WO2017040829A1 - Riborégulateurs régulés par des stimuli externes et leurs procédés d'utilisation - Google Patents

Riborégulateurs régulés par des stimuli externes et leurs procédés d'utilisation Download PDF

Info

Publication number
WO2017040829A1
WO2017040829A1 PCT/US2016/049963 US2016049963W WO2017040829A1 WO 2017040829 A1 WO2017040829 A1 WO 2017040829A1 US 2016049963 W US2016049963 W US 2016049963W WO 2017040829 A1 WO2017040829 A1 WO 2017040829A1
Authority
WO
WIPO (PCT)
Prior art keywords
rna
switch
trigger
domain
expression
Prior art date
Application number
PCT/US2016/049963
Other languages
English (en)
Inventor
Peng Yin
Jongmin Kim
Original Assignee
President And Fellows Of Harvard College
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by President And Fellows Of Harvard College filed Critical President And Fellows Of Harvard College
Publication of WO2017040829A1 publication Critical patent/WO2017040829A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/02—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving viable microorganisms
    • C12Q1/025—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving viable microorganisms for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/12—Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/67—General methods for enhancing the expression
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/34—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving hydrolase
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/34—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving hydrolase
    • C12Q1/40—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving hydrolase involving amylase
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
    • G01N33/5008—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
    • G01N33/502—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics for testing non-proliferative effects
    • G01N33/5023—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics for testing non-proliferative effects on expression patterns

Definitions

  • Riboregulators are sequences of RNA that effect changes in cells in response to a nucleic acid sequence. These RNA-based devices, which typically regulate protein translation or trigger mRNA degradation, have been used for a number of applications in synthetic biology, including sensitive control over gene expression, shunting of metabolic flux through different metabolic pathways, and synthetic control over cell death.
  • riboregulators that control protein expression, repression of protein translation has relied on sequestration of the normally single-stranded ribosome binding site (RBS) within a duplex RNA region that is upstream of a gene of interest (GOI).
  • RBS normally single-stranded ribosome binding site
  • crRNA cis-repressed RNA
  • a riboregulator based on an engineered crRNA can be constructed in which a trans-activating RNA (taRNA) binds to the crRNA and unwinds the repressing RNA duplex thereby exposing a now single- stranded RBS and activating translation of the downstream gene.
  • taRNA trans-activating RNA
  • riboregulators that decrease expression of the GOI, the RBS and initiation codon of the GOI are both exposed in the absence of the trigger RNA.
  • a trans-repressing RNA trRNA
  • trRNA trans-repressing RNA
  • the invention provides toehold riboregulator systems that are induced by the presence of one or more external stimuli such as light, temperature, water or moisture, pH, and small molecules, among other things. These systems can be used to produce a particular protein of interest as a readout for the presence of the external stimulus (and thus act as a reporter
  • a system comprising a host cell comprising an expression construct that encodes a switch RNA and one or more expression constructs that encode a trigger RNA, wherein a switch RNA comprises (i) a single-stranded toehold domain, (ii) a fully or partially double-stranded stem domain comprising an initiation codon, (iii) a loop domain comprising a ribosome binding site, and (iv) a coding domain, wherein the one or more trigger RNA(s) alone or combined hybridize to the single-stranded toehold domain of a switch RNA, and wherein expression of the switch RNA and the trigger RNA is induced in the presence of one or more external stimulus, or in the presence of one or more external stimuli and absence of one or more external stimuli, or in a combination of presence and absence of two or more external stimuli.
  • Also provided herein is a method of inducing translation of a protein by an external stimulus, comprising (1) providing a host cell comprising an expression construct that encodes a switch RNA and one or more expression constructs that encode a trigger RNA, wherein a switch RNA comprises (i) a single-stranded toehold domain, (ii) a fully or partially double-stranded stem domain comprising an initiation codon, (iii) a loop domain comprising a ribosome binding site, and (iv) a coding domain, wherein the one or more trigger RNA(s) alone or combined hybridize to the single-stranded toehold domain of a switch RNA, and wherein expression of the switch RNA and the trigger RNA is induced in the presence of one or more external stimulus, or in the presence of one or more external stimuli and absence of one or more external stimuli, or in a combination of presence and absence of two or more external stimuli, and (2) inducing translation of the coding domain by the presence of the external stimulus
  • the coding domain encodes an enzyme or an enzyme cofactor. In certain embodiments, the coding domain encodes a reporter protein.
  • the external stimulus is light, heat, water or moisture, pH, or one or more small molecules.
  • the host cell is provided in a housing.
  • the host cell is provided in a housing and the coding domain encodes an enzyme that degrades the housing.
  • the housing consists of paper, starch, cellulose and/or a hydrogel.
  • the enzyme is a cellulose, an amylase, a proteases, a peptidase, a beta-glucosidase, an exoglucanase, or an endoglucanase.
  • the expression constructs comprise inducible promoters selected from the group consisting of cl-ts857, cspA, cadA, Lacl, TetR and AraC sensitive promoters, as well as any of the promoters provided in Table 1.
  • FIG. 1 depicts a schematic of the toehold switches for environmental sensors. Simple promoter swapping for switch and trigger RNAs allows for different environmental sensors. For example, cl-ts857 and cspA are temperature sensors, cadA is a pH sensor, and Lacl, TetR, and AraC are specific small molecule sensors.
  • FIG. 2 depicts simple heat sensors.
  • FIG. 3 depicts a heat sensor with toehold switches.
  • FIG. 4 shows a heat sensor with toehold switches with built-in redundant control using multiple AND gate triggers.
  • FIG. 5 depicts the reduction of false positives using toehold switches.
  • FIG. 6 shows complex evaluation of environmental inputs.
  • FIG. 7A and 7B provide flow cytometry data obtained using a temperature-controlled toehold switch system.
  • FIG. 7A provides histograms of GFP fluorescence for a temperature- controlled toehold switch/trigger system at different temperatures compared to negative and positive controls. Negative controls are constructs lacking GFP and positive controls are constructs that constitutively express GFP.
  • the temperature-controlled toehold switches and triggers were both controlled by the thermo-labile lambda repressor, and these show temperature responsiveness as the temperature is increased from 30 °C to 37°C. In FIG.
  • FIG. 7A provides a plot of GFP mode fluorescence levels from the same data set as FIG. 7A.
  • compositions controlled by environmental stimuli and methods of using such compositions to detect or exploit such environmental stimuli.
  • the compositions are referred to collectively as riboregulators. They are nucleic acid based genetic systems that comprise a two or more RNA molecules, at least one of which encodes a protein (and is referred to herein as a "switch") and at least one of which is a trigger that hybridizes to the switch thereby activating it and causing translation of the encoded protein.
  • the switches comprise a regulatory region and a coding region.
  • the regulatory region typically comprises a hairpin structure that prevents translation of the coding sequence.
  • the hairpin structure comprising a stem and loop structure, and also optionally a single-stranded "bubble" within the stem structure.
  • a ribosome binding sequence (RBS) is typically located in the loop structure, and a start codon AUG is typically located in the bubble structure, as illustrated in FIG. 1.
  • the coding sequence begins at the AUG although typically the majority of this sequence is downstream of the stem structure.
  • the "coding region”, as used herein, refers to the coding sequence downstream of the stem structure.
  • the switch typically also comprises a single stranded region referred to as a toehold domain or sequence (referred to herein as a "toehold").
  • the toehold may be present at the single-stranded loop or the single- stranded bubble, or at another location. In the exemplary switch illustrated in FIG. l, the toehold is located upstream of the stem structure and denoted "a".
  • the toehold as its name implies, is the entry point for system triggers to bind to the switch and cause the unwinding of the hairpin, thereby allowing binding of the ribosome to the RBS and subsequent translation of the coding sequence.
  • the toehold sequence is therefore complementary to a sequence in the trigger (or a combination or complex of triggers, as discussed below).
  • the trigger or combination or complex of triggers
  • toehold switches comprising such toehold sequences are referred to herein as "toehold switches”.
  • a toehold domain of at least 5 or 6 nts in length is preferable for initial binding of the trigger.
  • the toehold domain can therefore be 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more nucleotides in length.
  • the trigger need only unwind two-thirds of the stem in order to allow translation of the downstream protein.
  • the stem domain may be as small as 12 bps for adequate repression in the switch.
  • the stem domain may however be longer than 12 bps, including 13, 14, 15, 16, 17, 18, 19, 20, or more base pairs in length.
  • the length of the loop domain may be 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more nucleotides.
  • the switches may have additional features.
  • the top three bases of the hairpin stem may be A-U base pairs.
  • the bottom three base pairs of the stem may comprise two strong G-C base pairs and one A-U base pair.
  • the length of the toehold may range from about 12- to about 15-nts. This latter feature may in some instances strengthen the initial binding between a trigger RNA and its switch RNA.
  • the size of the hairpin loop may range from about 11- to about 15-nts to enhance translation of the output protein upon switch activation. In some instances, the loop size is 15-nts.
  • a cognate trigger may be used that unwinds the first 15 of the 18 bases in the switch stem. In some instances, one or more, including all, of these features may be used simultaneously.
  • Opening of the switch in order to activate translation of the coding sequence may require the presence of a single trigger, or if may require the presence of two or more triggers.
  • the switch is opened in the presence of any one of a number of triggers.
  • the system may be referred to as having an "OR gate” intending that the opening (de-repression) of the switch requires the presence of any one of a number of triggers (e.g., trigger A or trigger B).
  • the switch is opened in the presence of two or more triggers.
  • the system may be referred to as having an "AND gate” intending that the opening of the switch requires the presence of two triggers (e.g., trigger A and trigger B).
  • the AND gate is illustrated in FIG. 4.
  • the two or more triggers combine with each other such as for example via hybridization to form a composite sequence that is able to open the switch.
  • trigger 1 and trigger 2 complex with each other to generate a structure having single stranded region "c*" adjacent to single stranded region "b*", and this "composite" sequence is complementary to the toehold sequence "c" and its adjacent sequence "b". As illustrated, it is only in the presence of both triggers 1 and 2 that the switch can be opened.
  • the switch is opened in the presence of one trigger but not in the presence of another trigger, wherein the latter trigger may be regarded as a deactivating trigger.
  • the system may be referred to as having an "ANDNOT gate" intending that the opening of the switch requires the presence of one trigger and the absence of another trigger (e.g., trigger A and not (deactivating) trigger B).
  • the second "deactivating" trigger may be designed to hybridize to the first trigger, thereby interfering with its ability to bind to and unwind the switch.
  • activation of the switch requires that the first trigger be expressed but not the second trigger. In that case, activation occurs if the first stimulus is present and if the second stimulus is absent. It will be clear that the stimuli that induce expression of the first and second stimuli should be different.
  • the invention contemplates that the various components of a riboregulator system, namely the switch and the trigger(s), are provided as expression constructs and that the transcription from such constructs is regulated by external stimuli such as environmental stimuli.
  • external stimuli such as environmental stimuli.
  • Such stimuli include but are not limited to temperature (e.g., heat or cold), pH, water or humidity, small molecules, and the like. A list of such stimuli is provided herein.
  • Transcriptional control of these expression constructs can occur through the use of a promoter system that is responsive to the external stimulus.
  • a promoter system may, for example, be bound by a repressive element such as a repressor in one condition and then not bound by the repressive element under another condition.
  • the condition may act on the repressive element, and may for example degrade or initiate the degradation of the repressive element, or it may cause the dissociation of the repressive element from the promoter, for example.
  • An example of such a promoter is shown in FIG. 2, albeit in the simple form of a promoter and generic output gene.
  • the Figure illustrates the use of a cl-ts857 promoter system in which the repressor binds to the promoter and represses transcription of the output gene under cold temperature conditions. Even under such repression, some leakage from the locus is still observed. When the temperature is increased, the repressor is degraded and the output gene is transcribed. Temperature cut-offs are shown in Table 1.
  • the invention contemplates a system comprising an expression construct that comprises the switch DNA, and one or more expression constructs that each comprise a trigger DNA.
  • the transcription of the switch DNA to form the switch (which is RNA in nature) and transcription of each of the triggers (which also are RNA in nature) may be regulated by the same stimulus.
  • FIG. 3 provides the expression constructs for the switch and the two triggers of an AND gate (trigger 1 and trigger 2).
  • both triggers must be present in order to activate (in this case, de-repress) the switch.
  • the system will be better suited to reduce false positives. This is represented in FIG. 5, where it is shown that using a heat- sensitive promoter system, the concentration of switch RNA and trigger RNA is low under cold temperature conditions, thereby resulting in low leakage from the system.
  • FIGs. 7A and 7B provide additional data demonstrating the efficacy of a
  • thermocontroller comprising a toehold switch and a trigger which are both under temperature control.
  • the reporter protein encoded by the toehold switch is produced in a temperature-dependent manner.
  • FIG. 6 further illustrates a system in which components of the system, including the trigger(s), are designed to each respond to a different stimulus.
  • the system may be an OR gate in which any one of a number of triggers must be present to de-repress the switch.
  • each of the triggers may itself by regulated by a different stimulus.
  • the system may comprise a switch DNA that is transcribed in the presence of water or moisture, a first trigger that is transcribed in the presence of heat, and a second trigger that is transcribed in the presence of a particular small molecule.
  • these triggers and switch may be designed to be an AND gate, in which case the switch would be activated only if the external stimuli of water/moisture, heat and the small molecule were present.
  • the output genes in the switches of the invention may be any variety of proteins. Of particular interest are enzymes or enzyme co-factors.
  • the invention contemplates that the systems can then be used to induce production of an enzyme only under certain external conditions. Thus, the resultant enzymatic activity is itself induced only under certain external conditions.
  • enzymes include cellulose or other paper-digesting enzyme, amylase or other starch-digesting enzyme, beta-glucosidases, exoglucanases, endoglucanases, proteases or peptidases that digest particular amino acid sequences, and the like.
  • the protein may be a reporter protein such as GFP. In this latter instance, the reporter protein is used as an indicator of a particular condition.
  • the various riboregulator components can be introduced into various cells including for example bacterial cells and may be integrated into the genome of such cells.
  • the switch and triggers may be comprised of RNA in whole or in part. They may comprise naturally occurring nucleotides and/or non-naturally occurring nucleotides.
  • the expression constructs that encode the switches and triggers may be comprised of DNA in whole or in part. They may comprise naturally occurring nucleotides and/or non- naturally occurring nucleotides.
  • a system comprising a host cell having, integrated or encoded into its genome, one or more riboregulator systems, each riboregulator system comprising (1) a switch RNA comprising (i) a single-stranded toehold domain, (ii) a fully or partially double- stranded stem domain comprising an initiation codon (AUG), (iii) a loop domain comprising a ribosome binding site (RBS), and (iv) a coding domain, and (2) one or more trigger RNA.
  • the host cell may comprise expression constructs encoding the switch RNA and the trigger RNA(s) and such expression constructs may all comprise inducible promoters that respond to the same or different external stimulus.
  • an external stimulus is a stimulus that is applied to or that comes in contact with the promoter of the expression constructs and/or the cell in which such constructs exist.
  • the external stimuli is typically not a stimulus that arises sua sponte in the cell without external interference.
  • it is a stimulus that originates outside the cell, such as an environmental stimulus (e.g., light, heat, pH, water or moisture, etc.).
  • the stimulus will be present or exist within the cell but its genesis will be external. Examples of promoters that are induced by external stimuli and known in the art and include those provided in Table 1.
  • the host cell may be a prokaryotic cell such as but not limited to a bacterial cell.
  • the host cell is an E. coli bacterium.
  • the invention contemplates that the components within a single riboregulator system may each be induced by a different external stimulus.
  • the invention also contemplates that the components within a single riboregulator system may each be induced by the same external stimulus.
  • the invention generally provides nucleic acids, constructs, plasmids, host cells and methods for regulation of protein expression using external stimuli.
  • nucleic acids of the invention may be referred to herein as non-naturally occurring, artificial, engineered or synthetic.
  • a non-naturally occurring, artificial, engineered or synthetic nucleic acid may be similar in sequence to a naturally occurring nucleic acid but may contain at least one artificially created insertion, deletion, inversion, or substitution relative to the sequence found in its naturally occurring counterpart.
  • a cell that contains an engineered nucleic acid may be referred to as an engineered cell. Cells into which riboregulator expression constructs are introduced are considered engineered cells, and such cells are not naturally occurring.
  • sequences that are complementary to each other.
  • the sequences are preferably fully complementary (i.e., 100% complementary). In other instances, however the sequences are only partially complementary.
  • Partially complementary sequences may be at least 60%, at least 70%, at least 80%, at least 90%, or at least 95% complementary.
  • Sequences that are only partially complementary, when hybridized to each other will comprise double- stranded regions and single- stranded regions.
  • the single-stranded regions may be single mismatches, loops (where for instances a series of consecutive nucleotides on one strand are
  • complementarity may be determined with respect to the entire length of the two sequences or with respect to portions of the sequences. Nucleic acids and/or other moieties of the invention may be isolated. As used herein,
  • isolated means separate from at least some of the components with which it is usually associated whether it be from a naturally occurring source or made synthetically.
  • Nucleic acids and/or other moieties of the invention may be purified. As used herein, purified means separated from the majority of other compounds or entities. A compound or moiety may be partially purified or substantially purified. Purity may be denoted by a weight by weight measure and may be determined using a variety of analytical techniques such as but not limited to mass spectrometry, HPLC, etc.
  • Nucleic acids generally refer to polymers comprising nucleotides or nucleotide analogs joined together through backbone linkages such as but not limited to phosphodiester bonds. Nucleic acids include deoxyribonucleic acids (DNA) and ribonucleic acids (RNA) such as messenger RNA (mRNA), transfer RNA (tRNA), etc. Nucleic acids may be single- stranded, double-stranded, and also tripled- stranded.
  • a naturally occurring nucleotide consists of a nucleoside, i.e., a nitrogenous base linked to a pentose sugar, and one or more phosphate groups which is usually esterified at the hydroxyl group attached to C-5 of the pentose sugar (indicated as 5') of the nucleoside.
  • Such compounds are called nucleoside 5'-phosphates or 5'-nucleotides.
  • the pentose sugar is deoxyribose
  • RNA the pentose sugar is ribose.
  • the nitrogenous base can be a purine such as adenine or guanine (found in DNA and RNA), or a pyrimidine such as cytosine (found in DNA and RNA), thymine (found in DNA) or uracil (found in RNA).
  • a purine such as adenine or guanine (found in DNA and RNA)
  • a pyrimidine such as cytosine (found in DNA and RNA), thymine (found in DNA) or uracil (found in RNA).
  • dATP deoxyadenosine 5'-triphosphate
  • dGTP deoxyguanosine 5'-triphosphate
  • dCTP deoxycytidine 5'-triphosphate
  • dTTP deoxythymidine 5'- triphosphate
  • RNA The major nucleotides of RNA are adenosine 5'-triphosphate (ATP), guanosine 5'-triphosphate (GTP), cytidine 5'-triphosphate (CTP) and uridine 5'-triphosphate (UTP).
  • ATP adenosine 5'-triphosphate
  • GTP guanosine 5'-triphosphate
  • CTP cytidine 5'-triphosphate
  • UDP uridine 5'-triphosphate
  • stable base pairing interactions occur between adenine and thymine (AT), adenine and uracil (AU), and guanine and cytosine (GC).
  • AT adenine and thymidine
  • adenine and uracil, and guanine and cytosine are referred to as being complementary to each other.
  • nucleic acid In general, one end of a nucleic acid has a 5 '-hydroxyl group and the other end of the nucleic acid has a 3 '-hydroxyl group. As a result, the nucleic acid has polarity.
  • the position or location of a sequence or moiety or domain in a nucleic acid may be denoted as being upstream or 5' of a particular marker, intending that it is between the marker and the 5' end of the nucleic acid.
  • the position or location of a sequence or moiety or domain in a nucleic acid may be denoted as being downstream or 3' of a particular marker, intending that it is between the marker and the 3' end of the nucleic acid.
  • Nucleic acids may comprise nucleotide analogs including non-naturally occurring nucleotide analogs.
  • Such analogs include nucleoside analogs (e.g., 2-aminoadenosine, 2- thiothymidine, inosine, 3 -methyl adenosine, C5-propynylcytidine, C5-propynyluridine, C5- bromouridine, C5-fluorouridine, C5-iodouridine, C5-methylcytidine, 7-deazaadenosine, 7- deazaguanosine, 8-oxoadenosine, 8-oxoguanosine, 0(6)-methylguanine, and 2-thiocytidine), chemically modified bases, biologically modified bases (e.g., methylated bases), intercalated bases, modified sugars (e.g., 2'-fluororibose, ribose, 2 '-deoxyrib
  • the nucleic acids of the invention may be provided or present in a larger nucleic acid.
  • the larger nucleic acid may comprise a nucleotide sequence that is transcribed to produce the switch RNA and trigger RNA of the invention.
  • the invention may refer to the larger nucleic acid as comprising the switch RNA and/or trigger RNA although it is to be understood that in practice this intends that the larger nucleic acid comprises a sequence that encodes the switch RNA and/or trigger RNA.
  • Such encoding sequences may be operably linked to other sequences in the larger nucleic acid such as but not limited to origins of replication.
  • operably linked refers to a relationship between two nucleic acid sequences wherein the production or expression of one of the nucleic acid sequences is controlled by, regulated by, modulated by, etc., the other nucleic acid sequence.
  • the transcription of a nucleic acid sequence is directed by an operably linked promoter sequence; post-transcriptional processing of a nucleic acid is directed by an operably linked processing sequence; the translation of a nucleic acid sequence is directed by an operably linked translational regulatory sequence; the transport or localization of a nucleic acid or polypeptide is directed by an operably linked transport or localization sequence; and the post-translational processing of a polypeptide is directed by an operably linked processing sequence.
  • a nucleic acid sequence that is operably linked to a second nucleic acid sequence is covalently linked, either directly or indirectly, to such a sequence, although any effective association is acceptable.
  • a regulatory sequence or element intends a region of nucleic acid sequence that directs, enhances, or inhibits the expression (e.g., transcription, translation, processing, etc.) of sequence(s) with which it is operatively linked.
  • the term includes promoters, enhancers and other transcriptional and/or translational control elements.
  • the switch RNA and trigger RNA moieties of the invention may be considered to be regulatory sequences or elements to the extent they control translation of a gene of interest that is operably linked to the switch RNA.
  • the invention contemplates that the switch RNA and trigger RNA of the invention may direct constitutive or inducible protein expression.
  • Inducible protein expression may be controlled in a temporal or developmental manner.
  • the translation of the operably linked protein is induced by the presence of one or more external stimuli (or alternatively by the presence of one or more external stimuli and the absence of one or more stimuli, as the case may be).
  • This inducible translation is accomplished by controlling the transcription of the switch or trigger(s) or deactivator moieties in a manner that is dependent on the presence or absence of one or more external stimuli.
  • one element in the system is constitutively expressed, but more typically all the elements in the system will be inducibly expressed as a function of the presence or absence or one or more external stimuli, including some combination of external stimuli.
  • vector or construct refers to a nucleic acid capable of mediating entry of, e.g., transferring, transporting, etc., a second nucleic acid molecule into a cell.
  • the transferred nucleic acid is generally linked to, e.g., inserted into, the vector nucleic acid.
  • a vector may include sequences that direct autonomous replication, or may include sequences sufficient to allow integration into host cell DNA.
  • Useful vectors include, for example, plasmids (typically DNA molecules although RNA plasmids are also known), cosmids, and viral vectors.
  • Reporter proteins may be used to visualize activation of the switch RNA, and thus may also be used as a readout of the presence of one or more external stimuli and/or absence of one or more stimuli and/or a combination of the presence and absence of one or more stimuli.
  • Reporter proteins suitable for this purpose include but are not limited to fluorescent or chemiluminescent reporters (e.g., GFP variants, luciferase, e.g., luciferase derived from the firefly (Photinus pyralis) or the sea pansy (Renilla reniformis) and mutants thereof), enzymatic reporters (e.g., ⁇ -galactosidase, alkaline phosphatase, DHFR, CAT), etc.
  • the eGFPs are a class of proteins that has various substitutions (e.g., Thr, Ala, Gly) of the serine at position 65 (Ser65).
  • the blue fluorescent proteins have a mutation at position 66 (Tyr to His mutation) which alters emission and excitation properties. This Y66H mutation in BFP causes the spectra to be blue-shifted compared to the wtGFP.
  • Cyan fluorescent proteins CFP have a Y66W mutation with excitation and emission spectra wavelengths between those of BFP and eGFP.
  • Sapphire is a mutant with the suppressed excitation peak at 495 nM but still retaining an excitation peak at 395 and the emission peak at 511 nM.
  • Yellow FP (YFP) mutants have an aromatic amino acid (e.g. Phe, Tyr, etc.) at position 203 and have red-shifted emission and excitation spectra.
  • RNA and DNA can be produced using in vitro systems, within cells, or by chemical synthesis using methods known in the art. It will be appreciated that insertion of switch RNA elements upstream of an open reading frame (ORF) can be accomplished by modifying a nucleic acid comprising the ORF.
  • ORF open reading frame
  • the invention provides DNA templates for transcription of a switch RNA or trigger RNA.
  • the invention also provides expression constructs, including plasmids, comprising such DNA templates.
  • the invention provides a construct comprising the template for transcription of a switch RNA or a trigger RNA operably linked to a promoter.
  • the invention provides a DNA construct comprising (i) a template for transcription of a switch RNA; and (ii) an inducible promoter located upstream of the template.
  • a construct or plasmid of the invention includes a restriction site downstream of the 3' end of the portion of the construct that serves as a template for the switch RNA, to allow insertion of an ORF of choice.
  • the construct may include part or all of a polylinker or multiple cloning site downstream of the portion that serves as a template for the switch RNA.
  • the construct may also include an ORF downstream of the switch RNA.
  • the invention provides a DNA construct comprising (i) a template for transcription of a trigger RNA; and (ii) an inducible promoter located upstream of the template.
  • the invention further provides a DNA construct comprising: (i) a template for transcription of a switch RNA; (ii) an inducible promoter located upstream of the template for transcription of the switch RNA; (iii) a template for transcription of a trigger RNA; and (iv) an inducible promoter located upstream of the template for transcription of the trigger RNA.
  • the inducible promoters may be the same or different.
  • the constructs may be or may be incorporated into plasmids, e.g., plasmids capable of replicating in bacteria.
  • the plasmid is a high copy number plasmid (e.g., a pUC-based or pBR322-based plasmid), while in other embodiments, the plasmid is a low or medium copy number plasmid, as these terms are understood and known in the art.
  • the plasmid may include any of a variety of origins of replication, which may provide different copy numbers.
  • any of the following may be used (copy numbers are listed in parenthesis): ColEl (50-70 (high)), pl5A (20-30 (medium)), pSClOl (10-12 (low)), pSOOl* ( ⁇ 4 (lowest). It may be desirable to use plasmids with different copy numbers for transcription of the switch RNA and the trigger RNA in order to alter their relative amounts in a cell or system. In addition, in certain embodiments a tunable copy number plasmid is employed.
  • the invention further provides viruses and cells comprising the nucleic acids, constructs (such as DNA constructs), and plasmids described above.
  • the cell is a prokaryotic cell.
  • the cell is a eukaryotic cell (e.g., a fungal cell, mammalian cell, insect cell, plant cell, etc.).
  • the nucleic acids or constructs may be integrated into a viral genome using recombinant nucleic acid technology, and infectious virus particles comprising the nucleic acid molecules and/or templates for their transcription can be produced.
  • the nucleic acid molecules, DNA constructs, plasmids, or viruses may be introduced into cells using any of a variety of methods known in the art, e.g., electroporation, calcium-phosphate mediated transfection, viral infection, etc.
  • the nucleic acid constructs can be integrated into the genome of a cell.
  • Such cells may be present in vitro (e.g., in culture) or in vivo (e.g., in an organism).
  • the cells may be eukaryotic or prokaryotic cells, including but not limited to mammalian cells and bacterial cells.
  • An example of a bacterial cell is an E. coli bacterium.
  • An example of a mammalian cell is a human cell or a mouse cell.
  • the invention further provides transgenic plants and non-human transgenic animals comprising the nucleic acids, DNA constructs, and/or plasmids of the invention. Methods for generating such transgenic organisms are known in the art.
  • the invention further provides a variety of kits.
  • the invention provides a kit comprising a plasmid, wherein a first plasmid comprises (i) a template for transcription of a switch RNA, and (ii) an inducible promoter located upstream of the template for transcription of the switch RNA element, and optionally a second plasmid that comprises (i) a template for transcription of a cognate (complementary) trigger RNA element, and (ii) an inducible promoter located upstream of the template for transcription of the trigger RNA element.
  • the promoters may be the same or, preferably, different, intending for example that the promoters may be induced by the same external stimulus or a different external stimulus.
  • the invention further provides a kit comprising a single plasmid that comprises a template for transcription of a switch RNA element and an inducible promoter located upstream of the template for transcription of the switch RNA element and further comprises a template for transcription of a cognate trigger RNA element and an inducible promoter located upstream of the template for transcription of the cognate trigger RNA element.
  • the plasmids comprise one or more restriction sites upstream or downstream of the template for transcription of the switch RNA element. If downstream, the restriction sites may be used for insertion of an open reading frame of choice.
  • kits may further include one or more of the following components: (i) one or more inducers; (ii) host cells (e.g., prokaryotic or eukaryotic host cells); (iii) one or more buffers; (iv) one or more enzymes, e.g., a restriction enzyme; (v) nucleic acid isolation and/or purification reagents; (vi) a control plasmid lacking a switch RNA or trigger RNA sequence; (vii) a control plasmid containing a switch RNA or trigger RNA sequence or both; (viii) sequencing primers; (ix) instructions for use.
  • the control plasmids may comprise a reporter sequence.
  • the riboregulators of the invention in some instances comprise a consensus prokaryotic RBS.
  • RBS any of a variety of alternative sequences may be used as the RBS.
  • the sequences of a large number of bacterial ribosome binding sites have been determined, and the important features of these sequences are known.
  • Preferred RBS sequences for high level translation contain a G-rich region at positions -6 to -11 with respect to the AUG and typically contain an A at position -3.
  • Exemplary RBS sequences for use in the present invention include, but are not limited to, AGAGGAGA (or subsequences of this sequence, e.g., subsequences at least 6 nucleotides in length, such as AGGAGG). Shorter sequences are also acceptable, e.g., AGGA, AGGGAG, GAGGAG, etc. Numerous synthetic ribosome binding sites have been created, and their translation initiation activity has been tested. In various embodiments any naturally occurring RBS may be used in the switch RNA constructs. The activity of any candidate sequence to function as an RBS may be tested using any suitable method.
  • expression may be measured as described in Example 1 of published PCT application WO 2004/046321, or as described in reference 53 of that published PCT application, e.g., by measuring the activity of a reporter protein encoded by an mRNA that contains the candidate RBS appropriately positioned upstream of the AUG.
  • an RBS sequence for use in the invention supports translation at a level of at least 10% of the level at which the consensus RBS supports translation (e.g., as measured by the activity of a reporter protein).
  • the candidate RBS is inserted into a control plasmid in place of the consensus RBS, the measured fluorescence will be at least 10% of that measured using the consensus RBS.
  • an RBS that supports translation at a level of at least 1%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or more relative to the level at which the consensus RBS supports translation is used.
  • an RBS that supports translation at higher levels than the consensus RBS is used.
  • the riboregulator system may comprise a reporter protein, such that presence of one or more external stimuli, a combination of external stimuli, and/or a combination of the presence of one or more certain external stimuli and absence of one or more certain external stimuli can be detected via the production of the reporter protein. Presence of the reporter protein can be determined visually, for example if the reporter protein emits a signal such as a fluorescent signal. Presence of the reporter protein may also be determined using an existing assay with which the riboregulator system is associated.
  • the riboregulator systems described herein may be used to trigger translation of the encoded protein so as to induce its activity at particular times, including remotely.
  • the riboregulator system is used to deploy a particular protein, including an enzyme, under certain environment conditions.
  • the protein may then act on another moiety, including for example a packaging material or a housing material such as paper or a cellulose-based product, or starch, or a protein hydrogel, and the like.
  • a packaging material or housing may be degraded upon exposure to a particular environmental condition. This has implications for clean technologies as well as other areas. Table 1. Promoter systems regulated by external stimuli
  • lacUV5 promoter IPTG homepage univie.ac.at/nikos.pi notsis/webPP/genetoprotein/clo _vector/promoters .html
  • tac promoter IPTG homepage.univie.ac.at/nikos.pi notsis/webPP/genetoprotein/clo _vector/promoters .html
  • trc promoter IPTG homepage.univie.ac.at/nikos.pi notsis/webPP/genetoprotein/clo _vector/promoters .html
  • T7 promoter temperature homepage univie.ac.at/nikos.pi notsis/webPP/genetoprotein/clo _vector/promoters .html
  • T7-lac operator promoter IPTG homepage univie.ac.at/nikos.pi notsis/webPP/genetoprotein/clo _vector/promoters .html
  • T3-lac operator promoter IPTG homepage univie.ac.at/nikos.pi notsis/webPP/genetoprotein/clo _vector/promoters .html
  • T5-lac operator promoter IPTG homepage univie.ac.at/nikos.pi notsis/webPP/genetoprotein/clo _vector/promoters .html
  • T4 gene 32 promoter T4 infection homepage.univie.ac.at/nikos.pi notsis/webPP/genetoprotein/clo _vector/promoters .html nprM-lac promoter IPTG homepage.univie.ac.at/nikos.pi operator notsis/webPP/genetoprotein/clo
  • VHb promoter oxygen homepage univie.ac.at/nikos.pi notsis/webPP/genetoprotein/clo _vector/promoters .html
  • Example 1 Temperature-controlled toehold switch and trigger.
  • E. coli strain DH5a endAl recAl gyrA96 thi-1 glnV44 reiki hsdR17(r K - m K + ) ⁇
  • Plasmids were constructed using PCR and Gibson assembly. The synthetic DNA strands purchased from Integrated DNA Technologies were amplified via PCR to form double-stranded DNAs. The resulting DNAs were then inserted into plasmid backbones using 30-bp homology domains via Gibson assembly. All plasmids were cloned in the E. coli
  • DH5a strain and validated through DNA sequencing.
  • Backbones for the plasmids were taken from the commercial vectors pET15b, pCOLADuet, and pCDFDuet (EMD Millipore).
  • GFPmut3b-ASV was used as the reporter for the gate plasmids. This GFP is GFPmut3b with an ASV degradation tag. Key sequences of elements used in the plasmids are provided in Table 2.
  • the switch plasmid having a toehold switch under the control of lambda pR promoter followed by GFPmut3b-ASV reporter has a medium copy ColA origin with kanamycin resistance.
  • the switch plasmid also encoded lac repressor under a constitutive promoter.
  • the trigger plasmid having a toehold trigger under the control lambda pR promoter has a high copy ColEl origin with ampicillin resistance.
  • the lambda repressor plasmid having thermo-labile lambda repressor cI2 under the control of lac promoter has a high copy CDF origin with spectinomycin resistance.
  • Temperature sensor circuits were tested using cells transformed with switch plasmid, trigger plasmid, and lambda repressor plasmid induced with different amounts of IPTG, to control the amount of lambda repressor cI2, and at different temperatures. Control cells with plasmid that constitutively expresses GFPmut3b-ASV and plasmid that does not encode GFP were included as positive and negative controls respectively.
  • E. coli DH5a cells were grown overnight in 96-well plates with shaking at 250 rpm and at 30°C were induced with 0.1 mM IPTG for high expression of lambda repressor and with appropriate antibiotics: ampicillin (50 ⁇ g mL -1 ), spectinomycin (25 ⁇ g mL -1 ), and kanamycin (30 ⁇ g mL "1 ). Overnight cultured were then diluted by 100-fold into fresh LB media with antibiotics and 0.1 mM IPTG and returned to shaking (250 rpm, 30°C). After 80 minutes, cells were returned to the shaker (250 rpm) at three different temperatures (30°C, 33°C, 37°C) and measured after 6 hrs.
  • Flow cytometry measurements were performed using a BD LSRFortessa cell analyzer with a high-throughput sampler. Prior to sampling, cells were diluted by a factor of -40 into phosphate-buffered saline. Cells were detected using a forward scatter (FSC) trigger and at least 20,000 cells were recorded for each measurement. Cell populations were gated according to their FSC and side scatter (SSC) distributions and the GFP fluorescence levels of these gated cells were used to measure circuit output. GFP fluorescence histograms yielded unimodal population distributions and the mode fluorescence was recorded from at least two biological replicates. Cellular autofluorescence was not subtracted.
  • FSC forward scatter
  • SSC side scatter
  • the flow cytometry measurement showed that the control cell populations had little temperature dependence on GFP expression or cellular autofluorescence.
  • the temperature sensor circuit showed fluorescence level close to cellular autofluorescence from the 30°C and 33°C culture, and induced GFP expression about 10 fold above background at 37°C.
  • Toehold switch 1 GATTGAATATGATAGAAGTTTAGTAGTAGACAATAGAACAGAGGAAA
  • TATTGATGACTACTAAACTA SEQ ID NO : 1
  • Toehold trigger 1 GATACACATAGAATCATGTGTATAACACTACTAAACTTCTATCATAT
  • CTGAGCAC SEQ ID NO : 4
  • GFPmut3b-ASV atgcgtaaaggagaagaacttttcactggagttgtcccaattcttgt tgaattagatggtgatgttaatgggcacaaattttctgtcagtggag agggtgaaggtgatgcaacatacggaaaacttacccttaaatttatt tgcactactggaaaactacctgttccgtggccaacacttgtcactac ttcggttatggtgttcaatgcttttgcgagatacccagatcacatga acagcatgactttttcaagagtgccatgcccgaaggttacgtacag gaaagaactatatttttcaaagatgacgggaactacaagacacgtgc tgaagtcaagtttgaa
  • inventive embodiments are presented by way of example only and that, within the scope of the appended claims and equivalents thereto, inventive embodiments may be practiced otherwise than as specifically described and claimed.
  • inventive embodiments of the present disclosure are directed to each individual feature, system, article, material, kit, and/or method described herein.
  • a reference to "A and/or B", when used in conjunction with open-ended language such as “comprising” can refer, in one embodiment, to A only (optionally including elements other than B); in another embodiment, to B only (optionally including elements other than A); in yet another embodiment, to both A and B (optionally including other elements); etc.
  • the phrase "at least one,” in reference to a list of one or more elements, should be understood to mean at least one element selected from any one or more of the elements in the list of elements, but not necessarily including at least one of each and every element specifically listed within the list of elements and not excluding any combinations of elements in the list of elements.
  • This definition also allows that elements may optionally be present other than the elements specifically identified within the list of elements to which the phrase "at least one" refers, whether related or unrelated to those elements specifically identified.
  • At least one of A and B can refer, in one embodiment, to at least one, optionally including more than one, A, with no B present (and optionally including elements other than B); in another

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Genetics & Genomics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biotechnology (AREA)
  • Molecular Biology (AREA)
  • Biomedical Technology (AREA)
  • Biochemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • General Health & Medical Sciences (AREA)
  • General Engineering & Computer Science (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Analytical Chemistry (AREA)
  • Medicinal Chemistry (AREA)
  • Urology & Nephrology (AREA)
  • Toxicology (AREA)
  • Hematology (AREA)
  • Cell Biology (AREA)
  • Plant Pathology (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Food Science & Technology (AREA)
  • General Physics & Mathematics (AREA)
  • Pathology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

L'invention concerne des compositions et des méthodes permettant d'induire l'expression d'une protéine sur la base d'un ou de plusieurs stimuli externes tels que des stimuli environnementaux.
PCT/US2016/049963 2015-09-02 2016-09-01 Riborégulateurs régulés par des stimuli externes et leurs procédés d'utilisation WO2017040829A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201562213217P 2015-09-02 2015-09-02
US62/213,217 2015-09-02

Publications (1)

Publication Number Publication Date
WO2017040829A1 true WO2017040829A1 (fr) 2017-03-09

Family

ID=58188393

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2016/049963 WO2017040829A1 (fr) 2015-09-02 2016-09-01 Riborégulateurs régulés par des stimuli externes et leurs procédés d'utilisation

Country Status (1)

Country Link
WO (1) WO2017040829A1 (fr)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2018187687A1 (fr) * 2017-04-07 2018-10-11 Arizona Board Regents On Behalf Of Arizona State University Dispositifs de diagnostic intégrés comportant des systèmes informatiques biomoléculaires intégrés et leurs utilisations
WO2019166816A1 (fr) * 2018-03-01 2019-09-06 Biotangents Limited Moyens et méthodes de détection d'acide nucléique cible
KR20190143037A (ko) * 2018-06-19 2019-12-30 서울대학교산학협력단 박테리아에서의 고품질 재조합 단백질 생산을 위해 전사 완료 후 번역이 개시되는 유전자 발현 카세트
US20210147846A1 (en) * 2016-08-01 2021-05-20 Arizona Board Of Regents On Behalf Of Arizona State University Synthetic Near-Threshold Translational Repressors

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2014074648A2 (fr) * 2012-11-06 2014-05-15 President And Fellows Of Harvard College Compositions de riborégulateur et procédés d'utilisation
US20140154744A1 (en) * 2011-07-11 2014-06-05 Yale University Compositions and Methods for Making Selenocysteine Containing Polypeptides

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20140154744A1 (en) * 2011-07-11 2014-06-05 Yale University Compositions and Methods for Making Selenocysteine Containing Polypeptides
WO2014074648A2 (fr) * 2012-11-06 2014-05-15 President And Fellows Of Harvard College Compositions de riborégulateur et procédés d'utilisation

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
JASCHKE, A: "Genetically Encoded RNA Photoswitches as Tools for the Control of Gene Expression", FEBS LETTERS., vol. 586, no. 15, 22 May 2012 (2012-05-22), pages 2106 - 2111, XP028400687 *

Cited By (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20210147846A1 (en) * 2016-08-01 2021-05-20 Arizona Board Of Regents On Behalf Of Arizona State University Synthetic Near-Threshold Translational Repressors
US11898144B2 (en) * 2016-08-01 2024-02-13 Arizona Board Of Regents On Behalf Of Arizona State University Synthetic near-threshold translational repressors
WO2018187687A1 (fr) * 2017-04-07 2018-10-11 Arizona Board Regents On Behalf Of Arizona State University Dispositifs de diagnostic intégrés comportant des systèmes informatiques biomoléculaires intégrés et leurs utilisations
US11547997B2 (en) 2017-04-07 2023-01-10 Arizona Board Of Regents On Behalf Of Arizona State University Integrated diagnostic devices having embedded biomolecular computing systems and uses thereof
WO2019166816A1 (fr) * 2018-03-01 2019-09-06 Biotangents Limited Moyens et méthodes de détection d'acide nucléique cible
KR20190143037A (ko) * 2018-06-19 2019-12-30 서울대학교산학협력단 박테리아에서의 고품질 재조합 단백질 생산을 위해 전사 완료 후 번역이 개시되는 유전자 발현 카세트
KR102182078B1 (ko) 2018-06-19 2020-11-23 서울대학교산학협력단 박테리아에서의 고품질 재조합 단백질 생산을 위해 전사 완료 후 번역이 개시되는 유전자 발현 카세트

Similar Documents

Publication Publication Date Title
US11788156B2 (en) Compositions comprising riboregulators and methods of use thereof
EP2917349B1 (fr) Compositions de riborégulateur et procédés d'utilisation
Autour et al. Fluorogenic RNA Mango aptamers for imaging small non-coding RNAs in mammalian cells
Duval et al. Escherichia coli ribosomal protein S1 unfolds structured mRNAs onto the ribosome for active translation initiation
Ezure et al. Cell‐free protein synthesis system prepared from insect cells by freeze‐thawing
WO2017040829A1 (fr) Riborégulateurs régulés par des stimuli externes et leurs procédés d'utilisation
WO2018145068A1 (fr) Système intégré pour méthylation d'adn programmable
US20210163947A1 (en) Ultrasensitive and multiplexed cell-free biosensors using cascaded amplification and positive feedback
Merino-Puerto et al. Cluster of genes that encode positive and negative elements influencing filament length in a heterocyst-forming cyanobacterium
WO2021173587A1 (fr) Détection de séquence d'acide nucléique par mesure de monoribonucléotides libres générés par une activité de clivage collatéral endonucléase
Case et al. CT406 encodes a chlamydial ortholog of NrdR, a repressor of ribonucleotide reductase
Cruz-Vera et al. The rate of peptidyl-tRNA dissociation from the ribosome during minigene expression depends on the nature of the last decoding interaction
Vockenhuber et al. Identification of metE as a second target of the sRNA scr5239 in Streptomyces coelicolor
WO2021194567A2 (fr) Biocapteurs acellulaires ultrasensibles et multiplexés utilisant une amplification en cascade et une rétroaction positive
Jiang Yu et al. Estimating the exogenous genes copy number of genetically modified organisms by droplet digital PCR.
Luther Role of endogenous antisense RNA in cardiac gene regulation
Kitto et al. RNA‐based fluorescent biosensors for live cell detection of bacterial sRNA
Ogasawara et al. Negative regulation of DNA repair gene (ung) expression by the CpxR/CpxA two-component system in Escherichia coli K-12 and induction of mutations by increased expression of CpxR
Andou et al. Development of an RNA detection system using bioluminescence resonance energy transfer
JP5525172B2 (ja) 真菌の形質転換のためのプラスミドベクター、ｐＣｒｙｐｔｏＲＮＡｉ
CN104919053B (zh) 脊椎动物dna甲基转移酶的dna5‑甲基胞嘧啶去甲基活性
US20240271186A1 (en) Argonaute-based nucleic acid detection system
Ng et al. A modular platform for bioluminescent RNA tracking
Wrighta et al. Second messengers and divergent HD-GYP enzymes regulate 3’, 3’-cGAMP signaling
WO2023240255A2 (fr) Biocapteurs acellulaires pour la détection in vitro de molécules cibles

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 16843005

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 16843005

Country of ref document: EP

Kind code of ref document: A1