013-12-12 | 2015-06-18 | The Broad Institute Inc. | Engineering of systems, methods and optimized guide compositions with new architectures for sequence manipulation |
-
2016
- 2016-09-09 WO PCT/US2016/050989 patent/WO2017044776A1/en not_active Ceased
Patent Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2013176772A1 (en) * | 2012-05-25 | 2013-11-28 | The Regents Of The University Of California | Methods and compositions for rna-directed target dna modification and for rna-directed modulation of transcription |
| WO2014093694A1 (en) * | 2012-12-12 | 2014-06-19 | The Broad Institute, Inc. | Crispr-cas nickase systems, methods and compositions for sequence manipulation in eukaryotes |
| WO2014093718A1 (en) * | 2012-12-12 | 2014-06-19 | The Broad Institute, Inc. | Methods, systems, and apparatus for identifying target sequences for cas enzymes or crispr-cas systems for target sequences and conveying results thereof |
| WO2014150624A1 (en) * | 2013-03-14 | 2014-09-25 | Caribou Biosciences, Inc. | Compositions and methods of nucleic acid-targeting nucleic acids |
| WO2014144592A2 (en) * | 2013-03-15 | 2014-09-18 | The General Hospital Corporation | Using truncated guide rnas (tru-grnas) to increase specificity for rna-guided genome editing |
| WO2015089473A1 (en) * | 2013-12-12 | 2015-06-18 | The Broad Institute Inc. | Engineering of systems, methods and optimized guide compositions with new architectures for sequence manipulation |
Non-Patent Citations (2)
| Title |
|---|
| CHEN, B. ET AL.: "Dynamic Imaging of Genomic Loci in Living Human Cells by an Optimized CRISPR/Cas System", CELL, vol. 155, 2013, pages 1479 - 1491, XP028806611 * |
| DANG, Y. ET AL.: "Optimizing sgRNA structure to improve CRISPR-Cas9 knockout efficiency", GENOME BIOLOGY, vol. 16, no. 280, 2015, pages 1 - 10, XP055369116 * |
Cited By (86)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US10323236B2 (en) | 2011-07-22 | 2019-06-18 | President And Fellows Of Harvard College | Evaluation and improvement of nuclease cleavage specificity |
| US12006520B2 (en) | 2011-07-22 | 2024-06-11 | President And Fellows Of Harvard College | Evaluation and improvement of nuclease cleavage specificity |
| US11920181B2 (en) | 2013-08-09 | 2024-03-05 | President And Fellows Of Harvard College | Nuclease profiling system |
| US10954548B2 (en) | 2013-08-09 | 2021-03-23 | President And Fellows Of Harvard College | Nuclease profiling system |
| US10508298B2 (en) | 2013-08-09 | 2019-12-17 | President And Fellows Of Harvard College | Methods for identifying a target site of a CAS9 nuclease |
| US11046948B2 (en) | 2013-08-22 | 2021-06-29 | President And Fellows Of Harvard College | Engineered transcription activator-like effector (TALE) domains and uses thereof |
| US12473573B2 (en) | 2013-09-06 | 2025-11-18 | President And Fellows Of Harvard College | Switchable Cas9 nucleases and uses thereof |
| US12559737B2 (en) | 2013-09-06 | 2026-02-24 | President And Fellows Of Harvard College | Cas9 variants and uses thereof |
| US10597679B2 (en) | 2013-09-06 | 2020-03-24 | President And Fellows Of Harvard College | Switchable Cas9 nucleases and uses thereof |
| US10682410B2 (en) | 2013-09-06 | 2020-06-16 | President And Fellows Of Harvard College | Delivery system for functional nucleases |
| US12584118B2 (en) | 2013-09-06 | 2026-03-24 | President And Fellows Of Harvard College | Cas9 variants and uses thereof |
| US9999671B2 (en) | 2013-09-06 | 2018-06-19 | President And Fellows Of Harvard College | Delivery of negatively charged proteins using cationic lipids |
| US10858639B2 (en) | 2013-09-06 | 2020-12-08 | President And Fellows Of Harvard College | CAS9 variants and uses thereof |
| US11299755B2 (en) | 2013-09-06 | 2022-04-12 | President And Fellows Of Harvard College | Switchable CAS9 nucleases and uses thereof |
| US10912833B2 (en) | 2013-09-06 | 2021-02-09 | President And Fellows Of Harvard College | Delivery of negatively charged proteins using cationic lipids |
| US11124782B2 (en) | 2013-12-12 | 2021-09-21 | President And Fellows Of Harvard College | Cas variants for gene editing |
| US10465176B2 (en) | 2013-12-12 | 2019-11-05 | President And Fellows Of Harvard College | Cas variants for gene editing |
| US11053481B2 (en) | 2013-12-12 | 2021-07-06 | President And Fellows Of Harvard College | Fusions of Cas9 domains and nucleic acid-editing domains |
| US12215365B2 (en) | 2013-12-12 | 2025-02-04 | President And Fellows Of Harvard College | Cas variants for gene editing |
| US12398406B2 (en) | 2014-07-30 | 2025-08-26 | President And Fellows Of Harvard College | CAS9 proteins including ligand-dependent inteins |
| US10077453B2 (en) | 2014-07-30 | 2018-09-18 | President And Fellows Of Harvard College | CAS9 proteins including ligand-dependent inteins |
| US11578343B2 (en) | 2014-07-30 | 2023-02-14 | President And Fellows Of Harvard College | CAS9 proteins including ligand-dependent inteins |
| US10704062B2 (en) | 2014-07-30 | 2020-07-07 | President And Fellows Of Harvard College | CAS9 proteins including ligand-dependent inteins |
| US10167457B2 (en) | 2015-10-23 | 2019-01-01 | President And Fellows Of Harvard College | Nucleobase editors and uses thereof |
| US11214780B2 (en) | 2015-10-23 | 2022-01-04 | President And Fellows Of Harvard College | Nucleobase editors and uses thereof |
| US12043852B2 (en) | 2015-10-23 | 2024-07-23 | President And Fellows Of Harvard College | Evolved Cas9 proteins for gene editing |
| US12344869B2 (en) | 2015-10-23 | 2025-07-01 | President And Fellows Of Harvard College | Nucleobase editors and uses thereof |
| US10113163B2 (en) | 2016-08-03 | 2018-10-30 | President And Fellows Of Harvard College | Adenosine nucleobase editors and uses thereof |
| US11999947B2 (en) | 2016-08-03 | 2024-06-04 | President And Fellows Of Harvard College | Adenosine nucleobase editors and uses thereof |
| US10947530B2 (en) | 2016-08-03 | 2021-03-16 | President And Fellows Of Harvard College | Adenosine nucleobase editors and uses thereof |
| US11702651B2 (en) | 2016-08-03 | 2023-07-18 | President And Fellows Of Harvard College | Adenosine nucleobase editors and uses thereof |
| US11661590B2 (en) | 2016-08-09 | 2023-05-30 | President And Fellows Of Harvard College | Programmable CAS9-recombinase fusion proteins and uses thereof |
| US11542509B2 (en) | 2016-08-24 | 2023-01-03 | President And Fellows Of Harvard College | Incorporation of unnatural amino acids into proteins using base editing |
| US12084663B2 (en) | 2016-08-24 | 2024-09-10 | President And Fellows Of Harvard College | Incorporation of unnatural amino acids into proteins using base editing |
| US11306324B2 (en) | 2016-10-14 | 2022-04-19 | President And Fellows Of Harvard College | AAV delivery of nucleobase editors |
| US11820969B2 (en) | 2016-12-23 | 2023-11-21 | President And Fellows Of Harvard College | Editing of CCR2 receptor gene to protect against HIV infection |
| US10745677B2 (en) | 2016-12-23 | 2020-08-18 | President And Fellows Of Harvard College | Editing of CCR5 receptor gene to protect against HIV infection |
| US12390514B2 (en) | 2017-03-09 | 2025-08-19 | President And Fellows Of Harvard College | Cancer vaccine |
| US12516308B2 (en) | 2017-03-09 | 2026-01-06 | President And Fellows Of Harvard College | Suppression of pain by gene editing |
| US11898179B2 (en) | 2017-03-09 | 2024-02-13 | President And Fellows Of Harvard College | Suppression of pain by gene editing |
| US11542496B2 (en) | 2017-03-10 | 2023-01-03 | President And Fellows Of Harvard College | Cytosine to guanine base editor |
| US12435331B2 (en) | 2017-03-10 | 2025-10-07 | President And Fellows Of Harvard College | Cytosine to guanine base editor |
| US11268082B2 (en) | 2017-03-23 | 2022-03-08 | President And Fellows Of Harvard College | Nucleobase editors comprising nucleic acid programmable DNA binding proteins |
| US20200131539A1 (en) * | 2017-04-21 | 2020-04-30 | The Board Of Trustees Of The Leland Stanford Junior University | Crispr/cas 9-mediated integration of polynucleotides by sequential homologous recombination of aav donor vectors |
| US11773409B2 (en) | 2017-04-21 | 2023-10-03 | The Board Of Trustees Of The Leland Stanford Junior University | CRISPR/Cas 9-mediated integration of polynucleotides by sequential homologous recombination of AAV donor vectors |
| WO2018195555A1 (en) * | 2017-04-21 | 2018-10-25 | The Board Of Trustees Of The Leland Stanford Junior University | Crispr/cas 9-mediated integration of polynucleotides by sequential homologous recombination of aav donor vectors |
| US11560566B2 (en) | 2017-05-12 | 2023-01-24 | President And Fellows Of Harvard College | Aptazyme-embedded guide RNAs for use with CRISPR-Cas9 in genome editing and transcriptional activation |
| EP3630975A4 (en) * | 2017-05-26 | 2021-03-10 | North Carolina State University | RNA GUIDES MODIFIED TO MODULATE CAS9 ACTIVITY AND USAGE PROCEDURES |
| US11866726B2 (en) | 2017-07-14 | 2024-01-09 | Editas Medicine, Inc. | Systems and methods for targeted integration and genome editing and detection thereof using integrated priming sites |
| EP3640333A4 (en) * | 2017-07-14 | 2020-12-30 | Cure Genetics Co., Ltd | EDITING SYSTEM AND PROCEDURE |
| US12359218B2 (en) | 2017-07-28 | 2025-07-15 | President And Fellows Of Harvard College | Methods and compositions for evolving base editors using phage-assisted continuous evolution (PACE) |
| US11732274B2 (en) | 2017-07-28 | 2023-08-22 | President And Fellows Of Harvard College | Methods and compositions for evolving base editors using phage-assisted continuous evolution (PACE) |
| US11932884B2 (en) | 2017-08-30 | 2024-03-19 | President And Fellows Of Harvard College | High efficiency base editors comprising Gam |
| US11319532B2 (en) | 2017-08-30 | 2022-05-03 | President And Fellows Of Harvard College | High efficiency base editors comprising Gam |
| US11795443B2 (en) | 2017-10-16 | 2023-10-24 | The Broad Institute, Inc. | Uses of adenosine base editors |
| WO2019087113A1 (en) * | 2017-11-01 | 2019-05-09 | Novartis Ag | Synthetic rnas and methods of use |
| US12406749B2 (en) | 2017-12-15 | 2025-09-02 | The Broad Institute, Inc. | Systems and methods for predicting repair outcomes in genetic engineering |
| US20210017518A1 (en) * | 2017-12-19 | 2021-01-21 | City Of Hope | Modified tracrrnas grnas, and uses thereof |
| US11939575B2 (en) * | 2017-12-19 | 2024-03-26 | City Of Hope | Modified tracrRNAs gRNAs, and uses thereof |
| US12157760B2 (en) | 2018-05-23 | 2024-12-03 | The Broad Institute, Inc. | Base editors and uses thereof |
| US12338436B2 (en) | 2018-06-29 | 2025-06-24 | Editas Medicine, Inc. | Synthetic guide molecules, compositions and methods relating thereto |
| US12522807B2 (en) | 2018-07-09 | 2026-01-13 | The Broad Institute, Inc. | RNA programmable epigenetic RNA modifiers and uses thereof |
| US12281338B2 (en) | 2018-10-29 | 2025-04-22 | The Broad Institute, Inc. | Nucleobase editors comprising GeoCas9 and uses thereof |
| US12351837B2 (en) | 2019-01-23 | 2025-07-08 | The Broad Institute, Inc. | Supernegatively charged proteins and uses thereof |
| US12281303B2 (en) | 2019-03-19 | 2025-04-22 | The Broad Institute, Inc. | Methods and compositions for prime editing nucleotide sequences |
| US12509680B2 (en) | 2019-03-19 | 2025-12-30 | The Broad Institute, Inc. | Methods and compositions for prime editing nucleotide sequences |
| US11447770B1 (en) | 2019-03-19 | 2022-09-20 | The Broad Institute, Inc. | Methods and compositions for prime editing nucleotide sequences |
| EP3941486A4 (en) * | 2019-03-19 | 2024-01-10 | Seattle Children's Hospital (DBA Seattle Children's Research Institute) | METHODS AND COMPOSITIONS FOR MANIPULATING CD4 DEFICIENCY CAR T CELLS AND ANTI-CD4 CAR T CELLS AND USES THEREOF |
| US12570972B2 (en) | 2019-03-19 | 2026-03-10 | The Broad Institute, Inc. | Methods and compositions for prime editing nucleotide sequences |
| US11643652B2 (en) | 2019-03-19 | 2023-05-09 | The Broad Institute, Inc. | Methods and compositions for prime editing nucleotide sequences |
| US11795452B2 (en) | 2019-03-19 | 2023-10-24 | The Broad Institute, Inc. | Methods and compositions for prime editing nucleotide sequences |
| JP2022525651A (en) * | 2019-03-19 | 2022-05-18 | シアトル チルドレンズ ホスピタル (ディービーエイ シアトル チルドレンズ リサーチ インスティテュート) | Methods and Compositions for Producing CD4 Deficient CAR T Cells and Anti-CD4 CAR T Cells and Their Use |
| US12473543B2 (en) | 2019-04-17 | 2025-11-18 | The Broad Institute, Inc. | Adenine base editors with reduced off-target effects |
| CN110241117A (en) * | 2019-06-13 | 2019-09-17 | 西安交通大学 | A kind of high activity sgRNA skeleton, sgRNA skeleton carrier and its application of double alkali yl mutation |
| EP3983536A4 (en) * | 2019-06-14 | 2023-11-29 | Arbor Biotechnologies, Inc. | Novel crispr dna targeting enzymes and systems |
| JP2022538789A (en) * | 2019-06-14 | 2022-09-06 | アーバー バイオテクノロジーズ, インコーポレイテッド | Novel CRISPR DNA targeting enzymes and systems |
| US12435330B2 (en) | 2019-10-10 | 2025-10-07 | The Broad Institute, Inc. | Methods and compositions for prime editing RNA |
| US12031126B2 (en) | 2020-05-08 | 2024-07-09 | The Broad Institute, Inc. | Methods and compositions for simultaneous editing of both strands of a target double-stranded nucleotide sequence |
| US11912985B2 (en) | 2020-05-08 | 2024-02-27 | The Broad Institute, Inc. | Methods and compositions for simultaneous editing of both strands of a target double-stranded nucleotide sequence |
| WO2021263179A1 (en) * | 2020-06-26 | 2021-12-30 | The Board Of Trustees Of The Leland Stanford Junior University | Targeting the human ccr5 locus as a safe harbor for the expression of therapeutic proteins |
| WO2022243540A1 (en) * | 2021-05-21 | 2022-11-24 | Aarhus Universitet | Lentivirus-derived nanoparticles comprising crispr/cas9 ribonucleoprotein complexes |
| EP4095246A1 (en) * | 2021-05-27 | 2022-11-30 | Max-Planck-Gesellschaft zur Förderung der Wissenschaften e.V. | Novel crispr grnas |
| WO2022248454A1 (en) * | 2021-05-27 | 2022-12-01 | MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V. | Novel crispr grnas |
| WO2024227047A3 (en) * | 2023-04-28 | 2024-12-19 | Beam Therapeutics Inc. | Modified guide rna |
| WO2024231575A1 (en) * | 2023-05-11 | 2024-11-14 | Evox Therapeutics Limited | Improved crispr/cas guide rna (grna) |
| US12390538B2 (en) | 2023-05-15 | 2025-08-19 | Nchroma Bio, Inc. | Compositions and methods for epigenetic regulation of HBV gene expression |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| WO2017044776A1 (en) | Single-guide rna (sgrna) with improved knockout efficiency | |
| Dang et al. | Optimizing sgRNA structure to improve CRISPR-Cas9 knockout efficiency | |
| JP7698828B2 (en) | Methods and compositions for editing RNA | |
| CN104805099B (en) | A kind of nucleic acid molecules and its expression vector of safe coding Cas9 albumen | |
| US20200140887A1 (en) | Viral Delivery of RNA Utilizing Self-Cleaving Ribozymes and CRISPR-Based Applications Thereof | |
| TW202144576A (en) | Novel cho integration sites and uses thereof | |
| WO2019213257A1 (en) | Lentiviral-based vectors and related systems and methods for eukaryotic gene editing | |
| EP3526322A1 (en) | Self-limiting cas9 circuitry for enhanced safety (slices) plasmid and lentiviral system thereof | |
| AU2019281034B2 (en) | Method for generating a gene editing vector with fixed guide RNA pairs | |
| Zhang et al. | Comprehensive off-target analysis of dCas9-SAM-mediated HIV reactivation via long noncoding RNA and mRNA profiling | |
| CN111613272A (en) | Programmable framework gRNA and its application | |
| CN116732099B (en) | Stem cell multiple CRISPR/Cas genome editing method | |
| CN104928292A (en) | Design method of sgRNA and lentivirus carrier formed by sgRNA and plasmids | |
| CN114364799A (en) | Method for editing BCL11A gene in hematopoietic stem/progenitor cells | |
| CN104152414B (en) | The method that genetic modification is carried out to the predetermined site of cellular genome | |
| AU2021200542B2 (en) | Sgrna for editing sheep fgf5 to realize alternative splicing, complete set of nucleic acids and use | |
| KR20240155953A (en) | Compositions, systems and methods for eukaryotic gene editing | |
| Li et al. | Establishing a dual knock-out cell line by lentivirus based combined CRISPR/Cas9 and Loxp/Cre system | |
| CN111004800B (en) | CRISPR/Cas9 system targeting HPV subtype 16/18 oncogene E6/E7 | |
| Sowińska et al. | Potential limitations of the" Sleeping Beauty" transposon use in gene expression studies | |
| US20240287506A1 (en) | Library construction method based on long overhang sequence ligation | |
| CN121022826A (en) | A highly active promoter sequence SL26 and its application in gene editing systems | |
| WO2025049877A1 (en) | Chemo-sensitive dominant clone for adaptive therapy | |
| US9890392B2 (en) | Method for preparing specific cells of human-derived cells | |
| HK40030035B (en) | A programmable scaffold grna and use thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 16845139 Country of ref document: EP Kind code of ref document: A1 |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 16845139 Country of ref document: EP Kind code of ref document: A1 |