WO2017025617A1 - Method for the quantification of faecalibacterium prausnitzii phylogroup i and/or phylogroup ii members and the use thereof as biomarkers - Google Patents

Method for the quantification of faecalibacterium prausnitzii phylogroup i and/or phylogroup ii members and the use thereof as biomarkers Download PDF

Info

Publication number
WO2017025617A1
WO2017025617A1 PCT/EP2016/069188 EP2016069188W WO2017025617A1 WO 2017025617 A1 WO2017025617 A1 WO 2017025617A1 EP 2016069188 W EP2016069188 W EP 2016069188W WO 2017025617 A1 WO2017025617 A1 WO 2017025617A1
Authority
WO
WIPO (PCT)
Prior art keywords
abundance
phgi
phgii
sample
disease
Prior art date
Application number
PCT/EP2016/069188
Other languages
French (fr)
Other versions
WO2017025617A8 (en
Inventor
Mireia LÓPEZ SILES
Librado Jesús GARCÍA GIL
Xavier ALDEGUER MANTÉ
Margarita MARTÍNEZ MEDINA
Original Assignee
Universitat De Girona
Institut D'investigació Biomèdica De Girona Dr. Josep Trueta
Goodgut S.L.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to CA2995308A priority Critical patent/CA2995308A1/en
Priority to KR1020187006886A priority patent/KR102726075B1/en
Priority to US15/751,805 priority patent/US11299788B2/en
Priority to ES16754468T priority patent/ES2901465T3/en
Priority to HRP20211757TT priority patent/HRP20211757T1/en
Priority to AU2016306627A priority patent/AU2016306627B2/en
Priority to MX2018001697A priority patent/MX390884B/en
Priority to DK16754468.3T priority patent/DK3334838T3/en
Priority to HK18116361.7A priority patent/HK1257108B/en
Priority to CN202211643379.9A priority patent/CN115976239A/en
Priority to EP16754468.3A priority patent/EP3334838B1/en
Priority to CN201680059564.XA priority patent/CN108474037A/en
Application filed by Universitat De Girona, Institut D'investigació Biomèdica De Girona Dr. Josep Trueta, Goodgut S.L. filed Critical Universitat De Girona
Priority to SI201631380T priority patent/SI3334838T1/en
Priority to JP2018527012A priority patent/JP7095210B2/en
Publication of WO2017025617A1 publication Critical patent/WO2017025617A1/en
Publication of WO2017025617A8 publication Critical patent/WO2017025617A8/en
Priority to IL257461A priority patent/IL257461B/en
Priority to JP2021173197A priority patent/JP2022031644A/en
Priority to US17/683,926 priority patent/US20220307075A1/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/106—Pharmacogenomics, i.e. genetic variability in individual responses to drugs and drug metabolism
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/112—Disease subtyping, staging or classification
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/118—Prognosis of disease development
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/158—Expression markers
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A90/00—Technologies having an indirect contribution to adaptation to climate change
    • Y02A90/10—Information and communication technologies [ICT] supporting adaptation to climate change, e.g. for weather forecasting or climate simulation

Definitions

  • the present invention relates to the field of diagnosis and classification of intestinal diseases and personalized medicine in general. It further relates to the field of microbiology and molecular biology, more particularly it relates to the relationship between intestinal microbiota composition and intestinal disease, e.g., in inflammatory bowel disease (IBD). Specifically it relates to a novel method for an accurate quantification in intestinal samples of Faecalibacterium prausnitzii phylogroup I members (PHGI) and/or Faecalibacterium prausnitzii phylogroup II members (PHGII).
  • PHGI Faecalibacterium prausnitzii phylogroup I members
  • PHGII Faecalibacterium prausnitzii phylogroup II members
  • IBD Inflammatory bowel disease
  • CD Crohn's disease
  • UC ulcerative colitis
  • IBD ulcerative colitis .
  • IBD hospitalizations and surgery rates in the United States have increased significantly since 1990.
  • IBD is one of the five most prevalent gastrointestinal disease burdens in the United States, with annual overall health care costs of more than $1.7 billion.
  • IBD One to two of every 1000 people in developed countries are affected with IBD, and global rates seem to be increasing, attributable to the rapid modernization and to the adoption of the Western world lifestyle.
  • These chronic diseases result in significant morbidity and mortality, compromising quality of life and life expectancies. (M' Koma A. E., World J Gastrointest Surg 2014; 6(1 1 ), 208-219).
  • Faecalibacterium prausnitzii is one of the three most abundant bacterial species found in the gut, representing between 2-20% of the fecal microbiota in healthy individuals, according to diversity studies of the human gut microbiome based on 16S rRNA gene analysis (Arumugam et al. Nature. 201 1 ;473: 174-180; Eckburg et al. Science. 2005;308: 1635-1638; Hold et al. AppI Environ Microbiol. 2003;69:4320-4324; Schwiertz et al. J Pediatr. 2010; 157:240-244; Suau et al. Systematic and Applied Microbiology.
  • the primers used for amplification of F. prausnitzii members were not targeting the F. prausnitzii 16S rRNA gene and were based on the sequence of two strains only. Furthermore, the members belonging to each subgroup were distinguished by the size of the PCR product and, no primer or probe was disclosed in Jia et al. 2010 specific for each of the A2-165 and M21/2 subgroups.
  • the diagnosis of IBD requires a comprehensive physical examination and a review of the patient's history. Various tests, including blood tests, stool examination, endoscopy, biopsies, and imaging studies help exclude other causes and confirm the diagnosis (World Gastroenterology Organisation Global Guidelines, Inflammatory bowel disease: a global perspective, June 2009).
  • the inventors developed a novel method for an accurate quantification in intestinal samples of phylogroup I members (PHGI) and/or phylogroup II members (PHGII) of F. prausnitzii species.
  • PHGI phylogroup I members
  • PHGII phylogroup II members
  • qPCR quantitative polymerase chain reaction
  • the broad coverage of the primers and probes of the invention provides for a more accurate quantification of F. prausnitzii phylogroups.
  • F. prausnitzii phylogroup I members PHGI
  • PHGII phylogroup II members
  • 5 known F. prausnitzii 16S rRNA gene sequences were used as starting point and for PHGII probe 13 known F. prausnitzii 16S rRNA gene sequences (see Tables 3 and 5 below, respectively).
  • Phylogroup classification of the known sequences was carried out according to Lopez-Siles et al. 2012.
  • the generated species-specific primers and phylogroup specific probes were submitted to in silico and in vivo testing to ensure broad coverage and specificity for the 16S rRNA gene of F.
  • PHGI probe SEQ ID NO:3 was shown by the inventors to specifically hybridize with more than 1000 16S rRNA gene sequences, namely the 1 196 sequences recited in Tables 3 and 4. Therefore, the term Faecalibacterium prausnitzii phylogroup I (PHGI) members as used herein includes those bacterial strains which 16S rRNA gene specifically hybridizes with PHGI probe (SEQ ID NO:3).
  • PHGII probe (SEQ ID NO:4) was shown by the inventors to specifically hybridize with more than 2000 16S rRNA gene sequences, namely the 2244 sequences recited in Tables 5 and 6. Accordingly, the term Faecalibacterium prausnitzii phylogroup II (PHGII) members as used herein includes those bacterial strains which 16S rRNA gene specifically hybridizes with PHGII probe (SEQ ID NO:4).
  • the inventors determined the variation of mucosa-associated and feces-associated F. prausnitzii phylogroups between healthy subjects and patients suffering several intestinal disorders in order to establish whether the imbalance in F. prausnitzii includes the overall population or specifically affects a particular phylogroup.
  • the present invention provides a novel method for the quantification of PHGI and/or of PHGII members and its use as new biomarkers of intestinal disease, particularly of Crohn's disease and/or ulcerative colitis.
  • a first aspect of the invention relates to an in vitro method for determining the abundance of Faecalibacterium prausnitzii phylogroup I members (PHGI) and/or of Faecalibacterium prausnitzii phylogroup II members (PHGII) in an intestinal sample from a subject; wherein PHGI abundance determination comprises the use of a primer and/or probe with sequence SEQ ID NO: 3 or a sequence with at least 75% identity thereof; and wherein PHGII abundance determination comprises the use of a primer and/or a probe with sequence SEQ ID NO: 4 or a sequence with at least 75% identity thereof.
  • the invention in a second aspect relates to a method for the obtaining of useful information for the detection of an intestinal disease in a human subject and/or for the prediction of the efficacy of a drug in the therapeutic treatment of an intestinal disease in a human subject, comprising for determination of the abundance of PHGI and/or of PHGII according to the method of the invention.
  • the invention relates to a method for detecting an intestinal disease in a human subject comprising the following steps:
  • PHGI Faecalibacterium prausnitzii phylogroup I members
  • PHGII Faecalibacterium prausnitzii phylogroup II members
  • the invention relates to the use of Faecalibacterium prausnitzii phylogroup I members (PHGI) and/or Faecalibacterium prausnitzii phylogroup II members (PHGII) abundance, and/or a mathematical combination thereof, and/or optionally a mathematical combination of any of these with Total F.Prausnitzii (FT) abundance and/or E.coli (EC) abundance, in an intestinal sample of a human subject as biomarker for the detection of an intestinal disease, and/or for predicting the efficacy of a drug in the treatment of an intestinal disease.
  • FT Total F.Prausnitzii
  • EC E.coli
  • the invention further provides a kit comprising:
  • a reagent for determining the abundance of Faecalibacterium prausnitzii phylogroup I members consisting of a primer and/or probe with sequence SEQ ID NO: 3 or a sequence with at least 75% identity thereof;
  • a reagent for determining the abundance of Faecalibacterium prausnitzii phylogroup II members consisting of a primer and/or a probe with sequence SEQ ID NO: 4 or a sequence with at least 75% identity thereof;
  • a further aspect of the invention relates to a nucleic acid sequence selected from the group consisting of SEQ ID NO: 1 , SEQ ID NO: 2, SEQ ID NO: 3, and SEQ ID NO: 4 or an oligonucleotide sequence with at least 75% identity thereof.
  • Still a further aspect of the invention relates to a method for the differential diagnosis of inflammatory bowel disease (IBD) phenotypes in a human subject comprising the following steps: i. determining the abundance of a target microorganism in an intestinal sample from said subject, wherein said target microorganism is selected from the group consisting of Faecalibacterium prausnitzii members (total FP), Faecalibacterium prausnitzii phylogroup I members (PHGI) and Faecalibacterium prausnitzii phylogroup II members (PHGII); and ii.
  • IBD inflammatory bowel disease
  • the subject sample abundance of one or more of said target microorganisms and/or a mathematical combination thereof with the corresponding values in a reference sample of the IBD phenotypes to be distinguished from to determine the IBD phenotype the subject is suffering from; wherein the subject sample presenting values significantly similar to one of said IBD phenotypes will be indicative that the subject is suffering from said IBD phenotype; and wherein said IBD phenotypes are defined by at least the combination of two, preferably three, of the following parameters:
  • biomarkers for the definition of said IBD phenotypes.
  • Another aspect of the invention relates to a method for diagnosing C-CD in a human subject suffering from IBD with colonic involvement comprising the following steps:
  • determining the abundance of a target microorganism in an intestinal sample from said subject wherein said target microorganism is selected from the group consisting of Faecalibacterium prausnitzii members (total FP), Faecalibacterium prausnitzii phylogroup I members (PHGI) and Faecalibacterium prausnitzii phylogroup II members (PHGII); and ii. comparing the subject sample abundance of one or more of said target microorganisms and/or a mathematical combination thereof, with the corresponding values in a reference sample, wherein a significant deviation in the subject sample values with regard to said reference sample is indicative of C-CD.
  • Another aspect of the invention relates to a method for diagnosing IC-CD in a human subject suffering from l-CD or C-CD comprising the following steps:
  • determining the abundance of a target microorganism in an intestinal sample from said subject wherein said target microorganism is selected from the group consisting of Faecalibacterium prausnitzii members (total FP), Faecalibacterium prausnitzii phylogroup I members (PHGI) and Faecalibacterium prausnitzii phylogroup II members (PHGII); and ii. comparing the subject sample abundance of one or more of said target microorganisms and/or a mathematical combination thereof, with the corresponding values in a reference sample from said subject at around diagnose of l-CD or C-CD, wherein a significant deviation in the subject sample values with regard to said reference sample is indicative of IC-CD.
  • a further aspect of the invention relates to a method for the prognosis of inflammatory bowel disease (IBD) which comprises the determination of an IBD phenotype according to a method for the differential diagnosis of any of the above aspects of the invention and establishing prognosis according to the determined IBD phenotype.
  • IBD inflammatory bowel disease
  • Another additional aspect of the invention relates to the use of Faecalibacterium prausnitzii members (total FP) abundance, Faecalibacterium prausnitzii phylogroup I members (PHGI) abundance and/or Faecalibacterium prausnitzii phylogroup II members (PHGII) abundance determined in an intestinal sample of a human subject; and/or a mathematical combination thereof as biomarker for the differential diagnosis of inflammatory bowel disease (IBD) phenotypes.
  • total FP Faecalibacterium prausnitzii members
  • PHGI Faecalibacterium prausnitzii phylogroup I members
  • PHGII Faecalibacterium prausnitzii phylogroup II members
  • Still another additional aspect of the invention relates to a kit for the differential diagnosis of inflammatory bowel disease (IBD) phenotypes according to a method of any of above aspects, comprising: - a reagent for determining the abundance of a target microorganism selected from the group consisting of Faecalibacterium prausnitzii members (total FP), Faecalibacterium prausnitzii phylogroup I members (PHGI), and Faecalibacterium prausnitzii phylogroup II members (PHGII); and instructions for use of said reagent(s) to determine the abundance levels of said target microorganism from a human intestinal sample.
  • a target microorganism selected from the group consisting of Faecalibacterium prausnitzii members (total FP), Faecalibacterium prausnitzii phylogroup I members (PHGI), and Faecalibacterium prausnitzii phylogroup II members (PHGII)
  • FIG. 1 Graphical representation of the prevalence of F. prausnitzii (black), F. prausnitzii phylogroup I (grey) and F. prausnitzii phylogroup II (white). Subjects were categorized by disease (left) and IBD location (right). The following abbreviations have been used: H, control subjects; CRC, colorectal cancer; IBS, irritable bowel syndrome; UC, ulcerative colitis; CD, Crohn's disease; E1 , proctitis; E2, left-sided colitis; E3, pancolitis; C-CD, colonic CD; IC-CD, ileocolonic CD; l-CD, ileal CD; and IBD, inflammatory bowel disease.
  • H control subjects
  • CRC colorectal cancer
  • IBS irritable bowel syndrome
  • UC ulcerative colitis
  • CD Crohn's disease
  • E1 proctitis
  • E2 left-sided colitis
  • E3 pancolitis
  • FIG. 1 Graphical representation of the prevalence of F. prausnitzii, F. prausnitzii phylogroup I and F. prausnitzii phylogroup II in each group of patients (A) categorized by disease and (B) categorized by IBD subtype. Both in A) and B) prevalence values along the gut have been represented (from inner to outer circles-ileum, colon and rectum) and also the corresponding prevalence pooling all the samples (outer circle).
  • H control subjects
  • CRC colorectal cancer
  • IBS irritable bowel syndrome
  • UC ulcerative colitis
  • CD Crohn's disease
  • E1 ulcerative proctitis
  • E2 ulcerative left-sided colitis
  • E3 ulcerative pancolitis
  • C-CD colonic CD
  • IC-CD ileocolonic CD
  • l-CD ileal CD
  • FIG. 3 Graphical representation as a heat map on the suitability of mucosa-associated F. prausnitzii, F. prausnitzii phylogroup I and F. prausnitzii phylogroup II abundances to be used as biomarkers to distinguish amongst different intestinal disorders and IBD subtypes (by location) determined by the area under the curve (AUC) obtained by receiver operating characteristic analysis (ROC curve).
  • a test is considered to be a suitable discriminator if the AUC is from 0.6 to 0.75 (in light grey), to have a high discrimination if the AUC is from 0.75 to 0.9 (in dark grey) and to be an excellent discriminator if the AUC is from 0.9 to 1 (in black).
  • H controls
  • IBD inflammatory bowel disease
  • IBS irritable bowel syndrome
  • UC ulcerative colitis
  • CD Crohn's disease
  • CRC colorectal cancer
  • l-CD ileal CD
  • IC-CD ileocolonic CD
  • C-CD colonic CD
  • E1 ulcerative proctitis
  • E2, distal UC and E3, extensive UC or ulcerative pancolitis.
  • FIG. 4 Receiver operating characteristic (ROC) curves for mucosa-associated F. prausnitzii, F. prausnitzii phylogroup I (PHGI) and F. prausnitzii phylogroup II (PHGII) abundances for those group comparisons wherein PHGI shows to be the best discriminator between presence and absence of intestinal disease or disease subtype.
  • In the Y axis is represented sensitivity and in the X axis 1 -specificity. The following abbreviations have been used: H, controls; IBD, inflammatory bowel disease; IBS, irritable bowel syndrome; CD, Crohn's disease; CRC, colorectal cancer; and l-CD, ileal CD.
  • Y axis is represented sensitivity and in the X axis 1 -specificity.
  • the following abbreviations have been used: l-CD, ileal CD; IC-CD, ileocolonic CD, C-CD, colonic CD; and E3, extensive UC or ulcerative pancolitis.
  • FIG. 6 Graphical representation as a heat map on the suitability of F. prausnitzii, F. prausnitzii phylogroup I and F. prausnitzii phylogroup II abundances in feces to be used as biomarkers to distinguish amongst different IBD diagnostics and IBD subtypes (by location) determined by the area under the curve (AUC) obtained by receiver operating characteristic analysis (ROC curve).
  • a test is considered to be a suitable discriminator if the AUC is from 0.6 to 0.75 (in light grey), to have a high discrimination if the AUC is from 0.75 to 0.9 (in dark grey) and to be an excellent discriminator if the AUC is from 0.9 to 1 (in black).
  • H controls
  • IBD inflammatory bowel disease
  • IBS irritable bowel syndrome
  • UC ulcerative colitis
  • CD Crohn's disease
  • CRC colorectal cancer
  • l-CD ileal CD
  • IC- CD ileocolonic CD, C-CD, colonic CD
  • E1 ulcerative proctitis, E2, distal UC
  • Figure 7 Receiver operating characteristic (ROC) curves for F. prausnitzii, F. prausnitzii phylogroup I (PHGI) and F.
  • prausnitzii phylogroup II PHGII
  • FIG. 8 Receiver operating characteristic (ROC) curves for F. prausnitzii, F. prausnitzii phylogroup I (PHGI) and F. prausnitzii phylogroup II (PHGII) abundances in feces for selected group comparisons for differential diagnosis of clinical interest.
  • Y axis is represented sensitivity and in the X axis 1 -specificity.
  • the following abbreviations have been used: l-CD, ileal CD; IC-CD, ileocolonic CD, C-CD, colonic CD; and E3, extensive UC or ulcerative pancolitis.
  • Figure 9 Graphs representing abundances of fecal Total F. prausnitzii (FT), phylogroups (PHGI and PHGII) and E.coli (EC) in healthy (H), Ulcerative Colitis (UC) and Crohn's Disease (CD) patients (expressed in Ct).
  • Figure 10. Graphs representing bacterial abundances by biomarkers ratios.
  • Figure 1 Graphs representing ROC curve analysis of fecal Total F. rausnitzii (FT), phylogroups (PHGI and PHGII) and E.coli (EC) in healthy (H), Ulcerative Colitis (UC) and Crohn's Disease (CD) patients.
  • FT Total F. rausnitzii
  • PHGI phylogroups
  • EC E.coli
  • FIG 14. Graphs representing ROC curve analysis of faecal Total F. prausnitzii (FT), phylogroups (PHGI and PHGII) and E.coli (EC) in ileal location in Crohn's Disease (CD) patients.
  • Figure 15. Graph representing ROC curve analysis of fecal Total F. prausnitzii (FT), and phylogroup I (PHGI) in ileocolonic location in Crohn's Disease (CD) patients.
  • Figure 16 Graphs representing ROC curve analysis of faecal Total F. prausnitzii (FT) and phylogroups (PHGI and PHGII) in colonic location in Crohn's Disease (CD) patients.
  • FT Total F. prausnitzii
  • PHGI phylogroups
  • CD Crohn's Disease
  • Figure 17 Graphs representing ROC curve analysis of bacterial markers and ratios to discriminate UC patients.
  • Figure 18 Graphs representing ROC curve analysis of bacterial markers and ratios in colonic location in Crohn's Disease (CD) patients.
  • FIG. 19 Total Faecalibacterium prausnitzii (FT), phylogroup I (PHI) and phylogroup II (PHII) in CD and UC patients between different ranges of calprotectin.
  • Figure 20 Graphs of ratios FT/PHI, PHI/PHII, PHI/EC and PHII/EC in CD and UC patients between calprotectin over or under 250 ⁇ g g.
  • Figure 21 Graphs of ROC curve analysis in CD patients with calprotectin values over 250 ⁇ g g.
  • Figure 22 Graphs of ROC curve analysis in UC patients with calprotectin values over 250 ⁇ g g.
  • FIG. 23 Abundances of total Faecalibacterium prausnitzii (FT), phylogroup I (PHI), phylogroup II (PHII) and E. coli in responders and non-responders CD and UC patients.
  • FT Faecalibacterium prausnitzii
  • PHI phylogroup I
  • PHII phylogroup II
  • E. coli E. coli in responders and non-responders CD and UC patients.
  • prevalence refers to a measure of the number of cases of disease occurring within the population under study, i.e., % of biological samples or individuals positive for a target microorganism from the total of biological samples or individuals analyzed. Prevalence is thus calculated from the qualitative determination (presence/absence) of said target microorganism within each of the samples or individuals under study.
  • the term "abundance” as used herein refers to a measure of the quantity of a target microorganism within a biological sample. It is also referred as "load”. Bacterial quantification is generally carried out by molecular methods, typically by determining the number of 16S rRNA gene copies of said target microorganism, for instance by fluorescence in situ hybridization (FISH), quantitative polymerase chain reaction (qPCR) or PCR/pyrosequencing. Quantification of the abundance of a target nucleic acid sequence within a biological sample might be absolute or relative.
  • FISH fluorescence in situ hybridization
  • qPCR quantitative polymerase chain reaction
  • Quantification of the abundance of a target nucleic acid sequence within a biological sample might be absolute or relative.
  • Relative quantification is generally based on one or more internal reference genes, i.e., 16S rRNA genes from reference strains, such as determination of total bacteria using universal primers and expressing the abundance of the target nucleic acid sequence as a percentage of total bacterial 16S rRNA gene copies or normalized by E.coli 16S rRNA gene copies.
  • “Absolute quantification” gives the exact number of target molecules by comparison with DNA standards or normalizing by DNA concentration.
  • quantification levels might be the concentration (DNA amount per unit of volume), the DNA amount or number of gene copies per number of cells, the cycle threshold value (Ct value) or any mathematical transformation thereof, such as the log 10 of the number of gene copies.
  • biomarker refers to how well the molecular marker identifies the target condition of interest, in other words, how well said parameter enables to discriminate between subjects belonging to different population groups, for instance between disease and non-disease group or between different disease phenotypes. This is referred as the "validity" or "performance” of the test.
  • Negative likelihood ratio (LR-) (1 - sensitivity) specificity
  • sensitivity refers to the proportion of subjects who have the target condition (reference standard positive) and give positive test results (TP/ (TP + FN)). It shows how good the test is at detecting a disease. Sensitivity (“sens”) may be within the range of 0 (0%) ⁇ sens ⁇ 1 (100%) and ideally, the number of false negatives equaling zero or close to equaling zero and sensitivity equaling one (100%) or close to equaling one (100%).
  • Specificity refers to the proportion of subjects without the target condition (reference standard negative) and give negative test results (TN/ (TN + FP)). It shows how good the test is at identifying normal (negative) condition. Specificity (“spec") may be within the range of 0 (0%) ⁇ spec ⁇ 1 (100%) and ideally, the number of false positives equaling zero or close to equaling zero and specificity equaling one (100%) or close to equaling one (100%).
  • accuracy refers to the proportion of true results, either true positive or true negative, in a population. It measures the degree of veracity of a screening test on a condition, i.e., how correct is the determination and exclusion of a given condition (TN + TP)/(TN+TP+FN+FP). Accuracy (“acc") may be within the range of 0 (0%) ⁇ acc ⁇ 1 (100%) and ideally, the number of false positives equaling zero or close to equaling zero and accuracy equaling one (100%) or close to equaling one (100%).
  • ROC curves refers to a graphical plot that illustrates the performance of a binary classifier system as its discrimination threshold is varied. The curve is created by plotting the true positive rate against the false positive rate at various threshold settings. The true positive rate is also known as sensitivity. The false positive rate is calculated as 1 - specificity. The ROC curve is thus a way of graphically displaying the true positive rate versus the false positive rate (sensitivity vs (1 -specificity)) across a range of cut-offs and of selecting the optimal cut-off for clinical use. Accuracy expressed as the area under the ROC curve (AUC) provides a useful parameter for comparing test performance.
  • AUC area under the ROC curve
  • An AUC approaching 1 indicates that the test is highly sensitive as well as highly specific whereas an AUC approaching 0.5 indicates that the test is neither sensitive nor specific.
  • a test is considered to be a suitable discriminator if the AUC is from 0.6 to 0.75, to have high discrimination capacity if the AUC is from 0.75 to 0.9 and to be an excellent discriminator if the AUC is from 0.9 to 1.
  • Zweig MH and Campbell G Clinical Chemistry 1993; 39:561-577 or Greiner et al. Preventive Veterinary Medicine 2000; 45:23-41.
  • the term "significant” or “statistically significant” when referring to differences between the test sample and the control or reference sample, relates to the condition when using the appropriate statistical analysis the probability of the groups being the same is less than 5%, e.g. p ⁇ 0.05. In other words, the probability of obtaining the same results on a completely random basis is less than 5 out of 100 attempts.
  • the appropriate statistical analysis is determined based on whether the variable under study has a normal distribution, for instance by using the test of Kolmogorov-Smirnov and on whether there is homoscedasticity, which is determined for instance with the Levene test.
  • a parametric model such as t-test or ANOVA test is used; and where at least one of these two requirements is not accomplished then a non-parametric model such as Mann-Whitney U test or Kruskal-Wallis test is generally used.
  • IBD Inflammatory bowel disease
  • CD Crohn's disease
  • UC ulcerative colitis
  • IBD phenotypes includes diseases or disorders such as CD, UC, indeterminate colitis, inflammatory bowel disease type unclassified (IBDU), pouchitis, microscopic colitis, diverticulitis (Mowat et al., Gut 201 1 , 1-37; Geboes et al., J Clin Pathol 2005;58: 1 133-1 134; Cheifetz A, and Itzkowitz S., J Clin Gastroenterol. 2004 May-Jun;38(5 Suppl 1 ):S44-50). It further includes subtypes within an IBD disease or disorder. CD subtypes are for instance those defined by the Montreal classification, wherein CD is classified according to age at diagnosis, location and/or behavior.
  • UC subtypes can be also those defined by the Montreal classification, wherein UC is classified according to disease extend and/or disease severity (World Gastroenterology Organisation Global Guidelines, Inflammatory bowel disease: a global perspective, June 2009; and Silverberg et al., Can J Gastroenterol. 2005, 19 Suppl A:5-36).
  • IBDU inflammatory bowel disease type unclassified
  • diagnosis test refers to a test which determines the presence or absence of a disease when a subject shows signs or symptoms of the disease. The test could be used to suggest or ruled out the disease or phenotype. The term diagnosis may include the differential diagnosis.
  • screening test refers to a test which identifies asymptomatic individuals who may have the disease and it is used for early detection of the disease. The test could be used to suspect the presence of the disease or phenotype.
  • test for monitoring progression refers to a test which determines whether the disease has been extended to other areas of the intestine, for instance monitoring whether the disease has progressed in a patient from l-CD (CD with ileal location) to IC-CD wherein the disease has been extended also to the colon.
  • efficacy of a treatment refers to the degree to which a treatment accomplishes the desired or projected outcomes, for instance the ability of a drug to achieve the desired effect.
  • treatment encompasses both a prophylactic or therapeutic treatment.
  • therapeutic treatment or “therapy” as used herein refers to bringing a body from a pathological state or disease back to its normal, healthy state.
  • prophylactic treatment refers to preventing a pathological state.
  • probe refers to synthetic or biologically produced nucleic acids, between 10 and 285 base pairs in length which contain specific nucleotide sequences that allow specific and preferential hybridization under predetermined conditions to target nucleic acid sequences, and optionally contain a moiety for detection or for enhancing assay performance.
  • a minimum of ten nucleotides is generally necessary in order to statistically obtain specificity and to form stable hybridization products, and a maximum of 285 nucleotides generally represents an upper limit for length in which reaction parameters can be easily adjusted to determine mismatched sequences and preferential hybridization.
  • Probes may optionally contain certain constituents that contribute to their proper or optimal functioning under certain assay conditions.
  • probes may be modified to improve their resistance to nuclease degradation (e.g., by end capping), to carry detection ligands (e.g., fluorescein) or to facilitate their capture onto a solid support (e.g., poly-deoxyadenosine "tails").
  • detection ligands e.g., fluorescein
  • solid support e.g., poly-deoxyadenosine "tails”
  • primers refers to oligonucleotides that can be used in an amplification method, such as a polymerase chain reaction ("PCR"), to amplify a nucleotide sequence. Primers are designed based on the polynucleotide sequence of a particular target sequence, e.g., one specific 16S rDNA sequence. Design and validation of primers and probes is well known in the art. For quantitative real-time PCR methods, see for instance Rodriguez A et al. (Methods Mol Biol., 2015, 1275:31-56).
  • nucleotide sequence will hybridize to/amplify a predetermined target sequence and will not substantially hybridize to/amplify a non-target sequence under the assay conditions, generally stringent conditions are used.
  • hybridization refers to a process by which, under predetermined reaction conditions, two partially or completely complementary strands of nucleic acid are allowed to come together in an antiparallel fashion to form a double-stranded nucleic acid with specific and stable hydrogen bonds, following explicit rules pertaining to which nucleic acid bases may pair with one another.
  • substantially hybridization means that the amount of hybridization observed will be such that one observing the results would consider the result positive with respect to hybridization data in positive and negative controls. Data which is considered “background noise” is not substantial hybridization.
  • stringent hybridization conditions means approximately 35°C to 65°C in a salt solution of approximately 0.9 molar NaCI. Stringency may also be governed by such reaction parameters as the concentration and type of ionic species present in the hybridization solution, the types and concentrations of denaturing agents present, and the temperature of hybridization. Generally as hybridization conditions become more stringent, longer probes are preferred if stable hybrids are to be formed. As a rule, the stringency of the conditions under which hybridization is to take place will dictate certain characteristics of the preferred probes to be employed.
  • identity refers to an exact nucleotide-to-nucleotide or amino acid to amino acid correspondence of two polynucleotides or polypeptide sequences, respectively.
  • Two or more sequences can be compared by determining their "percent identity".
  • the "percent identity" of two sequences is the number of exact matches between two aligned sequences divided by the length of the shorter sequence and multiplied by 100.
  • Suitable programs for calculating the percent identity or similarity between sequences are well known in the art, such as the NCBI BLAST program, used for example with default parameters (http://www. ncbi. nlm. gov/cgi-bin/BLAST).
  • kit or "testing kit” denotes combinations of reagents and adjuvants required for an analysis. Although a test kit consists in most cases of several units, one-piece analysis elements are also available, which must likewise be regarded as testing kits.
  • the invention relates to an in vitro method for determining the abundance of Faecalibacterium prausnitzii phylogroup I members (PHGI) and/or of Faecalibacterium prausnitzii phylogroup II members (PHGII) in an intestinal sample from a subject; wherein PHGI abundance determination comprises the use of a primer and/or probe with sequence SEQ ID NO: 3 or a sequence with at least 75% identity thereof; and wherein PHGII abundance determination comprises the use of a primer and/or a probe with sequence SEQ ID NO: 4 or a sequence with at least 75% identity thereof.
  • Faecalibacterium is a new genus created by Duncan et al. (Duncan et al., Int J Syst Evol Microbiol. 2002; 52, 2141-2146) with the following description: Faecalibacterium (Fae.ca.li.bac.te«ri.um. L. adj. faecalis pertaining to feces; Gr. dim. n. bakterion a small rod; N.L. neut. n. Faecalibacterium rod from feces, as this bacterium is present in high numbers in feces in the colon, its presumed habitat). Gram-negative, non-spore-forming and strictly anaerobic.
  • the non-motile organism produces butyrate,d-lactate and formate, and utilizes acetate.
  • Genomic DNA G-C content is 47 ⁇ 57 mol % (as determined by thermal denaturation).
  • the type strain whose characteristics were reported by Cato ef al. (1974), is Faecalibacterium prausnitzii ATCC 27768T (NCIMB 13872T). However, most of the recent studies performed on this species in the last ten years are based on strain A2-165 (DSM 17677) also described by Duncan et al. (Duncan et al., Int J Syst Evol Microbiol. 2002; 52, 2141-2146).
  • SEQ ID NO 14 (E.coli 395 F) CATG CCG CGTGTATG AAG AA
  • SEQ ID NO 15 (E.coli 490 R) CGGGTAACGTCAATGAGCAAA
  • SEQ ID NO 16 (E.coli 437 PR) TATTAACTTTACTCCCTTCCTCCCCGCTGAA
  • TestPrimeTM allows evaluating the performance of primer pairs by running an in silico PCR on the SILVA databases. From the results of the PCR, TestPrime computes coverages for each taxonomic group in all of the taxonomies offered by SILVA.
  • SILVA is a database which includes sequences of the 16S rRNA gene of all the Faecalibacterium sp. recovered through molecular methods by different studies. The designed primers were tested and targeted 74.85% of the of the 16S rRNA gene of Faecalibacterium sp. sequences in this dataset.
  • said primers enable the amplification of at least 60%, at least 65%, at least 70%, preferably around 75% of the known 16S rRNA gene of Faecalibacterium sp.
  • the known 16S rRNA gene of Faecalibacterium sp are those included in the SILVA database at the time of filing the application.
  • SILVA database includes only sequences from 16S rRNA gene but there may be other parts of the genomes of bacterial species which can match with the primers and cause false positive results
  • Faecalibacterium prausnitzii phylogroup I members are those bacterial sequences which 16S rRNA gene matched with the Phylogroup I probe (SEQ ID NO:3), this includes the 5 sequences used for probe design shown in Table 3 and the 1 191 sequences matched in the SILVA database, which accession numbers are provided in Table 4 (it is understood that the sequences listed in Table 3 also matched in the SILVA database but have not been repeated herein).
  • Phylogroup I probe (SEQ ID NO:3) was shown to hybridize specifically with a total of 1 196 16S rRNA gene sequences.
  • Faecalibacterium prausnitzii phylogroup II members are those bacterial sequences which 16S rRNA gene matched with the Phylogroup II probe (SEQ ID NO:4), this includes the 13 sequences used for probe design shown in Table 5 and the 2231 sequences matched in the SILVA database, which accession numbers are provided in Table 6_(it is understood that the sequences listed in Table 5 also matched in the SILVA database but have not been repeated herein).
  • Phylogroup II probe SEQ ID NO:4 was shown to hybridize specifically with a total of 2244 16S rRNA gene sequences.
  • FJ36331 1 FJ365339 FJ368052 FJ371264 FJ504203 FJ504627 FJ505262
  • FJ363484 FJ365467 FJ368369 FJ371741 FJ504302 FJ504716 FJ505354
  • FJ363488 FJ365502 FJ368415 FJ371852 FJ504315 FJ504727 FJ505388
  • FJ363642 FJ365569 FJ369823 FJ372098 FJ504350 FJ504770 FJ505448
  • FJ363861 FJ365712 FJ370091 FJ372209 FJ504388 FJ504969 FJ505461
  • FJ364280 FJ365873 FJ370184 FJ372330 FJ504458 FJ504979 FJ507023
  • FJ507650 FJ510176 FJ512868 FJ673658 FJ675865 FJ676871 FJ677780
  • FJ507656 FJ510521 FJ512875 FJ673737 FJ675969 FJ677020 FJ677882 FJ507657 FJ510534 FJ512885 FJ673761 FJ675980 FJ677040 FJ677909
  • FJ509494 FJ512310 FJ673191 FJ674077 FJ676410 FJ677326 FJ678466
  • FJ509842 FJ512332 FJ673301 FJ6741 1 1 FJ676416 FJ677381 FJ678533
  • the invention in a second aspect, relates to a method for the obtaining of useful information for the detection of an intestinal disease in a human subject and/or for the prediction of the efficacy of a drug in the therapeutic treatment of an intestinal disease in a human subject, comprising the determination of the abundance of PHGI and/or of PHGII according to a method of the first aspect; wherein preferably said intestinal disease is selected from the group consisting of inflammatory bowel disease (IBD), irritable bowel syndrome (IBS) and colorectal cancer (CRC).
  • IBD inflammatory bowel disease
  • IBS irritable bowel syndrome
  • CRC colorectal cancer
  • the invention pertains to a method for obtaining useful information from an intestinal sample of a human subject comprising the following steps:
  • Another embodiment pertains to a method for obtaining useful information from an intestinal sample of a human subject comprising determining the abundance of Faecalibacterium prausnitzii phylogroup I members (PHGI) in an intestinal sample from said subject.
  • a further embodiment relates to a method for obtaining useful information from an intestinal sample of a human subject comprising determining the abundance of PHGI and of PHGII in an intestinal sample from said subject.
  • PHGI Faecalibacterium prausnitzii phylogroup I members
  • Said information could be useful for detecting an intestinal disease in said human subject when comparing the PHGI abundance, and/or the PHGII abundance and/or a mathematical combination thereof, and/or optionally a mathematical combination of any of these with Total F. Prausnitzii (FT) abundance and/or E.coli (EC) abundance, in the subject sample with the corresponding values in a reference sample, wherein a significant deviation in the subject sample values with regard to said reference sample is indicative of intestinal disease.
  • FT Total F. Prausnitzii
  • EC E.coli
  • the invention relates to a method for detecting an intestinal disease in a human subject comprising the following steps:
  • PHGI Faecalibacterium prausnitzii phylogroup I members
  • PHGII Faecalibacterium prausnitzii phylogroup II members
  • said intestinal disease is selected from the group consisting of inflammatory bowel disease (IBD), irritable bowel syndrome (IBS) and colorectal cancer (CRC); and wherein said reference sample is preferably a healthy subject sample and/or the sample of a patient with intestinal disease in remission.
  • IBD inflammatory bowel disease
  • IBS irritable bowel syndrome
  • CRC colorectal cancer
  • said reference sample is preferably a healthy subject sample and/or the sample of a patient with intestinal disease in remission.
  • it relates to a method for detecting an intestinal disease in a human subject comprising the following steps: a. determining the abundance of Faecalibacterium prausnitzii phylogroup I members (PHGI) in an intestinal sample from said subject;
  • PHGI Faecalibacterium prausnitzii phylogroup I members
  • PHGII Faecalibacterium prausnitzii phylogroup II members
  • PHGI abundance optionally the PHGII abundance and/or a mathematical combination thereof, and/or optionally a mathematical combination of any of these with Total F. Prausnitzii (FT) abundance and/or E.coli (EC) abundance, in the subject sample with the corresponding values in a reference sample,
  • FT Total F. Prausnitzii
  • EC E.coli
  • the term detecting an intestinal disease as used herein includes the screening, diagnosis, differential diagnosis, and/or monitoring of disease activity and/or progression. In a particular embodiment, it relates to a method for detecting intestinal disease in a human subject comprising the following steps:
  • it relates to a method for detecting intestinal disease in a human subject comprising the following steps: a. determining the abundance of PHGI in an intestinal sample from said subject;
  • the PHGI abundance and PHGII abundance are determined.
  • the PHGI abundance and PHGII abundance, as well as the mathematical combination or relationship between said sequences is determined.
  • the PHGI abundance and/or PHGII abundance is determined, as well as the mathematical combination or relationship between any of these (e.g. ratio, multivariant analysis, etc.) with the Total F. Prausnitzii (FT) abundance and/or E.coli (EC) abundance.
  • the ratio between PHGI, PHGII, FT and/or EC abundance may be obtained by dividing the quantification levels of a first sequence by the quantification levels of a second sequence. For instance, the ratio of PHGII abundance/PHGI abundance is obtained by dividing the PHGII 16S rRNA gene sequence quantification levels by the PHGI 16S rRNA gene sequence quantification levels.
  • the ratio between PHGI, PHGII, FT and/or EC abundance may also be obtained by subtracting from the quantification levels of a first sequence the quantification levels of a second sequence.
  • the ratio of PHGII abundance/PHGI abundance is obtained by subtracting from the PHGII 16S rRNA gene sequence quantification levels the PHGI 16S rRNA gene sequence quantification levels.
  • Preferred ratios of the invention are PHGI abundance/PHGI I abundance (PHGI/PHGII), PHGI abundance/EC abundance (PHGI/EC), PHGII abundance/EC abundance (PHGII/EC), FT abundance/PHGI abundance (FT/PHGI), and FT abundance /PHGII abundance (FT/PHGII) and viceversa.
  • Particularly preferred ratios are PHGI/EC and PHGII/EC.
  • quantification has been performed by qPCR (described below) and quantification levels are expressed as the cycle threshold value (Ct value). More preferably, the ratios are calculated by subtraction.
  • the ratio between the PHGII abundance and the PHGI abundance is determined and the PHGII/PHGI ratio in said subject sample compared with the PHGII/PHGI ratio in a reference sample, wherein a significant deviation in the subject sample values with regard to said reference sample is indicative of intestinal disease.
  • Molecular biology methods for measuring quantities of target nucleic acid sequences are well known in the art. These methods include but are not limited to end pointPCR, competitive PCR, reverse transcriptase-PCR (RT-PCR), quantitative PCR (qPCR), reverse transcriptase qPCR (RT-qPCR), PCR- pyrosequencing, PCR-ELISA, DNA microarrays, in situ hybridization assays such as dot-blot or Fluorescence In Situ Hybridization assay (FISH), branched DNA (Nolte, Adv. Clin. Chem. 1998,33:201- 235) and to multiplex versions of said methods (see for instance, Andoh et al., Current Pharmaceutical Design, 2009; 15,2066-2073).
  • a multiplex assay is an assay that simultaneously measures multiple analytes, typically dozens or more, in a single run/cycle of the assay.
  • Preferred primers and/or probes react in a predictable manner, typically by offering a direct and linear response to increasing amounts of bacterial nucleic acid sequences.
  • said molecular method for gene quantification is selected from the group consisting of quantitative Polymerase Chain Reaction (qPCR), PCR-pyrosequencing, fluorescence in-situ hybridization (FISH), DNA microarrays, and PCR-ELISA.
  • FISH fluorescence in situ hybridization
  • qPCR quantitative PCR
  • Different instruments are available, such as ABI Prism 7700 SDS, GeneAmp 5700 SDS, ABI Prism 7900 HT SDS from Applied Biosystems; iCycler iQ from Bio-Rad; Smart Cycler from Cepheid; Rotor- Gene from Corbett Research; LightCycler from Roche Molecular Biochemicals and Mx4000 Multiplex from Stratagene.
  • the qPCR process enables accurate quantification of the PCR product in real-time by measuring PCR product accumulation very early in the exponential phase of the reaction, thus reducing bias in the quantification linked to the PCR amplification efficiency occurring in end-point PCR.
  • Real-time PCR is well known in the art and is thus not described in detail herein.
  • Technology overview and protocols for qPCR are available for instance from the above-mentioned vendors, e.g., http://www.sigmaaldrich.com/technical-documents/protocols/biology/sybr-green-qpcr.html or http://www.sigmaaldrich.com/life-science/molecular-biology/pcr/quantitative-pcr/qpcr-technical-guide.html.
  • the quantification method is a multiplex qPCR.
  • 16S rRNA differs for each bacterial species.
  • a bacterial species is hard to define, but is often taken as organisms with 16S rRNA gene sequences having at least 97% identity, defined as an operational taxonomic unit (OTU).
  • OTU operational taxonomic unit
  • a 16S rRNA gene sequence of about 1.5 kilobases has nine short hypervariable regions that distinguish bacterial taxa; the sequences of one or more of these regions are targeted in a community census (Weinstock B.M, Nature 2012, 489,250-256).
  • Protein coding genes for instance housekeeping genes may also be used. Roux et al. (FEMS Microbiol Ecol 78 (201 1 ) 617-628), describes the use of five protein marker genes (rplB, pyrG, fusA, leuS and rpoB), for which primer sets were available, as taxonomic markers for ecological studies. The use of nucleotidyl transferase gene and the butyryl-CoA transferase gene for specific target bacteria quantification purposes has also been described (Jia et al. FEMS Microbiol Lett. 2010; 310: 138-144). Different detecting chemistries are available for qPCR. All of them can be used with the above-mentioned qPCR instruments.
  • detection chemistry refers to a method to report amplification of specific PCR product in real-time PCR and may include hydrolysis or TaqMan® probes; molecular beacons; scorpions; hybridization probes and DNA-binding dyes such as SYBR® Green I. These are described in detail for instance in Giulietti et al., Methods 2001 ; 25, 386-401.
  • said probes are dual-labelled oligonucleotides, such as hydrolysis probes or molecular beacons.
  • the 5' end of the oligonucleotide is typically labelled with a fluorescent reporter molecule while the 3' end is labelled with a quencher molecule.
  • the sequence of the probe is specific for a region of interest in the amplified target molecule.
  • said probe is a hydrolysis probe which is designed so that the length of the sequence places the 5' fluorophore and the 3' quencher in close enough proximity so as to suppress fluorescence.
  • PHGI and/or PHGII abundance determination is carried out by 16S rRNA gene quantification.
  • PHGI abundance determination is carried out by quantifying Faecalibacterium prausnitzii 16S rRNA gene sequences hybridizing specifically with SEQ ID NO: 3 or a sequence with at least 75% identity thereof.
  • PHGI abundance determination is carried out by quantifying a Faecalibacterium prausnitzii 16S rRNA gene sequence comprising or consisting of SEQ ID NO: 3 or a sequence with at least 75% identity thereof.
  • PHGII abundance determination is carried out by quantifying Faecalibacterium prausnitzii 16S rRNA gene sequences hybridizing specifically with SEQ ID NO: 4 or a sequence with at least 75% identity thereof.
  • PHGII abundance is determined by quantifying a Faecalibacterium prausnitzii 16S rRNA gene sequence comprising or consisting of SEQ ID NO: 4 or a sequence with at least 75% identity thereof.
  • PHGI abundance determination is carried out by quantifying a Faecalibacterium prausnitzii 16S rRNA gene sequence comprising or consisting of SEQ ID NO: 3 and PHGII abundance by quantifying a Faecalibacterium prausnitzii 16S rRNA gene sequence comprising or consisting of SEQ ID NO: 4.
  • PHGI 16S rRNA gene quantification is performed with at least one oligonucleotide molecule of sequence SEQ ID NO: 1 or SEQ ID NO: 2, or a sequence with at least 75% identity thereof; and/or an oligonucleotide molecule of sequence SEQ ID NO: 3 or a sequence with at least 75% identity thereof.
  • oligonucleotide molecules of sequence SEQ ID NO: 1 and SEQ ID NO: 2 are used.
  • PHGI 16S rRNA gene quantification is performed with primers consisting of oligonucleotide sequences SEQ ID NO: 1 and SEQ ID NO: 2, or a sequence with at least 75% identity thereof; and/or a probe consisting of oligonucleotide sequence SEQ ID NO: 3 or a sequence with at least 75% identity thereof.
  • PHGII 16S rRNA gene quantification is performed with at least one, oligonucleotide molecule of sequence SEQ ID NO: 1 or SEQ ID NO: 2, or a sequence with at least 75% identity thereof; and/or an oligonucleotide molecule of sequence SEQ ID NO: 4, or a sequence with at least 75% identity thereof.
  • oligonucleotide molecules of sequence SEQ ID NO: 1 and SEQ ID NO: 2 are used.
  • PHGII 16S rRNA gene quantification is performed with primers consisting of oligonucleotide sequences SEQ ID NO: 1 and SEQ ID NO: 2, or a sequence with at least 75% identity thereof; and/or a probe consisting of oligonucleotide sequence SEQ ID NO: 4, or a sequence with at least 75% identity thereof.
  • said oligonucleotide sequences with at least 75% identity described herein have at least 80%, at least 85%, at least 90%, at least 95%, more preferably 96%, 97%, 98%, 99% or 100% identity with the respective sequence (e.g., SEQ ID NO: 1 , SEQ ID NO: 2, SEQ ID NO: 3 and/or SEQ ID NO: 4 respectively); a nucleotide molecule with a sequence identity of 100% being particularly preferred.
  • these oligonucleotide sequences with at least 75% identity may have the same nucleotide number, may be longer or shorter than SEQ ID NO: 1 , SEQ ID NO: 2, SEQ ID NO: 3 and/or SEQ ID NO: 4.
  • PHGI 16S rRNA gene quantification is performed, preferably by qPCR, with primers consisting of oligonucleotide sequences SEQ ID NO: 1 and SEQ ID NO: 2, and a probe consisting of oligonucleotide sequence SEQ ID NO: 3.
  • PHGII 16S rRNA gene quantification is performed, preferably by qPCR, with primers consisting of oligonucleotide sequences SEQ ID NO: 1 and SEQ ID NO: 2, and a probe consisting of oligonucleotide sequence SEQ ID NO: 4.
  • Said oligonucleotide sequences may be modified.
  • probes may be modified to improve their resistance to nuclease degradation (e.g., by end capping), to carry detection ligands (e.g., fluorescein) or to facilitate their capture onto a solid support (e.g., poly-deoxyadenosine "tails").
  • detection ligands e.g., fluorescein
  • solid support e.g., poly-deoxyadenosine "tails”
  • said PHGI specific probe consists of SEQ ID NO: 3 or a sequence with at least 75% identity thereof which has been modified.
  • it is a dual labelled probe as described above, more preferably a hydrolysis probe.
  • SEQ ID NO: 3 is modified with 6FAM (6-carboxyfluorescin) in its 5' end and with BHQ1 (Black Hole Quencherl ) in its 3' end and it is represented as 6FAM-TAAGCCCACGACCCGGCATCG-BHQ1.
  • said PHGII specific probe consists of SEQ ID NO: 4 or a sequence with at least 75% identity thereof, which has been modified.
  • it is a dual labelled probe, more preferably a hydrolysis probe.
  • SEQ ID NO: 4 is modified with JOE (4',5'- dichloro-2',7'-dimethoxy-5(6)-carboxyfluorescein) in its 5' end and with BHQ1 (Black Hole Quencherl ) in its 3' end and it is represented as JOE-TAAGCCCACRGCTCGGCATC-BHQ1.
  • Said intestinal sample may be an intestinal biopsy.
  • Several methods are well known in the art for the obtaining of intestinal biopsies, e.g. by endoscopy.
  • said intestinal sample is a non-invasive intestinal sample.
  • a non-invasive intestinal sample may be for instance, an intestinal biopsy obtained by a non-invasive method, such as a rectal sigmoidoscopy, and also a feces sample.
  • said intestinal sample is a feces sample.
  • DNA is extracted from the intestinal sample prior to gene quantification. After sample collection, fresh samples can be processed and DNA extracted immediately. Alternatively, several treatments are commonly known in order to preserve the quality of DNA before extraction, such as freezing or mixing with a buffer or DNA stabilization solution. Prior to DNA extraction, the sample may also be subject to additional processing, such as to one or more washing cycles.
  • said intestinal sample is a biopsy sample and DNA is extracted from said sample prior to the quantification of said bacterial sequences.
  • said intestinal sample is a feces sample and DNA is extracted from the feces sample prior to the quantification of said bacterial sequences.
  • DNA extraction methods from biological samples are well known in the art, all these methods relying on chemical or mechanical disruption of the cells, lysis using detergents, or a combination of these approaches (Kennedy A. et al., PLoS One, 2014;9(2):e88982).
  • DNA from a biopsy sample may be extracted for instance using the NucleoSpin® Tissue Kit (Macherey-Nagel Gmbh& Co. KG).
  • Preferred, methods use a combination of mechanical disruption, such as high speed bead beating extraction, chemical lysis and a final purification step, preferably using silica membrane column such as those included in the commercially available DNA extraction kits "MobioPowerSoil® DNA extraction procedure” (Mo-Bio Laboratories Inc.,), FastDNA® SPIN Kit for soil procedure (MP biomedicals) and NucleoSpin® Soil (Macherey-Nagel Gmbh& Co. KG).
  • silica membrane column such as those included in the commercially available DNA extraction kits "MobioPowerSoil® DNA extraction procedure” (Mo-Bio Laboratories Inc.,), FastDNA® SPIN Kit for soil procedure (MP biomedicals) and NucleoSpin® Soil (Macherey-Nagel Gmbh& Co. KG).
  • PCR inhibitors in the DNA extracts from fecal samples such as bilirubins, bile salts and complex carbohydrates is one of the difficulties faced for the determination of DNA biomarkers in DNA extracts from feces (Fleckna et al., Mol Cell Probes, 2007;21 (4):282-7).
  • Preferred DNA extraction methods are those that provide fecal extracts with a low amount of PCR inhibitors, such as less than 5%, preferably less than 2%, more preferably less than 1 %, even more preferably less than 0.5%, such as less than 0.25%, 0.1 %, 0.05% or 0.01 %.
  • Quantification levels can be absolute or relative. It is generally preferred that the abundance levels are normalized. Normalization can be performed with respect to different measurements in the sample, such as by sample weight, human cells quantification, total DNA quantification, total bacteria quantification, total F. prausnitzii quantification or the other F. prausnitzii phylogroup quantification. These methods are well known to a person skilled in the art.
  • the quantification of PHGI and/or PHGII abundance levels is performed by qPCR and the quantification levels are normalized.
  • normalization is carried out with respect to total bacteria 16S rRNA gene quantification, for example as the median log 10 16S rRNA gene copies/ million bacterial rRNA gene copies.
  • Preferred primers and probe for total bacteria quantification are those described in Furet J-P, et al. FEMS Microbiology Ecology. 2009;68:351- 362 and specified in Table 15, see the Examples.
  • the method of the invention may further comprise detecting and/or quantifying one or more biomarkers of intestinal disease, preferably these markers are specific of IBD or a particular IBD phenotype, more preferably these markers are specific of UC or CD, even more preferably these markers are specific of CD.
  • IBD biomarkers and its implications for classification and diagnosis are described for instance in Silverberg et al., Can J Gastroenterol. 2005, 19 Suppl A:5-36, and Satsangi et al., Gut 2006; 55, 749-753.
  • biomarker refers to markers of disease which are typically substances found in a bodily sample that can be easily measured.
  • Said bodily sample can be for instance a blood, plasma or feces sample.
  • the measured amount correlates to an underlying disease pathophysiology, such as presence or absence of a particular IBD disease or phenotype, making it useful for diagnosing and measuring the progress of a disease or the effects of a treatment.
  • biomarker encompasses biophysical and biochemical determinations, including genetic and serological markers.
  • Serological biomarkers may be used, such as for instance anii-Saccharomyces cerevisiae antibodies (ASCA), antineutrophil cytoplasmic autoantibodies (ANCA), anti-OMPC and anti-12, and anti-CBirl flagellin antibodies.
  • ASCA anii-Saccharomyces cerevisiae antibodies
  • ANCA antineutrophil cytoplasmic autoantibodies
  • anti-OMPC anti-12
  • anti-CBirl flagellin antibodies Other authors have reported that the combination of ASCA, ANCA, anti-OmpC, and anti-12 may help in the subclassification of CD, in particular that these serological markers are associated with particularly complicated and severe disease behaviour, including need for surgery.
  • Genetic markers might also be used, such as NOD2/CARD15, HLA, MDR1 , DLG5 or TLR4 genes.
  • Microbiota biomarkers may also be used.
  • PHGI and/or PHGII abundance is used in combination with leucocyte counts. It has been previously reported that CD and UC could be differentiated through monitoring F. prausnitzii abundance in conjunction with fecal leucocyte counts (Swidsinski et al., Inflamm Bowel Dis. 2008; 14: 147-161 ).
  • PHGI and/or PHGII abundance is used in combination with Escherichia coli abundance.
  • Lopez-Siles et al. International Journal of Medical Microbiology. 2014;304:464-475) described the use of F. prausnitzii abundance in combination with Escherichia coli abundance as a complementary contrasting indicator.
  • the method of the invention further comprises the quantification of total F. prausnitzii (FT) and/or E.coli (EC).
  • FT abundance determination may be performed with primers with sequence SEQ ID NO: 5 and SEQ ID NO: 6, or a sequence with at least 75% identity thereof; and a probe with sequence SEQ ID NO: 7 or a sequence with at least 75% identity thereof.
  • EC abundance determination may be performed with primers with sequence SEQ ID NO: 14 and SEQ ID NO: 15, or a sequence with at least 75% identity thereof; and a probe with sequence SEQ ID NO: 16 or a sequence with at least 75% identity thereof.
  • said oligonucleotide sequences with at least 75% identity described herein have at least 80%, at least 85%, at least 90%, at least 95%, more preferably 96%, 97%, 98%, 99% or 100% identity with the respective sequence (e.g., SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 14, SEQ ID NO: 15, and/or SEQ ID NO: 16, respectively); a nucleotide molecule with a sequence identity of 100% being particularly preferred.
  • said reference sample can be an individual sample or a collection of samples of the population of reference.
  • the population of reference is generally selected according to the use given to the method of the invention, for example, for diagnosis said population of reference would typically be a healthy subject or a patient in remission, whereas for determining the activity or progression of the disease the population of reference would generally be the same patient at a previous point in time, e.g. at diagnosis or in remission.
  • intestinal disease refers to those diseases affecting the small intestine, the colon and/or rectum.
  • said intestinal disease is selected from the group consisting of CRC, IBS and IBD.
  • said intestinal disease is CRC.
  • said intestinal disease is IBS.
  • said intestinal disease is IBD.
  • the method of the invention may be used for the screening or early detection of intestinal disease, for the diagnosis of intestinal disease, for the determination of disease activity, for monitoring of progression and/or activity of intestinal disease, for monitoring relapses of intestinal disease, and/or for monitoring postsurgical recurrence of intestinal disease, and/or for determining efficacy of a treatment on an intestinal disease.
  • the method of the invention is used for the screening or early detection of IBD, for the diagnosis of IBD, for monitoring progression of IBD, for monitoring relapses of IBD, and/or for monitoring postsurgical recurrence of IBD, and/or for determining efficacy of a treatment on IBD.
  • IBD alternates periods where the patients have symptoms of the disease (flare ups) and other periods where they do not have the symptoms and they are in remission. When a patient is in a remission period and then switches to present them they have a relapse. A test for detecting presence of the disease may also enable to detect relapses.
  • post-surgical recurrence refers to those situations where the treatment is unsuccessful and after a certain period of time the patient suffers from IBD again.
  • a test for detecting presence of the disease may also enable to detect postsurgical recurrence.
  • the method of the invention is used for the screening and/or diagnosis of an intestinal disease, preferably of IBD.
  • said reference sample is a healthy subject sample and/or the sample of a subject with intestinal disease in remission.
  • a healthy subject is defined as a subject not suffering from intestinal disease, preferably not suffering from IBD, more preferably not suffering of CD or UC.
  • Said sample from a healthy patient can be obtained for instance from patients who underwent colonoscopy for different reasons, such as rectorrhagia, CRC familial history or abdominal pain.
  • said reference sample is the sample of the same subject in remission.
  • Biomarkers for the determination of healthy digestive status according to the present invention are shown in Examples 14 and 15. Particularly preferred biomarkers for the determination of healthy digestive status are PHGI/EC, PHGII/EC, FT/PHGI and FT/PHGII.
  • the PHGI/EC, PHGII/EC ratios were shown to decrease in samples from healthy patients in Example 14, whereas FT/PHGI and FT/PHGII were shown to be good discriminators by ROC curve analysis in Example 15
  • the method of the invention is used for prognosis purposes.
  • the method of the invention is used for selecting the most appropriate prophylactic or therapeutic treatment.
  • the method of the invention is used for predicting the efficacy or usefulness of a given prophylactic or therapeutic treatment.
  • said treatment is a therapeutic treatment.
  • Biomarkers for the screening and/or diagnosis of IBD, CD and/or UC according to the present invention are shown in Examples 14 and 15. Particularly preferred biomarkers for the screening and/or diagnosis of IBD are PHGI, PHGII, PHGI/EC and PHGII/EC. PHGI and PHGII whose abundance decreases in IBD, and PHGI/EC and PHGII/EC ratios that increase in IBD. IBD may be UC or CD. In a particular embodiment, said IBD is UC. Particularly preferred biomarkers for the screening and/or diagnosis of UC are PHGI, PHGII PHGI/EC and PHGII/EC.
  • PHGI, PHGII whose abundance decreases in UC, and PHGI/EC and PHGII/EC ratios that increase in UC, preferably PHGI/EC and PHGII/EC.
  • said IBD is CD.
  • biomarkers for the screening and/or diagnosis of CD are PHGI, PHGII, PHGI/EC and PHGII/EC.
  • CD is distinguished from UC by disease proximal to the colon, perineal disease, fistulas, histologic granulomas, and full-thickness as opposed to mucosa-limited disease.
  • granulomas are evident in up to 50% of patients and fistulas in 25%.
  • Table 7 below from the World Gastroenterology Organisation Global Guidelines (Inflammatory bowel disease: a global perspective, June 2009) provides an overview on the current diagnostic criteria for UC and CD:
  • Table 9 Main differential diagnoses for Ulcerative colitis (UC) and Crohn's disease (CD). • Ty ical UC features Typical CD features
  • the method of the invention for the detection of an intestinal disease is a method for the differential diagnosis between CD and UC.
  • Biomarkers for the differential diagnosis between CD and UC according to the present invention are shown in Examples 14 and 15. Particularly preferred biomarkers for the differential diag nosis between CD and UC are PHGI, PHGII as identified by ROC curve analysis and, PHGI/EC and PHGII/EC ratios that increase in CD.
  • Subtypes classification is typically performed using international classifications, such as those issued by the international working group on its report of Rome 1991 , Vienna 1998 or Montreal 2005.
  • IBD subtypes are determined according to the Montreal classification (further details on the Montreal classification are provided below).
  • E1 ulcerative proctitis: involvement limited to the rectum
  • E2 distal colitis: involvement limited to the portion of the colorectum distal to the splenic flexure
  • CD patients are classified according to the location of the disease in the following sub-types: ileal CD (l-CD), ileocolonic CD (IC-CD), and colonic CD (C-CD).
  • Biomarkers for the detection of l-CD, IC-CD and C-CD according to the present invention are shown in Example 16. Particularly preferred biomarkers for the detection of l-CD are PHGI/PHGII, and FT/PHGII which were shown to be good discriminators by ROC curve analysis.
  • a preferred biomarker for the detection of IC-CD is FT/PHGI which was shown to be a good discriminator by ROC curve analysis.
  • said ratios have been calculated by subtraction as described above and in the Examples.
  • PHGI abundance is determined and a significant reduction of PHGI abundance levels in the subject sample with regard to said reference sample is indicative of CD, preferably of CD with ileal involvement (IC-CD or l-CD).
  • Particularly preferred biomarkers for the detection of C-CD are PHGI, PHGII, PHGI/PHGII, PHGI/EC and PHGII/EC, preferably PHGI and PHGI/EC which were shown to be good discriminators by ROC curve analysis.
  • said ratios have been calculated by subtraction as described above and in the Examples.
  • the PHGII/PHGI ratio is determined and a significant deviation in the subject sample values with regard to said reference sample is indicative of CD, preferably of CD with colonic involvement (C-CD or IC-CD).
  • PHGI abundance and PHGII abundance is determined and a significant reduction of PHGII with no significant reduction of PHGI is indicative of l-CD.
  • the method of the invention may also comprise combining the results of PHGI abundance, PHGII abundance and/or further biomarkers detection and/or quantification as described herein with other indicators of intestinal disease, preferably of IBD.
  • IBD The diagnosis of IBD is generally confirmed by clinical evaluation and a combination of laboratory, endoscopic, histological, or imaging-based investigations.
  • the result of these clinical, laboratory, endoscopic, histological, and imaging-based investigations alone or in combination can be indicators of IBD.
  • Clinical investigations are typically endoscopy, histopathology, and imaging tests, including ultrasound, magnetic resonance imaging, computed tomography scanning, barium fluoroscopy and/or isotope-labelled scans (Mowat et al., Gut 201 1 , 1-37).
  • Laboratory investigations may include full blood count, urea and electrolytes, liver function tests, erythrocyte sedimentation rate, C reactive protein, ferritin, transferrin saturation, vitamin B12, and folate.
  • said laboratory tests include fecal tests.
  • Fecal tests commonly used for IBD diagnosis are routine fecal examinations and cultures to eliminate bacterial, viral or parasitic causes of diarrhea, to exclude inter alia Clostridium difficile or cytomegalovirus infections, checking for occult blood or fecal leukocytes, calprotectin, lactoferrin and a1-antitripsin.
  • the method of the invention is used in combination with the fecal calprotectin test.
  • Calprotectin is an abundant neutrophil protein found in both plasma and stool that is markedly elevated in infectious and inflammatory conditions, including IBD.
  • the role of fecal calprotectin as a biomarker of intestinal inflammation in IBD has previously been described, see for instance, Konikoff and Denson, Inflamm Bowel Dis. 2006; 12(6):524-34; or Van Rheenen et al. BMJ 2010;341 :c3369.
  • indexes used to assess disease activity can be for instance validated clinical indices: Crohn's Disease Activity Index (CDAI) (Best, W.R., et al. Gastroenterology, 1976.
  • CDAI Crohn's Disease Activity Index
  • PDAI Perianal Disease Activity Index
  • IBDQ Inflammatory Bowel Disease Questionnaire
  • CDEIS Crohn's Disease Endoscopic Index of Severity
  • SES-CD Simple Endoscopic Score for Crohn's Disease
  • Rutgeeerts' score for postsurgical recurrence see Sostegni et al., Aliment Pharmacol Ther. 2003; 17 Suppl 2: 1 1-7.
  • UC see for instance, True Love and Witts (Journal of Crohn's and colitis 2008; 2: 1-23) or the Sutherland Disease Activity Index (Sutherland et al. Gastroenterology 1987;92: 1894-8; and for CD, see for instance the Harvey-Bradshaw simplified Crohn's disease activity index (Lancet. 1980;315 (8167):514).
  • the invention relates to a method for determining disease activity (i.e., calprotectin levels over 250 ⁇ g g) wherein said method comprises steps a) and b) as defined in the above aspect, wherein a significant deviation in the subject sample values with regard to said reference sample is indicative of active intestinal disease.
  • disease activity i.e., calprotectin levels over 250 ⁇ g g
  • Biomarkers for detecting disease activity in IBD, UC or CD according to the present invention are shown in Example 18.
  • Particularly preferred biomarkers for detecting disease activity in CD are PHGI, PHGII, PHGII/EC.
  • PHGI which was shown to be a good discriminator by ROC curve, PHGII, whose abundance decreases in active CD, and PHGII/EC ratio that increases.
  • particularly preferred biomarkers for detecting disease activity in UC are PHGI, PHGII, FT/PHGI, and PHGI/PHGII.
  • PHGI whose abundance decreases in active UC
  • PHGII which was shown to be a good discriminator by ROC curve
  • FT/PHGI ratio that decreases
  • PHGI/PHGII ratio that decreases
  • PHGI/EC ratio that increases.
  • PHII for CD and PHI for UC disease appear to be the perfect discriminators for disease activity (i.e., calprotectin levels over 250 ⁇ g/g).
  • the invention refers to a method for the monitoring of the activity of an intestinal disease in a human subject comprising steps a) and b) as defined in the above aspect, wherein a significant deviation in the subject sample values with regard to said reference sample is indicative of active intestinal disease and wherein said reference sample is preferably a previous sample of the same subject (e.g., at diagnosis or in remission).
  • said intestinal disease is preferably selected from the group consisting of inflammatory bowel disease (IBD), irritable bowel syndrome (IBS) and colorectal cancer (CRC), and more preferably is IBD.
  • said mathematical combination with FT abundance and/or EC abundance is a ratio selected from the group consisting of: PHGI abundance/EC abundance, PHGII abundance/EC abundance, FT abundance/PHGI abundance, and FT abundance/PHGII abundance.
  • abundance determination is performed by qPCR and is expressed as threshold cycle (Ct) value and said ratio is obtained by subtracting from the first Ct value the second Ct value.
  • Biomarkers for the monitoring of disease activity according to the present invention are shown in Example 19. Particularly preferred biomarkers for the monitoring of disease activity (i.e., determination of increased inflammatory activity between two time points) in UC are PHGI, and, FT/PHGI ratio, that decrease.
  • tumour necrosis factor a such as infliximab, adalimumab, cetolizumab pegol, etanercept, and golimumab.
  • TNFa tumour necrosis factor a
  • infliximab adalimumab
  • cetolizumab pegol adalimumab
  • golimumab a tumour necrosis factor a
  • Intestinal resection is also indicated in those patients with fulminant or fistulising CD and for those patients unresponsive to any of the previously mentioned medication (refractory cases). More recently, persistence of unmet therapeutic needs in CD patients with refractory disease has raised interest in innovative cellular immunoregulatory and regenerative medicines including autologous hematopoietic stem cell transplant.
  • Preferred treatments are mesalazine, moderate immunosuppressants, such as azathioprine, or methotrexate, and anti-TNF a agents, such as infliximab, adalimumab, cetolizumab pegol, etanercept, and golimumab.
  • moderate immunosuppressants such as azathioprine, or methotrexate
  • anti-TNF a agents such as infliximab, adalimumab, cetolizumab pegol, etanercept, and golimumab.
  • the invention further provides a method for predicting the efficacy of a treatment.
  • a particular embodiment relates to a method for predicting the efficacy of a treatment in a human subject suffering from IBD, wherein said method comprises:
  • PHGI Faecalibacterium prausnitzii phylogroup I members
  • PHGII Faecalibacterium prausnitzii phylogroup II members
  • FT Total F. Prausnitzii
  • EC E.coli
  • the invention refers to an in vitro method for the classification of a subject suffering from IBD as responder to a treatment, said method comprising steps a) and b) of the above aspect of the invention, wherein a significant deviation in the subject sample values with regard to said reference sample is indicative of increased possibilities of response to the treatment and wherein a subject with increased possibilities of response is classified as responder.
  • the invention refers to a method for selecting a treatment for a subject suffering from IBD, said method comprising the classification of the subjects as responders or non-responders to a treatment as described in the above aspect, and the selection of said treatment for responders.
  • Said treatment may be any of the recited above.
  • said treatment is with an anti-TNFalpha agent.
  • said reference sample is a healthy subject sample or a sample of a patient with intestinal disease in remission.
  • Other preferred features and embodiments are as defined above for other aspects of the invention.
  • Biomarkers for the determination of response to TNF-alpha treatment according to the present invention are shown in Example 20.
  • Particularly preferred biomarkers for the classification of subjects as responders or non-responders of TNF-alpha treatment are PHGI and PHGII.
  • PHGI Ct were increased in non-responders of UC and CD (26.80% and 53.94%, respectively) and PHGII Ct were 66.82% increased in non-responders of UC.
  • responder refers to those subjects suffering from IBD (e.g., CD or UC) which show a decrease in inflammation, i.e., a decrease of calprotectin levels below 250 ⁇ g G after biological treatment induction.
  • IBD e.g., CD or UC
  • induction refers to the time period where different treatment dosage is given to achieve the therapeutic dose.
  • treatment may be based on surgery.
  • the treatment is a combination of pharmacotherapy and surgery.
  • UC is typically surgically curable.
  • surgical resection is often not curative in CD, with recurrence being the norm.
  • Surgical intervention in IBD includes inter alia the following:
  • Fulminant colitis Surgical procedure of choice is subtotal colectomy with end ileostomy and creation of a Hartmann pouch;
  • CD Surgery most commonly performed in cases of disease complications of the disease; generally consists of conservative resection (eg, potential stricturoplasty vs resective surgery) to preserve bowel length in case future additional surgery needed;
  • Severe perianal fistulas Option for diverting ileostomy; generally, resection for symptomatic enteroenteric fistulas.
  • the invention further provides a method for treating a subject which has an intestinal disease, wherein said method comprises the steps of the method of the invention for the detection of an intestinal disease as described herein and further comprises c) administering a treatment to this subject.
  • said treatment is an anti-TNF alpha agent.
  • the invention also provides a method for treating a subject which has an intestinal disease, wherein said method comprises the steps of the method of the invention for classifying a subject as a responder or non-responder and further comprises c) administering a treatment to a subject which is a responder.
  • said treatment is an anti-TNF alpha agent.
  • the method of the invention further comprises storing the results of the method in a data carrier.
  • said data carrier is a paper sheet.
  • said data carrier is a computer readable medium.
  • a computer readable medium can be any apparatus that may include, store, communicate, propagate, or transport the results of the determination of the method of the invention.
  • the medium can be an electronic, magnetic, optical, electromagnetic, infrared, or semiconductor system (or apparatus or device) or a propagation medium.
  • Sensitivity, specificity, and accuracy, or a combination thereof are parameters typically used to describe the validity or performance of a test. In particular, they are used to quantify how good and reliable the method is.
  • the method of the invention has a sensitivity of 70% to 90%, 75% to 95%, 80% to 95%, 85% to 100%, or 90% to 100%. More preferably, the method of the invention has sensitivity values of at least 85%, such as about 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 97.5%, 98%, 99% or 100%.
  • the method of the invention has a specificity of 70% to 90%, 75% to 95%, 80% to 95%, 85% to 100%, or 90% to 100%. More preferably, the method of the invention has specificity values of at least 85%, such as about 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 97.5%, 98%, 99% or 100%.
  • the method for detecting inflammatory bowel disease (IBD) of the present invention diagnoses, early detects, determines progression, determines relapses, determines recurrence and/or determines efficacy of a treatment in an statistically significant manner with a sensitivity and/or specificity of at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97.5%, or preferably 100%.
  • the accuracy of the method of the invention is of at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97.5%, or preferably 100%. In a preferred embodiment, it has an accuracy of 70% to 90%, 75% to 95%, 80% to 95%, 85% to 100%, or 90% to 100%.
  • the method of the invention has accuracy values of at least 85%, such as about 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 97.5%, 98%, 99% or 100%.
  • Sensitivity, specificity and accuracy parameters are proportions, thus the according confidence intervals can be calculated by using standard methods for proportions well known in the art. Two types of 95% confidence intervals are generally defined around proportions. The exact confidence interval is defined by using binomial distribution to reach an exact estimate. Asymptotic confidence interval is calculated by assuming a normal approximation of the sample distribution. A person skilled in the art will know how to define the appropriate confidence interval. The choice of one or another type of confidence interval will typically depend on whether the sample proportion is a good approximation to a normal distribution.
  • Accuracy is preferably determined by the area under the ROC curve.
  • the "ROC curve” is a graphic presentation of the relationship between both sensitivity and specificity and it helps to decide the optimal model through determining the best threshold (optimal cut-point) for the screening test.
  • the area under ROC curve (AUC) provides a way to measure the accuracy of a test.
  • the AUC range values of the method of the invention are from 0.6 to 1 , more preferably 0.7 to 1 , more preferred values being in the range of 0.75 to 1 , more preferably of 0.8 to 1 or of 0.9 to 1 .
  • AUC is from 0.7 to 0.9, from 0.7 to 0.95, from 0.75 to 0.9, from 0.75 to 0.95, from 0.8 to 0.9, from 0.8 to 0.95, from 0.85 to 0.9, or from 0.85 to 0.95.
  • the method for detecting inflammatory bowel disease (IBD) of the present invention diagnoses, early detects, determines progression, determines relapses, determines recurrence and/or determines efficacy of a treatment in an statistically significant manner with an AUC value of at least 0.6, at least 0.65, at 0.7, at least 0.75, at least 0.8, at least 0.85, at least 0.9, at least 0.95 or higher.
  • the invention relates to the use of Faecalibacterium prausnitzii phylogroup I members (PHGI) and/or Faecalibacterium prausnitzii phylogroup II members (PHGII) abundance, and/or a mathematical combination thereof, and/or optionally a mathematical combination of any of these with Total F.
  • PHGI Faecalibacterium prausnitzii phylogroup I members
  • PHGII Faecalibacterium prausnitzii phylogroup II members
  • Prausnitzii (FT) abundance and/or E.coli (EC) abundance in an intestinal sample of a human subject as biomarker for the detection of an intestinal disease, and/or for predicting the efficacy of a drug in the treatment of an intestinal disease
  • it relates to the use of Faecalibacterium prausnitzii phylogroup I members (PHGI) abundance, optionally with Faecalibacterium prausnitzii phylogroup II members (PHGII) abundance, including any mathematical combinations thereof, in an intestinal sample of a human subject as biomarker for the detection of intestinal disease.
  • the determination of the PGHI and/or PGHII abundance in an intestinal sample is performed in vitro according to the method of the invention.
  • PHGI abundance is used in combination with PHGII abundance, including any mathematical combinations thereof, in an intestinal sample of said human subject, preferably wherein the ratio between the PHGII abundance and the PHGI abundance (PHGII/PHGI ratio) is determined.
  • PHGII/PHGI ratio the ratio between the PHGII abundance and the PHGI abundance
  • PHGI and/or PHGII abundance determination is performed by gene quantification with a molecular method selected from the group consisting of quantitative Polymerase Chain Reaction (qPCR), PCR-pyrosequencing, fluorescence in-situ hybridization (FISH), microarrays, and PCR-ELISA, preferably quantification is performed by qPCR. Also, several genes can be used for bacterial quantification purposes as described above.
  • PHGI and/or PHGII abundance determination is carried out by 16S rRNA gene quantification. In a particular embodiment, PHGI abundance determination is carried out by quantifying a Faecalibacterium prausnitzii 16S rRNA gene sequence comprising or consisting of SEQ ID NO: 3.
  • PHGII abundance is determined by quantifying a Faecalibacterium prausnitzii 16S rRNA gene sequence comprising or consisting of SEQ ID NO: 4.
  • PHGI abundance determination is carried out by quantifying a Faecalibacterium prausnitzii 16S rRNA gene sequence comprising or consisting of SEQ ID NO: 3 and PHGII abundance by quantifying a Faecalibacterium prausnitzii 16S rRNA gene sequence comprising or consisting of SEQ ID NO: 4.
  • Preferred oligonucleotides for PHGI and/or PHGII abundance determination, detection chemistries and preferred embodiments of the quantification method are provided above.
  • Said intestinal sample may be an intestinal biopsy.
  • said intestinal sample is an intestinal biopsy obtained by a non-invasive method, such as a rectal sigmoidoscopy.
  • said intestinal sample is a feces sample. Preferred embodiments on the processing of the sample are provided above.
  • said intestinal disease is selected from the group consisting of CRC, IBS and IBD.
  • said intestinal disease is IBD, preferably said IBD is Ulcerative colitis (UC) or Crohn's disease (CD), more preferably said IBD is CD. Further details on the diagnosis, classification, and treatment of said intestinal diseases are provided above.
  • PHGI and/or PHGII abundance in an intestinal sample is used as biomarker for the screening, for the diagnosis, for monitoring progression, for monitoring relapses, and/or for monitoring postsurgical recurrence of an intestinal disease, and/or for determining efficacy of a treatment on an intestinal disease; preferably for the screening or diagnosis of an intestinal disease.
  • a further aspect of the invention relates to a kit for detecting intestinal disease according to a method as described under the third aspect of the invention, said kit comprising:
  • PHGI Faecalibacterium prausnitzii phylogroup I members
  • a reagent for determining the abundance of Faecalibacterium prausnitzii phylogroup II members PHGII
  • the invention further provides a kit comprising:
  • PHGI Faecalibacterium prausnitzii phylogroup I members
  • PHGII Faecalibacterium prausnitzii phylogroup II members
  • instructions for use of said reagent(s) to determine the abundance of PHGI, and/or PHGII, from a human intestinal sample are optionally, instructions for use of said reagent(s) to determine the abundance of PHGI, and/or PHGII, from a human intestinal sample.
  • said intestinal sample is a feces sample.
  • Said kit may be used for the screening, for the diagnosis, for determining disease activity, for monitoring activity and/or progression, for monitoring relapses, and/or for monitoring postsurgical recurrence of intestinal disease, and/or for determining efficacy of a treatment on intestinal disease; preferably for the screening and/or diagnosis of intestinal disease.
  • the invention further relates to the use of a kit as described herein for detecting an intestinal disease, for predicting the efficacy of a drug in the treatment of an intestinal disease, and/or for the differential diagnosis of IBD phenotypes.
  • Reagents for determining PHGI and/or PHGII abundance are as described above for the previous aspects of the invention.
  • said reagent for determining PHGI abundance is selected from the group consisting of:
  • - a pair of nucleic acid primers consisting of oligonucleotide sequences SEQ ID NO: 1 and SEQ ID NO: 2 or an oligonucleotide sequence with at least 75% identity thereof
  • - a probe consisting of oligonucleotide sequence SEQ ID NO: 3 or an oligonucleotide sequence with at least 75% of identity thereof.
  • said reagent for determining PHGII abundance is selected from the group consisting of:
  • nucleic acid primers consisting of oligonucleotide sequences SEQ ID NO: 1 and SEQ ID NO: 2 or an oligonucleotide sequence with at least 75% identity thereof, and/or
  • a probe consisting of oligonucleotide sequence SEQ ID NO: 4 or an oligonucleotide sequence with at least 75% identity thereof.
  • said reagent for determining PHGI abundance and said reagent for determining PHGII abundance are those in the particular embodiments defined above for the previous aspects of the invention.
  • the kit may further comprise DNA extraction means, means for carrying out the hybridization and/or amplification, detection means, and/or one or more containers for collecting and/or holding the biological sample.
  • the kit of the invention may further comprise a reference reagent for normalizing data, preferably wherein said reagent are primers and/or a probe for the quantification of total bacteria. Further details on quantification data normalization are provided above.
  • said intestinal disease is selected from the group consisting of CRC, IBS and IBD.
  • said intestinal disease is IBD, preferably said IBD is Ulcerative colitis (UC) or Crohn's disease (CD), more preferably said IBD is CD. Further details on the diagnosis, classification, and treatment of said intestinal diseases are provided above.
  • kit of the invention for the detection of intestinal disease are as provided for the previous aspects of the invention.
  • An additional aspect of the invention relates to a nucleic acid molecule with a sequence selected from the group consisting of SEQ ID NO: 1 , SEQ ID NO: 2, SEQ ID NO: 3, and SEQ ID NO: 4 or an oligonucleotide sequence with at least 75% identity thereof.
  • said oligonucleotide sequence with at least 75% identity have at least 80%, at least 85%, at least 90%, at least 95%, more preferably, 96%, 97%, 98%, 99% or 100% identity with SEQ ID NO: 1 , SEQ ID NO: 2, SEQ ID NO: 3 and/or SEQ ID NO: 4.
  • these oligonucleotide sequences with at least 75% identity may have the same nucleotide number, may be longer or shorter than SEQ ID NO: 1 , SEQ ID NO: 2, SEQ ID NO: 3 and/or SEQ ID NO: 4.
  • said nucleic acid molecule has a sequence selected from the group consisting of SEQ ID NO: 1 or a sequence with at least 80% identity thereof; SEQ ID NO: 2 or a sequence with at least 90% identity thereof; SEQ ID NO: 3 or a sequence with at least 80% identity thereof; and SEQ ID NO: 4 or a sequence with at least 85% identity thereof.
  • Said nucleic acid molecules may be used as primers or probes in the method of the invention, and may be modified as described above. Additional details and other preferred embodiments are as provided for the previous aspects of the invention.
  • a particular embodiment relates to a method for determining the abundance of Faecalibacterium prausnitzii phylogroup I members (PHGI) and/or the abundance of Faecalibacterium prausnitzii phylogroup II members (PHGII) in an intestinal sample from a subject wherein said determination is carried out by 16S rRNA gene quantification, wherein PHGI abundance determination is carried out by quantifying a Faecalibacterium prausnitzii 16S rRNA gene sequence comprising or consisting of SEQ ID NO: 3, and wherein PHGII abundance determination is carried out by quantifying a Faecalibacterium prausnitzii 16S rRNA gene sequence comprising or consisting of SEQ ID NO: 4.
  • 16S rRNA gene quantification is carried out with a molecular method selected from the group consisting of quantitative Polymerase Chain Reaction (qPCR), PCR-pyrosequencing, fluorescence in-situ hybridization (FISH), microarrays, and PCR-ELISA, preferably quantification is performed by qPCR.
  • qPCR quantitative Polymerase Chain Reaction
  • FISH fluorescence in-situ hybridization
  • microarrays microarrays
  • PCR-ELISA preferably quantification is performed by qPCR.
  • PHGI 16S rRNA gene quantification is performed with at least one oligonucleotide molecule of sequence SEQ ID NO: 1 or SEQ ID NO: 2, or a sequence with at least 75% identity thereof; and/or an oligonucleotide molecule of sequence SEQ ID NO: 3 or a sequence with at least 75% identity thereof.
  • oligonucleotide molecules of sequence SEQ ID NO: 1 and SEQ ID NO: 2 are used.
  • PHGI 16S rRNA gene quantification is performed with primers consisting of oligonucleotide sequences SEQ ID NO: 1 and SEQ ID NO: 2, or a sequence with at least 75% identity thereof; and/or a probe consisting of oligonucleotide sequence SEQ ID NO: 3 or a sequence with at least 75% identity thereof. It is preferred that PHGII 16S rRNA gene quantification is performed with at least one, oligonucleotide molecule of sequence SEQ ID NO: 1 or SEQ ID NO: 2, or a sequence with at least 75% identity thereof; and/or an oligonucleotide molecule of sequence SEQ ID NO: 4, or a sequence with at least 75% identity thereof. Preferably, oligonucleotide molecules of sequence SEQ ID NO: 1 and SEQ ID NO: 2 are used.
  • PHGII 16S rRNA gene quantification is performed with primers consisting of oligonucleotide sequences SEQ ID NO: 1 and SEQ ID NO: 2, or a sequence with at least 75% identity thereof; and/or a probe consisting of oligonucleotide sequence SEQ ID NO: 4, or a sequence with at least 75% identity thereof.
  • said oligonucleotide sequences with at least 75% identity have at least 80%, at least 85%, at least 90%, at least 95%, more preferably, 96%, 97%, 98%, 99% or 100% identity with SEQ ID NO: 1 , SEQ ID NO: 2, SEQ ID NO: 3 and/or SEQ ID NO: 4.
  • these oligonucleotide sequences with at least 75% identity may have the same nucleotide number, may be longer or shorter than SEQ ID NO:
  • PHGI 16S rRNA gene quantification is preferably performed by qPCR with primers consisting of oligonucleotide sequences SEQ ID NO: 1 and SEQ ID NO: 2, and a probe consisting of oligonucleotide sequence SEQ ID NO: 3.
  • PHGII 16S rRNA gene quantification is preferably performed by qPCR with primers consisting of oligonucleotide sequences SEQ ID NO: 1 and SEQ ID NO:
  • Said oligonucleotide sequences may be modified.
  • said PHGI specific probe consists of SEQ ID NO: 3 or a sequence with at least 75% identity thereof which has been modified.
  • it is a dual labelled probe, more preferably a hydrolysis probe.
  • SEQ ID NO: 3 is modified with 6FAM (6-carboxyfluorescin) in its 5' end and with BHQ1 (Black Hole Quencherl ) in its 3' end and it is represented as 6FAM-TAAGCCCACGACCCGGCATCG- BHQ1.
  • said PHGII specific probe consists of SEQ ID NO: 4 or a sequence with at least 75% identity thereof, which has been modified.
  • it is a dual labelled probe, more preferably a hydrolysis probe.
  • SEQ ID NO: 4 is modified with JOE (4',5'- dichloro-2',7'-dimethoxy-5(6)-carboxyfluorescein) in its 5' end and with BHQ1 (Black Hole Quencherl ) in its 3' end and it is represented as JOE-TAAGCCCACRGCTCGGCATC-BHQ1.
  • the PHGI and/or PHGII abundance levels are normalized as described above.
  • normalization is carried out with respect to total bacteria quantification. Further details on the PHGI and/or PHGII abundance quantification methods, detection chemistries and other specifics are as provided above.
  • the determination of the PGHI and/or PGHII abundance in an intestinal sample by the method of the invention is performed in vitro.
  • Said intestinal sample may be an intestinal biopsy. Several methods are well known in the art for the obtaining of intestinal biopsies, e.g. by endoscopy.
  • said intestinal sample is a non-invasive intestinal sample.
  • a non-invasive intestinal sample may be an intestinal biopsy obtained by a non-invasive method, such as a rectal sigmoidoscopy, and also a feces sample.
  • said intestinal sample is a feces sample.
  • Preferred embodiments on the processing of the sample are provided above.
  • DNA is extracted from the intestinal sample prior to PHGI and PHGII gene quantification. Additional details and other preferred embodiments on the method for determining the abundance of PHGI and/or PHGII in an intestinal sample are as provided under the previous aspects of the invention.
  • An additional aspect of the invention relates to a method for the differential diagnosis of inflammatory bowel disease (IBD) phenotypes in a human subject comprising the following steps: i. determining the abundance of a target microorganism in an intestinal sample from said subject, wherein said target microorganism is selected from the group consisting of
  • Faecalibacterium prausnitzii members total FP
  • Faecalibacterium prausnitzii phylogroup I members PHGI
  • Faecalibacterium prausnitzii phylogroup II members PHGII
  • FT Prausnitzii
  • EC E.coli
  • IBD phenotypes are defined by at least the combination of two, preferably three, of the following parameters:
  • biomarkers for the definition of said IBD phenotypes.
  • IBD types this term as used herein referring to IBD diseases or disorders have been recited above.
  • said IBD type is selected from the group consisting of Ulcerative Colitis (UC), Crohn's disease (CD), indeterminate colitis and inflammatory bowel disease unclassified (IBDU).
  • Subtypes may be defined within an IBD disease or disorder.
  • Subtypes classification is typically performed using international classifications, such as those issued by the international working group on its report of Rome 1991 , Vienna 1998 or Montreal 2005.
  • IBD subtypes are determined according to the Montreal classification.
  • said IBD phenotypes are selected from the group consisting of:
  • CD phenotypes defined by one or more, preferably all, of the following parameters:
  • UC phenotypes defined by one or more, preferably all, of the following parameters:
  • CD subtypes are for those defined by the Montreal classification, wherein CD is classified according to age at diagnosis, location and/or behavior.
  • preferred UC subtypes are those defined by the Montreal classification, wherein UC is classified according to disease extend and/or disease severity (World Gastroenterology Organisation Global Guidelines, Inflammatory bowel disease: a global perspective, June 2009; Satsangi et al., Gut 2006; 55, 749-753 and Silverberg et al., Can J Gastroenterol. 2005, 19 Suppl A:5-36).
  • the specific subtypes defined according to these parameters are provided in the tables below from Satsangi et al (Satsangi et al., Gut 2006; 55, 749-753).
  • * is a modifier that can be added to LI— 13 when concomitant upper gastrointestinal disease is present.
  • ⁇ "p" is added to B1 -B3 when concomitant perianal disease is present.
  • Moderate UC Passage of more than four stools per day but with minimal sig of systemic toxicity Severe UC Passage of at least six bloody stools daily, pulse rate of at least 90 beats per minute, temperature of at least 37SC, haemoglobin of lee than 10.5 g/100 ml, and ESR of at least 30 mm/h
  • said IBD phenotypes are defined by disease location, more preferably, these are selected from the group consisting of:
  • l-CD ileal CD
  • IC-CD ileocolonic CD
  • C-CD colonic CD
  • UC phenotypes consisting of ulcerative proctitis (UC-E1 ), distal colitis (UC-E2) and extensive UC or pancolitis (UC-E3).
  • the method of the invention may be useful for the differential diagnosis between one or more of the following IBD subtypes: UC vs C-CD, UC-E2 vs UC-E3, UC-E2 vs C-CD, UC-E2 vs IC-CD, UC-E2 vs I- CD, UC-E3 vs C-CD, UC-E3 vs IC-CD, UC-E3 vs l-CD, C-CD vs IC-CD, C-CD vs l-CD or l-CD vs IC-CD; preferably selected from the list consisting of UC vs C-CD, UC-E3 vs C-CD, l-CD vs IC-CD and C-CD vs IC-CD.
  • Said intestinal sample may be an intestinal biopsy.
  • said intestinal sample is an intestinal biopsy obtained by a non-invasive method, such as a rectal sigmoidoscopy.
  • said intestinal sample is a feces sample. Preferred embodiments on the processing of the sample are provided above.
  • said IBD phenotypes are UC-E3 and C-CD and the subject sample values are compared with a UC-E3 positive reference sample and/or a C-CD positive reference sample, wherein the subject sample presenting values significantly similar to UC-E3 or C-CD will be indicative that the subject is suffering from said IBD phenotype.
  • said human subject has previously been diagnosed of IBD with colonic involvement.
  • said target microorganism is the PHGII.
  • said mathematical combination with FT abundance and/or EC abundance is a ratio selected from the group consisting of: PHGI abundance/EC abundance, PHGII abundance/EC abundance, FT abundance/PHGI abundance, and FT abundance/PHGII abundance.
  • abundance determination is performed by qPCR and is expressed as threshold cycle (Ct) value and said ratio is obtained by subtracting from the first Ct value the second Ct value.
  • Biomarkers for differential diagnosis of UC from C-CD according to the present invention are shown in Example 17. Particularly preferred biomarkers for differential diagnosis of UC and C-CD are PHGI, PHGII, PHGI/EC and PHGII/EC ratios. PHGI and PHGII abundance increases in UC, and PHGI/EC and PHGII/EC ratios decrease in UC. Other particularly preferred biomarkers for differential diagnosis of UC from C-CD are FT/PHGI and FT/PHGII ratios which were shown to be good discriminators by ROC curve analysis.
  • biomarkers for differential diagnosis of C-CD from UC are PHGI, PHGII, PHGI/PHGII, PHGI/EC, and PHGII/EC, preferably PHGI and PHGI/EC that were shown to be good discriminators by ROC curve analysis.
  • a further aspect of the invention relates to a method for diagnosing C-CD in a human subject suffering from IBD with colonic involvement comprising the following steps:
  • determining the abundance of a target microorganism in an intestinal sample from said subject wherein said target microorganism is selected from the group consisting of Faecalibacterium prausnitzii members (total FP), Faecalibacterium prausnitzii phylogroup I members (PHGI) and Faecalibacterium prausnitzii phylogroup II members (PHGII); and ii. comparing the subject sample abundance of one or more of said target microorganisms and/or a mathematical combination thereof, and/or optionally a mathematical combination of any of these with Total F. Prausnitzii (FT) abundance and/or E.coli (EC) abundance, with the corresponding values in a reference sample, wherein a significant deviation in the subject sample values with regard to said reference sample is indicative of C-CD.
  • FT Total F. Prausnitzii
  • EC E.coli
  • said target microorganism is PHGI and PHGII. In another particular embodiment said target microorganism is PHGI. In another particular embodiment, said target microorganism is PHGII.
  • biomarkers for the detection of C-CD are PHGI, PHGII, PHGI/PHGII, PHGI/EC and PHGII/EC, preferably PHGI and PHGI/EC.
  • said ratios have been calculated by subtraction as described above and in the Examples.
  • it relates to a method for diagnosing C-CD in a human subject suffering from IBD with colonic involvement comprising the following steps:
  • said reference sample is a sample of a healthy subject and/or a sample of a patient with IBD in remission, more preferably a sample of the same subject in remission.
  • said IBD phenotypes are selected from the group consisting of l-CD, C-CD and IC-CD and the subject sample values are compared with an l-CD positive reference sample, a C-CD positive reference sample and/or a IC-CD positive reference sample, wherein the subject sample presenting values significantly similar to l-CD, C-CD or IC-CD will be indicative that the subject is suffering from said IBD phenotype.
  • the method of the invention is used for determining extension of the disease to the colonic area (IC-CD) in a human subject who has previously been diagnosed with l-CD.
  • said target microorganism is the PHGII.
  • the method of the invention is used for determining extension of the disease to the ileal area (IC-CD) in a human subject who has previously been diagnosed with C-CD.
  • said target microorganism is the PHGII.
  • An additional aspect of the invention relates to a method for diagnosing IC-CD in a human subject suffering from l-CD or C-CD comprising the following steps:
  • determining the abundance of a target microorganism in an intestinal sample from said subject wherein said target microorganism is selected from the group consisting of Faecalibacterium prausnitzii members (total FP), Faecalibacterium prausnitzii phylogroup I members (PHGI) and Faecalibacterium prausnitzii phylogroup II members (PHGII); and ii. comparing the subject sample abundance of one or more of said target microorganisms and/or a mathematical combination thereof, and/or optionally a mathematical combination of any of these with Total F.
  • Faecalibacterium prausnitzii members total FP
  • PHGI Faecalibacterium prausnitzii phylogroup I members
  • PHGII Faecalibacterium prausnitzii phylogroup II members
  • FT Prausnitzii
  • EC E.coli
  • said target microorganism is PHGI and PHGII.
  • said target microorganism is PHGI.
  • said target microorganism is PHGII.
  • said target microorganism is FT and PHGI.
  • a preferred biomarker for the detection of IC-CD is FT/PHGI.
  • IC-CD in a human subject suffering from l-CD or C-CD comprising the following steps:
  • said target microorganism abundance determination is performed by gene quantification with a molecular method selected from the group consisting of quantitative Polymerase Chain Reaction (qPCR), PCR-pyrosequencing, fluorescence in-situ hybridization (FISH), microarrays, and PCR-ELISA, preferably quantification is performed by qPCR.
  • qPCR quantitative Polymerase Chain Reaction
  • FISH fluorescence in-situ hybridization
  • microarrays microarrays
  • PCR-ELISA preferably quantification is performed by qPCR.
  • target microorganism abundance determination is carried out by 16S rRNA gene quantification.
  • Said target microorganism is preferably selected from the group consisting of PHGI and PHGII.
  • PHGI abundance is used in combination with PHGII abundance, including any mathematical combinations thereof, in an intestinal sample of said human subject, preferably wherein the ratio between the PHGII abundance and the PHGI abundance (PHGII/PHGI ratio) is determined.
  • PHGI abundance determination is carried out by quantifying a Faecalibacterium prausnitzii 16S rRNA gene sequence comprising or consisting of SEQ ID NO: 3.
  • PHGII abundance is determined by quantifying a Faecalibacterium prausnitzii 16S rRNA gene sequence comprising or consisting of SEQ ID NO: 4.
  • PHGI abundance determination is carried out by quantifying a Faecalibacterium prausnitzii 16S rRNA gene sequence comprising or consisting of SEQ ID NO: 3 and PHGII abundance by quantifying a Faecalibacterium prausnitzii 16S rRNA gene sequence comprising or consisting of SEQ ID NO: 4.
  • oligonucleotides for PHGI and/or PHGII abundance determination, detection chemistries and preferred embodiments of the quantification method are provided under the above aspects of the invention.
  • total FP 16S rRNA gene quantification is performed by quantifying a Faecalibacterium prausnitzii 16S rRNA gene sequence comprising or consisting of SEQ ID NO: 7.
  • total FP 16S rRNA gene quantification is performed with at least one oligonucleotide molecule of sequence SEQ ID NO: 5 or SEQ ID NO: 6, or a sequence with at least 75% identity thereof; and/or an oligonucleotide molecule of sequence SEQ ID NO: 7 or a sequence with at least 75% identity thereof.
  • oligonucleotide molecules of sequence SEQ ID NO: 5 and SEQ ID NO: 6 are used.
  • PHGI 16S rRNA gene quantification is performed with primers consisting of oligonucleotide sequences SEQ ID NO: 5 and SEQ ID NO: 6 or a sequence with at least 75% identity thereof; and/or a probe consisting of oligonucleotide sequence SEQ ID NO: 7 or a sequence with at least 75% identity thereof.
  • total FP 16S rRNA gene quantification is performed, preferably by qPCR, with primers consisting of oligonucleotide sequences SEQ ID NO: 5 and SEQ ID NO: 6, and a probe consisting of oligonucleotide sequence SEQ ID NO: 7.
  • said oligonucleotide sequences with at least 75% identity have at least 80%, at least 85%, at least 90%, at least 95%, more preferably, 96%, 97%, 98%, 99% or 100% identity with SEQ ID NO: 5, SEQ ID NO: 6, and/or SEQ ID NO: 7.
  • these oligonucleotide sequences with at least 75% identity may have the same nucleotide number, may be longer or shorter than SEQ ID NO: 5, SEQ ID NO: 6, and/or SEQ ID NO: 7.
  • said total FP probe consists of SEQ ID NO: 7 or a sequence with at least 75% identity thereof which has been modified.
  • it is a dual labelled probe, more preferably a hydrolysis probe.
  • SEQ ID NO: 7 is modified with 6FAM (6- carboxyfluorescin) in its 5' end and with TAMRA (tetramethylrhodamin) in its 3' end and it is represented as 6FAM-CAAGGAAGTGACGGCTAACTACGTGCCAG-TAMRA
  • said method further comprises detecting and/or quantifying one or more biomarkers of intestinal disease, preferably of IBD.
  • said method further comprises combining the results of the target microorganism quantification and/or said further biomarkers detection and/or quantification with clinical signs and/or symptoms which are independent predictors of IBD.
  • said method further comprises storing the method results in a data carrier, preferably wherein said data carrier is a computer readable medium. Additional details and other preferred embodiments on a method for the differential diagnosis of inflammatory bowel disease (IBD) phenotypes in a human subject according to any of the sixth to eight aspects of the invention are as provided for the previous aspects of the invention.
  • IBD inflammatory bowel disease
  • the invention relates to a method for the prognosis of inflammatory bowel disease (IBD) which comprises the determination of an IBD phenotype according to a method for the differential diagnosis as described herein of the invention and establishing prognosis according to the determined IBD phenotype.
  • IBD inflammatory bowel disease
  • the invention relates to the use of Faecalibacterium prausnitzii phylogroup I members (PHGI) and/or Faecalibacterium prausnitzii phylogroup II members (PHGII) abundance, and/or mathematical combinations thereof, and/or optionally a mathematical combination of any of these with Total F.
  • PHGI Faecalibacterium prausnitzii phylogroup I members
  • PHGII Faecalibacterium prausnitzii phylogroup II members
  • FT Prausnitzii
  • EC E.coli abundance
  • the determination of total FP, PGHI and/or PGHII abundance in an intestinal sample is performed in vitro. Further details and preferred embodiments on IBD phenotypes are provided above.
  • said IBD phenotypes are selected from the group consisting of:
  • Ulcerative Colitis phenotypes consisting of ulcerative proctitis (UC-E1 ), distal colitis (UC-E2) and extensive UC or pancolitis (UC-E3); and
  • CD Crohn's disease phenotypes consisting of ileal CD (l-CD), ileocolonic CD (IC-CD) and colonic CD (C-CD).
  • the abundance of PHGI, the abundance of PHGII and/or a mathematical combination thereof is used as biomarker.
  • a mathematical combination of PHGI and PHGII abundance is used as biomarker, preferably wherein the ratio between the PHGII and the PHGI abundance (PHGII/PHGI ratio) is used as biomarker.
  • said target microorganism abundance determination is performed by gene quantification with a molecular method selected from the group consisting of quantitative Polymerase Chain Reaction (qPCR), PCR-pyrosequencing, fluorescence in-situ hybridization (FISH), microarrays, and PCR-ELISA, preferably quantification is performed by qPCR.
  • qPCR quantitative Polymerase Chain Reaction
  • FISH fluorescence in-situ hybridization
  • microarrays microarrays
  • PCR-ELISA preferably quantification is performed by qPCR.
  • target microorganism abundance determination is carried out by 16S rRNA gene quantification.
  • said intestinal sample is a feces sample.
  • kits for the differential diagnosis of inflammatory bowel disease (IBD) phenotypes according to a method of any of the sixth to eight aspects, comprising:
  • a reagent for determining the abundance of a target microorganism selected from the group consisting of Faecalibacterium prausnitzii members (total FP), Faecalibacterium prausnitzii phylogroup I members (PHGI), and Faecalibacterium prausnitzii phylogroup II members (PHGII); and instructions for use of said reagent(s) to determine the abundance levels of said target microorganism from a human intestinal sample.
  • said intestinal sample is a feces sample.
  • said reagent for determining PHGI abundance is selected from the group consisting of:
  • - a pair of nucleic acid primers consisting of oligonucleotide sequences SEQ ID NO: 1 and SEQ ID NO: 2 or an oligonucleotide sequence with at least 75% identity thereof
  • - a probe consisting of oligonucleotide sequence SEQ ID NO: 3 or an oligonucleotide sequence with at least 75% of identity thereof.
  • said reagent for determining PHGII abundance is selected from the group consisting of: - a pair of nucleic acid primers consisting of oligonucleotide sequences SEQ ID NO: 1 and SEQ ID NO: 2 or an oligonucleotide sequence with at least 75% identity thereof, and/or
  • a probe consisting of oligonucleotide sequence SEQ ID NO: 4 or an oligonucleotide sequence with at least 75% identity thereof.
  • said reagent for determining total FP abundance is selected from the group consisting of:
  • nucleic acid primers consisting of oligonucleotide sequences SEQ ID NO: 5 and SEQ ID NO: 6 or an oligonucleotide sequence with at least 75% identity thereof, and/or
  • a probe consisting of oligonucleotide sequence SEQ ID NO: 7 or an oligonucleotide sequence with at least 75% identity thereof.
  • said kit further comprises a reference reagent for normalizing data, preferably wherein said reagent are primers and/or a probe for the quantification of total bacteria.
  • kits for the differential diagnosis of inflammatory bowel disease (IBD) phenotypes are as provided for the previous aspects of the invention.
  • ITEMS related to the method for detecting intestinal disease in a human subject
  • a method for detecting intestinal disease in a human subject comprising the following steps: a. determining the abundance of Faecalibacterium prausnitzii phylogroup I members (PHGI) in an intestinal sample from said subject;
  • PHGI Faecalibacterium prausnitzii phylogroup I members
  • PHGII Faecalibacterium prausnitzii phylogroup II members
  • the ratio between the PHGII abundance and the PHGI abundance is determined; and the PHGII/PHGI ratio in said subject sample is compared with the PHGII/PHGI ratio in a reference sample.
  • PHGI and/or PHGII abundance determination is performed by gene quantification with a molecular method selected from the group consisting of quantitative Polymerase Chain Reaction (qPCR), PCR-pyrosequencing, fluorescence in-situ hybridization (FISH), microarrays, and PCR-ELISA, preferably quantification is performed by qPCR.
  • qPCR quantitative Polymerase Chain Reaction
  • FISH fluorescence in-situ hybridization
  • microarrays microarrays
  • PCR-ELISA preferably quantification is performed by qPCR.
  • PHGI abundance determination is carried out by quantifying a Faecalibacterium prausnitzii 16S rRNA gene sequence comprising or consisting of SEQ ID NO: 3.
  • PHGI 16S rRNA gene quantification is performed with primers consisting of oligonucleotide sequences SEQ ID NO: 1 and SEQ ID NO: 2 or a sequence with at least 75% identity thereof; and/or a probe consisting of oligonucleotide sequence SEQ ID NO: 3 or a sequence with at least 75% identity thereof.
  • the method according to any of items 1 to 21 wherein said method further comprises storing the method results in a data carrier, preferably wherein said data carrier is a computer readable medium.
  • PHGI Faecalibacterium prausnitzii phylogroup I members
  • PHGI abundance is used in combination with Faecalibacterium prausnitzii phylogroup II members (PHGII) abundance in an intestinal sample of said human subject, preferably wherein the ratio between the PHGII abundance and the PHGI abundance (PHGII/PHGI ratio) is determined.
  • PHGII Faecalibacterium prausnitzii phylogroup II members
  • PHGI and/or PHGII abundance determination is performed by gene quantification with a molecular method selected from the group consisting of quantitative Polymerase Chain Reaction (qPCR), PCR-pyrosequencing, fluorescence in-situ hybridization (FISH), microarrays, and PCR-ELISA, preferably quantification is performed by qPCR.
  • qPCR quantitative Polymerase Chain Reaction
  • FISH fluorescence in-situ hybridization
  • microarrays microarrays
  • PCR-ELISA preferably quantification is performed by qPCR.
  • kits for detecting an intestinal disease comprising: o a reagent for determining the abundance of Faecalibacterium prausnitzii phylogroup I members (PHGI);
  • a reagent for determining the abundance of Faecalibacterium prausnitzii phylogroup II members PHGII
  • kits according to item 30 for the screening, for the diagnosis, for monitoring progression, for monitoring relapses, and/or for monitoring postsurgical recurrence of an intestinal disease, and/or for determining efficacy of a treatment on an intestinal disease; preferably for the screening or diagnosis of an intestinal disease.
  • kit according to any of items 30 or 31 , wherein said reagent for determining PHGI abundance is selected from the group consisting of: o a pair of nucleic acid primers consisting of oligonucleotide sequences SEQ ID NO: 1 and SEQ ID NO: 2 or an oligonucleotide sequence with at least 75% identity thereof, and/or o a probe consisting of oligonucleotide sequence SEQ ID NO: 3 or an oligonucleotide sequence with at least 75% of identity thereof.
  • kit according to any of items 30 to 32, wherein said reagent for determining PHGII abundance is selected from the group consisting of:
  • a pair of nucleic acid primers consisting of oligonucleotide sequences SEQ ID NO: 1 and SEQ ID NO: 2 or an oligonucleotide sequence with at least 75% identity thereof
  • a probe consisting of oligonucleotide sequence SEQ ID NO: 4 or an oligonucleotide sequence with at least 75% identity thereof.
  • kit according to any of items 30 to 33, further comprising a reference reagent for normalizing data, preferably wherein said reagent are primers and/or a probe for the quantification of total bacteria.
  • kits according to any of items 30 to 34, wherein said intestinal disease is IBD, preferably wherein said IBD is Ulcerative colitis (UC) or Crohn's disease (CD), more preferably wherein said IBD is CD.
  • IBD Ulcerative colitis
  • CD Crohn's disease
  • 37. A method for determining the abundance of Faecalibacterium prausnitzii phylogroup I members
  • PHGI Faecalibacterium prausnitzii phylogroup II members
  • said determination is carried out by 16S rRNA gene quantification, wherein PHGI abundance determination is carried out by quantifying a Faecalibacterium prausnitzii 16S rRNA gene sequence comprising or consisting of SEQ ID NO: 3, and wherein PHGII abundance determination is carried out by quantifying a Faecalibacterium prausnitzii 16S rRNA gene sequence comprising or consisting of SEQ ID NO: 4.
  • 16S rRNA gene quantification is carried out with a molecular method selected from the group consisting of quantitative Polymerase Chain Reaction (qPCR), PCR-pyrosequencing, fluorescence in-situ hybridization (FISH), microarrays, and PCR-
  • qPCR quantitative Polymerase Chain Reaction
  • FISH fluorescence in-situ hybridization
  • microarrays and PCR-
  • ELISA preferably quantification is performed by qPCR.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Analytical Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Genetics & Genomics (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Physics & Mathematics (AREA)
  • Pathology (AREA)
  • Oncology (AREA)
  • Hospice & Palliative Care (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Investigating Or Analysing Biological Materials (AREA)

Abstract

The present invention relates to a novel method for an accurate quantification in intestinal samples of Faecalibacterium prausnitzii phylogroup I members (PHGI) and/or Faecalibacterium prausnitzii phylogroup II members (PHGII). It further relates to a method for detecting intestinal diseases, including the screening, diagnosis, differential diagnosis, and/or monitoring of disease activity or progression in a human subject comprising determining the abundance of PHGI and/or PHGII in an intestinal sample from said subject. Moreover, it relates to a method for the prediction of the efficacy of a drug in the therapeutic treatment of an intestinal disease in a human subject comprising determining the abundance of PHGI and/or PHGII in an intestinal sample from said subject.

Description

METHOD FOR THE QUANTIFICATION OF FAECALIBACTERIUM PRAUSNITZII PHYLOGROUP I AND/OR PHYLOGROUP II MEMBERS AND THE USE THEREOF AS
BIOMARKERS
FIELD OF INVENTION
The present invention relates to the field of diagnosis and classification of intestinal diseases and personalized medicine in general. It further relates to the field of microbiology and molecular biology, more particularly it relates to the relationship between intestinal microbiota composition and intestinal disease, e.g., in inflammatory bowel disease (IBD). Specifically it relates to a novel method for an accurate quantification in intestinal samples of Faecalibacterium prausnitzii phylogroup I members (PHGI) and/or Faecalibacterium prausnitzii phylogroup II members (PHGII). It further relates to a method for detecting intestinal diseases, including the screening, diagnosis, differential diagnosis, determining disease activity and/or monitoring of disease activity and/or progression in a human subject comprising determining the abundance of PHGI and/or PHGII members in an intestinal sample from said subject. Moreover, it relates to a method for the prediction of the efficacy of a drug in the therapeutic treatment of an intestinal disease in a human subject comprising determining the abundance of PHGI and/or PHGII in an intestinal sample from said subject.
BACKGROUND OF THE INVENTION Inflammatory bowel disease (IBD) represents a group of idiopathic chronic inflammatory intestinal conditions. The two main disease categories the term covers are Crohn's disease (CD) and ulcerative colitis (UC), with both overlapping and distinct clinical and pathological features (World Gastroenterology Organisation Global Guidelines, Inflammatory bowel disease: a global perspective, June 2009; and Silverberg et al., Can J Gastroenterol. 2005, 19 Suppl A:5-36).
IBD affects as many as 1.6 million persons in the United States and 2.2 million in Europe. The incidence is increasing worldwide. In spite of advances in IBD-therapy, IBD hospitalizations and surgery rates in the United States have increased significantly since 1990. IBD is one of the five most prevalent gastrointestinal disease burdens in the United States, with annual overall health care costs of more than $1.7 billion. One to two of every 1000 people in developed countries are affected with IBD, and global rates seem to be increasing, attributable to the rapid modernization and to the adoption of the Western world lifestyle. These chronic diseases result in significant morbidity and mortality, compromising quality of life and life expectancies. (M'Koma A. E., World J Gastrointest Surg 2014; 6(1 1 ), 208-219). An association between the increased incidence of IBD and environmental factors linked to socioeconomic development has been persistently detected in different parts of the world, and it seems that the lifestyle in developed countries might impair the natural patterns of microbial colonization of the human gut. In IBD, mucosal lesions are generally associated to an excessive or dysregulated immune response against commensal microbes in the gut, and studies using molecular methods for intestinal microbiota analysis indicate that dysbiosis (that is, abnormal microbiota composition) and decreased complexity of the gut microbial ecosystem are common features in patients with CD or UC (Manichanh et al., Nat. Rev. Gastroenterol. Hepatol. 2012; 9, 599-608). Faecalibacterium prausnitzii (Ruminococcaceae) is one of the three most abundant bacterial species found in the gut, representing between 2-20% of the fecal microbiota in healthy individuals, according to diversity studies of the human gut microbiome based on 16S rRNA gene analysis (Arumugam et al. Nature. 201 1 ;473: 174-180; Eckburg et al. Science. 2005;308: 1635-1638; Hold et al. AppI Environ Microbiol. 2003;69:4320-4324; Schwiertz et al. J Pediatr. 2010; 157:240-244; Suau et al. Systematic and Applied Microbiology. 2001 ;24: 139-145; Walker et al. ISME J. 201 1 :220-230). On the other hand, it has been reported to represent 6% of bacteria in mucosa-associated microbial communities (Swidsinski et al. World J Gastroenterol. 2005; 1 1 : 1 131-1 140), although some studies have indicated that these values can increase to around 20-50% in some individuals (Nava GM, Stappenbeck TS. Gut Microbes. 201 1 ;2: 99- 104; Baumgart et al. ISME J. 2007; 1 :403-418).
In recent years, there has been increasing interest in F. prausnitzii given its potentially important role in promoting gut health (Louis et al. FEMS Microbiol Lett. 2009;294: 1-8; Sokol et al. Proc Natl Acad Sci U S A. 2008; 105: 16731-16736) through the formation of anti-inflammatory compounds (Louis et al. FEMS Microbiol Lett. 2009;294: 1-8; Sokol et al. Proc Natl Acad Sci U S A. 2008; 105: 16731-16736; Barcenilla et al. AppI Environ Microbiol. 2000;66: 1654-1661 ; Duncan et al. Int J Syst Evol Microbiol 2002;52:2141- 2146; Lopez-Siles et al. AppI Environ Microbiol. 2012;78:420-428) and enhancement of intestinal barrier function (Carlsson et al. Scand J Gastroenterol. 2013;48: 1 136-1 144; Wrzosek et al. BMC Biol. 2013;1 1 :61 ). Many studies have shown that F. prausnitzii prevalence and abundance is reduced in different intestinal disorders (Miquel et al. Curr Opin Microbiol. 2013;16:255-261 ), in particular the depletion in F. prausnitzii numbers has been most extensively reported in inflammatory bowel disease (IBD). Low counts of this species have been observed in both fecal and mucosa-associated communities of adult CD patients (Sokol et al. Proc Natl Acad Sci U S A. 2008; 105: 16731-16736;Lopez-Siles et al. International Journal of Medical Microbiology. 2014;304:464-475; Sokol et al. Inflamm Bowel Dis. 2009; 15: 1 183-1 189; Swidsinski et al. Inflamm Bowel Dis. 2008; 14: 147-161 ; Willing et al. Inflamm Bowel Dis. 2009; 15:653-660).
Variable populations have been reported in UC patients (Swidsinski et al. World J Gastroenterol.
2005; 1 1 : 1 131-1 140; Lopez-Siles et al. International Journal of Medical Microbiology. 2014;304:464-475; Sokol et al. Inflamm Bowel Dis. 2009; 15: 1 183-1 189; Hansen et al. Am J Gastroenterol. 2012; 107: 1913-
1922; Jia et al. FEMS Microbiol Lett. 2010;310:138-144; Kabeerdoss et al. BMC Gastroenterol.
2013;13:20; Machiels et al. Gut. 2013; McLaughlin et al. Therap Adv Gastroenterol. 2010;3:335-348;
Vermeiren et al. FEMS Microbiol Ecol. 2012;79:685-696), despite the reduction of Firmicutes having been repeatedly observed in this disorder (Machiels et al. Gut. 2013; Frank et al. Proc Natl Acad Sci U S A. 2007; 104: 13780-13785; Nagalingam NA, Lynch SV. Inflamm Bowel Dis. 2012;18:968-984). A recent study conducted on 127 UC subjects points out that a reduction in F. prausnitzii is also involved in UC dysbiosis (Machiels et al. Gut. 2013). Interestingly, lower counts of Faecalibacterium-re\aied bacteria have also been observed in functional gut disorders such as irritable bowel syndrome (IBS) of alternating type (Rajilic-Stojanovic et al. Gastroenterology. 201 1 ; 141 : 1792-1801 ), that in turn shares some features with IBD patients (Ghoshal et al. Int J Inflam. 2012;2012: 151085; Spiller RC. Best Practice & Research Clinical Gastroenterology. 2004;18:641-661 ), and in more severe intestinal disorders as colorectal cancer (CRC) (Balamurugan et al. J Gastroenterol Hepatol. 2008;23: 1298-1303). Taken together these findings suggest that shifts in F. prausnitzii numbers occur under several pathological disorders. Relatively few studies have paid attention to the diversity within the genus Faecalibacterium. Recent phylogenetic analysis showed that mainly two different F. prausnitzii phylogroups were found in fecal samples of healthy subjects (Lopez-Siles et al. Appl Environ Microbiol. 2012;78:420-428). More specifically, Lopez-Siles et al. 2012 analyzed the phylogenetic relationship of F. prausnitzii isolates to other members of Clostridium cluster IV based on 16S rRNA gene sequences and defined for the first time two phylogroups within F. prausnitzii species (Figure 1 ), These F. prausnitzii phylogroups included five sequences reported previously for the cultured isolates M21/2, ATCC 27766, and ATCC 27768 (belonging to PHGI) and A2-165 and L2-6 (belonging to PHGII).
Besides, Jia et al. FEMS Microbiol Lett. 2010;310: 138-144 describe a method for the amplification in a single end point PCR of bacterial DNA sequences belonging to F. prausnitzii species. The primers used for the amplification (Fp.ID.F2 and Fp.ID.R2) were designed against the nucleotidyl transferase gene and the butyryl- CoA transferase gene sequences, respectively, of F. prausnitzii A2-165 and M21/2 strains and, yields of PCR products were classified as belonging to two different subgroups, namely the A2-165 subgroup and the M21/2 subgroup (see Table 1 ). Accordingly, the primers used for amplification of F. prausnitzii members were not targeting the F. prausnitzii 16S rRNA gene and were based on the sequence of two strains only. Furthermore, the members belonging to each subgroup were distinguished by the size of the PCR product and, no primer or probe was disclosed in Jia et al. 2010 specific for each of the A2-165 and M21/2 subgroups. Nowadays, the diagnosis of IBD requires a comprehensive physical examination and a review of the patient's history. Various tests, including blood tests, stool examination, endoscopy, biopsies, and imaging studies help exclude other causes and confirm the diagnosis (World Gastroenterology Organisation Global Guidelines, Inflammatory bowel disease: a global perspective, June 2009). Accurate IBD diagnosis is crucial for providing correct, evidence-based treatment, since treatment response and complications differ significantly among UC and CD patients (Farmer et al. Am J Gastroenterol 2000; 95: 3184-3188). From the clinician's perspective, accurate diagnosis and classification of these diseases would have potential benefits with respect to patient counselling, assessing disease prognosis, monitoring disease progression and relapses, and particularly with choosing the most appropriate treatment for each disease subtype. Besides, the issue of disease progression for both CD and UC is critical in studies relating genotype to phenotype, as disease behavior and severity will undoubtedly change over time (Satsangi et al., Gut 2006; 55, 749-753). Despite significant advances having been made in the last twenty years in the discovery of molecular and serological markers related to IBD, there is an on-going need for improved methods for the accurate diagnosis, classification, study of the progression and/or prognosis of IBD and IBD phenotypes.
SUMMARY OF THE INVENTION
The inventors developed a novel method for an accurate quantification in intestinal samples of phylogroup I members (PHGI) and/or phylogroup II members (PHGII) of F. prausnitzii species. In particular, in order to simultaneously quantify both F. prausnitzii phylogroups, a multiplex quantitative polymerase chain reaction (qPCR) was developed comprising the use of a unique pair of species-specific primers for the 16S rRNA gene of F. prausnitzii and two hydrolysis probes targeting each of F. prausnitzii phylogroup members which were designed and optimized by the inventors to have broad coverage while preserving specificity. There is interindividual variability in the intestinal microbiota composition of patients suffering from an intestinal disease (e.g, suffering from IBD, Crohn's disease or ulcerative colitis), and some of the F. prausnitzii strains may not be represented in the intestinal bacterial population of a given individual. Therefore, the broad coverage of the primers and probes of the invention provides for a more accurate quantification of F. prausnitzii phylogroups.
For the design of the species-specific primers and phylogroup specific probes, 33 sequences of the 16S rRNA gene from F. prausnitzii were recovered from GenBank and aligned (see Table 14, where these sequences (in bold) were marked *, 1 and 2, respectively). From the generated consensus sequences for the F. prausnitzii 16S rRNA gene and for each phylogroup, both primers and hydrolysis probes were manually designed and optimized. Accordingly, in contrast with Jia et al. 2010 where the primers were designed based on the nucleotidyl transferase gene and the butyryl- CoA transferase gene sequence of F. prausnitzii A2-165 and M21/2 strains only, the design of the species-specific primers for F. prausnitzii 16S rRNA gene of the invention was based on the alignment of 33 known F. prausnitzii 16S rRNA gene sequences.
Moreover, for the first time probes specific of the F. prausnitzii phylogroup I members (PHGI) and phylogroup II members (PHGII) were described. For the design of the PHGI probe, 5 known F. prausnitzii 16S rRNA gene sequences were used as starting point and for PHGII probe 13 known F. prausnitzii 16S rRNA gene sequences (see Tables 3 and 5 below, respectively). Phylogroup classification of the known sequences was carried out according to Lopez-Siles et al. 2012. The generated species-specific primers and phylogroup specific probes were submitted to in silico and in vivo testing to ensure broad coverage and specificity for the 16S rRNA gene of F. prausnitzii (inclusivity/exclusivity tests). PHGI probe (SEQ ID NO:3) was shown by the inventors to specifically hybridize with more than 1000 16S rRNA gene sequences, namely the 1 196 sequences recited in Tables 3 and 4. Therefore, the term Faecalibacterium prausnitzii phylogroup I (PHGI) members as used herein includes those bacterial strains which 16S rRNA gene specifically hybridizes with PHGI probe (SEQ ID NO:3). Similarly, PHGII probe (SEQ ID NO:4), was shown by the inventors to specifically hybridize with more than 2000 16S rRNA gene sequences, namely the 2244 sequences recited in Tables 5 and 6. Accordingly, the term Faecalibacterium prausnitzii phylogroup II (PHGII) members as used herein includes those bacterial strains which 16S rRNA gene specifically hybridizes with PHGII probe (SEQ ID NO:4).
Using the newly developed method for the quantification of PHGI and PHGII members, the inventors determined the variation of mucosa-associated and feces-associated F. prausnitzii phylogroups between healthy subjects and patients suffering several intestinal disorders in order to establish whether the imbalance in F. prausnitzii includes the overall population or specifically affects a particular phylogroup.
Moreover, it was determined the usefulness of the quantification of F. prausnitzii phylogroups alone, in combination or in combination with other biomarkers (e.g., F. prausnitzii and E.coli) as biomarkers for detecting intestinal diseases, including the screening diagnosis, differential diagnosis (e.g., differential diagnosis of IBD phenotypes), determining disease activity and monitoring of disease activity or progression. Furthermore, its usefulness as biomarkers for the prediction of a therapeutic treatment effect in intestinal diseases, particularly in Crohn's disease and ulcerative colitis,
Accordingly, the present invention provides a novel method for the quantification of PHGI and/or of PHGII members and its use as new biomarkers of intestinal disease, particularly of Crohn's disease and/or ulcerative colitis.
Thus, in accordance with the particular findings of the present invention, there is provided: A first aspect of the invention relates to an in vitro method for determining the abundance of Faecalibacterium prausnitzii phylogroup I members (PHGI) and/or of Faecalibacterium prausnitzii phylogroup II members (PHGII) in an intestinal sample from a subject; wherein PHGI abundance determination comprises the use of a primer and/or probe with sequence SEQ ID NO: 3 or a sequence with at least 75% identity thereof; and wherein PHGII abundance determination comprises the use of a primer and/or a probe with sequence SEQ ID NO: 4 or a sequence with at least 75% identity thereof.
In a second aspect the invention relates to a method for the obtaining of useful information for the detection of an intestinal disease in a human subject and/or for the prediction of the efficacy of a drug in the therapeutic treatment of an intestinal disease in a human subject, comprising for determination of the abundance of PHGI and/or of PHGII according to the method of the invention.
In a third aspect, the invention relates to a method for detecting an intestinal disease in a human subject comprising the following steps:
a. determining the abundance of Faecalibacterium prausnitzii phylogroup I members (PHGI) and/or Faecalibacterium prausnitzii phylogroup II members (PHGII) in an intestinal sample from said subject according to a method as described under the first aspect; and b. comparing the PHGI and/or PHGII abundance, and/or a mathematical combination thereof, and/or optionally a mathematical combination of any of these with Total F.Prausnitzii (FT) abundance and/or E.coli (EC) abundance, in the subject sample with the corresponding values in a reference sample,
wherein a significant deviation in the subject sample values with regard to said reference sample is indicative of intestinal disease.
In a further aspect, the invention relates to the use of Faecalibacterium prausnitzii phylogroup I members (PHGI) and/or Faecalibacterium prausnitzii phylogroup II members (PHGII) abundance, and/or a mathematical combination thereof, and/or optionally a mathematical combination of any of these with Total F.Prausnitzii (FT) abundance and/or E.coli (EC) abundance, in an intestinal sample of a human subject as biomarker for the detection of an intestinal disease, and/or for predicting the efficacy of a drug in the treatment of an intestinal disease.
The invention further provides a kit comprising:
a. a reagent for determining the abundance of Faecalibacterium prausnitzii phylogroup I members (PHGI) consisting of a primer and/or probe with sequence SEQ ID NO: 3 or a sequence with at least 75% identity thereof; and/or
b. a reagent for determining the abundance of Faecalibacterium prausnitzii phylogroup II members (PHGII) consisting of a primer and/or a probe with sequence SEQ ID NO: 4 or a sequence with at least 75% identity thereof; and
c. optionally, instructions for use of said reagent(s) to determine the abundance of PHGI, and/or PHGII, from a human intestinal sample. A further aspect of the invention relates to a nucleic acid sequence selected from the group consisting of SEQ ID NO: 1 , SEQ ID NO: 2, SEQ ID NO: 3, and SEQ ID NO: 4 or an oligonucleotide sequence with at least 75% identity thereof.
Still a further aspect of the invention relates to a method for the differential diagnosis of inflammatory bowel disease (IBD) phenotypes in a human subject comprising the following steps: i. determining the abundance of a target microorganism in an intestinal sample from said subject, wherein said target microorganism is selected from the group consisting of Faecalibacterium prausnitzii members (total FP), Faecalibacterium prausnitzii phylogroup I members (PHGI) and Faecalibacterium prausnitzii phylogroup II members (PHGII); and ii. comparing the subject sample abundance of one or more of said target microorganisms and/or a mathematical combination thereof, with the corresponding values in a reference sample of the IBD phenotypes to be distinguished from to determine the IBD phenotype the subject is suffering from; wherein the subject sample presenting values significantly similar to one of said IBD phenotypes will be indicative that the subject is suffering from said IBD phenotype; and wherein said IBD phenotypes are defined by at least the combination of two, preferably three, of the following parameters:
- disease location;
IBD type; and
- age at diagnosis,
optionally, comprising the use of additional biomarkers for the definition of said IBD phenotypes.
Another aspect of the invention relates to a method for diagnosing C-CD in a human subject suffering from IBD with colonic involvement comprising the following steps:
i. determining the abundance of a target microorganism in an intestinal sample from said subject, wherein said target microorganism is selected from the group consisting of Faecalibacterium prausnitzii members (total FP), Faecalibacterium prausnitzii phylogroup I members (PHGI) and Faecalibacterium prausnitzii phylogroup II members (PHGII); and ii. comparing the subject sample abundance of one or more of said target microorganisms and/or a mathematical combination thereof, with the corresponding values in a reference sample, wherein a significant deviation in the subject sample values with regard to said reference sample is indicative of C-CD.
Also, another aspect of the invention relates to a method for diagnosing IC-CD in a human subject suffering from l-CD or C-CD comprising the following steps:
i. determining the abundance of a target microorganism in an intestinal sample from said subject, wherein said target microorganism is selected from the group consisting of Faecalibacterium prausnitzii members (total FP), Faecalibacterium prausnitzii phylogroup I members (PHGI) and Faecalibacterium prausnitzii phylogroup II members (PHGII); and ii. comparing the subject sample abundance of one or more of said target microorganisms and/or a mathematical combination thereof, with the corresponding values in a reference sample from said subject at around diagnose of l-CD or C-CD, wherein a significant deviation in the subject sample values with regard to said reference sample is indicative of IC-CD. A further aspect of the invention relates to a method for the prognosis of inflammatory bowel disease (IBD) which comprises the determination of an IBD phenotype according to a method for the differential diagnosis of any of the above aspects of the invention and establishing prognosis according to the determined IBD phenotype. Another additional aspect of the invention relates to the use of Faecalibacterium prausnitzii members (total FP) abundance, Faecalibacterium prausnitzii phylogroup I members (PHGI) abundance and/or Faecalibacterium prausnitzii phylogroup II members (PHGII) abundance determined in an intestinal sample of a human subject; and/or a mathematical combination thereof as biomarker for the differential diagnosis of inflammatory bowel disease (IBD) phenotypes.
Still another additional aspect of the invention relates to a kit for the differential diagnosis of inflammatory bowel disease (IBD) phenotypes according to a method of any of above aspects, comprising: - a reagent for determining the abundance of a target microorganism selected from the group consisting of Faecalibacterium prausnitzii members (total FP), Faecalibacterium prausnitzii phylogroup I members (PHGI), and Faecalibacterium prausnitzii phylogroup II members (PHGII); and instructions for use of said reagent(s) to determine the abundance levels of said target microorganism from a human intestinal sample.
BRIEF DESCRIPTION OF THE DRAWINGS
Figure 1. Graphical representation of the prevalence of F. prausnitzii (black), F. prausnitzii phylogroup I (grey) and F. prausnitzii phylogroup II (white). Subjects were categorized by disease (left) and IBD location (right). The following abbreviations have been used: H, control subjects; CRC, colorectal cancer; IBS, irritable bowel syndrome; UC, ulcerative colitis; CD, Crohn's disease; E1 , proctitis; E2, left-sided colitis; E3, pancolitis; C-CD, colonic CD; IC-CD, ileocolonic CD; l-CD, ileal CD; and IBD, inflammatory bowel disease. Numbers in the bars indicate the number of patients (biopsies) analyzed to calculate the prevalence. Statistics was calculated separately for each panel. Homogeneous subgroups (P>0.05) within each panel are indicated with the same symbols above the bars, whereas groups of patients with statistically different prevalence (P<0.05) do not share any superscript.
Figure 2. Graphical representation of the prevalence of F. prausnitzii, F. prausnitzii phylogroup I and F. prausnitzii phylogroup II in each group of patients (A) categorized by disease and (B) categorized by IBD subtype. Both in A) and B) prevalence values along the gut have been represented (from inner to outer circles-ileum, colon and rectum) and also the corresponding prevalence pooling all the samples (outer circle). The following abbreviations have been used: H, control subjects; CRC, colorectal cancer; IBS, irritable bowel syndrome; UC, ulcerative colitis; CD, Crohn's disease; E1 , ulcerative proctitis; E2, ulcerative left-sided colitis; E3, ulcerative pancolitis; C-CD, colonic CD; IC-CD, ileocolonic CD; and l-CD, ileal CD. Numbers in the sectors indicate the number of biopsies analysed. * Samples with uncertain location have been included in the average analysis of IBS patients.
Figure 3. Graphical representation as a heat map on the suitability of mucosa-associated F. prausnitzii, F. prausnitzii phylogroup I and F. prausnitzii phylogroup II abundances to be used as biomarkers to distinguish amongst different intestinal disorders and IBD subtypes (by location) determined by the area under the curve (AUC) obtained by receiver operating characteristic analysis (ROC curve). A test is considered to be a suitable discriminator if the AUC is from 0.6 to 0.75 (in light grey), to have a high discrimination if the AUC is from 0.75 to 0.9 (in dark grey) and to be an excellent discriminator if the AUC is from 0.9 to 1 (in black). The following abbreviations have been used: H, controls; IBD, inflammatory bowel disease; IBS, irritable bowel syndrome; UC, ulcerative colitis; CD, Crohn's disease; CRC, colorectal cancer; l-CD, ileal CD; IC-CD, ileocolonic CD, C-CD, colonic CD; E1 , ulcerative proctitis, E2, distal UC; and E3, extensive UC or ulcerative pancolitis.
Figure 4. Receiver operating characteristic (ROC) curves for mucosa-associated F. prausnitzii, F. prausnitzii phylogroup I (PHGI) and F. prausnitzii phylogroup II (PHGII) abundances for those group comparisons wherein PHGI shows to be the best discriminator between presence and absence of intestinal disease or disease subtype. A) H vs IBS + IBD + CRC; B).H vs IBD; C) H vs CD and D) H vs I- CD. In the Y axis is represented sensitivity and in the X axis 1 -specificity. The following abbreviations have been used: H, controls; IBD, inflammatory bowel disease; IBS, irritable bowel syndrome; CD, Crohn's disease; CRC, colorectal cancer; and l-CD, ileal CD.
Figure 5. Receiver operating characteristic (ROC) curves for mucosa-associated F. prausnitzii, F. prausnitzii phylogroup I (PHGI) and F. prausnitzii phylogroup II (PHGII) abundances for selected group comparisons for differential diagnosis of clinical interest. A) UC-E3 vs C-CD; B) l-CD vs IC-CD; and C) IC- CD vs C-CD. In the Y axis is represented sensitivity and in the X axis 1 -specificity. The following abbreviations have been used: l-CD, ileal CD; IC-CD, ileocolonic CD, C-CD, colonic CD; and E3, extensive UC or ulcerative pancolitis.
Figure 6. Graphical representation as a heat map on the suitability of F. prausnitzii, F. prausnitzii phylogroup I and F. prausnitzii phylogroup II abundances in feces to be used as biomarkers to distinguish amongst different IBD diagnostics and IBD subtypes (by location) determined by the area under the curve (AUC) obtained by receiver operating characteristic analysis (ROC curve). A test is considered to be a suitable discriminator if the AUC is from 0.6 to 0.75 (in light grey), to have a high discrimination if the AUC is from 0.75 to 0.9 (in dark grey) and to be an excellent discriminator if the AUC is from 0.9 to 1 (in black). The following abbreviations have been used: H, controls; IBD, inflammatory bowel disease; IBS, irritable bowel syndrome; UC, ulcerative colitis; CD, Crohn's disease; CRC, colorectal cancer; l-CD, ileal CD; IC- CD, ileocolonic CD, C-CD, colonic CD; E1 , ulcerative proctitis, E2, distal UC; and E3, extensive UC or ulcerative pancolitis. Figure 7. Receiver operating characteristic (ROC) curves for F. prausnitzii, F. prausnitzii phylogroup I (PHGI) and F. prausnitzii phylogroup II (PHGII) abundances in feces for selected group comparisons of IBD disease and disease subtype. A).H vs IBD; C) H vs CD and D) H vs l-CD. In the Y axis is represented sensitivity and in the X axis 1 -specificity. The following abbreviations have been used: H, controls; IBD, inflammatory bowel disease; IBS, irritable bowel syndrome; CD, Crohn's disease; CRC, colorectal cancer; and l-CD, ileal CD.
Figure 8. Receiver operating characteristic (ROC) curves for F. prausnitzii, F. prausnitzii phylogroup I (PHGI) and F. prausnitzii phylogroup II (PHGII) abundances in feces for selected group comparisons for differential diagnosis of clinical interest. A) IC-CD vs l-CD; B). IC-CD vs C-CD; and C) UC-E3 vs C-CD. In the Y axis is represented sensitivity and in the X axis 1 -specificity. The following abbreviations have been used: l-CD, ileal CD; IC-CD, ileocolonic CD, C-CD, colonic CD; and E3, extensive UC or ulcerative pancolitis.
Figure 9. Graphs representing abundances of fecal Total F. prausnitzii (FT), phylogroups (PHGI and PHGII) and E.coli (EC) in healthy (H), Ulcerative Colitis (UC) and Crohn's Disease (CD) patients (expressed in Ct). Figure 10. Graphs representing bacterial abundances by biomarkers ratios.
Figure 1 1. Graphs representing ROC curve analysis of fecal Total F. rausnitzii (FT), phylogroups (PHGI and PHGII) and E.coli (EC) in healthy (H), Ulcerative Colitis (UC) and Crohn's Disease (CD) patients.
Figure 12. Faecalibacterium prausnitzii phylogroup I (PHGI) and phylogroup II (PHGII) abundance in samples of colonic, ileocolonic and ileal locations of CD patients.
Figure 13. Ratios of FT/PHGI and FT/PHGII abundance in samples of colonic, ileocolonic and ileal locations of CD patients.
Figure 14. Graphs representing ROC curve analysis of faecal Total F. prausnitzii (FT), phylogroups (PHGI and PHGII) and E.coli (EC) in ileal location in Crohn's Disease (CD) patients. Figure 15. Graph representing ROC curve analysis of fecal Total F. prausnitzii (FT), and phylogroup I (PHGI) in ileocolonic location in Crohn's Disease (CD) patients.
Figure 16. Graphs representing ROC curve analysis of faecal Total F. prausnitzii (FT) and phylogroups (PHGI and PHGII) in colonic location in Crohn's Disease (CD) patients.
Figure 17. Graphs representing ROC curve analysis of bacterial markers and ratios to discriminate UC patients.
Figure 18. Graphs representing ROC curve analysis of bacterial markers and ratios in colonic location in Crohn's Disease (CD) patients.
Figure 19. Total Faecalibacterium prausnitzii (FT), phylogroup I (PHI) and phylogroup II (PHII) in CD and UC patients between different ranges of calprotectin. Figure 20. Graphs of ratios FT/PHI, PHI/PHII, PHI/EC and PHII/EC in CD and UC patients between calprotectin over or under 250μg g.
Figure 21. Graphs of ROC curve analysis in CD patients with calprotectin values over 250μg g. Figure 22. Graphs of ROC curve analysis in UC patients with calprotectin values over 250μg g.
Figure 23. Abundances of total Faecalibacterium prausnitzii (FT), phylogroup I (PHI), phylogroup II (PHII) and E. coli in responders and non-responders CD and UC patients.
Figure 24. FT/EC, FT/PHI, FT/PHII, PHI/PHII, PHI/EC and PHII/EC ratios in CD and UC patients subclassified as responders and non-responders. DETAILED DESCRIPTION OF THE INVENTION
DEFINITIONS The term "prevalence" as used herein refers to a measure of the number of cases of disease occurring within the population under study, i.e., % of biological samples or individuals positive for a target microorganism from the total of biological samples or individuals analyzed. Prevalence is thus calculated from the qualitative determination (presence/absence) of said target microorganism within each of the samples or individuals under study.
The term "abundance" as used herein refers to a measure of the quantity of a target microorganism within a biological sample. It is also referred as "load". Bacterial quantification is generally carried out by molecular methods, typically by determining the number of 16S rRNA gene copies of said target microorganism, for instance by fluorescence in situ hybridization (FISH), quantitative polymerase chain reaction (qPCR) or PCR/pyrosequencing. Quantification of the abundance of a target nucleic acid sequence within a biological sample might be absolute or relative. "Relative quantification" is generally based on one or more internal reference genes, i.e., 16S rRNA genes from reference strains, such as determination of total bacteria using universal primers and expressing the abundance of the target nucleic acid sequence as a percentage of total bacterial 16S rRNA gene copies or normalized by E.coli 16S rRNA gene copies. "Absolute quantification" gives the exact number of target molecules by comparison with DNA standards or normalizing by DNA concentration.
The term "quantification levels" might be the concentration (DNA amount per unit of volume), the DNA amount or number of gene copies per number of cells, the cycle threshold value (Ct value) or any mathematical transformation thereof, such as the log 10 of the number of gene copies.
The expression "usefulness as biomarker" as used herein refers to how well the molecular marker identifies the target condition of interest, in other words, how well said parameter enables to discriminate between subjects belonging to different population groups, for instance between disease and non-disease group or between different disease phenotypes. This is referred as the "validity" or "performance" of the test.
Validity studies address the agreement between a proposed (index) test and a reference standard for the ability to identify a target condition (see Florkowski M. C, Clin Biochem Rev. 2008, 29 (Suppl 1 ): S83- S87). Sensitivity, specificity, accuracy, positive likelihood ratio, negative likelihood ratio, positive predictive value and negative predictive value are statistic values which can be defined to evaluate the test performance. Acronyms' definition and further details are provided in Table 1 below. Table 1. Formulas and acronym's definition of parameters useful for defining the validity of a test, Florkowski M. C, Clin Biochem Rev. 2008, 29 (Suppl 1 ): S83-S87.
Reference Standard
Disease present Disease absent Total
Index Test positive True positive (TP) False positive (FP) TP + FP
Index Test negative False negative (FN) True negative (TN) TN + FN
Total TP + FN TN + FP
Sensitivity = TP / (TP + FN)
Specificity = TN / (TN + FP)
Positive predictive value (PPV) = TP / (TP + FP)
Negative predictive value ( PV) = TN / (TN + FN)
Positive likelihood ratio (LR+) = sensitivity / (l - specificity)
Negative likelihood ratio (LR-) = (1 - sensitivity) specificity The term "sensitivity" as used herein refers to the proportion of subjects who have the target condition (reference standard positive) and give positive test results (TP/ (TP + FN)). It shows how good the test is at detecting a disease. Sensitivity ("sens") may be within the range of 0 (0%) < sens < 1 (100%) and ideally, the number of false negatives equaling zero or close to equaling zero and sensitivity equaling one (100%) or close to equaling one (100%).
The term "specificity" as used herein refers to the proportion of subjects without the target condition (reference standard negative) and give negative test results (TN/ (TN + FP)). It shows how good the test is at identifying normal (negative) condition. Specificity ("spec") may be within the range of 0 (0%) < spec < 1 (100%) and ideally, the number of false positives equaling zero or close to equaling zero and specificity equaling one (100%) or close to equaling one (100%).
The term "accuracy" as used herein refers to the proportion of true results, either true positive or true negative, in a population. It measures the degree of veracity of a screening test on a condition, i.e., how correct is the determination and exclusion of a given condition (TN + TP)/(TN+TP+FN+FP). Accuracy ("acc") may be within the range of 0 (0%) < acc < 1 (100%) and ideally, the number of false positives equaling zero or close to equaling zero and accuracy equaling one (100%) or close to equaling one (100%).
The term "Receiver Operating Characteristic (ROC) curves" as used herein refers to a graphical plot that illustrates the performance of a binary classifier system as its discrimination threshold is varied. The curve is created by plotting the true positive rate against the false positive rate at various threshold settings. The true positive rate is also known as sensitivity. The false positive rate is calculated as 1 - specificity. The ROC curve is thus a way of graphically displaying the true positive rate versus the false positive rate (sensitivity vs (1 -specificity)) across a range of cut-offs and of selecting the optimal cut-off for clinical use. Accuracy expressed as the area under the ROC curve (AUC) provides a useful parameter for comparing test performance. An AUC approaching 1 indicates that the test is highly sensitive as well as highly specific whereas an AUC approaching 0.5 indicates that the test is neither sensitive nor specific. In general, a test is considered to be a suitable discriminator if the AUC is from 0.6 to 0.75, to have high discrimination capacity if the AUC is from 0.75 to 0.9 and to be an excellent discriminator if the AUC is from 0.9 to 1. For further details see for instance, Zweig MH and Campbell G, Clinical Chemistry 1993; 39:561-577 or Greiner et al. Preventive Veterinary Medicine 2000; 45:23-41. The term "significant" or "statistically significant" when referring to differences between the test sample and the control or reference sample, relates to the condition when using the appropriate statistical analysis the probability of the groups being the same is less than 5%, e.g. p<0.05. In other words, the probability of obtaining the same results on a completely random basis is less than 5 out of 100 attempts. A person skilled in the art will know how to choose the appropriate statistical analysis. Typically, the appropriate statistical analysis is determined based on whether the variable under study has a normal distribution, for instance by using the test of Kolmogorov-Smirnov and on whether there is homoscedasticity, which is determined for instance with the Levene test. Preferably, in those cases where there is a normal distribution and homoscedasticity, a parametric model such as t-test or ANOVA test is used; and where at least one of these two requirements is not accomplished then a non-parametric model such as Mann-Whitney U test or Kruskal-Wallis test is generally used.
The term "Inflammatory bowel disease (IBD)" as used herein refers to a group of idiopathic chronic inflammatory intestinal conditions. The two main disease categories the term covers are Crohn's disease (CD) and ulcerative colitis (UC), with both overlapping and distinct clinical and pathological features. The diagnosis of IBD requires a comprehensive physical examination and a review of the patient's history. Various tests, including blood tests, stool examination, endoscopy, biopsies, and imaging studies help exclude other causes and confirm the diagnosis. (World Gastroenterology Organisation Global Guidelines, Inflammatory bowel disease: a global perspective, June 2009; and Silverberg et al., Can J Gastroenterol. 2005, 19 Suppl A:5-36). With an increasing understanding of epidemiology and genetics of IBD, it has become evident to clinicians that UC and CD may actually represent several forms of IBD. Thus, the term "IBD" as used herein includes phenotypes thereof.
The term "IBD phenotypes" as used herein includes diseases or disorders such as CD, UC, indeterminate colitis, inflammatory bowel disease type unclassified (IBDU), pouchitis, microscopic colitis, diverticulitis (Mowat et al., Gut 201 1 , 1-37; Geboes et al., J Clin Pathol 2005;58: 1 133-1 134; Cheifetz A, and Itzkowitz S., J Clin Gastroenterol. 2004 May-Jun;38(5 Suppl 1 ):S44-50). It further includes subtypes within an IBD disease or disorder. CD subtypes are for instance those defined by the Montreal classification, wherein CD is classified according to age at diagnosis, location and/or behavior. UC subtypes can be also those defined by the Montreal classification, wherein UC is classified according to disease extend and/or disease severity (World Gastroenterology Organisation Global Guidelines, Inflammatory bowel disease: a global perspective, June 2009; and Silverberg et al., Can J Gastroenterol. 2005, 19 Suppl A:5-36).
The term "indeterminate colitis (IC)" as used herein refers to those cases of chronic IBD without characteristic features of either UC or CD in a colectomy specimen (Silverberg et al., Can J Gastroenterol. 2005, 19 Suppl A:5-36; Satsangi et al., Gut 2006; 55, 749-753). The term "inflammatory bowel disease type unclassified (IBDU)" as used herein refers to those cases wherein there is evidence on clinical and endoscopic grounds for chronic inflammatory bowel disease affecting the colon, without small bowel involvement and there is no histological or other evidence to establish either CD or UC, wherein infection has been ruled out (Satsangi et al., Gut 2006; 55, 749-753).
The term "diagnostic test" as used herein refers to a test which determines the presence or absence of a disease when a subject shows signs or symptoms of the disease. The test could be used to suggest or ruled out the disease or phenotype. The term diagnosis may include the differential diagnosis. The term "screening test" as used herein refers to a test which identifies asymptomatic individuals who may have the disease and it is used for early detection of the disease. The test could be used to suspect the presence of the disease or phenotype.
The term "test for monitoring progression" as used herein for IBD refers to a test which determines whether the disease has been extended to other areas of the intestine, for instance monitoring whether the disease has progressed in a patient from l-CD (CD with ileal location) to IC-CD wherein the disease has been extended also to the colon.
The term "efficacy of a treatment" as used herein refers to the degree to which a treatment accomplishes the desired or projected outcomes, for instance the ability of a drug to achieve the desired effect.
The term "treatment" encompasses both a prophylactic or therapeutic treatment. The term "therapeutic treatment" or "therapy" as used herein refers to bringing a body from a pathological state or disease back to its normal, healthy state. The term "prophylactic treatment" as used herein refers to preventing a pathological state.
The term "probe" as used herein refers to synthetic or biologically produced nucleic acids, between 10 and 285 base pairs in length which contain specific nucleotide sequences that allow specific and preferential hybridization under predetermined conditions to target nucleic acid sequences, and optionally contain a moiety for detection or for enhancing assay performance. A minimum of ten nucleotides is generally necessary in order to statistically obtain specificity and to form stable hybridization products, and a maximum of 285 nucleotides generally represents an upper limit for length in which reaction parameters can be easily adjusted to determine mismatched sequences and preferential hybridization. Probes may optionally contain certain constituents that contribute to their proper or optimal functioning under certain assay conditions. For example, probes may be modified to improve their resistance to nuclease degradation (e.g., by end capping), to carry detection ligands (e.g., fluorescein) or to facilitate their capture onto a solid support (e.g., poly-deoxyadenosine "tails").
The term "primers" as used herein refers to oligonucleotides that can be used in an amplification method, such as a polymerase chain reaction ("PCR"), to amplify a nucleotide sequence. Primers are designed based on the polynucleotide sequence of a particular target sequence, e.g., one specific 16S rDNA sequence. Design and validation of primers and probes is well known in the art. For quantitative real-time PCR methods, see for instance Rodriguez A et al. (Methods Mol Biol., 2015, 1275:31-56).
The term "specific" as used herein means that a nucleotide sequence will hybridize to/amplify a predetermined target sequence and will not substantially hybridize to/amplify a non-target sequence under the assay conditions, generally stringent conditions are used.
The term "hybridization" as used herein refers to a process by which, under predetermined reaction conditions, two partially or completely complementary strands of nucleic acid are allowed to come together in an antiparallel fashion to form a double-stranded nucleic acid with specific and stable hydrogen bonds, following explicit rules pertaining to which nucleic acid bases may pair with one another.
The term "substantial hybridization" means that the amount of hybridization observed will be such that one observing the results would consider the result positive with respect to hybridization data in positive and negative controls. Data which is considered "background noise" is not substantial hybridization.
The term "stringent hybridization conditions" means approximately 35°C to 65°C in a salt solution of approximately 0.9 molar NaCI. Stringency may also be governed by such reaction parameters as the concentration and type of ionic species present in the hybridization solution, the types and concentrations of denaturing agents present, and the temperature of hybridization. Generally as hybridization conditions become more stringent, longer probes are preferred if stable hybrids are to be formed. As a rule, the stringency of the conditions under which hybridization is to take place will dictate certain characteristics of the preferred probes to be employed. The term "identity" as used herein refers to an exact nucleotide-to-nucleotide or amino acid to amino acid correspondence of two polynucleotides or polypeptide sequences, respectively. Two or more sequences (polynucleotide or amino acid) can be compared by determining their "percent identity". The "percent identity" of two sequences, whether nucleic acid or amino acid sequences, is the number of exact matches between two aligned sequences divided by the length of the shorter sequence and multiplied by 100. Suitable programs for calculating the percent identity or similarity between sequences are well known in the art, such as the NCBI BLAST program, used for example with default parameters (http://www. ncbi. nlm. gov/cgi-bin/BLAST).
The term "kit" or "testing kit" denotes combinations of reagents and adjuvants required for an analysis. Although a test kit consists in most cases of several units, one-piece analysis elements are also available, which must likewise be regarded as testing kits.
A METHOD FOR DETERMINING THE ABUNDANCE OF FAECALIBACTERIUM PRAUSNITZII PHGI AND/OR PHGII MEMBERS In a first aspect, the invention relates to an in vitro method for determining the abundance of Faecalibacterium prausnitzii phylogroup I members (PHGI) and/or of Faecalibacterium prausnitzii phylogroup II members (PHGII) in an intestinal sample from a subject; wherein PHGI abundance determination comprises the use of a primer and/or probe with sequence SEQ ID NO: 3 or a sequence with at least 75% identity thereof; and wherein PHGII abundance determination comprises the use of a primer and/or a probe with sequence SEQ ID NO: 4 or a sequence with at least 75% identity thereof.
Faecalibacterium is a new genus created by Duncan et al. (Duncan et al., Int J Syst Evol Microbiol. 2002; 52, 2141-2146) with the following description: Faecalibacterium (Fae.ca.li.bac.te«ri.um. L. adj. faecalis pertaining to feces; Gr. dim. n. bakterion a small rod; N.L. neut. n. Faecalibacterium rod from feces, as this bacterium is present in high numbers in feces in the colon, its presumed habitat). Gram-negative, non-spore-forming and strictly anaerobic. The non-motile organism produces butyrate,d-lactate and formate, and utilizes acetate. Genomic DNA G-C content is 47±57 mol % (as determined by thermal denaturation). The type strain, whose characteristics were reported by Cato ef al. (1974), is Faecalibacterium prausnitzii ATCC 27768T (NCIMB 13872T). However, most of the recent studies performed on this species in the last ten years are based on strain A2-165 (DSM 17677) also described by Duncan et al. (Duncan et al., Int J Syst Evol Microbiol. 2002; 52, 2141-2146).
Two phylogroups of F. prausnitzii have been previously described (Lopez-Siles et al. (Appl Environ Microbiol. 2012;78:420-428). This study analyses the phylogenetic relationship of F. prausnitzii isolates to other members of Clostridium cluster IV based on 16S rRNA gene sequences and defines for the first time two phylogroups within F. prausnitzii species (Figure 1 ), specifically it defines two branches within the Ruminococcaceae family with > 97% sequence identity. These include five sequences reported previously for the isolates M21/2, ATCC 27766, and ATCC 27768 (belonging to PHGI) and A2-165 and L2-6 (belonging to PHGII).
In order to simultaneously quantify both F. prausnitzii phylogroups, it was developed a qPCR assay comprising the use of a unique pair of species-specific primers for 16S rRNA gene of F. prausnitzii and two hydrolysis probes targeting each F. prausnitzii phylogroup which were designed and optimized by the inventors. The oligonucleotides used in this study are shown in Table 15, see the Examples. The primers and probes used for the quantification of F. prausnitzii phylogroups have been newly designed whereas those for total F. prausnitzii were previously disclosed in Lopez-Siles et al., International Journal of Medical Microbiology 2014, 304:464-475. The oligonucleotides recited in Table 15 are referred throughout the specification as SEQ ID NO: 1 to SEQ ID NO: 16 as shown in Table 2 below:
Table 2. Oligonucleotides for F. prausnitzii and the phylogroups thereof, total bacteria, E.coli and internal amplification control (IAC).
Figure imgf000017_0001
SEQ ID NO 4 (PHG2 180PR oligont) TAAGCCCACRGCTCGGCATC
SEQ ID NO 5 (Fpra 428 F) TGTAAACTCCTGTTGTTGAGGAAGATAA
SEQ ID NO 6 (Fpra 583 R) GCGCTCCCTTTACACCCA
SEQ ID NO 7 (Fpra 493 PR oligont) CAAGGAAGTGACGGCTAACTACGTGCCAG
SEQ ID NO 8 (F_Bact 1369) CGGTGAATACGTTCCCGG
SEQ ID NO 9 (R_Prok_1492) TACGGCTACCTTGTTACGACTT
SEQ ID NO 10 (P_TM_1389F oligont) CTTGTACACACCGCCCGTC
SEQ ID NO 11 (IAC F) TACGGATGAGGAGGACAAAGGA
SEQ ID NO 12 (IAC R) CACTTCGCTCTGATCCATTGG
SEQ ID NO 13 (IAC PR OLIGONT) CGCCGCTATGGGCATCGCA
SEQ ID NO 14 (E.coli 395 F) CATG CCG CGTGTATG AAG AA
SEQ ID NO 15 (E.coli 490 R) CGGGTAACGTCAATGAGCAAA
SEQ ID NO 16 (E.coli 437 PR) TATTAACTTTACTCCCTTCCTCCCCGCTGAA
Design
Sequences of the 16S rRNA gene from F. prausnitzii and from closely related Ruminococcaceae were recovered from GenBank (Table 14, see the Examples) and aligned using Clustal W software to obtain the F. prausnitzii 16S rRNA gene, PHGI 16S rRNA gene and PHGII 16S rRNA gene, respective consensus sequences. Both primers and hydrolysis probes were manually designed from these consensus sequences and optimized.
In silico validation
Coverage was determined in silico using TestPrime™ against sequences in the SILVA database (the SILVA Probe Match and Evaluation Tool - TestProbe 3.0, http://www.arb-silva.de/search/testprobe/). TestPrime™ allows evaluating the performance of primer pairs by running an in silico PCR on the SILVA databases. From the results of the PCR, TestPrime computes coverages for each taxonomic group in all of the taxonomies offered by SILVA.
SILVA is a database which includes sequences of the 16S rRNA gene of all the Faecalibacterium sp. recovered through molecular methods by different studies. The designed primers were tested and targeted 74.85% of the of the 16S rRNA gene of Faecalibacterium sp. sequences in this dataset. Accordingly, in a particular embodiment of the in vitro method for determining the abundance of Faecalibacterium prausnitzii phylogroup I members (PHGI) and/or of Faecalibacterium prausnitzii phylogroup II members (PHGII) of the invention, said primers enable the amplification of at least 60%, at least 65%, at least 70%, preferably around 75% of the known 16S rRNA gene of Faecalibacterium sp. In a particular embodiment the known 16S rRNA gene of Faecalibacterium sp are those included in the SILVA database at the time of filing the application.
Since SILVA database includes only sequences from 16S rRNA gene but there may be other parts of the genomes of bacterial species which can match with the primers and cause false positive results, the primers specificity was further tested by using Nucleotide BLAST (http://blast.ncbi. nlm.nih.gov/Blast.cgi?PROGRAM=blastn&PAGE_TYPE=BlastSearch&LINK_LOC=blast home, NCBI BLAST: a better web interface. Johnson M et al. Nucleic Acids Res. 2008, 1 ;36(Web Server issue): W5-9.), limiting the search to "bacteria NOT uncultured". The results obtained confirmed specificity for Faecalibacterium sp.
In vitro validation
Furthermore, inclusivity/exclusivity tests in vitro were carried out. The primers showed to be able to specifically amplify the 16S rRNA gene of the 9 isolates available for F. prausnitzii and the probes were specific for each of the phylogroups. In addition, the same test was performed with no target species DNA (exclusivity test) and specificity confirmed (Table 16, see the Examples). Faecalibacterium prausnitzii phylogroup I members are those bacterial sequences which 16S rRNA gene matched with the Phylogroup I probe (SEQ ID NO:3), this includes the 5 sequences used for probe design shown in Table 3 and the 1 191 sequences matched in the SILVA database, which accession numbers are provided in Table 4 (it is understood that the sequences listed in Table 3 also matched in the SILVA database but have not been repeated herein). Thus, Phylogroup I probe (SEQ ID NO:3) was shown to hybridize specifically with a total of 1 196 16S rRNA gene sequences.
Table 3. Accession number, phytogeny, organism name and length (bp) of the 16S rRNA gene bacterial sequences used as basis for the design of with the PHGI specific probe.
Accession length number Phytogeny Organism Name (bp)
Bacteria;Firmicutes;Clostridia;Clostridiales; Faecalibacterium prausnitzii 16S
AJ413954 Ruminococcaceae;Faecalibacterium; rRNA gene, strain ATCC 27768 1462
F. prausnitzii DNA for 16S
Bacteria;Firmicutes Clostridia;Clostridiales; ribosomal RNA, strain ATCC
X85022 Ruminococcaceae Faecalibacterium; 27766 1499
Bacteria;Firmicutes Clostridia;Clostridiales; Butyrate-producing bacterium AY305307 Ruminococcaceae; Faecalibacterium; M21/2 16S ribosomal RNA gene 1433
Bacteria;Firmicutes ;Clostridia;Clostridiales; F. prausnitzii strain S4L/4 16S HQ457025 Ruminococcaceae; Faecalibacterium; ribosomal RNA gene 1483
Bacteria;Firmicutes ;Clostridia;Clostridiales; F. prausnitzii strain S3L/3 16S HQ457024 Ruminococcaceae; Faecalibacterium; ribosomal RNA gene 1469
Table 4. Accession numbers of the 1 191 sequences hybridizing specifically with the PHGI specific probe in the SILVA database under default conditions.
AF132246 AY977820 AY979936 AY984249 DQ796476 DQ797641 DQ798487
AJ408973 AY977841 AY980001 AY984354 DQ796525 DQ797649 DQ798541
AY978015 AY980058 AY984361 DQ796571 DQ797651 DQ798562
AM697227 AY9781 1 1 AY980091 AY984496 DQ796592 DQ797657 DQ798615
AY850440 AY978217 AY980107 AY984560 DQ796696 DQ797659 DQ798647
AY916168 AY978256 AY980109 AY984598 DQ796726 DQ797661 DQ798679
AY916280 AY978301 AY980155 AY984640 DQ796734 DQ797696 DQ799921
AY916290 AY97831 1 AY980177 AY984652 DQ796787 DQ797712 DQ799935
AY974822 AY978335 AY980714 AY984722 DQ796854 DQ797715 DQ799950
AY974935 AY97841 1 AY981 125 AY984772 DQ796890 DQ797719 DQ799967
AY975090 AY978468 AY981 136 AY984773 DQ796971 DQ797730 DQ800008
AY975146 AY978536 AY981 192 AY984841 DQ796987 DQ797737 DQ800043
AY975182 AY978548 AY981226 AY984871 DQ796999 DQ797747 DQ8001 15
AY975217 AY978554 AY981236 AY984874 DQ797013 DQ797750 DQ800745 AY975290 AY978582 AY981421 AY984965 DQ797018 DQ797754 DQ800932
AY975353 AY978660 AY981477 AY984996 DQ797073 DQ797757 DQ801041
AY975391 AY978691 AY981479 AY985061 DQ797107 DQ797764 DQ801054
AY975464 AY978708 AY981631 AY985082 DQ797128 DQ797776 DQ801057
AY975498 AY97871 1 AY981706 AY985087 DQ797136 DQ797784 DQ801077
AY975558 AY978734 AY981710 AY985131 DQ797226 DQ797785 DQ801 105
AY975568 AY978761 AY981719 AY985159 DQ797231 DQ797787 DQ801 1 12
AY975691 AY978779 AY981750 AY986127 DQ797271 DQ797803 DQ801271
AY975720 AY978813 AY981882 BAAX01000032 DQ797285 DQ797806 DQ801294
AY975737 AY978857 AY981951 BAAX01000131 DQ797286 DQ797810 DQ801297
AY975989 AY978859 AY982516 DQ326015 DQ797302 DQ797835 DQ801314
AY976012 AY978873 AY982567 DQ326327 DQ797304 DQ797836 DQ801384
AY976301 AY978881 AY982581 DQ441336 DQ797310 DQ797846 DQ801428
AY976471 AY978892 AY982583 DQ795780 DQ797365 DQ797847 DQ801446
AY976476 AY978922 AY982651 DQ795835 DQ797376 DQ797871 DQ801490
AY976559 AY978977 AY982665 DQ795862 DQ797385 DQ797908 DQ801519
AY976602 AY979070 AY982709 DQ795878 DQ797421 DQ797931 DQ801541
AY976609 AY979084 AY982784 DQ795925 DQ797444 DQ797964 DQ801571
AY976627 AY9791 16 AY983029 DQ795954 DQ797452 DQ798075 DQ801628
AY976645 AY979169 AY983068 DQ796034 DQ797455 DQ798141 DQ801695
AY976672 AY979176 AY983243 DQ796041 DQ797457 DQ798149 DQ801714
AY976683 AY979191 AY983314 DQ796042 DQ797467 DQ798184 DQ801762
AY976928 AY979237 AY983329 DQ796058 DQ797475 DQ798223 DQ801846
AY977016 AY979240 AY983449 DQ796134 DQ797532 DQ798226 DQ801880
AY977109 AY979246 AY983558 DQ796201 DQ797534 DQ798239 DQ801891
AY977231 AY979261 AY983608 DQ796294 DQ797590 DQ798258 DQ802184
AY977301 AY979342 AY983619 DQ796359 DQ797594 DQ798278 DQ802252
AY977388 AY979460 AY983735 DQ796372 DQ797602 DQ798316 DQ802262
AY97751 1 AY979747 AY983849 DQ796384 DQ797617 DQ798337 DQ802304
AY977557 AY979905 AY984204 DQ796459 DQ797630 DQ798404 DQ802307
DQ802315 DQ805664 DQ808693 DQ824246 DQ825077 EF401 1 16 EF402793
DQ802317 DQ805679 DQ808727 DQ824247 DQ825081 EF401 175 EF402812
DQ802330 DQ805730 DQ808739 DQ824255 DQ825084 EF401 184 EF402860
DQ802345 DQ805736 DQ808845 DQ824261 DQ825089 EF401200 EF402930
DQ802349 DQ805738 DQ808853 DQ824266 DQ825095 EF401203 EF402973
DQ802351 DQ805771 DQ808900 DQ824302 DQ825099 EF401227 EF402982
DQ802376 DQ805802 DQ808935 DQ824320 DQ825109 EF401283 EF403019
DQ802388 DQ805849 DQ808995 DQ824327 DQ8251 1 1 EF401312 EF403035
DQ802390 DQ805961 DQ809023 DQ824365 DQ8251 19 EF401374 EF403087
DQ802416 DQ806097 DQ809024 DQ824379 DQ825132 EF401433 EF403090
DQ802430 DQ806428 DQ809064 DQ824403 DQ825136 EF401490 EF403170
DQ802477 DQ806552 DQ809074 DQ824439 DQ825147 EF401498 EF403202
DQ802537 DQ806559 DQ809087 DQ824456 DQ825203 EF401537 EF403224
DQ802546 DQ806634 DQ809136 DQ824459 DQ825233 EF401593 EF403240
DQ802574 DQ806635 DQ809289 DQ824481 DQ825244 EF401601 EF403246
DQ802578 DQ806659 DQ809290 DQ824509 DQ825245 EF401643 EF403251
DQ802590 DQ806688 DQ809292 DQ824772 DQ825246 EF401659 EF403293
DQ802658 DQ806704 DQ809295 DQ824800 DQ825251 EF401719 EF403314 DQ802743 DQ806714 DQ809805 DQ824810 DQ825252 EF401740 EF403326
DQ802764 DQ806745 DQ809860 DQ824817 DQ825253 EF401748 EF403370
DQ802816 DQ806778 DQ809892 DQ824822 DQ825261 EF401771 EF403380
DQ803339 DQ806864 DQ810047 DQ824824 DQ825280 EF401840 EF403455
DQ80451 1 DQ806868 DQ810166 DQ824825 DQ825281 EF401888 EF403457
DQ804536 DQ806951 DQ823651 DQ824829 DQ825294 EF401979 EF403464
DQ804556 DQ807292 DQ823661 DQ824850 DQ825301 EF401998 EF403469
DQ804564 DQ807305 DQ823664 DQ824858 DQ825309 EF402038 EF403552
DQ804568 DQ807378 DQ823694 DQ824865 DQ82531 1 EF4021 17 EF403588
DQ804597 DQ807383 DQ823731 DQ824877 DQ825322 EF402124 EF403703
DQ804616 DQ807392 DQ823803 DQ824893 DQ825328 EF402129 EF403716
DQ804632 DQ807458 DQ823824 DQ824895 DQ825336 EF402161 EF403721
DQ804660 DQ808476 DQ823827 DQ824921 DQ825339 EF402189 EF403761
DQ804733 DQ808489 DQ823860 DQ824938 DQ904651 EF402250 EF403762
DQ804758 DQ808519 DQ823915 DQ824947 DQ904678 EF402359 EF403845
DQ804764 DQ808522 DQ823917 DQ824962 DQ904701 EF402414 EF403882
DQ804767 DQ808530 DQ823929 DQ824972 DQ904876 EF402460 EF403887
DQ804799 DQ808555 DQ823958 DQ824977 EF400765 EF402461 EF404000
DQ804807 DQ808580 DQ823982 DQ824979 EF400784 EF402470 EF404029
DQ805089 DQ808593 DQ824007 DQ824994 EF400802 EF402473 EF404036
DQ805139 DQ808630 DQ824020 DQ825019 EF400835 EF402530 EF404121
DQ805142 DQ808646 DQ824084 DQ825025 EF400958 EF402548 EF404156
DQ805143 DQ808649 DQ824087 DQ825028 EF400974 EF402552 EF404228
DQ805180 DQ808664 DQ824173 DQ825053 EF401005 EF402620 EF404234
DQ805268 DQ808673 DQ824217 DQ825062 EF401023 EF402758 EF404284
DQ805429 DQ808680 DQ824229 DQ825068 EF401093 EF402771 EF404288
EF404298 EU762904 FJ363528 FJ369154 FJ504501 FJ509240 FJ512284
EF404352 EU762928 FJ363552 FJ370804 FJ504518 FJ509248 FJ512285
EF404375 EU763004 FJ363717 FJ371 152 FJ504586 FJ509495 FJ512286
EF404442 EU763044 FJ363882 FJ371 164 FJ504593 FJ509496 FJ512287
EF404447 EU763072 FJ363897 FJ371 170 FJ504619 FJ509506 FJ512288
EF404456 EU763100 FJ364270 FJ371 179 FJ504629 FJ509507 FJ512289
EF404497 EU763157 FJ364354 FJ371203 FJ504633 FJ509850 FJ512290
EF404505 EU764022 FJ364498 FJ371234 FJ504698 FJ510190 FJ512291
EF404521 EU765786 FJ364535 FJ371245 FJ504713 FJ510191 FJ512292
EF404538 EU766096 FJ364947 FJ371389 FJ504723 FJ510192 FJ512293
EF404576 EU767077 FJ364952 FJ371429 FJ504729 FJ510193 FJ512294
EF404583 EU767203 FJ364960 FJ371718 FJ504796 FJ510514 FJ512295
EF404591 EU767429 FJ365109 FJ371731 FJ504816 FJ510518 FJ512296
EF404617 EU768089 FJ365124 FJ371732 FJ506821 FJ510519 FJ512297
EF404622 EU768103 FJ365130 FJ371746 FJ506893 FJ510525 FJ512298
EF404629 EU768453 FJ365144 FJ371786 FJ506907 FJ510526 FJ512299
EF404652 EU768534 FJ365238 FJ371790 FJ506974 FJ510528 FJ512300
EF404689 EU774102 FJ366075 FJ371792 FJ507033 FJ510529 FJ512301
EF404698 EU774128 FJ366221 FJ371813 FJ507085 FJ510530 FJ512302
EF404759 EU774255 FJ366894 FJ371860 FJ507130 FJ510531 FJ512303
EF404787 EU775393 FJ366936 FJ371873 FJ507672 FJ510532 FJ512304
EF404868 EU777345 FJ366953 FJ371913 FJ507673 FJ510533 FJ512305 EF404872 EU778127 FJ366977 FJ371915 FJ507675 FJ510546 FJ512343
EF404886 EU778130 FJ367026 FJ371948 FJ507676 FJ510547 FJ512344
EF404958 EU778240 FJ367036 FJ372236 FJ507887 FJ510548 FJ512888
EF404962 EU778287 FJ367066 FJ372239 FJ507888 FJ510860 FJ512889
EF404970 EU778343 FJ367076 FJ372286 FJ507889 FJ510863 FJ512891
EF404992 FJ362670 FJ3671 17 FJ503869 FJ507890 FJ510864 FJ512892
EF405005 FJ362673 FJ367178 FJ504079 FJ507898 FJ510865 FJ512893
EF405017 FJ362734 FJ367407 FJ504238 FJ507899 FJ510866 FJ512894
EF405058 FJ362750 FJ367413 FJ504239 FJ507900 FJ510867 FJ512895
EF405176 FJ362806 FJ367496 FJ504269 FJ508226 FJ510868 FJ512896
EF405256 FJ362812 FJ367506 FJ504294 FJ508617 FJ510872 FJ512897
EF405259 FJ362819 FJ368253 FJ504338 FJ508618 FJ510873 FJ512898
EF405285 FJ362867 FJ368294 FJ504351 FJ508619 FJ510874 FJ512900
EF405286 FJ362934 FJ368328 FJ504352 FJ508620 FJ510875 FJ512901
EF405292 FJ362977 FJ368355 FJ504358 FJ508621 FJ51 1314 FJ512903
EF405327 FJ363063 FJ368365 FJ504360 FJ508622 FJ51 1315 FJ512904
EF405374 FJ363216 FJ368366 FJ504362 FJ508623 FJ51 1316 FJ512905
EF405465 FJ363272 FJ368368 FJ504378 FJ508929 FJ51 1318 FJ673014
EF405490 FJ363301 FJ368390 FJ504379 FJ508930 FJ51 1823 FJ673121
EU462466 FJ363322 FJ368396 FJ504383 FJ508931 FJ51 1824 FJ673295
EU761801 FJ363461 FJ368404 FJ504387 FJ508932 FJ512282 FJ673582
EU762168 FJ363490 FJ368453 FJ504467 FJ508954 FJ512283 FJ673757
FJ673815 GQ448269 HQ773650 HQ778925 HQ790769 HQ810774 JQ183352
FJ675804 GQ44831 1 HQ773659 HQ780359 HQ790907 HQ810792 JQ183361
FJ677025 GQ448314 HQ773793 HQ780655 HQ791073 HQ810990 JQ185070
FJ677540 GQ448356 HQ774044 HQ780752 HQ791510 HQ812306 JQ185237
FJ677745 GQ448360 HQ774190 HQ780833 HQ791809 HQ812417 JQ186576
FJ678131 GQ448933 HQ774867 HQ780901 HQ792145 HQ812781 JQ186663
FJ678272 GQ448935 HQ774908 HQ781001 HQ792597 HQ812874 JQ186829
FJ678292 GQ492289 HQ775044 HQ781061 HQ792702 HQ812904 JQ186959
FJ678301 GQ896631 HQ775050 HQ781201 HQ792748 HQ813593 JQ186967
FJ678584 GQ896641 HQ775094 HQ781254 HQ792749 HQ813618 JQ186970
FJ678825 GQ896844 HQ775197 HQ781305 HQ792781 HQ813736 JQ189296
FJ679029 GQ896855 HQ775678 HQ781340 HQ792877 HQ813981 JQ190076
FJ679163 GQ896912 HQ775978 HQ781412 HQ792891 HQ815495 JQ190310
FJ679406 GQ897054 HQ776013 HQ781432 HQ792898 HQ816070 JQ190464
FJ679719 GQ897060 HQ776300 HQ781543 HQ792944 HQ816084 JQ190600
FJ679826 GQ897108 HQ776346 HQ782498 HQ792951 HQ816102 JQ941034
FJ679975 GQ897135 HQ776618 HQ783938 HQ792995 HQ816209 KF079369
FJ680543 GQ897267 HQ777044 HQ784200 HQ793834 HQ816240 KF080223
FJ682837 GQ897282 HQ777084 HQ784870 HQ793984 HQ819688 KF083506
FJ682920 GQ898058 HQ777252 HQ784924 HQ794481 HQ819689 KF088388
FJ683068 GQ898130 HQ777343 HQ785169 HQ794501 HQ819924 KF098066
FJ683129 GQ898135 HQ777348 HQ785309 HQ794558 JF030154 KF101388
FJ683190 GQ898417 HQ777372 HQ785926 HQ794613 JF030218 KF841632
FJ683291 GQ898476 HQ777421 HQ786337 HQ794617 JF1 18323 KF841685
FJ683292 GQ898574 HQ777422 HQ786925 HQ798175 JF124766 KF841718
FJ683324 GQ898622 HQ777471 HQ787097 HQ798180 JF135842 KF841733 FJ683435 HM262976 HQ777476 HQ7871 12 HQ798362 JF159724 KF841834
FJ683771 HM272035 HQ777484 HQ787194 HQ805740 JF160987 KF841916
FJ683934 HM343866 HQ777544 HQ787204 HQ805865 JF161 120 KF841925
FJ685187 HQ777554 HQ787293 HQ806134 JF161374 KF841935
FM873803 HQ751556 HQ777570 HQ787414 HQ806142 JF161478 KF841994
FM873958 HQ759466 HQ777587 HQ788628 HQ807875 JF161700 KF842592
GQ158585 HQ759508 HQ777629 HQ788644 HQ807965 JF162159 KF843045
GQ159565 HQ759528 HQ777647 HQ788709 HQ808038 JF163182 KF843344
GQ159566 HQ759703 HQ777860 HQ788757 HQ808188 JF163209 KF843510
GQ159567 HQ765918 HQ777870 HQ788806 HQ808300 JF177473
GQ448252 HQ766177 HQ778076 HQ788855 HQ809864 JF180334
GQ448253 HQ766193 HQ778126 HQ788864 HQ810227 JF220917
GQ448258 HQ773645 HQ778920 HQ7901 14 HQ810729 JN413782
Faecalibacterium prausnitzii phylogroup II members are those bacterial sequences which 16S rRNA gene matched with the Phylogroup II probe (SEQ ID NO:4), this includes the 13 sequences used for probe design shown in Table 5 and the 2231 sequences matched in the SILVA database, which accession numbers are provided in Table 6_(it is understood that the sequences listed in Table 5 also matched in the SILVA database but have not been repeated herein). Thus, Phylogroup II probe (SEQ ID NO:4) was shown to hybridize specifically with a total of 2244 16S rRNA gene sequences.
Table 5. Accession number, phylogeny, organism name and length (bp) of the 16S rRNA gene bacterial sequences used as basis for the design of the PHGII specific probe.
length
Accession number Phylogeny Organism Name (bp)
Bacteria;Firmicutes;Clostridia;Clostridiales;R Butyrate-producing bacterium uminococcaceae;Faecalibacterium; A2-165 16S rRNA gene 1466
Bacteria;Firmicutes;Clostridia;Clostridiales;R Butyrate-producing bacterium uminococcaceae;Faecalibacterium; L2-6 16S rRNA gene 1464
Bacteria;Firmicutes;Clostridia;Clostridiales;R F. prausnitzii strain L2-15
uminococcaceae;Faecalibacterium; 16S ribosomal RNA gene 1258
Bacteria;Firmicutes;Clostridia;Clostridiales;R F. prausnitzii strain L2-39
uminococcaceae;Faecalibacterium; 16S ribosomal RNA gene 1279
Bacteria;Firmicutes;Clostridia;Clostridiales;R F. prausnitzii strain L2-61
uminococcaceae;Faecalibacterium; 16S ribosomal RNA gene 1238
Bacteria;Firmicutes;Clostridia;Clostridiales;R F. prausnitzii strain HTF-A uminococcaceae;Faecalibacterium; 16S ribosomal RNA gene 1378
Bacteria;Firmicutes;Clostridia;Clostridiales;R F. prausnitzii strain HTF-B uminococcaceae;Faecalibacterium; 16S ribosomal RNA gene 1402
Bacteria;Firmicutes;Clostridia;Clostridiales;R F. prausnitzii strain HTF-C uminococcaceae;Faecalibacterium; 16S ribosomal RNA gene 1424
Bacteria;Firmicutes;Clostridia;Clostridiales;R F. prausnitzii strain HTF-E uminococcaceae;Faecalibacterium; 16S ribosomal RNA gene 1406
Bacteria;Firmicutes;Clostridia;Clostridiales;R F. prausnitzii strain HTF-F uminococcaceae;Faecalibacterium; 16S ribosomal RNA gene 1394
Bacteria;Firmicutes;Clostridia;Clostridiales;R F. prausnitzii strain HTF-I uminococcaceae;Faecalibacterium; 16S ribosomal RNA gene 1308
Bacteria;Firmicutes;Clostridia;Clostridiales;R F. prausnitzii strain HTF-60C uminococcaceae;Faecalibacterium; 16S ribosomal RNA gene 1405
Bacteria;Firmicutes;Clostridia;Clostridiales;R F. prausnitzii strain HTF-75H uminococcaceae;Faecalibacterium; 16S ribosomal RNA gene 1351 Table 6. Accession numbers of the 2231 sequences hybridizing specifically with the PHGII specific probe in the SILVA database under default conditions.
AB506178 AY976695 AY978972 AY981592 AY984645 DQ793377 DQ796243
AJ409008 AY976779 AY979066 AY981727 AY984702 DQ793398 DQ796295
AM277069 AY976925 AY979072 AY981781 AY984716 DQ793502 DQ796342
AY850522 AY977090 AY979089 AY981943 AY984864 DQ793517 DQ796425
AY916181 AY977105 AY979094 AY981990 AY984873 DQ793523 DQ796434
AY916214 AY9771 10 AY979105 AY981996 AY984975 DQ793661 DQ796461
AY916305 AY977165 AY9791 17 AY982015 AY985063 DQ793829 DQ796604
AY974954 AY977188 AY979138 AY9821 15 AY985128 DQ793946 DQ796609
AY974998 AY977264 AY979152 AY982232 AY985138 DQ79401 1 DQ796660
AY975016 AY977370 AY979205 AY982278 AY985161 DQ794016 DQ796668
AY975134 AY977419 AY979247 AY982342 AY985204 DQ794040 DQ796704
AY975187 AY977435 AY979345 AY982343 AY985588 DQ794060 DQ796705
AY975227 AY977468 AY979407 AY982473 AY985652 DQ794084 DQ796725
AY975313 AY977565 AY979484 AY982573 AY986013 DQ794102 DQ796970
AY975322 AY977588 AY979499 AY982780 AY986185 DQ794128 DQ796982
AY975331 AY977710 AY979529 AY98281 1 AY986192 DQ794134 DQ797012
AY975375 AY977724 AY979619 AY982822 AY986207 DQ794141 DQ797025
AY975402 AY977732 AY979852 AY982856 AY986232 DQ794142 DQ797050
AY975435 AY977749 AY979899 AY982906 BAAU01000008 DQ794171 DQ797059
AY975537 AY977789 AY979902 AY983023 BAAU01000686 DQ794183 DQ797106
AY975603 AY977848 AY979928 AY983235 BAAX01000042 DQ794313 DQ7971 19
AY975644 AY977860 AY980032 AY983274 BAAX01000205 DQ794322 DQ797124
AY975678 AY977915 AY980038 AY983342 BAAX01000694 DQ794455 DQ797142
AY975687 AY977925 AY980040 AY983445 BAAY01002722 DQ794479 DQ797160
AY975701 AY978094 AY980124 AY983550 BABA01001765 DQ794542 DQ797178
AY975782 AY978128 AY980135 AY983605 BABD01001073 DQ794767 DQ797182
AY975853 AY978198 AY980137 AY983740 BABG01000003 DQ794834 DQ797191
AY975872 AY978251 AY980139 AY983820 BABG01000051 DQ794898 DQ797216
AY975906 AY978265 AY980164 AY983923 DQ325670 DQ795019 DQ797224
AY975935 AY978309 AY98021 1 AY984008 DQ325799 DQ795021 DQ797230
AY976066 AY978313 AY980222 AY984038 DQ325893 DQ795034 DQ797233
AY976079 AY978325 AY980271 AY984170 DQ326036 DQ795038 DQ797289
AY976086 AY978340 AY980273 AY984209 DQ326038 DQ795063 DQ797312
AY9761 1 1 AY978358 AY980419 AY984280 DQ326054 DQ795078 DQ797344
AY9761 15 AY978424 AY980466 AY984282 DQ326121 DQ795124 DQ797347
AY976189 AY978428 AY980489 AY984300 DQ326221 DQ795130 DQ797405
AY976214 AY978438 AY980494 AY984306 DQ326396 DQ795158 DQ797406
AY976309 AY978505 AY980637 AY984407 DQ326490 DQ795781 DQ797409
AY976318 AY978678 AY980716 AY984537 DQ469229 DQ795787 DQ797443
AY976409 AY978773 AY980819 AY984582 DQ469240 DQ795802 DQ797465
AY976506 AY978829 AY981036 AY984597 DQ793254 DQ795919 DQ797471
AY976534 AY978874 AY981072 AY984599 DQ793280 DQ795927 DQ797485
AY976564 AY978905 AY981 164 AY984612 DQ793299 DQ795984 DQ797501
AY976679 AY978957 AY981461 AY984627 DQ793306 DQ7961 10 DQ797514
DQ797519 DQ798579 DQ800223 DQ801698 DQ805666 DQ808483 DQ823721 DQ797562 DQ798596 DQ800234 DQ801703 DQ805696 DQ808533 DQ823885
DQ797565 DQ798617 DQ800251 DQ801825 DQ805705 DQ808548 DQ823889
DQ797593 DQ798653 DQ800255 DQ801929 DQ805707 DQ808550 DQ824033
DQ797647 DQ798665 DQ800275 DQ801940 DQ805720 DQ808569 DQ824161
DQ797650 DQ798678 DQ800345 DQ801946 DQ805816 DQ808570 DQ824923
DQ797686 DQ798699 DQ800359 DQ801984 DQ805822 DQ808585 DQ825046
DQ797720 DQ798709 DQ800367 DQ801990 DQ805837 DQ808609 DQ825130
DQ797723 DQ798715 DQ800384 DQ802009 DQ805847 DQ808654 DQ825149
DQ797761 DQ798784 DQ800387 DQ802010 DQ805870 DQ808662 DQ904703
DQ797766 DQ798785 DQ800398 DQ802088 DQ805871 DQ808677 DQ904941
DQ797832 DQ798823 DQ800622 DQ802096 DQ805908 DQ808722 DQ904977
DQ797833 DQ798824 DQ800929 DQ802109 DQ805928 DQ808728 DQ905073
DQ797865 DQ798910 DQ800956 DQ802129 DQ806084 DQ808732 DQ9051 16
DQ797878 DQ798997 DQ800973 DQ802139 DQ806234 DQ808762 DQ905134
DQ797892 DQ799005 DQ801033 DQ802159 DQ806272 DQ808797 DQ905156
DQ797928 DQ799101 DQ801044 DQ802161 DQ806329 DQ808833 DQ905174
DQ797963 DQ799149 DQ801056 DQ802202 DQ806334 DQ808834 DQ905305
DQ797997 DQ799182 DQ801 100 DQ802259 DQ806367 DQ808850 DQ905685
DQ798009 DQ799247 DQ801 139 DQ802431 DQ806371 DQ808851 DQ905722
DQ798044 DQ799252 DQ801 167 DQ802488 DQ806390 DQ808865 DQ905741
DQ798050 DQ799361 DQ801 193 DQ802576 DQ806427 DQ808898 DQ905743
DQ798053 DQ799388 DQ801201 DQ802632 DQ806431 DQ808907 DQ905762
DQ798064 DQ799443 DQ801227 DQ802689 DQ806512 DQ808926 DQ905805
DQ7981 19 DQ799461 DQ801239 DQ802768 DQ806522 DQ808984 DQ905818
DQ798135 DQ799493 DQ801254 DQ804576 DQ806536 DQ809045 DQ905899
DQ798140 DQ799498 DQ801256 DQ804662 DQ806563 DQ809049 DQ905919
DQ798214 DQ799510 DQ801263 DQ804785 DQ806570 DQ809066 EF399784
DQ798241 DQ799520 DQ801269 DQ805106 DQ806750 DQ809080 EF399839
DQ798245 DQ799559 DQ801272 DQ805109 DQ806763 DQ809088 EF399899
DQ798290 DQ799564 DQ801295 DQ805122 DQ806773 DQ809109 EF399905
DQ798294 DQ799631 DQ801304 DQ805125 DQ806783 DQ809197 EF399941
DQ79831 1 DQ799632 DQ801315 DQ805132 DQ806857 DQ809307 EF399994
DQ798326 DQ799671 DQ801355 DQ805164 DQ806902 DQ809483 EF400079
DQ798372 DQ799672 DQ801372 DQ805170 DQ807022 DQ809610 EF400085
DQ798395 DQ799695 DQ801449 DQ805186 DQ807193 DQ809649 EF400221
DQ798409 DQ799747 DQ801451 DQ805240 DQ807266 DQ809651 EF400285
DQ798412 DQ799824 DQ801459 DQ805282 DQ807344 DQ809715 EF400292
DQ798421 DQ799978 DQ801491 DQ805298 DQ807398 DQ809746 EF400306
DQ798428 DQ800105 DQ801540 DQ805302 DQ807434 DQ809844 EF400361
DQ798510 DQ800128 DQ801576 DQ805620 DQ807527 DQ809906 EF400533
DQ798520 DQ800190 DQ801636 DQ805642 DQ807540 DQ810021 EF400658
DQ798521 DQ800201 DQ801678 DQ805651 DQ80761 1 DQ810074 EF400660
DQ798555 DQ800205 DQ801687 DQ805658 DQ808238 DQ810178 EF400678
EF400716 EF402443 EF403107 EF40451 1 EU76221 1 EU766034 EU768395
EF400777 EF402449 EF403134 EF404601 EU762301 EU766632 EU768423
EF400840 EF402465 EF403166 EF404676 EU762325 EU766644 EU768448
EF400977 EF402489 EF403207 EF404719 EU762396 EU766645 EU768660
EF400999 EF402495 EF403241 EF404739 EU762527 EU766649 EU768686 EF401031 EF402512 EF403262 EF404843 EU762608 EU766701 EU768728
EF401085 EF402524 EF403312 EF404888 EU762674 EU766703 EU768737
EF401216 EF402535 EF403334 EF404910 EU762758 EU766722 EU768756
EF401235 EF402551 EF403369 EF404926 EU762767 EU766725 EU768771
EF401244 EF402572 EF403400 EF405006 EU762798 EU766758 EU773399
EF401246 EF402586 EF403448 EF405070 EU762839 EU766846 EU773475
EF401329 EF402591 EF403461 EF405076 EU762845 EU766848 EU774095
EF401446 EF402598 EF403468 EF405180 EU762846 EU766860 EU774207
EF401526 EF402614 EF403472 EF405183 EU762902 EU766916 EU775408
EF401595 EF402624 EF403493 EF405188 EU762912 EU766990 EU778073
EF401693 EF402632 EF40351 1 EF405200 EU76301 1 EU766995 EU778081
EF401729 EF402644 EF403519 EF405203 EU763234 EU767009 EU778088
EF401734 EF402650 EF403608 EF405227 EU763276 EU767016 EU778090
EF401777 EF402657 EF403613 EF405375 EU763302 EU767049 EU7781 10
EF401933 EF402685 EF403642 EF405376 EU763391 EU767071 EU778135
EF401942 EF402689 EF403646 EF405391 EU763433 EU767085 EU778170
EF401970 EF402737 EF403655 EF405429 EU763531 EU7671 10 EU778187
EF401971 EF402763 EF403675 EF405462 EU763562 EU7671 14 EU778193
EF401988 EF402766 EF403681 EF405494 EU763607 EU767123 EU778227
EF402005 EF402777 EF403775 EF405524 EU763792 EU767130 EU778236
EF402014 EF402790 EF403778 EU462258 EU763820 EU767143 EU778253
EF402028 EF402791 EF403830 EU466841 EU763909 EU767149 EU778265
EF402041 EF402799 EF403853 EU467322 EU763945 EU767181 EU778272
EF402060 EF402839 EF40391 1 EU530262 EU763991 EU767239 EU778278
EF402108 EF402872 EF403932 EU530453 EU763992 EU767259 EU778292
EF402167 EF402896 EF403939 EU530480 EU764005 EU767420 EU778299
EF402182 EF402970 EF403960 EU531954 EU764009 EU767488 EU778300
EF402195 EF402971 EF404019 EU728783 EU764019 EU767489 EU778310
EF402238 EF402972 EF404051 EU761610 EU764026 EU767497 EU778317
EF402263 EF402980 EF404063 EU761613 EU764071 EU767527 EU778336
EF402267 EF402987 EF404101 EU761638 EU764127 EU767943 EU778349
EF402315 EF403020 EF404138 EU761684 EU764558 EU767999 EU778361
EF402319 EF403024 EF404157 EU761731 EU764825 EU768031 EU778364
EF402368 EF403043 EF404239 EU761829 EU764935 EU768147 FJ362628
EF402389 EF403045 EF404243 EU761839 EU764987 EU768184 FJ362669
EF402415 EF403066 EF404268 EU761869 EU7651 18 EU768193 FJ362727
EF402423 EF403069 EF404348 EU761965 EU765489 EU768200 FJ362730
EF402435 EF403076 EF404462 EU762028 EU765828 EU768295 FJ362735
EF402438 EF403101 EF404490 EU762144 EU765973 EU768326 FJ362744
FJ362745 FJ364312 FJ365874 FJ370192 FJ372377 FJ504469 FJ504982
FJ362767 FJ364337 FJ365882 FJ370204 FJ503669 FJ504472 FJ504983
FJ362776 FJ364373 FJ365891 FJ370206 FJ503676 FJ504504 FJ504987
FJ362780 FJ364378 FJ365927 FJ370239 FJ503681 FJ504505 FJ504988
FJ362808 FJ364417 FJ366006 FJ370296 FJ503753 FJ504529 FJ504990
FJ362905 FJ364428 FJ366039 FJ370322 FJ503758 FJ504535 FJ504992
FJ362917 FJ364451 FJ366101 FJ370369 FJ503780 FJ504543 FJ504994
FJ362929 FJ364478 FJ3661 19 FJ370385 FJ503974 FJ504545 FJ504995
FJ362949 FJ364484 FJ366387 FJ370407 FJ503982 FJ504548 FJ504996 FJ362973 FJ36451 1 FJ366399 FJ370413 FJ503989 FJ504558 FJ504998
FJ363037 FJ364590 FJ366455 FJ370948 FJ504097 FJ504561 FJ505001
FJ363121 FJ364601 FJ366724 FJ370960 FJ504122 FJ504563 FJ505002
FJ363122 FJ364880 FJ366865 FJ371 106 FJ504137 FJ504565 FJ505003
FJ363128 FJ365031 FJ367435 FJ371 133 FJ504144 FJ504589 FJ505187
FJ363149 FJ365059 FJ367852 FJ371 147 FJ504147 FJ504594 FJ505198
FJ363256 FJ365097 FJ367860 FJ371 182 FJ504150 FJ504595 FJ505221
FJ363265 FJ365205 FJ367888 FJ371239 FJ504164 FJ504596 FJ505227
FJ363269 FJ365271 FJ368000 FJ371246 FJ504188 FJ504603 FJ505239
FJ363310 FJ365290 FJ368033 FJ371249 FJ504190 FJ504608 FJ505259
FJ36331 1 FJ365339 FJ368052 FJ371264 FJ504203 FJ504627 FJ505262
FJ363312 FJ365343 FJ368096 FJ371302 FJ504253 FJ504630 FJ505263
FJ363392 FJ365364 FJ368195 FJ371336 FJ504276 FJ504687 FJ505266
FJ363395 FJ365370 FJ368202 FJ371350 FJ504278 FJ504692 FJ505268
FJ363429 FJ365444 FJ368256 FJ371394 FJ504286 FJ504699 FJ505281
FJ363435 FJ365445 FJ368265 FJ371672 FJ504290 FJ504704 FJ505300
FJ363446 FJ365450 FJ368275 FJ371736 FJ504292 FJ504709 FJ505322
FJ363484 FJ365467 FJ368369 FJ371741 FJ504302 FJ504716 FJ505354
FJ363485 FJ365469 FJ368385 FJ371751 FJ504308 FJ504717 FJ505355
FJ363486 FJ365498 FJ368388 FJ371801 FJ50431 1 FJ504721 FJ505362
FJ363488 FJ365502 FJ368415 FJ371852 FJ504315 FJ504727 FJ505388
FJ363513 FJ365506 FJ368421 FJ371993 FJ504320 FJ504728 FJ505412
FJ363555 FJ365513 FJ368436 FJ372036 FJ504324 FJ504742 FJ505422
FJ363566 FJ365543 FJ368697 FJ372056 FJ504335 FJ504761 FJ505430
FJ363574 FJ365551 FJ369071 FJ372080 FJ504339 FJ504765 FJ505441
FJ363642 FJ365569 FJ369823 FJ372098 FJ504350 FJ504770 FJ505448
FJ363646 FJ365576 FJ369848 FJ372125 FJ504369 FJ504807 FJ505452
FJ363715 FJ365666 FJ369910 FJ372178 FJ504374 FJ504828 FJ505455
FJ363799 FJ365677 FJ369985 FJ372190 FJ504382 FJ504839 FJ505456
FJ363861 FJ365712 FJ370091 FJ372209 FJ504388 FJ504969 FJ505461
FJ363893 FJ365734 FJ370097 FJ372241 FJ504400 FJ504970 FJ505463
FJ363906 FJ365752 FJ370104 FJ372247 FJ504433 FJ504971 FJ506841
FJ363908 FJ365840 FJ370159 FJ372288 FJ504435 FJ504973 FJ506853
FJ363917 FJ365847 FJ370180 FJ372328 FJ504436 FJ504977 FJ506937
FJ364280 FJ365873 FJ370184 FJ372330 FJ504458 FJ504979 FJ507023
FJ507029 FJ510167 FJ512860 FJ673425 FJ675669 FJ676696 FJ677462
FJ507051 FJ510168 FJ512861 FJ673427 FJ675701 FJ676704 FJ677575
FJ507084 FJ510169 FJ512863 FJ673481 FJ675708 FJ676705 FJ67761 1
FJ507346 FJ510170 FJ512864 FJ673534 FJ675744 FJ676729 FJ677631
FJ507347 FJ510172 FJ512865 FJ673554 FJ675765 FJ676737 FJ677694
FJ507352 FJ510173 FJ512866 FJ673597 FJ675796 FJ676831 FJ677730
FJ507649 FJ510175 FJ512867 FJ673618 FJ675864 FJ676846 FJ677737
FJ507650 FJ510176 FJ512868 FJ673658 FJ675865 FJ676871 FJ677780
FJ507651 FJ510178 FJ512869 FJ673688 FJ675866 FJ676940 FJ677782
FJ507652 FJ510183 FJ512870 FJ673706 FJ675872 FJ676962 FJ677797
FJ507653 FJ510185 FJ512871 FJ673728 FJ675906 FJ676965 FJ677857
FJ507655 FJ510520 FJ512874 FJ673732 FJ675939 FJ677004 FJ677865
FJ507656 FJ510521 FJ512875 FJ673737 FJ675969 FJ677020 FJ677882 FJ507657 FJ510534 FJ512885 FJ673761 FJ675980 FJ677040 FJ677909
FJ507658 FJ510535 FJ512886 FJ673763 FJ675993 FJ677043 FJ677912
FJ507660 FJ510537 FJ512887 FJ673765 FJ676008 FJ677070 FJ677915
FJ507661 FJ510538 FJ672951 FJ673785 FJ676037 FJ677073 FJ677929
FJ507667 FJ510540 FJ672975 FJ673804 FJ676047 FJ677086 FJ677932
FJ507670 FJ510543 FJ672979 FJ673805 FJ676061 FJ677098 FJ677967
FJ507671 FJ510544 FJ672996 FJ673821 FJ676063 FJ677126 FJ677986
FJ507894 FJ510545 FJ673009 FJ673825 FJ676064 FJ677143 FJ678047
FJ507906 FJ510844 FJ673029 FJ673842 FJ676070 FJ677148 FJ678060
FJ508214 FJ510845 FJ673049 FJ673868 FJ6761 13 FJ677155 FJ678151
FJ508224 FJ510846 FJ673068 FJ673880 FJ676193 FJ677162 FJ678172
FJ508636 FJ510847 FJ673082 FJ673884 FJ676205 FJ677164 FJ678240
FJ508913 FJ510850 FJ673085 FJ673886 FJ676208 FJ677176 FJ678348
FJ508914 FJ510853 FJ673090 FJ673914 FJ676223 FJ677213 FJ678349
FJ508933 FJ510855 FJ673097 FJ673930 FJ676226 FJ677225 FJ678365
FJ508934 FJ510858 FJ673099 FJ673952 FJ676247 FJ677262 FJ678373
FJ509234 FJ510876 FJ673101 FJ673984 FJ676365 FJ677264 FJ678388
FJ509235 FJ512306 FJ6731 13 FJ674055 FJ676367 FJ677273 FJ678390
FJ509246 FJ512308 FJ673158 FJ674061 FJ676378 FJ677280 FJ678422
FJ509247 FJ512309 FJ673187 FJ674063 FJ676393 FJ677300 FJ678426
FJ509494 FJ512310 FJ673191 FJ674077 FJ676410 FJ677326 FJ678466
FJ509498 FJ51231 1 FJ673257 FJ674086 FJ67641 1 FJ677335 FJ678508
FJ509514 FJ512312 FJ673284 FJ674104 FJ676412 FJ677368 FJ678517
FJ509842 FJ512332 FJ673301 FJ6741 1 1 FJ676416 FJ677381 FJ678533
FJ509843 FJ512333 FJ673310 FJ6741 14 FJ676446 FJ677390 FJ678558
FJ509844 FJ512334 FJ673321 FJ674128 FJ676481 FJ677397 FJ678576
FJ509846 FJ512336 FJ673324 FJ674151 FJ676536 FJ677399 FJ678599
FJ509847 FJ512339 FJ673343 FJ674170 FJ676590 FJ677408 FJ678639
FJ509849 FJ512340 FJ673351 FJ674188 FJ676591 FJ677419 FJ678640
FJ509852 FJ512341 FJ673383 FJ674262 FJ676620 FJ677420 FJ678642
FJ509854 FJ512859 FJ673415 FJ674266 FJ676646 FJ677448 FJ678678
FJ678704 FJ679772 FJ681202 FJ682839 FJ683727 GQ079161 GQ8981 10
FJ678718 FJ679782 FJ681394 FJ682856 FJ683739 GQ079284 GQ8981 1 1
FJ678720 FJ679793 FJ681399 FJ682907 FJ683764 GQ079599 GQ8981 15
FJ678732 FJ679834 FJ681478 FJ682937 FJ683832 GQ079614 GQ8981 19
FJ678740 FJ679857 FJ681568 FJ682975 FJ683833 GQ106380 GQ898138
FJ678769 FJ679858 FJ681572 FJ683009 FJ683865 GQ156701 GQ898174
FJ678782 FJ679875 FJ681597 FJ683033 FJ683870 GQ156702 GQ898186
FJ678798 FJ679900 FJ681616 FJ683091 FJ683915 GQ157298 GQ898283
FJ678815 FJ679967 FJ681716 FJ6831 14 FJ683916 GQ157299 GQ898285
FJ678820 FJ679977 FJ681947 FJ683130 FJ683918 GQ158092 GQ898309
FJ678822 FJ679979 FJ681951 FJ683137 FJ683940 GQ158184 GQ898312
FJ678847 FJ680015 FJ681996 FJ683181 FJ683963 GQ158583 GQ898333
FJ678849 FJ680023 FJ682002 FJ68321 1 FJ684002 GQ158831 GQ898350
FJ678852 FJ680033 FJ682049 FJ683213 FJ684008 GQ159043 GQ898408
FJ678861 FJ680041 FJ682074 FJ683231 FJ684079 GQ159217 GQ898441
FJ678948 FJ680048 FJ682075 FJ683259 FJ684122 GQ159572 GQ898501
FJ678955 FJ680054 FJ682091 FJ683272 FJ684131 GQ448015 GQ898624 FJ678964 FJ680071 FJ682107 FJ683320 FJ684184 GQ448026 GQ898681
FJ678999 FJ680077 FJ6821 12 FJ683322 FJ684234 GQ448468 GQ898737
FJ679008 FJ680081 FJ682123 FJ683355 FJ684326 GQ448799 GQ898777
FJ679074 FJ680083 FJ682135 FJ683359 FJ684331 GQ448805 GQ898790
FJ679091 FJ680125 FJ682161 FJ683367 FJ684341 GQ491965 GQ898862
FJ679099 FJ680153 FJ682306 FJ683387 FJ684396 GQ492999 HM282132
FJ679157 FJ680161 FJ682308 FJ683410 FJ684413 GQ493175 HM284779
FJ679193 FJ680188 FJ682340 FJ683417 FJ684553 GQ896577 HM285702
FJ679254 FJ680206 FJ682349 FJ683423 FJ684556 GQ896588 HM285980
FJ679261 FJ68021 1 FJ682383 FJ683439 FJ684619 GQ896639 HM286500
FJ679304 FJ680223 FJ682388 FJ683442 FJ684635 GQ896681 HM286526
FJ679320 FJ680224 FJ682430 FJ683444 FJ684695 GQ896705 HM286682
FJ679366 FJ680285 FJ682443 FJ683493 FJ684742 GQ896750 HM286702
FJ679369 FJ680292 FJ682454 FJ683496 FJ684971 GQ896769 HM286714
FJ679376 FJ680530 FJ682461 FJ683515 FJ68501 1 GQ896871 HM286731
FJ67941 1 FJ680557 FJ682484 FJ683526 FJ685245 GQ896961 HM286935
FJ679434 FJ680563 FJ682489 FJ683533 FJ685342 GQ897005 HM300409
FJ679538 FJ680601 FJ682509 FJ683537 FJ685392 GQ897144 HM304758
FJ679571 FJ680690 FJ682513 FJ683572 FJ685400 GQ897176 HM335106
FJ679591 FJ680784 FJ682623 FJ683595 FM872976 GQ897244 HQ743862
FJ679646 FJ680786 FJ682640 FJ683638 FM873424 GQ897285 HQ744069
FJ679695 FJ680807 FJ682660 FJ683641 FM873865 GQ897292 HQ744243
FJ679698 FJ680864 FJ682702 FJ683649 GQ016078 GQ897310 HQ751613
FJ679709 FJ680954 FJ682740 FJ683668 GQ016178 GQ897318 HQ751663
FJ67971 1 FJ681 1 14 FJ682763 FJ683692 GQ016589 GQ897884 HQ751700
FJ679735 FJ681 165 FJ682765 FJ683693 GQ016610 GQ897933 HQ751875
FJ679746 FJ681 199 FJ682808 FJ683700 GQ042959 GQ897941 HQ751953
HQ759329 HQ780099 HQ784959 HQ793040 HQ800953 HQ804342 HQ810967
HQ759343 HQ780124 HQ784980 HQ793057 HQ801021 HQ804343 HQ810974
HQ759481 HQ780138 HQ785068 HQ793193 HQ801073 HQ805890 HQ810977
HQ759542 HQ780326 HQ785524 HQ793266 HQ801078 HQ805909 HQ810981
HQ759543 HQ780371 HQ785553 HQ793714 HQ801088 HQ805946 HQ810998
HQ759648 HQ780404 HQ786386 HQ793823 HQ801094 HQ805972 HQ81 1001
HQ759677 HQ780501 HQ786387 HQ793996 HQ801 108 HQ805994 HQ81 1006
HQ759694 HQ780562 HQ786448 HQ794414 HQ801 131 HQ806000 HQ81 1009
HQ763046 HQ780574 HQ786580 HQ794417 HQ801 152 HQ806003 HQ81 1 1 19
HQ763235 HQ780635 HQ786805 HQ794432 HQ802076 HQ806138 HQ81 1422
HQ766415 HQ780821 HQ786813 HQ794439 HQ802969 HQ806805 HQ81 1934
HQ766742 HQ780975 HQ786854 HQ794473 HQ802982 HQ806884 HQ812242
HQ774887 HQ780989 HQ786986 HQ794477 HQ803800 HQ806987 HQ813677
HQ775180 HQ780999 HQ786993 HQ794572 HQ803802 HQ807243 HQ813752
HQ775251 HQ781058 HQ787025 HQ794586 HQ803815 HQ810078 HQ814198
HQ775806 HQ781 122 HQ78721 1 HQ794622 HQ803839 HQ810609 HQ814234
HQ775813 HQ781 128 HQ787247 HQ794624 HQ803870 HQ810666 HQ814355
HQ775906 HQ781 154 HQ787334 HQ794642 HQ803885 HQ810689 HQ814359
HQ775981 HQ781 184 HQ787347 HQ795103 HQ803886 HQ810713 HQ814379
HQ776261 HQ781 187 HQ787408 HQ7951 13 HQ803936 HQ810731 HQ814451
HQ776430 HQ781221 HQ787431 HQ795421 HQ803961 HQ810732 HQ814510 HQ776566 HQ781232 HQ788630 HQ795518 HQ803972 HQ810737 HQ814529
HQ776759 HQ781248 HQ788656 HQ797391 HQ804005 HQ810739 HQ814565
HQ777121 HQ781284 HQ788686 HQ797519 HQ804009 HQ810769 HQ814814
HQ777241 HQ781285 HQ788690 HQ797605 HQ80401 1 HQ810775 HQ814861
HQ777291 HQ781328 HQ788713 HQ797621 HQ804027 HQ810787 HQ815161
HQ777328 HQ781343 HQ788721 HQ797700 HQ804052 HQ810796 HQ815406
HQ777447 HQ781381 HQ788734 HQ797770 HQ804058 HQ810808 HQ815431
HQ777449 HQ781431 HQ788882 HQ797860 HQ804060 HQ810821 HQ815458
HQ777517 HQ781558 HQ790288 HQ797871 HQ804062 HQ810853 HQ815650
HQ777969 HQ781581 HQ790332 HQ797898 HQ804065 HQ810863 HQ815963
HQ779055 HQ781723 HQ790735 HQ797979 HQ804135 HQ810867 HQ816034
HQ779520 HQ781758 HQ790865 HQ800194 HQ804154 HQ810875 HQ816295
HQ779702 HQ783571 HQ791058 HQ800627 HQ804181 HQ810877 HQ816959
HQ779714 HQ783636 HQ791071 HQ800687 HQ804218 HQ810878 HQ817913
HQ779798 HQ783824 HQ791 104 HQ800705 HQ804245 HQ810904 HQ818200
HQ779804 HQ783906 HQ791 126 HQ800721 HQ804267 HQ810920 HQ821275
HQ779820 HQ783929 HQ791 177 HQ800749 HQ804287 HQ810924 JF1 17521
HQ779841 HQ784028 HQ791 185 HQ800757 HQ804288 HQ810925 JF128397
HQ780016 HQ784038 HQ792630 HQ800760 HQ804291 HQ810928 JF128446
HQ780047 HQ784040 HQ792645 HQ800808 HQ804305 HQ810930 JF133787
HQ780061 HQ784398 HQ792682 HQ800875 HQ804313 HQ810940 JF133856
HQ780078 HQ784403 HQ792883 HQ800879 HQ804322 HQ810951 JF135768
HQ780086 HQ784883 HQ792973 HQ800917 HQ804327 HQ810964 JF145440
JF152180 JF168288 JQ183885 JQ188414 JQ189840 KF841715 KF842659
JF159588 JF168414 JQ184737 JQ188516 JQ189871 KF841774 KF842663
JF160220 JF168451 JQ185267 JQ188602 JQ190412 KF841799 KF842748
JF161316 JF188128 JQ186559 JQ188618 JQ190807 KF841981 KF842843
JF161642 JF234854 JQ186613 JQ188625 JQ190977 KF842167 KF842928
JF161844 JF237768 JQ186648 JQ188631 JQ940410 KF842183 KF843160
JF162799 JF239714 JQ186700 JQ188868 JQ940685 KF842294 KF843215
JF1631 15 JQ186758 JQ189425 KF097757 KF842468 KF843241
JF163215 JN 157660 JQ186808 JQ189454 KF101719 KF842504 KF843624
JF163805 JN187070 JQ186977 JQ189471 KF841668 KF842632 LN612658
JF163913 JQ183445 JQ187055 JQ189754 KF841714 KF842638
A METHOD FOR THE OBTAINING OF USEFUL INFORMATION
In a second aspect, the invention relates to a method for the obtaining of useful information for the detection of an intestinal disease in a human subject and/or for the prediction of the efficacy of a drug in the therapeutic treatment of an intestinal disease in a human subject, comprising the determination of the abundance of PHGI and/or of PHGII according to a method of the first aspect; wherein preferably said intestinal disease is selected from the group consisting of inflammatory bowel disease (IBD), irritable bowel syndrome (IBS) and colorectal cancer (CRC). In a particular embodiment the invention pertains to a method for obtaining useful information from an intestinal sample of a human subject comprising the following steps:
a. determining the abundance of Faecalibacterium prausnitzii phylogroup I members (PHGI) in an intestinal sample from said subject; and
b. optionally, determining the abundance of Faecalibacterium prausnitzii phylogroup II members
(PHGII) in an intestinal sample from said subject.
Another embodiment pertains to a method for obtaining useful information from an intestinal sample of a human subject comprising determining the abundance of Faecalibacterium prausnitzii phylogroup I members (PHGI) in an intestinal sample from said subject. A further embodiment relates to a method for obtaining useful information from an intestinal sample of a human subject comprising determining the abundance of PHGI and of PHGII in an intestinal sample from said subject.
Said information could be useful for detecting an intestinal disease in said human subject when comparing the PHGI abundance, and/or the PHGII abundance and/or a mathematical combination thereof, and/or optionally a mathematical combination of any of these with Total F. Prausnitzii (FT) abundance and/or E.coli (EC) abundance, in the subject sample with the corresponding values in a reference sample, wherein a significant deviation in the subject sample values with regard to said reference sample is indicative of intestinal disease. This and other uses of the quantification of PHGI and/or PHGII abundance are as described herein.
A METHOD FOR DETECTING INTESTINAL DISEASE
In a third aspect, the invention relates to a method for detecting an intestinal disease in a human subject comprising the following steps:
a. determining the abundance of Faecalibacterium prausnitzii phylogroup I members (PHGI) and/or Faecalibacterium prausnitzii phylogroup II members (PHGII) in an intestinal sample from said subject according to a method as described under the first aspect; and b. comparing the PHGI and/or PHGII abundance, and/or a mathematical combination thereof, and/or optionally a mathematical combination of any of these with Total F. Prausnitzii (FT) abundance and/or E.coli (EC) abundance, in the subject sample with the corresponding values in a reference sample,
wherein a significant deviation in the subject sample values with regard to said reference sample is indicative of intestinal disease;
wherein preferably said intestinal disease is selected from the group consisting of inflammatory bowel disease (IBD), irritable bowel syndrome (IBS) and colorectal cancer (CRC); and wherein said reference sample is preferably a healthy subject sample and/or the sample of a patient with intestinal disease in remission. Preferably, it relates to a method for detecting an intestinal disease in a human subject comprising the following steps: a. determining the abundance of Faecalibacterium prausnitzii phylogroup I members (PHGI) in an intestinal sample from said subject;
b. optionally, determining the abundance of Faecalibacterium prausnitzii phylogroup II members (PHGII) in an intestinal sample from said subject; and
c. comparing the PHGI abundance, optionally the PHGII abundance and/or a mathematical combination thereof, and/or optionally a mathematical combination of any of these with Total F. Prausnitzii (FT) abundance and/or E.coli (EC) abundance, in the subject sample with the corresponding values in a reference sample,
wherein a significant deviation in the subject sample values with regard to said reference sample is indicative of intestinal disease.
The term detecting an intestinal disease as used herein includes the screening, diagnosis, differential diagnosis, and/or monitoring of disease activity and/or progression. In a particular embodiment, it relates to a method for detecting intestinal disease in a human subject comprising the following steps:
a. determining the abundance of Faecalibacterium prausnitzii phylogroup I members (PHGI) in an intestinal sample from said subject; and
b. comparing the subject sample abundance levels with the abundance levels in a reference sample,
wherein a significant reduction of abundance levels in the subject sample with regard to said reference sample is indicative of intestinal disease.
In another particular embodiment it relates to a method for detecting intestinal disease in a human subject comprising the following steps: a. determining the abundance of PHGI in an intestinal sample from said subject;
b. determining the abundance of PHGII in an intestinal sample from said subject; and
c. comparing the PHGI abundance, the PHGII abundance and/or a mathematical combination thereof in the subject sample, with the corresponding values in a reference sample,
wherein a significant deviation in the subject sample values with regard to said reference sample is indicative of intestinal disease.
In one particular embodiment of the invention the PHGI abundance and PHGII abundance are determined. In another particular embodiment, the PHGI abundance and PHGII abundance, as well as the mathematical combination or relationship between said sequences (e.g. ratio, multivariant analysis, etc.) is determined. In a further embodiment, the PHGI abundance and/or PHGII abundance is determined, as well as the mathematical combination or relationship between any of these (e.g. ratio, multivariant analysis, etc.) with the Total F. Prausnitzii (FT) abundance and/or E.coli (EC) abundance. The ratio between PHGI, PHGII, FT and/or EC abundance may be obtained by dividing the quantification levels of a first sequence by the quantification levels of a second sequence. For instance, the ratio of PHGII abundance/PHGI abundance is obtained by dividing the PHGII 16S rRNA gene sequence quantification levels by the PHGI 16S rRNA gene sequence quantification levels.
The ratio between PHGI, PHGII, FT and/or EC abundance may also be obtained by subtracting from the quantification levels of a first sequence the quantification levels of a second sequence. For instance, the ratio of PHGII abundance/PHGI abundance is obtained by subtracting from the PHGII 16S rRNA gene sequence quantification levels the PHGI 16S rRNA gene sequence quantification levels.
Preferred ratios of the invention are PHGI abundance/PHGI I abundance (PHGI/PHGII), PHGI abundance/EC abundance (PHGI/EC), PHGII abundance/EC abundance (PHGII/EC), FT abundance/PHGI abundance (FT/PHGI), and FT abundance /PHGII abundance (FT/PHGII) and viceversa. Particularly preferred ratios are PHGI/EC and PHGII/EC.
Preferably, quantification has been performed by qPCR (described below) and quantification levels are expressed as the cycle threshold value (Ct value). More preferably, the ratios are calculated by subtraction.
In a particular embodiment, the ratio between the PHGII abundance and the PHGI abundance (PHGII/PHGI ratio) is determined and the PHGII/PHGI ratio in said subject sample compared with the PHGII/PHGI ratio in a reference sample, wherein a significant deviation in the subject sample values with regard to said reference sample is indicative of intestinal disease.
One of ordinary skill in the art knows several methods and devices for the determination of the abundance of Faecalibacterium prausnitzii PHGI and/or PHGII. It is typically performed by bacterial gene quantification. The term "quantifying" refers to the ability to determine the amount of a specific nucleic acid sequence in a sample.
Molecular biology methods for measuring quantities of target nucleic acid sequences are well known in the art. These methods include but are not limited to end pointPCR, competitive PCR, reverse transcriptase-PCR (RT-PCR), quantitative PCR (qPCR), reverse transcriptase qPCR (RT-qPCR), PCR- pyrosequencing, PCR-ELISA, DNA microarrays, in situ hybridization assays such as dot-blot or Fluorescence In Situ Hybridization assay (FISH), branched DNA (Nolte, Adv. Clin. Chem. 1998,33:201- 235) and to multiplex versions of said methods (see for instance, Andoh et al., Current Pharmaceutical Design, 2009; 15,2066-2073). For a review on molecular approaches to study gut microbiota see also Manichanh et al., (Nat. Rev. Gastroenterol. Hepatol. 2012; 9, 599-608) and Weinstock B.M (Nature 2012, 489,250-256). A multiplex assay is an assay that simultaneously measures multiple analytes, typically dozens or more, in a single run/cycle of the assay.
Preferred primers and/or probes react in a predictable manner, typically by offering a direct and linear response to increasing amounts of bacterial nucleic acid sequences. By preparation of and by comparison to appropriate standards, one can readily quantify the amount of a given nucleic acid sequence in a sample. Preferably, said molecular method for gene quantification is selected from the group consisting of quantitative Polymerase Chain Reaction (qPCR), PCR-pyrosequencing, fluorescence in-situ hybridization (FISH), DNA microarrays, and PCR-ELISA.
One particularly preferred quantification method is FISH, which combines probe hybridization with fluorescent light microscopy, confocal laser microscopy or flow cytometry for direct quantification of individual bacterial sequences. For reviews of FISH methodology, see, e.g., Harmsen et al.,Appl Environ Microbiol, 2002;68 2982-2990, Kalliomaki et al., J AllergClinlmmunol, 2001 ; 107 129-134; Tkachuk et al., Genet. Anal. Tech. Appl., 1991 ;8: 67-74; Trask et al., Trends Genet., 1991 ;7 (5): 149-154; and Weier et al., Expert Rev. Mol. Diagn., 2002,2(2): 109-1 19; and U.S. Pat. No. 6, 174,681.
Another particularly preferred quantification method is quantitative PCR (qPCR), also known as real-time PCR. Different instruments are available, such as ABI Prism 7700 SDS, GeneAmp 5700 SDS, ABI Prism 7900 HT SDS from Applied Biosystems; iCycler iQ from Bio-Rad; Smart Cycler from Cepheid; Rotor- Gene from Corbett Research; LightCycler from Roche Molecular Biochemicals and Mx4000 Multiplex from Stratagene. The qPCR process enables accurate quantification of the PCR product in real-time by measuring PCR product accumulation very early in the exponential phase of the reaction, thus reducing bias in the quantification linked to the PCR amplification efficiency occurring in end-point PCR. Real-time PCR is well known in the art and is thus not described in detail herein. Technology overview and protocols for qPCR are available for instance from the above-mentioned vendors, e.g., http://www.sigmaaldrich.com/technical-documents/protocols/biology/sybr-green-qpcr.html or http://www.sigmaaldrich.com/life-science/molecular-biology/pcr/quantitative-pcr/qpcr-technical-guide.html. For a review of qPCR methods see Smith CJ and Osborn AM., FEMS Microbiol Ecol., 2009;67(1 ):6-20 and Giulietti et al., Methods 2001 ; 25, 386-401. In a preferred embodiment, the quantification method is a multiplex qPCR.
Several genes can be used for bacterial quantification purposes. Typically, a specific target bacteria is quantified by PCR amplification of the 16S rRNA gene. 16S rRNA differs for each bacterial species. A bacterial species is hard to define, but is often taken as organisms with 16S rRNA gene sequences having at least 97% identity, defined as an operational taxonomic unit (OTU). A 16S rRNA gene sequence of about 1.5 kilobases has nine short hypervariable regions that distinguish bacterial taxa; the sequences of one or more of these regions are targeted in a community census (Weinstock B.M, Nature 2012, 489,250-256).
Protein coding genes, for instance housekeeping genes may also be used. Roux et al. (FEMS Microbiol Ecol 78 (201 1 ) 617-628), describes the use of five protein marker genes (rplB, pyrG, fusA, leuS and rpoB), for which primer sets were available, as taxonomic markers for ecological studies. The use of nucleotidyl transferase gene and the butyryl-CoA transferase gene for specific target bacteria quantification purposes has also been described (Jia et al. FEMS Microbiol Lett. 2010; 310: 138-144). Different detecting chemistries are available for qPCR. All of them can be used with the above-mentioned qPCR instruments. The term "detection chemistry" refers to a method to report amplification of specific PCR product in real-time PCR and may include hydrolysis or TaqMan® probes; molecular beacons; scorpions; hybridization probes and DNA-binding dyes such as SYBR® Green I. These are described in detail for instance in Giulietti et al., Methods 2001 ; 25, 386-401.
In a preferred embodiment said probes are dual-labelled oligonucleotides, such as hydrolysis probes or molecular beacons. The 5' end of the oligonucleotide is typically labelled with a fluorescent reporter molecule while the 3' end is labelled with a quencher molecule. The sequence of the probe is specific for a region of interest in the amplified target molecule. In a more preferred embodiment, said probe is a hydrolysis probe which is designed so that the length of the sequence places the 5' fluorophore and the 3' quencher in close enough proximity so as to suppress fluorescence.
Several reporter molecules and quenchers for use in qPCR probes are well known in the art. These being available for instance from https://www.eurofinsgenomics.eu/en/dna-rna-oligonucleotides/optimised- application-oligos/qpcr-probes.aspx:. For illustration purposes, Table 7 below provides a non-exhaustive list of dual labeled probes for qPCR analysis.
Table 7. Dual labeled probes for qPCR analysis with different reporter dye-quencher combinations and the corresponding absorption and emission wavelengths.
5" Reporter Abs [nm] Em [nm] 3' Quencher
FAM 495 520 TAM, BHQ1 , DAB, Eclip
TET 521 536 TAM, BHQ1
JOE 520 548 TAM, BHQ1 , BHQ2
Yakima
Yellow 530 549 BHQ1 , Eclip
TAM, BHQ1 , BHQ2, Eclip,
HEX 535 556 BBQ650
Cyanine3 552 570 BHQ1 , BHQ2, BBQ650
ATTO 550 554 576 TAM, BHQ2
TAMRA 544 576 BHQ2
ROX 575 602 TAM, BHQ2, BBQ650
Texas Red 583 603 BHQ2, BBQ650
Cyanine3.5 588 604 BHQ2
LC 610 590 610 BHQ2
LC 640 625 640 BHQ2, BBQ650
ATTO 647N 644 669 BHQ2, BHQ3, BBQ650
Cyanine5 649 670 BHQ2, BHQ3, BBQ650
Cyanine5.5 675 694 BHQ2, BHQ3, BBQ650
ATTO 680 680 700 BHQ3, BBQ650
Preferably, PHGI and/or PHGII abundance determination is carried out by 16S rRNA gene quantification.
In a particular embodiment, PHGI abundance determination is carried out by quantifying Faecalibacterium prausnitzii 16S rRNA gene sequences hybridizing specifically with SEQ ID NO: 3 or a sequence with at least 75% identity thereof. In an alternative embodiment, PHGI abundance determination is carried out by quantifying a Faecalibacterium prausnitzii 16S rRNA gene sequence comprising or consisting of SEQ ID NO: 3 or a sequence with at least 75% identity thereof. In another embodiment, PHGII abundance determination is carried out by quantifying Faecalibacterium prausnitzii 16S rRNA gene sequences hybridizing specifically with SEQ ID NO: 4 or a sequence with at least 75% identity thereof. In an alterantive embodiment, PHGII abundance is determined by quantifying a Faecalibacterium prausnitzii 16S rRNA gene sequence comprising or consisting of SEQ ID NO: 4 or a sequence with at least 75% identity thereof. In a preferred embodiment, PHGI abundance determination is carried out by quantifying a Faecalibacterium prausnitzii 16S rRNA gene sequence comprising or consisting of SEQ ID NO: 3 and PHGII abundance by quantifying a Faecalibacterium prausnitzii 16S rRNA gene sequence comprising or consisting of SEQ ID NO: 4.
In preferred embodiments, PHGI 16S rRNA gene quantification is performed with at least one oligonucleotide molecule of sequence SEQ ID NO: 1 or SEQ ID NO: 2, or a sequence with at least 75% identity thereof; and/or an oligonucleotide molecule of sequence SEQ ID NO: 3 or a sequence with at least 75% identity thereof. Preferably, oligonucleotide molecules of sequence SEQ ID NO: 1 and SEQ ID NO: 2 are used.
In a further preferred embodiment, PHGI 16S rRNA gene quantification is performed with primers consisting of oligonucleotide sequences SEQ ID NO: 1 and SEQ ID NO: 2, or a sequence with at least 75% identity thereof; and/or a probe consisting of oligonucleotide sequence SEQ ID NO: 3 or a sequence with at least 75% identity thereof.
It is preferred that PHGII 16S rRNA gene quantification is performed with at least one, oligonucleotide molecule of sequence SEQ ID NO: 1 or SEQ ID NO: 2, or a sequence with at least 75% identity thereof; and/or an oligonucleotide molecule of sequence SEQ ID NO: 4, or a sequence with at least 75% identity thereof. Preferably, oligonucleotide molecules of sequence SEQ ID NO: 1 and SEQ ID NO: 2 are used.
In another preferred embodiment, PHGII 16S rRNA gene quantification is performed with primers consisting of oligonucleotide sequences SEQ ID NO: 1 and SEQ ID NO: 2, or a sequence with at least 75% identity thereof; and/or a probe consisting of oligonucleotide sequence SEQ ID NO: 4, or a sequence with at least 75% identity thereof.
Preferably, said oligonucleotide sequences with at least 75% identity described herein have at least 80%, at least 85%, at least 90%, at least 95%, more preferably 96%, 97%, 98%, 99% or 100% identity with the respective sequence (e.g., SEQ ID NO: 1 , SEQ ID NO: 2, SEQ ID NO: 3 and/or SEQ ID NO: 4 respectively); a nucleotide molecule with a sequence identity of 100% being particularly preferred. Furthermore, these oligonucleotide sequences with at least 75% identity may have the same nucleotide number, may be longer or shorter than SEQ ID NO: 1 , SEQ ID NO: 2, SEQ ID NO: 3 and/or SEQ ID NO: 4.
In particularly preferred embodiments, PHGI 16S rRNA gene quantification is performed, preferably by qPCR, with primers consisting of oligonucleotide sequences SEQ ID NO: 1 and SEQ ID NO: 2, and a probe consisting of oligonucleotide sequence SEQ ID NO: 3. In further preferred embodiments, PHGII 16S rRNA gene quantification is performed, preferably by qPCR, with primers consisting of oligonucleotide sequences SEQ ID NO: 1 and SEQ ID NO: 2, and a probe consisting of oligonucleotide sequence SEQ ID NO: 4.
Said oligonucleotide sequences may be modified. For example, probes may be modified to improve their resistance to nuclease degradation (e.g., by end capping), to carry detection ligands (e.g., fluorescein) or to facilitate their capture onto a solid support (e.g., poly-deoxyadenosine "tails").
In a preferred embodiment, said PHGI specific probe consists of SEQ ID NO: 3 or a sequence with at least 75% identity thereof which has been modified. Preferably, it is a dual labelled probe as described above, more preferably a hydrolysis probe. In a more preferred embodiment, SEQ ID NO: 3 is modified with 6FAM (6-carboxyfluorescin) in its 5' end and with BHQ1 (Black Hole Quencherl ) in its 3' end and it is represented as 6FAM-TAAGCCCACGACCCGGCATCG-BHQ1.
In another preferred embodiment, said PHGII specific probe consists of SEQ ID NO: 4 or a sequence with at least 75% identity thereof, which has been modified. Preferably, it is a dual labelled probe, more preferably a hydrolysis probe. In a more preferred embodiment, SEQ ID NO: 4 is modified with JOE (4',5'- dichloro-2',7'-dimethoxy-5(6)-carboxyfluorescein) in its 5' end and with BHQ1 (Black Hole Quencherl ) in its 3' end and it is represented as JOE-TAAGCCCACRGCTCGGCATC-BHQ1.
The determination of the PGHI and/or PGHII abundance in an intestinal sample by the method of the invention is performed in vitro. Said intestinal sample may be an intestinal biopsy. Several methods are well known in the art for the obtaining of intestinal biopsies, e.g. by endoscopy. In a preferred embodiment said intestinal sample is a non-invasive intestinal sample. A non-invasive intestinal sample may be for instance, an intestinal biopsy obtained by a non-invasive method, such as a rectal sigmoidoscopy, and also a feces sample. In a more preferred embodiment, said intestinal sample is a feces sample.
It is preferred in the method of the invention that DNA is extracted from the intestinal sample prior to gene quantification. After sample collection, fresh samples can be processed and DNA extracted immediately. Alternatively, several treatments are commonly known in order to preserve the quality of DNA before extraction, such as freezing or mixing with a buffer or DNA stabilization solution. Prior to DNA extraction, the sample may also be subject to additional processing, such as to one or more washing cycles.
In a particular embodiment, said intestinal sample is a biopsy sample and DNA is extracted from said sample prior to the quantification of said bacterial sequences. In a preferred embodiment, said intestinal sample is a feces sample and DNA is extracted from the feces sample prior to the quantification of said bacterial sequences.
Several DNA extraction methods from biological samples are well known in the art, all these methods relying on chemical or mechanical disruption of the cells, lysis using detergents, or a combination of these approaches (Kennedy A. et al., PLoS One, 2014;9(2):e88982). DNA from a biopsy sample may be extracted for instance using the NucleoSpin® Tissue Kit (Macherey-Nagel Gmbh& Co. KG). Methods for extraction of bacterial DNA in fecal samples are known from instance from M Corist et al., Journal of Microbiological Methods, 2002; 50(2):131-139, Whitney D et al., Journal of Molecular Diagnostics, American Society for Investigative Pathology, 2004;6(4):386-395 and WO2003/068788. Preferred, methods use a combination of mechanical disruption, such as high speed bead beating extraction, chemical lysis and a final purification step, preferably using silica membrane column such as those included in the commercially available DNA extraction kits "MobioPowerSoil® DNA extraction procedure" (Mo-Bio Laboratories Inc.,), FastDNA® SPIN Kit for soil procedure (MP biomedicals) and NucleoSpin® Soil (Macherey-Nagel Gmbh& Co. KG). The presence of PCR inhibitors in the DNA extracts from fecal samples such as bilirubins, bile salts and complex carbohydrates is one of the difficulties faced for the determination of DNA biomarkers in DNA extracts from feces (Fleckna et al., Mol Cell Probes, 2007;21 (4):282-7). Preferred DNA extraction methods are those that provide fecal extracts with a low amount of PCR inhibitors, such as less than 5%, preferably less than 2%, more preferably less than 1 %, even more preferably less than 0.5%, such as less than 0.25%, 0.1 %, 0.05% or 0.01 %.
Quantification levels can be absolute or relative. It is generally preferred that the abundance levels are normalized. Normalization can be performed with respect to different measurements in the sample, such as by sample weight, human cells quantification, total DNA quantification, total bacteria quantification, total F. prausnitzii quantification or the other F. prausnitzii phylogroup quantification. These methods are well known to a person skilled in the art.
In a particular embodiment, the quantification of PHGI and/or PHGII abundance levels is performed by qPCR and the quantification levels are normalized. In a preferred embodiment, normalization is carried out with respect to total bacteria 16S rRNA gene quantification, for example as the median log 10 16S rRNA gene copies/ million bacterial rRNA gene copies. Several primers and probes have been described for the quantification of total bacteria, reference is made for instance to those described in Furet J-P, et al. FEMS Microbiology Ecology 2009, 68:351-362, Corless et al., J Clin Microbiol. 2000, 38(5): 1747-52, Suzuki et al., Appl Environ Microbiol. 2000, 66(1 1 ):4605-14, Bach et al., J Microbiol Methods. 2002, 49(3):235-45, Nadkarni et al., Microbiology. 2002, 148(Pt 1 ):257-66. Preferred primers and probe for total bacteria quantification are those described in Furet J-P, et al. FEMS Microbiology Ecology. 2009;68:351- 362 and specified in Table 15, see the Examples.
The method of the invention may further comprise detecting and/or quantifying one or more biomarkers of intestinal disease, preferably these markers are specific of IBD or a particular IBD phenotype, more preferably these markers are specific of UC or CD, even more preferably these markers are specific of CD. IBD biomarkers and its implications for classification and diagnosis are described for instance in Silverberg et al., Can J Gastroenterol. 2005, 19 Suppl A:5-36, and Satsangi et al., Gut 2006; 55, 749-753.
The term "biomarker" as used herein refers to markers of disease which are typically substances found in a bodily sample that can be easily measured. Said bodily sample can be for instance a blood, plasma or feces sample. Typically, the measured amount correlates to an underlying disease pathophysiology, such as presence or absence of a particular IBD disease or phenotype, making it useful for diagnosing and measuring the progress of a disease or the effects of a treatment. The term biomarker encompasses biophysical and biochemical determinations, including genetic and serological markers.
Serological biomarkers may be used, such as for instance anii-Saccharomyces cerevisiae antibodies (ASCA), antineutrophil cytoplasmic autoantibodies (ANCA), anti-OMPC and anti-12, and anti-CBirl flagellin antibodies. Other authors have reported that the combination of ASCA, ANCA, anti-OmpC, and anti-12 may help in the subclassification of CD, in particular that these serological markers are associated with particularly complicated and severe disease behaviour, including need for surgery. Genetic markers might also be used, such as NOD2/CARD15, HLA, MDR1 , DLG5 or TLR4 genes.
Microbiota biomarkers may also be used. In a particular embodiment, PHGI and/or PHGII abundance is used in combination with leucocyte counts. It has been previously reported that CD and UC could be differentiated through monitoring F. prausnitzii abundance in conjunction with fecal leucocyte counts (Swidsinski et al., Inflamm Bowel Dis. 2008; 14: 147-161 ). In a particularly preferred embodiment, PHGI and/or PHGII abundance is used in combination with Escherichia coli abundance. Lopez-Siles et al. (International Journal of Medical Microbiology. 2014;304:464-475) described the use of F. prausnitzii abundance in combination with Escherichia coli abundance as a complementary contrasting indicator.
In a particular embodiment, the method of the invention further comprises the quantification of total F. prausnitzii (FT) and/or E.coli (EC). FT abundance determination may be performed with primers with sequence SEQ ID NO: 5 and SEQ ID NO: 6, or a sequence with at least 75% identity thereof; and a probe with sequence SEQ ID NO: 7 or a sequence with at least 75% identity thereof. Similarly, EC abundance determination may be performed with primers with sequence SEQ ID NO: 14 and SEQ ID NO: 15, or a sequence with at least 75% identity thereof; and a probe with sequence SEQ ID NO: 16 or a sequence with at least 75% identity thereof.
Preferably, said oligonucleotide sequences with at least 75% identity described herein have at least 80%, at least 85%, at least 90%, at least 95%, more preferably 96%, 97%, 98%, 99% or 100% identity with the respective sequence (e.g., SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 14, SEQ ID NO: 15, and/or SEQ ID NO: 16, respectively); a nucleotide molecule with a sequence identity of 100% being particularly preferred.
In the method of the invention, said reference sample can be an individual sample or a collection of samples of the population of reference. The population of reference is generally selected according to the use given to the method of the invention, for example, for diagnosis said population of reference would typically be a healthy subject or a patient in remission, whereas for determining the activity or progression of the disease the population of reference would generally be the same patient at a previous point in time, e.g. at diagnosis or in remission.
The term intestinal disease refers to those diseases affecting the small intestine, the colon and/or rectum. Preferably, said intestinal disease is selected from the group consisting of CRC, IBS and IBD. In a particular embodiment, said intestinal disease is CRC. In another particular embodiment, said intestinal disease is IBS. In a preferred embodiment, said intestinal disease is IBD. The method of the invention may be used for the screening or early detection of intestinal disease, for the diagnosis of intestinal disease, for the determination of disease activity, for monitoring of progression and/or activity of intestinal disease, for monitoring relapses of intestinal disease, and/or for monitoring postsurgical recurrence of intestinal disease, and/or for determining efficacy of a treatment on an intestinal disease.
In preferred embodiments, the method of the invention is used for the screening or early detection of IBD, for the diagnosis of IBD, for monitoring progression of IBD, for monitoring relapses of IBD, and/or for monitoring postsurgical recurrence of IBD, and/or for determining efficacy of a treatment on IBD.
IBD alternates periods where the patients have symptoms of the disease (flare ups) and other periods where they do not have the symptoms and they are in remission. When a patient is in a remission period and then switches to present them they have a relapse. A test for detecting presence of the disease may also enable to detect relapses.
One of the available treatments that can be applied to IBD patients is the surgical resection of the affected zone in the gut. The expression post-surgical recurrence refers to those situations where the treatment is unsuccessful and after a certain period of time the patient suffers from IBD again. A test for detecting presence of the disease may also enable to detect postsurgical recurrence.
In a more preferred embodiment; the method of the invention is used for the screening and/or diagnosis of an intestinal disease, preferably of IBD. Preferably, said reference sample is a healthy subject sample and/or the sample of a subject with intestinal disease in remission. A healthy subject is defined as a subject not suffering from intestinal disease, preferably not suffering from IBD, more preferably not suffering of CD or UC. Said sample from a healthy patient, can be obtained for instance from patients who underwent colonoscopy for different reasons, such as rectorrhagia, CRC familial history or abdominal pain. In a preferred embodiment, said reference sample is the sample of the same subject in remission.
Biomarkers for the determination of healthy digestive status according to the present invention are shown in Examples 14 and 15. Particularly preferred biomarkers for the determination of healthy digestive status are PHGI/EC, PHGII/EC, FT/PHGI and FT/PHGII. The PHGI/EC, PHGII/EC ratios were shown to decrease in samples from healthy patients in Example 14, whereas FT/PHGI and FT/PHGII were shown to be good discriminators by ROC curve analysis in Example 15
A person skilled in the art will know that establishing the right diagnostic will enable to provide a more accurate prognostic, to choose the most appropriate prophylactic or therapeutic treatment for each disease or disease subtype, and even to predict the efficacy of a particular treatment. In a particular embodiment, the method of the invention is used for prognosis purposes. In another embodiment, the method of the invention is used for selecting the most appropriate prophylactic or therapeutic treatment. In a further embodiment, the method of the invention is used for predicting the efficacy or usefulness of a given prophylactic or therapeutic treatment. Preferably, said treatment is a therapeutic treatment.
Biomarkers for the screening and/or diagnosis of IBD, CD and/or UC according to the present invention are shown in Examples 14 and 15. Particularly preferred biomarkers for the screening and/or diagnosis of IBD are PHGI, PHGII, PHGI/EC and PHGII/EC. PHGI and PHGII whose abundance decreases in IBD, and PHGI/EC and PHGII/EC ratios that increase in IBD. IBD may be UC or CD. In a particular embodiment, said IBD is UC. Particularly preferred biomarkers for the screening and/or diagnosis of UC are PHGI, PHGII PHGI/EC and PHGII/EC. PHGI, PHGII whose abundance decreases in UC, and PHGI/EC and PHGII/EC ratios that increase in UC, preferably PHGI/EC and PHGII/EC. In a preferred embodiment said IBD is CD. Particularly preferred biomarkers for the screening and/or diagnosis of CD are PHGI, PHGII, PHGI/EC and PHGII/EC. PHGI, PHGII, whose abundance decrease in CD, and PHGI/EC and PHGII/EC that increase in CD preferably PHGI/EC and PHGII/EC.
Typically, CD is distinguished from UC by disease proximal to the colon, perineal disease, fistulas, histologic granulomas, and full-thickness as opposed to mucosa-limited disease. Generally, in CD, granulomas are evident in up to 50% of patients and fistulas in 25%. Table 7 below from the World Gastroenterology Organisation Global Guidelines (Inflammatory bowel disease: a global perspective, June 2009) provides an overview on the current diagnostic criteria for UC and CD:
Table 8. Diagnosis of Ulcerative colitis (UC) and Crohn's disease (CD).
Figure imgf000041_0001
Furthermore, features for differentiating between UC and CD are provided in Table 9 below from the World Gastroenterology Organisation Global Guidelines (Inflammatory bowel disease: a global perspective, June 2009):
Table 9. Main differential diagnoses for Ulcerative colitis (UC) and Crohn's disease (CD). • Ty ical UC features Typical CD features
Clinical frequent smaH- volume diarrhea Diarrhea accompanied by abdominal
with urgency pain and malnutrition
Predominantly bloody diarrhea Stomatitis
Abdominal mass
Perianal lesions
Endoscopic anil Diffuse superficial colonic Discontinuous transmural asymmetric radioloflical inflammation lesions
in otvement of rectum, but this Mainly involving ileum and right-sided can be patchy colon
Shallow erosions and ulcers Cobblestone appearance
Spontaneous bleeding L aifitudinai ulcer
Deep fissures
Histopathologic!! Diffuse inflammation in mucosa Granulomatous inflammation
or submucosa
Crypt architecture distortio Fissures or aphthous ulcers can be seen;
often transmural inflammation
Serological markers Aotineutropriii cytoplasmic Mii-Sacchammyces cerevisiae
antibodies antibodies
In a further embodiment, the method of the invention for the detection of an intestinal disease is a method for the differential diagnosis between CD and UC. Biomarkers for the differential diagnosis between CD and UC according to the present invention are shown in Examples 14 and 15. Particularly preferred biomarkers for the differential diag nosis between CD and UC are PHGI, PHGII as identified by ROC curve analysis and, PHGI/EC and PHGII/EC ratios that increase in CD.
Subtypes classification is typically performed using international classifications, such as those issued by the international working group on its report of Rome 1991 , Vienna 1998 or Montreal 2005. Preferably, IBD subtypes are determined according to the Montreal classification (further details on the Montreal classification are provided below).
In a preferred embodiment UC patients are classified by the extent of colorectal inflammation in the following sub-types:
E1 : ulcerative proctitis: involvement limited to the rectum,
E2: distal colitis: involvement limited to the portion of the colorectum distal to the splenic flexure, and
- E3: extensive UC or pancolitis: involvement extends proximal to the splenic flexure.
In another preferred embodiment, CD patients are classified according to the location of the disease in the following sub-types: ileal CD (l-CD), ileocolonic CD (IC-CD), and colonic CD (C-CD). Biomarkers for the detection of l-CD, IC-CD and C-CD according to the present invention are shown in Example 16. Particularly preferred biomarkers for the detection of l-CD are PHGI/PHGII, and FT/PHGII which were shown to be good discriminators by ROC curve analysis. A preferred biomarker for the detection of IC-CD is FT/PHGI which was shown to be a good discriminator by ROC curve analysis. Preferably, said ratios have been calculated by subtraction as described above and in the Examples. In a particular embodiment, PHGI abundance is determined and a significant reduction of PHGI abundance levels in the subject sample with regard to said reference sample is indicative of CD, preferably of CD with ileal involvement (IC-CD or l-CD). Particularly preferred biomarkers for the detection of C-CD are PHGI, PHGII, PHGI/PHGII, PHGI/EC and PHGII/EC, preferably PHGI and PHGI/EC which were shown to be good discriminators by ROC curve analysis. Preferably, said ratios have been calculated by subtraction as described above and in the Examples. In another particular embodiment, the PHGII/PHGI ratio is determined and a significant deviation in the subject sample values with regard to said reference sample is indicative of CD, preferably of CD with colonic involvement (C-CD or IC-CD).
In a further particular embodiment, PHGI abundance and PHGII abundance is determined and a significant reduction of PHGII with no significant reduction of PHGI is indicative of l-CD.
The method of the invention may also comprise combining the results of PHGI abundance, PHGII abundance and/or further biomarkers detection and/or quantification as described herein with other indicators of intestinal disease, preferably of IBD.
The diagnosis of IBD is generally confirmed by clinical evaluation and a combination of laboratory, endoscopic, histological, or imaging-based investigations. The result of these clinical, laboratory, endoscopic, histological, and imaging-based investigations alone or in combination can be indicators of IBD. Clinical investigations are typically endoscopy, histopathology, and imaging tests, including ultrasound, magnetic resonance imaging, computed tomography scanning, barium fluoroscopy and/or isotope-labelled scans (Mowat et al., Gut 201 1 , 1-37).
Laboratory investigations may include full blood count, urea and electrolytes, liver function tests, erythrocyte sedimentation rate, C reactive protein, ferritin, transferrin saturation, vitamin B12, and folate.
Preferably, said laboratory tests include fecal tests. Fecal tests commonly used for IBD diagnosis are routine fecal examinations and cultures to eliminate bacterial, viral or parasitic causes of diarrhea, to exclude inter alia Clostridium difficile or cytomegalovirus infections, checking for occult blood or fecal leukocytes, calprotectin, lactoferrin and a1-antitripsin.
In a particular embodiment, the method of the invention is used in combination with the fecal calprotectin test. Calprotectin is an abundant neutrophil protein found in both plasma and stool that is markedly elevated in infectious and inflammatory conditions, including IBD.The role of fecal calprotectin as a biomarker of intestinal inflammation in IBD has previously been described, see for instance, Konikoff and Denson, Inflamm Bowel Dis. 2006; 12(6):524-34; or Van Rheenen et al. BMJ 2010;341 :c3369. There are several indexes used to assess disease activity, these can be for instance validated clinical indices: Crohn's Disease Activity Index (CDAI) (Best, W.R., et al. Gastroenterology, 1976. 70(3): p. 439- 44.), Harvey-Bradshaw (Lancet. 1980;315 (8167):514), Mayo (Pineton de Chambrun, G., L. et al. Nat Rev Gastroenterol Hepatol, 2010. 7(1 ): p. 15-29), Perianal Disease Activity Index (PDAI), fistula drainage assessment, quality of life scores: Inflammatory Bowel Disease Questionnaire (IBDQ), and endoscopic indices: Crohn's Disease Endoscopic Index of Severity (CDEIS)/Simple Endoscopic Score for Crohn's Disease (SES-CD), Rutgeeerts' score for postsurgical recurrence), see Sostegni et al., Aliment Pharmacol Ther. 2003; 17 Suppl 2: 1 1-7. In particular, for UC see for instance, True Love and Witts (Journal of Crohn's and colitis 2008; 2: 1-23) or the Sutherland Disease Activity Index (Sutherland et al. Gastroenterology 1987;92: 1894-8; and for CD, see for instance the Harvey-Bradshaw simplified Crohn's disease activity index (Lancet. 1980;315 (8167):514).
In a further aspect, the invention relates to a method for determining disease activity (i.e., calprotectin levels over 250μg g) wherein said method comprises steps a) and b) as defined in the above aspect, wherein a significant deviation in the subject sample values with regard to said reference sample is indicative of active intestinal disease.
Biomarkers for detecting disease activity in IBD, UC or CD according to the present invention are shown in Example 18. Particularly preferred biomarkers for detecting disease activity in CD are PHGI, PHGII, PHGII/EC. PHGI which was shown to be a good discriminator by ROC curve, PHGII, whose abundance decreases in active CD, and PHGII/EC ratio that increases. On the other hand, particularly preferred biomarkers for detecting disease activity in UC are PHGI, PHGII, FT/PHGI, and PHGI/PHGII. PHGI, whose abundance decreases in active UC, PHGII which was shown to be a good discriminator by ROC curve, FT/PHGI ratio that decreases, PHGI/PHGII ratio that decreases, and PHGI/EC ratio that increases. PHII for CD and PHI for UC disease appear to be the perfect discriminators for disease activity (i.e., calprotectin levels over 250μg/g).
In a related aspect, the invention refers to a method for the monitoring of the activity of an intestinal disease in a human subject comprising steps a) and b) as defined in the above aspect, wherein a significant deviation in the subject sample values with regard to said reference sample is indicative of active intestinal disease and wherein said reference sample is preferably a previous sample of the same subject (e.g., at diagnosis or in remission).
For any of these aspects, said intestinal disease is preferably selected from the group consisting of inflammatory bowel disease (IBD), irritable bowel syndrome (IBS) and colorectal cancer (CRC), and more preferably is IBD. In a particular embodiment, said mathematical combination with FT abundance and/or EC abundance is a ratio selected from the group consisting of: PHGI abundance/EC abundance, PHGII abundance/EC abundance, FT abundance/PHGI abundance, and FT abundance/PHGII abundance. Preferably, abundance determination is performed by qPCR and is expressed as threshold cycle (Ct) value and said ratio is obtained by subtracting from the first Ct value the second Ct value.
Biomarkers for the monitoring of disease activity according to the present invention are shown in Example 19. Particularly preferred biomarkers for the monitoring of disease activity (i.e., determination of increased inflammatory activity between two time points) in UC are PHGI, and, FT/PHGI ratio, that decrease.
Several treatments are currently available for IBD management. The most appropriate treatment will generally be selected according to the disease location, severity and activity. Common pharmacotherapies currently used are anti-inflammatory chemicals derived from sialicylic acid (i.e. mesalazine, and sulfasalazine), corticosteroids (i.e. prednisone, methyl-prednisone and budesonide), antibiotics (i.e. metronidazole and ciprofloxacin), immunosupressors (i.e. azathioprine and mercaptopurine), antimetabolite and antifolate methotrexate, and the so called "biological " drugs consisting of antibodies against tumour necrosis factor a (TNFa), such as infliximab, adalimumab, cetolizumab pegol, etanercept, and golimumab. Intestinal resection is also indicated in those patients with fulminant or fistulising CD and for those patients unresponsive to any of the previously mentioned medication (refractory cases). More recently, persistence of unmet therapeutic needs in CD patients with refractory disease has raised interest in innovative cellular immunoregulatory and regenerative medicines including autologous hematopoietic stem cell transplant. Also a growing body of literature supports the emerging concept that suggests that probiotics or prebiotics may have therapeutic effects in IBD through balancing the disbiosis. For instance, studies in animal models have pointed out that some species of the gut microbiota such as Bacteroides fragilis and F. prausnitzii are able to produce molecules that prevent colitis or with anti-inflammatory effects respectively, which shed new light on the future use of gut microbiota as therapeutics in this intestinal disorders. Preferred treatments are mesalazine, moderate immunosuppressants, such as azathioprine, or methotrexate, and anti-TNF a agents, such as infliximab, adalimumab, cetolizumab pegol, etanercept, and golimumab.
The invention further provides a method for predicting the efficacy of a treatment. A particular embodiment relates to a method for predicting the efficacy of a treatment in a human subject suffering from IBD, wherein said method comprises:
a. determining the abundance of Faecalibacterium prausnitzii phylogroup I members (PHGI) and/or Faecalibacterium prausnitzii phylogroup II members (PHGII) in an intestinal sample from said subject according to a method of the first aspect; and
b. comparing the PHGI and/or PHGII abundance, and/or a mathematical combination thereof, and/or optionally a mathematical combination of any of these with Total F. Prausnitzii (FT) abundance and/or E.coli (EC) abundance, in the subject sample with the corresponding values in a reference sample,
wherein a significant deviation in the subject sample values with regard to said reference sample is indicative of increased possibilities of response to the treatment.
In a related aspect, the invention refers to an in vitro method for the classification of a subject suffering from IBD as responder to a treatment, said method comprising steps a) and b) of the above aspect of the invention, wherein a significant deviation in the subject sample values with regard to said reference sample is indicative of increased possibilities of response to the treatment and wherein a subject with increased possibilities of response is classified as responder. In a further related aspect, the invention refers to a method for selecting a treatment for a subject suffering from IBD, said method comprising the classification of the subjects as responders or non-responders to a treatment as described in the above aspect, and the selection of said treatment for responders.
Said treatment may be any of the recited above. In a particular embodiment, said treatment is with an anti-TNFalpha agent. Preferably, said reference sample is a healthy subject sample or a sample of a patient with intestinal disease in remission. Other preferred features and embodiments are as defined above for other aspects of the invention.
Biomarkers for the determination of response to TNF-alpha treatment according to the present invention are shown in Example 20. Particularly preferred biomarkers for the classification of subjects as responders or non-responders of TNF-alpha treatment are PHGI and PHGII. In example 20, it was observed that PHGI Ct were increased in non-responders of UC and CD (26.80% and 53.94%, respectively) and PHGII Ct were 66.82% increased in non-responders of UC.
The term "responder" as used herein refers to those subjects suffering from IBD (e.g., CD or UC) which show a decrease in inflammation, i.e., a decrease of calprotectin levels below 250μg G after biological treatment induction. The term "induction" as used herein refers to the time period where different treatment dosage is given to achieve the therapeutic dose.
On the other hand, treatment may be based on surgery. Preferably, the treatment is a combination of pharmacotherapy and surgery. UC is typically surgically curable. However, surgical resection is often not curative in CD, with recurrence being the norm. Surgical intervention in IBD includes inter alia the following:
• UC: Proctocolectomy with ileostomy, total proctocolectomy with ileoanal anastomosis;
• Fulminant colitis: Surgical procedure of choice is subtotal colectomy with end ileostomy and creation of a Hartmann pouch;
• CD: Surgery most commonly performed in cases of disease complications of the disease; generally consists of conservative resection (eg, potential stricturoplasty vs resective surgery) to preserve bowel length in case future additional surgery needed;
• Selected patients with distal ileal or proximal colonic disease: Option for ileorectal or ileocolonic anastomosis;
• Severe perianal fistulas: Option for diverting ileostomy; generally, resection for symptomatic enteroenteric fistulas.
The invention further provides a method for treating a subject which has an intestinal disease, wherein said method comprises the steps of the method of the invention for the detection of an intestinal disease as described herein and further comprises c) administering a treatment to this subject. Preferably, wherein said treatment is an anti-TNF alpha agent. The invention also provides a method for treating a subject which has an intestinal disease, wherein said method comprises the steps of the method of the invention for classifying a subject as a responder or non-responder and further comprises c) administering a treatment to a subject which is a responder. Preferably, wherein said treatment is an anti-TNF alpha agent.
Preferably, the method of the invention further comprises storing the results of the method in a data carrier. In one embodiment, said data carrier is a paper sheet. In a preferred embodiment, said data carrier is a computer readable medium. As used herein, "a computer readable medium" can be any apparatus that may include, store, communicate, propagate, or transport the results of the determination of the method of the invention. The medium can be an electronic, magnetic, optical, electromagnetic, infrared, or semiconductor system (or apparatus or device) or a propagation medium.
Sensitivity, specificity, and accuracy, or a combination thereof, are parameters typically used to describe the validity or performance of a test. In particular, they are used to quantify how good and reliable the method is.
Preferably, the method of the invention has a sensitivity of 70% to 90%, 75% to 95%, 80% to 95%, 85% to 100%, or 90% to 100%. More preferably, the method of the invention has sensitivity values of at least 85%, such as about 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 97.5%, 98%, 99% or 100%.
Preferably, the method of the invention has a specificity of 70% to 90%, 75% to 95%, 80% to 95%, 85% to 100%, or 90% to 100%. More preferably, the method of the invention has specificity values of at least 85%, such as about 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 97.5%, 98%, 99% or 100%.
In a preferred embodiment, the method for detecting inflammatory bowel disease (IBD) of the present invention diagnoses, early detects, determines progression, determines relapses, determines recurrence and/or determines efficacy of a treatment in an statistically significant manner with a sensitivity and/or specificity of at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97.5%, or preferably 100%.
Preferably, the accuracy of the method of the invention is of at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97.5%, or preferably 100%. In a preferred embodiment, it has an accuracy of 70% to 90%, 75% to 95%, 80% to 95%, 85% to 100%, or 90% to 100%. Preferably, the method of the invention has accuracy values of at least 85%, such as about 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 97.5%, 98%, 99% or 100%.
Sensitivity, specificity and accuracy parameters are proportions, thus the according confidence intervals can be calculated by using standard methods for proportions well known in the art. Two types of 95% confidence intervals are generally defined around proportions. The exact confidence interval is defined by using binomial distribution to reach an exact estimate. Asymptotic confidence interval is calculated by assuming a normal approximation of the sample distribution. A person skilled in the art will know how to define the appropriate confidence interval. The choice of one or another type of confidence interval will typically depend on whether the sample proportion is a good approximation to a normal distribution.
Accuracy is preferably determined by the area under the ROC curve. The "ROC curve" is a graphic presentation of the relationship between both sensitivity and specificity and it helps to decide the optimal model through determining the best threshold (optimal cut-point) for the screening test. The area under ROC curve (AUC) provides a way to measure the accuracy of a test. Preferably, the AUC range values of the method of the invention are from 0.6 to 1 , more preferably 0.7 to 1 , more preferred values being in the range of 0.75 to 1 , more preferably of 0.8 to 1 or of 0.9 to 1 . In preferred embodiments, AUC is from 0.7 to 0.9, from 0.7 to 0.95, from 0.75 to 0.9, from 0.75 to 0.95, from 0.8 to 0.9, from 0.8 to 0.95, from 0.85 to 0.9, or from 0.85 to 0.95. In a preferred embodiment, the method for detecting inflammatory bowel disease (IBD) of the present invention diagnoses, early detects, determines progression, determines relapses, determines recurrence and/or determines efficacy of a treatment in an statistically significant manner with an AUC value of at least 0.6, at least 0.65, at 0.7, at least 0.75, at least 0.8, at least 0.85, at least 0.9, at least 0.95 or higher. USE OF PHGI AND/OR PHGII ABUNDANCE AS BIOMARKER FOR THE DETECTION OF INTESTINAL DISEASES
In a further aspect, the invention relates to the use of Faecalibacterium prausnitzii phylogroup I members (PHGI) and/or Faecalibacterium prausnitzii phylogroup II members (PHGII) abundance, and/or a mathematical combination thereof, and/or optionally a mathematical combination of any of these with Total F. Prausnitzii (FT) abundance and/or E.coli (EC) abundance, in an intestinal sample of a human subject as biomarker for the detection of an intestinal disease, and/or for predicting the efficacy of a drug in the treatment of an intestinal disease, In a particular embodiment, it relates to the use of Faecalibacterium prausnitzii phylogroup I members (PHGI) abundance, optionally with Faecalibacterium prausnitzii phylogroup II members (PHGII) abundance, including any mathematical combinations thereof, in an intestinal sample of a human subject as biomarker for the detection of intestinal disease. The determination of the PGHI and/or PGHII abundance in an intestinal sample is performed in vitro according to the method of the invention.
In preferred embodiments, PHGI abundance is used in combination with PHGII abundance, including any mathematical combinations thereof, in an intestinal sample of said human subject, preferably wherein the ratio between the PHGII abundance and the PHGI abundance (PHGII/PHGI ratio) is determined. As above-mentioned, one of ordinary skill in the art knows several methods and devices for the determination of the abundance of Faecalibacterium prausnitzii PHGI and/or PHGII. Further details are provided above. In preferred embodiments, PHGI and/or PHGII abundance determination is performed by gene quantification with a molecular method selected from the group consisting of quantitative Polymerase Chain Reaction (qPCR), PCR-pyrosequencing, fluorescence in-situ hybridization (FISH), microarrays, and PCR-ELISA, preferably quantification is performed by qPCR. Also, several genes can be used for bacterial quantification purposes as described above. Preferably, PHGI and/or PHGII abundance determination is carried out by 16S rRNA gene quantification. In a particular embodiment, PHGI abundance determination is carried out by quantifying a Faecalibacterium prausnitzii 16S rRNA gene sequence comprising or consisting of SEQ ID NO: 3. In another embodiment, PHGII abundance is determined by quantifying a Faecalibacterium prausnitzii 16S rRNA gene sequence comprising or consisting of SEQ ID NO: 4. In a preferred embodiment, PHGI abundance determination is carried out by quantifying a Faecalibacterium prausnitzii 16S rRNA gene sequence comprising or consisting of SEQ ID NO: 3 and PHGII abundance by quantifying a Faecalibacterium prausnitzii 16S rRNA gene sequence comprising or consisting of SEQ ID NO: 4. Preferred oligonucleotides for PHGI and/or PHGII abundance determination, detection chemistries and preferred embodiments of the quantification method are provided above.
Said intestinal sample may be an intestinal biopsy. In a preferred embodiment said intestinal sample is an intestinal biopsy obtained by a non-invasive method, such as a rectal sigmoidoscopy. In another preferred embodiment, said intestinal sample is a feces sample. Preferred embodiments on the processing of the sample are provided above.
Preferably, said intestinal disease is selected from the group consisting of CRC, IBS and IBD. In preferred embodiments, said intestinal disease is IBD, preferably said IBD is Ulcerative colitis (UC) or Crohn's disease (CD), more preferably said IBD is CD. Further details on the diagnosis, classification, and treatment of said intestinal diseases are provided above.
In preferred embodiments, PHGI and/or PHGII abundance in an intestinal sample is used as biomarker for the screening, for the diagnosis, for monitoring progression, for monitoring relapses, and/or for monitoring postsurgical recurrence of an intestinal disease, and/or for determining efficacy of a treatment on an intestinal disease; preferably for the screening or diagnosis of an intestinal disease.
Additional details and other preferred embodiments on the use of PHGI and/or PHGII abundance in an intestinal sample of a human subject as biomarker for the detection of intestinal disease are as provided under the above aspects of the invention. A KIT FOR DETECTING INTESTINAL DISEASE
A further aspect of the invention relates to a kit for detecting intestinal disease according to a method as described under the third aspect of the invention, said kit comprising:
- a reagent for determining the abundance of Faecalibacterium prausnitzii phylogroup I members (PHGI);
- optionally, a reagent for determining the abundance of Faecalibacterium prausnitzii phylogroup II members (PHGII); and
instructions for use of said reagent(s) to determine the abundance levels of PHGI, and optionally PHGII, from a human intestinal sample.
The invention further provides a kit comprising:
- a reagent for determining the abundance of Faecalibacterium prausnitzii phylogroup I members (PHGI) consisting of a primer and/or probe with sequence SEQ ID NO: 3 or a sequence with at least 75% identity thereof; and/or
- a reagent for determining the abundance of Faecalibacterium prausnitzii phylogroup II members (PHGII) consisting of a primer and/or a probe with sequence SEQ ID NO: 4 or a sequence with at least 75% identity thereof; and
- optionally, instructions for use of said reagent(s) to determine the abundance of PHGI, and/or PHGII, from a human intestinal sample.
Preferably, said intestinal sample is a feces sample.
Said kit may be used for the screening, for the diagnosis, for determining disease activity, for monitoring activity and/or progression, for monitoring relapses, and/or for monitoring postsurgical recurrence of intestinal disease, and/or for determining efficacy of a treatment on intestinal disease; preferably for the screening and/or diagnosis of intestinal disease. Accordingly, the invention further relates to the use of a kit as described herein for detecting an intestinal disease, for predicting the efficacy of a drug in the treatment of an intestinal disease, and/or for the differential diagnosis of IBD phenotypes.
Reagents for determining PHGI and/or PHGII abundance are as described above for the previous aspects of the invention.
In a particular embodiment, said reagent for determining PHGI abundance is selected from the group consisting of:
- a pair of nucleic acid primers consisting of oligonucleotide sequences SEQ ID NO: 1 and SEQ ID NO: 2 or an oligonucleotide sequence with at least 75% identity thereof, and/or - a probe consisting of oligonucleotide sequence SEQ ID NO: 3 or an oligonucleotide sequence with at least 75% of identity thereof.
In another particular embodiment, said reagent for determining PHGII abundance is selected from the group consisting of:
- a pair of nucleic acid primers consisting of oligonucleotide sequences SEQ ID NO: 1 and SEQ ID NO: 2 or an oligonucleotide sequence with at least 75% identity thereof, and/or
- a probe consisting of oligonucleotide sequence SEQ ID NO: 4 or an oligonucleotide sequence with at least 75% identity thereof.
In a preferred embodiment, said reagent for determining PHGI abundance and said reagent for determining PHGII abundance are those in the particular embodiments defined above for the previous aspects of the invention. In a preferred embodiment, the kit may further comprise DNA extraction means, means for carrying out the hybridization and/or amplification, detection means, and/or one or more containers for collecting and/or holding the biological sample.
The kit of the invention may further comprise a reference reagent for normalizing data, preferably wherein said reagent are primers and/or a probe for the quantification of total bacteria. Further details on quantification data normalization are provided above.
Preferably, said intestinal disease is selected from the group consisting of CRC, IBS and IBD. In preferred embodiments, said intestinal disease is IBD, preferably said IBD is Ulcerative colitis (UC) or Crohn's disease (CD), more preferably said IBD is CD. Further details on the diagnosis, classification, and treatment of said intestinal diseases are provided above.
Additional details and other preferred embodiments of the kit of the invention for the detection of intestinal disease are as provided for the previous aspects of the invention.
A NUCLEIC ACID SEQUENCE OF THE INVENTION
An additional aspect of the invention relates to a nucleic acid molecule with a sequence selected from the group consisting of SEQ ID NO: 1 , SEQ ID NO: 2, SEQ ID NO: 3, and SEQ ID NO: 4 or an oligonucleotide sequence with at least 75% identity thereof. Preferably, said oligonucleotide sequence with at least 75% identity have at least 80%, at least 85%, at least 90%, at least 95%, more preferably, 96%, 97%, 98%, 99% or 100% identity with SEQ ID NO: 1 , SEQ ID NO: 2, SEQ ID NO: 3 and/or SEQ ID NO: 4. Furthermore, these oligonucleotide sequences with at least 75% identity may have the same nucleotide number, may be longer or shorter than SEQ ID NO: 1 , SEQ ID NO: 2, SEQ ID NO: 3 and/or SEQ ID NO: 4. In a particular embodiment, said nucleic acid molecule has a sequence selected from the group consisting of SEQ ID NO: 1 or a sequence with at least 80% identity thereof; SEQ ID NO: 2 or a sequence with at least 90% identity thereof; SEQ ID NO: 3 or a sequence with at least 80% identity thereof; and SEQ ID NO: 4 or a sequence with at least 85% identity thereof.
Said nucleic acid molecules may be used as primers or probes in the method of the invention, and may be modified as described above. Additional details and other preferred embodiments are as provided for the previous aspects of the invention.
A METHOD FOR DETERMINING THE ABUNDANCE OF PHGI AND/OR PHGII IN AN INTESTINAL SAMPLE
This section provides additional embodiments under the first aspect of the invention. In a particular embodiment relates to a method for determining the abundance of Faecalibacterium prausnitzii phylogroup I members (PHGI) and/or the abundance of Faecalibacterium prausnitzii phylogroup II members (PHGII) in an intestinal sample from a subject wherein said determination is carried out by 16S rRNA gene quantification, wherein PHGI abundance determination is carried out by quantifying a Faecalibacterium prausnitzii 16S rRNA gene sequence comprising or consisting of SEQ ID NO: 3, and wherein PHGII abundance determination is carried out by quantifying a Faecalibacterium prausnitzii 16S rRNA gene sequence comprising or consisting of SEQ ID NO: 4.
As above-mentioned, one of ordinary skill in the art knows several methods and devices for the determination of the abundance of Faecalibacterium prausnitzii PHGI and/or PHGII. Further details are provided above.
In preferred embodiments, 16S rRNA gene quantification is carried out with a molecular method selected from the group consisting of quantitative Polymerase Chain Reaction (qPCR), PCR-pyrosequencing, fluorescence in-situ hybridization (FISH), microarrays, and PCR-ELISA, preferably quantification is performed by qPCR.
In preferred embodiments, PHGI 16S rRNA gene quantification is performed with at least one oligonucleotide molecule of sequence SEQ ID NO: 1 or SEQ ID NO: 2, or a sequence with at least 75% identity thereof; and/or an oligonucleotide molecule of sequence SEQ ID NO: 3 or a sequence with at least 75% identity thereof. Preferably, oligonucleotide molecules of sequence SEQ ID NO: 1 and SEQ ID NO: 2 are used.
In a further preferred embodiment, PHGI 16S rRNA gene quantification is performed with primers consisting of oligonucleotide sequences SEQ ID NO: 1 and SEQ ID NO: 2, or a sequence with at least 75% identity thereof; and/or a probe consisting of oligonucleotide sequence SEQ ID NO: 3 or a sequence with at least 75% identity thereof. It is preferred that PHGII 16S rRNA gene quantification is performed with at least one, oligonucleotide molecule of sequence SEQ ID NO: 1 or SEQ ID NO: 2, or a sequence with at least 75% identity thereof; and/or an oligonucleotide molecule of sequence SEQ ID NO: 4, or a sequence with at least 75% identity thereof. Preferably, oligonucleotide molecules of sequence SEQ ID NO: 1 and SEQ ID NO: 2 are used.
In another preferred embodiment, PHGII 16S rRNA gene quantification is performed with primers consisting of oligonucleotide sequences SEQ ID NO: 1 and SEQ ID NO: 2, or a sequence with at least 75% identity thereof; and/or a probe consisting of oligonucleotide sequence SEQ ID NO: 4, or a sequence with at least 75% identity thereof.
Preferably, said oligonucleotide sequences with at least 75% identity have at least 80%, at least 85%, at least 90%, at least 95%, more preferably, 96%, 97%, 98%, 99% or 100% identity with SEQ ID NO: 1 , SEQ ID NO: 2, SEQ ID NO: 3 and/or SEQ ID NO: 4. Furthermore, these oligonucleotide sequences with at least 75% identity may have the same nucleotide number, may be longer or shorter than SEQ ID NO:
1 , SEQ ID NO: 2, SEQ ID NO: 3 and/or SEQ ID NO: 4.
More specifically, PHGI 16S rRNA gene quantification is preferably performed by qPCR with primers consisting of oligonucleotide sequences SEQ ID NO: 1 and SEQ ID NO: 2, and a probe consisting of oligonucleotide sequence SEQ ID NO: 3. Also, PHGII 16S rRNA gene quantification is preferably performed by qPCR with primers consisting of oligonucleotide sequences SEQ ID NO: 1 and SEQ ID NO:
2, and a probe consisting of oligonucleotide sequence SEQ ID NO: 4.
Said oligonucleotide sequences may be modified. In a preferred embodiment, said PHGI specific probe consists of SEQ ID NO: 3 or a sequence with at least 75% identity thereof which has been modified. Preferably, it is a dual labelled probe, more preferably a hydrolysis probe. In a more preferred embodiment, SEQ ID NO: 3 is modified with 6FAM (6-carboxyfluorescin) in its 5' end and with BHQ1 (Black Hole Quencherl ) in its 3' end and it is represented as 6FAM-TAAGCCCACGACCCGGCATCG- BHQ1.
In another preferred embodiment, said PHGII specific probe consists of SEQ ID NO: 4 or a sequence with at least 75% identity thereof, which has been modified. Preferably, it is a dual labelled probe, more preferably a hydrolysis probe. In a more preferred embodiment, SEQ ID NO: 4 is modified with JOE (4',5'- dichloro-2',7'-dimethoxy-5(6)-carboxyfluorescein) in its 5' end and with BHQ1 (Black Hole Quencherl ) in its 3' end and it is represented as JOE-TAAGCCCACRGCTCGGCATC-BHQ1.
In preferred embodiments, the PHGI and/or PHGII abundance levels are normalized as described above. Preferably, normalization is carried out with respect to total bacteria quantification. Further details on the PHGI and/or PHGII abundance quantification methods, detection chemistries and other specifics are as provided above. The determination of the PGHI and/or PGHII abundance in an intestinal sample by the method of the invention is performed in vitro. Said intestinal sample may be an intestinal biopsy. Several methods are well known in the art for the obtaining of intestinal biopsies, e.g. by endoscopy. In a preferred embodiment said intestinal sample is a non-invasive intestinal sample. A non-invasive intestinal sample may be an intestinal biopsy obtained by a non-invasive method, such as a rectal sigmoidoscopy, and also a feces sample. In a more preferred embodiment, said intestinal sample is a feces sample. Preferred embodiments on the processing of the sample are provided above. In a preferred embodiment, DNA is extracted from the intestinal sample prior to PHGI and PHGII gene quantification. Additional details and other preferred embodiments on the method for determining the abundance of PHGI and/or PHGII in an intestinal sample are as provided under the previous aspects of the invention.
A METHOD FOR THE DIFFERENTIAL DIAGNOSIS OF INFLAMMATORY BOWEL DISEASE (IBD) PHENOTYPES IN A HUMAN SUBJECT
An additional aspect of the invention relates to a method for the differential diagnosis of inflammatory bowel disease (IBD) phenotypes in a human subject comprising the following steps: i. determining the abundance of a target microorganism in an intestinal sample from said subject, wherein said target microorganism is selected from the group consisting of
Faecalibacterium prausnitzii members (total FP), Faecalibacterium prausnitzii phylogroup I members (PHGI) and Faecalibacterium prausnitzii phylogroup II members (PHGII); and ii. comparing the subject sample abundance of one or more of said target microorganisms and/or a mathematical combination thereof, and/or optionally a mathematical combination of any of these with Total F. Prausnitzii (FT) abundance and/or E.coli (EC) abundance, with the corresponding values in a reference sample of the IBD phenotypes to be distinguished from to determine the IBD phenotype the subject is suffering from; wherein the subject sample presenting values significantly similar to one of said IBD phenotypes will be indicative that the subject is suffering from said IBD phenotype; and
wherein said IBD phenotypes are defined by at least the combination of two, preferably three, of the following parameters:
- disease location;
IBD type; and
- age at diagnosis,
optionally, comprising the use of additional biomarkers for the definition of said IBD phenotypes.
IBD types, this term as used herein referring to IBD diseases or disorders have been recited above. Preferably, said IBD type is selected from the group consisting of Ulcerative Colitis (UC), Crohn's disease (CD), indeterminate colitis and inflammatory bowel disease unclassified (IBDU). Subtypes may be defined within an IBD disease or disorder. Subtypes classification is typically performed using international classifications, such as those issued by the international working group on its report of Rome 1991 , Vienna 1998 or Montreal 2005. Preferably, IBD subtypes are determined according to the Montreal classification.
In a preferred embodiment, said IBD phenotypes are selected from the group consisting of:
i. CD phenotypes defined by one or more, preferably all, of the following parameters:
- disease location;
- age at diagnosis; and
- behavior;
ii. UC phenotypes defined by one or more, preferably all, of the following parameters:
- disease location or extent; and
- severity. Preferably, CD subtypes are for those defined by the Montreal classification, wherein CD is classified according to age at diagnosis, location and/or behavior. Similarly, preferred UC subtypes are those defined by the Montreal classification, wherein UC is classified according to disease extend and/or disease severity (World Gastroenterology Organisation Global Guidelines, Inflammatory bowel disease: a global perspective, June 2009; Satsangi et al., Gut 2006; 55, 749-753 and Silverberg et al., Can J Gastroenterol. 2005, 19 Suppl A:5-36). The specific subtypes defined according to these parameters are provided in the tables below from Satsangi et al (Satsangi et al., Gut 2006; 55, 749-753).
Table 10. Vienna and Montreal classification for CD.
Vienna Montreal
Age at diagnosis At below 40 y Al e 16 y
A2 above 40 y A2 between 17 and 40 y
A3 above 40
Location LI ileal LI ileal
12 colonic 12 colonic
13 ileoco mc L3 feocoionic
upper 14 isolated upper' disease*
Behaviour 61 non-stricturing, non -penetrating 11 non-strictering, non-penetrating
12 stricturing B2 stricturing
S3 penetrating 13 penetrati g
p perianal disease modifier!
* is a modifier that can be added to LI— 13 when concomitant upper gastrointestinal disease is present.
†"p" is added to B1 -B3 when concomitant perianal disease is present.
Table 11. Montreal classification of extent of UC. Extent Anatomy
El Ulcerative proctitis Involvement limited to the rectum (that is, proximal extent of
inflammation is distal to the rectosigmoid junction)
E2 Left sided UC (distal UC) Involvement limited to a proportion of the colorectum distal to the
spbrtlc flexure
E3 Extensive UC (pancolitis) Involvement extends proximal to (he splenic flexure
Table 12. Montreal classification of severity of UC.
Severity Definition
Clinical remission Asymptomatic
Mild UC Passage of four or fewer stools/day (with or without blood), absence of any
systemic illness, and normal inflammatory markers {ESI}
Moderate UC Passage of more than four stools per day but with minimal sig of systemic toxicity Severe UC Passage of at least six bloody stools daily, pulse rate of at least 90 beats per minute, temperature of at least 37SC, haemoglobin of lee than 10.5 g/100 ml, and ESR of at least 30 mm/h
ESR, erythrocyte sedimentation rote.
In a further preferred embodiment said IBD phenotypes are defined by disease location, more preferably, these are selected from the group consisting of:
- CD phenotypes consisting of ileal CD (l-CD), ileocolonic CD (IC-CD) and colonic CD (C-CD); and
UC phenotypes consisting of ulcerative proctitis (UC-E1 ), distal colitis (UC-E2) and extensive UC or pancolitis (UC-E3).
The method of the invention may be useful for the differential diagnosis between one or more of the following IBD subtypes: UC vs C-CD, UC-E2 vs UC-E3, UC-E2 vs C-CD, UC-E2 vs IC-CD, UC-E2 vs I- CD, UC-E3 vs C-CD, UC-E3 vs IC-CD, UC-E3 vs l-CD, C-CD vs IC-CD, C-CD vs l-CD or l-CD vs IC-CD; preferably selected from the list consisting of UC vs C-CD, UC-E3 vs C-CD, l-CD vs IC-CD and C-CD vs IC-CD.
Said intestinal sample may be an intestinal biopsy. In a preferred embodiment said intestinal sample is an intestinal biopsy obtained by a non-invasive method, such as a rectal sigmoidoscopy. In another preferred embodiment, said intestinal sample is a feces sample. Preferred embodiments on the processing of the sample are provided above.
In a preferred embodiment, said IBD phenotypes are UC-E3 and C-CD and the subject sample values are compared with a UC-E3 positive reference sample and/or a C-CD positive reference sample, wherein the subject sample presenting values significantly similar to UC-E3 or C-CD will be indicative that the subject is suffering from said IBD phenotype. Preferably, said human subject has previously been diagnosed of IBD with colonic involvement. In a further preferred embodiment, optionally in combination of any of the above, said target microorganism is the PHGII. In another further preferred embodiment, optionally in combination of any of the above, said mathematical combination with FT abundance and/or EC abundance is a ratio selected from the group consisting of: PHGI abundance/EC abundance, PHGII abundance/EC abundance, FT abundance/PHGI abundance, and FT abundance/PHGII abundance. Preferably, abundance determination is performed by qPCR and is expressed as threshold cycle (Ct) value and said ratio is obtained by subtracting from the first Ct value the second Ct value.
Biomarkers for differential diagnosis of UC from C-CD according to the present invention are shown in Example 17. Particularly preferred biomarkers for differential diagnosis of UC and C-CD are PHGI, PHGII, PHGI/EC and PHGII/EC ratios. PHGI and PHGII abundance increases in UC, and PHGI/EC and PHGII/EC ratios decrease in UC. Other particularly preferred biomarkers for differential diagnosis of UC from C-CD are FT/PHGI and FT/PHGII ratios which were shown to be good discriminators by ROC curve analysis. On the other hand, particularly preferred biomarkers for differential diagnosis of C-CD from UC are PHGI, PHGII, PHGI/PHGII, PHGI/EC, and PHGII/EC, preferably PHGI and PHGI/EC that were shown to be good discriminators by ROC curve analysis.
A METHOD FOR DIAGNOSING C-CD IN A HUMAN SUBJECT SUFFERING FROM IBD WITH COLONIC INVOLVEMENT A further aspect of the invention relates to a method for diagnosing C-CD in a human subject suffering from IBD with colonic involvement comprising the following steps:
i. determining the abundance of a target microorganism in an intestinal sample from said subject, wherein said target microorganism is selected from the group consisting of Faecalibacterium prausnitzii members (total FP), Faecalibacterium prausnitzii phylogroup I members (PHGI) and Faecalibacterium prausnitzii phylogroup II members (PHGII); and ii. comparing the subject sample abundance of one or more of said target microorganisms and/or a mathematical combination thereof, and/or optionally a mathematical combination of any of these with Total F. Prausnitzii (FT) abundance and/or E.coli (EC) abundance, with the corresponding values in a reference sample, wherein a significant deviation in the subject sample values with regard to said reference sample is indicative of C-CD.
In a particular embodiment, said target microorganism is PHGI and PHGII. In another particular embodiment said target microorganism is PHGI. In another particular embodiment, said target microorganism is PHGII.
As above-mentioned, particularly preferred biomarkers for the detection of C-CD are PHGI, PHGII, PHGI/PHGII, PHGI/EC and PHGII/EC, preferably PHGI and PHGI/EC. Preferably, said ratios have been calculated by subtraction as described above and in the Examples. In a preferred embodiment, it relates to a method for diagnosing C-CD in a human subject suffering from IBD with colonic involvement comprising the following steps:
i. determining the abundance of Faecalibacterium prausnitzii phylogroup II members (PHGII) in an intestinal sample from said subject; and
ii. comparing the subject sample abundance levels with the levels in a reference sample, wherein a significant reduction of abundance levels in the subject sample with regard to said reference sample is indicative of C-CD.
Preferably, said reference sample is a sample of a healthy subject and/or a sample of a patient with IBD in remission, more preferably a sample of the same subject in remission.
In preferred embodiments, said IBD phenotypes are selected from the group consisting of l-CD, C-CD and IC-CD and the subject sample values are compared with an l-CD positive reference sample, a C-CD positive reference sample and/or a IC-CD positive reference sample, wherein the subject sample presenting values significantly similar to l-CD, C-CD or IC-CD will be indicative that the subject is suffering from said IBD phenotype.
In a preferred embodiment, the method of the invention is used for determining extension of the disease to the colonic area (IC-CD) in a human subject who has previously been diagnosed with l-CD. Preferably, said target microorganism is the PHGII.
In another preferred embodiment, the method of the invention is used for determining extension of the disease to the ileal area (IC-CD) in a human subject who has previously been diagnosed with C-CD. Preferably, said target microorganism is the PHGII.
A METHOD FOR DIAGNOSING IC-CD IN A HUMAN SUBJECT SUFFERING FROM l-CD OR C-CD
An additional aspect of the invention relates to a method for diagnosing IC-CD in a human subject suffering from l-CD or C-CD comprising the following steps:
i. determining the abundance of a target microorganism in an intestinal sample from said subject, wherein said target microorganism is selected from the group consisting of Faecalibacterium prausnitzii members (total FP), Faecalibacterium prausnitzii phylogroup I members (PHGI) and Faecalibacterium prausnitzii phylogroup II members (PHGII); and ii. comparing the subject sample abundance of one or more of said target microorganisms and/or a mathematical combination thereof, and/or optionally a mathematical combination of any of these with Total F. Prausnitzii (FT) abundance and/or E.coli (EC) abundance, with the corresponding values in a reference sample from said subject at around diagnose of l-CD or C-CD, wherein a significant deviation in the subject sample values with regard to said reference sample is indicative of IC-CD. In a particular embodiment, said target microorganism is PHGI and PHGII. In another particular embodiment said target microorganism is PHGI. In another particular embodiment, said target microorganism is PHGII. In a further embodiment, said target microorganism is FT and PHGI. As above- mentioned a preferred biomarker for the detection of IC-CD is FT/PHGI.
In a preferred embodiment, it relates to a method for diagnosing IC-CD in a human subject suffering from l-CD or C-CD comprising the following steps:
i. determining the abundance of Faecalibacterium prausnitzii phylogroup II members (PHGII) in an intestinal sample from said subject; and
ii. comparing the subject sample PHGII abundance levels with the levels in a reference sample from said subject at around diagnose of l-CD or C-CD, wherein a significant reduction of abundance levels in the subject sample with regard to said reference sample is indicative of IC-CD. As above-mentioned, one of ordinary skill in the art knows several methods and devices for the determination of the abundance of a target microorganism. Further details are provided above.
In preferred embodiments, said target microorganism abundance determination is performed by gene quantification with a molecular method selected from the group consisting of quantitative Polymerase Chain Reaction (qPCR), PCR-pyrosequencing, fluorescence in-situ hybridization (FISH), microarrays, and PCR-ELISA, preferably quantification is performed by qPCR.
Also, several genes can be used for bacterial quantification purposes as described above. Preferably, said target microorganism abundance determination is carried out by 16S rRNA gene quantification.
Said target microorganism is preferably selected from the group consisting of PHGI and PHGII. In a preferred embodiment, PHGI abundance is used in combination with PHGII abundance, including any mathematical combinations thereof, in an intestinal sample of said human subject, preferably wherein the ratio between the PHGII abundance and the PHGI abundance (PHGII/PHGI ratio) is determined.
In a preferred embodiment, PHGI abundance determination is carried out by quantifying a Faecalibacterium prausnitzii 16S rRNA gene sequence comprising or consisting of SEQ ID NO: 3. In another embodiment, PHGII abundance is determined by quantifying a Faecalibacterium prausnitzii 16S rRNA gene sequence comprising or consisting of SEQ ID NO: 4. In a preferred embodiment, PHGI abundance determination is carried out by quantifying a Faecalibacterium prausnitzii 16S rRNA gene sequence comprising or consisting of SEQ ID NO: 3 and PHGII abundance by quantifying a Faecalibacterium prausnitzii 16S rRNA gene sequence comprising or consisting of SEQ ID NO: 4. Preferred oligonucleotides for PHGI and/or PHGII abundance determination, detection chemistries and preferred embodiments of the quantification method are provided under the above aspects of the invention. With regard to total FP 16S rRNA gene quantification is performed by quantifying a Faecalibacterium prausnitzii 16S rRNA gene sequence comprising or consisting of SEQ ID NO: 7.
In preferred embodiments, total FP 16S rRNA gene quantification is performed with at least one oligonucleotide molecule of sequence SEQ ID NO: 5 or SEQ ID NO: 6, or a sequence with at least 75% identity thereof; and/or an oligonucleotide molecule of sequence SEQ ID NO: 7 or a sequence with at least 75% identity thereof. Preferably, oligonucleotide molecules of sequence SEQ ID NO: 5 and SEQ ID NO: 6 are used. In a further preferred embodiment, PHGI 16S rRNA gene quantification is performed with primers consisting of oligonucleotide sequences SEQ ID NO: 5 and SEQ ID NO: 6 or a sequence with at least 75% identity thereof; and/or a probe consisting of oligonucleotide sequence SEQ ID NO: 7 or a sequence with at least 75% identity thereof. In a preferred embodiment, total FP 16S rRNA gene quantification is performed, preferably by qPCR, with primers consisting of oligonucleotide sequences SEQ ID NO: 5 and SEQ ID NO: 6, and a probe consisting of oligonucleotide sequence SEQ ID NO: 7.
Preferably, said oligonucleotide sequences with at least 75% identity have at least 80%, at least 85%, at least 90%, at least 95%, more preferably, 96%, 97%, 98%, 99% or 100% identity with SEQ ID NO: 5, SEQ ID NO: 6, and/or SEQ ID NO: 7. Furthermore, these oligonucleotide sequences with at least 75% identity may have the same nucleotide number, may be longer or shorter than SEQ ID NO: 5, SEQ ID NO: 6, and/or SEQ ID NO: 7.
In a preferred embodiment, said total FP probe consists of SEQ ID NO: 7 or a sequence with at least 75% identity thereof which has been modified. Preferably, it is a dual labelled probe, more preferably a hydrolysis probe. In a more preferred embodiment, SEQ ID NO: 7 is modified with 6FAM (6- carboxyfluorescin) in its 5' end and with TAMRA (tetramethylrhodamin) in its 3' end and it is represented as 6FAM-CAAGGAAGTGACGGCTAACTACGTGCCAG-TAMRA
Further details and preferred embodiments of the quantification method are provided under the above aspects of the invention.
In a preferred embodiment, said method further comprises detecting and/or quantifying one or more biomarkers of intestinal disease, preferably of IBD. In a further preferred embodiment, said method further comprises combining the results of the target microorganism quantification and/or said further biomarkers detection and/or quantification with clinical signs and/or symptoms which are independent predictors of IBD.
In another embodiment, said method further comprises storing the method results in a data carrier, preferably wherein said data carrier is a computer readable medium. Additional details and other preferred embodiments on a method for the differential diagnosis of inflammatory bowel disease (IBD) phenotypes in a human subject according to any of the sixth to eight aspects of the invention are as provided for the previous aspects of the invention. A METHOD FOR THE PROGNOSIS OF INFLAMMATORY BOWEL DISEASE (IBD)
In still an additional aspect, the invention relates to a method for the prognosis of inflammatory bowel disease (IBD) which comprises the determination of an IBD phenotype according to a method for the differential diagnosis as described herein of the invention and establishing prognosis according to the determined IBD phenotype.
THE USE OF TOTAL FP, PHGI AND/OR PHGII ABUNDANCE AS BIOMARKER FOR THE DIFFERENTIAL DIAGNOSIS OF IBD PHENOTYPES. In a further aspect, the invention relates to the use of Faecalibacterium prausnitzii phylogroup I members (PHGI) and/or Faecalibacterium prausnitzii phylogroup II members (PHGII) abundance, and/or mathematical combinations thereof, and/or optionally a mathematical combination of any of these with Total F. Prausnitzii (FT) abundance and/or (EC) E.coli abundance, in an intestinal sample of a human subject as biomarker for the differential diagnosis of IBD phenotypes, wherein the abundance of PHGI and/or PHGII in an intestinal sample from said subject is determined according to the method of the invention.
In a particular embodiment, relates to the use of Faecalibacterium prausnitzii members (total FP) abundance, Faecalibacterium prausnitzii phylogroup I members (PHGI) abundance and/or Faecalibacterium prausnitzii phylogroup II members (PHGII) abundance determined in an intestinal sample of a human subject; and/or a mathematical combination thereof as biomarker for the differential diagnosis of inflammatory bowel disease (IBD) phenotypes. The determination of total FP, PGHI and/or PGHII abundance in an intestinal sample is performed in vitro. Further details and preferred embodiments on IBD phenotypes are provided above. In a preferred embodiment, said IBD phenotypes are selected from the group consisting of:
Ulcerative Colitis (UC) phenotypes consisting of ulcerative proctitis (UC-E1 ), distal colitis (UC-E2) and extensive UC or pancolitis (UC-E3); and
- Crohn's disease (CD) phenotypes consisting of ileal CD (l-CD), ileocolonic CD (IC-CD) and colonic CD (C-CD).
In a preferred embodiment, the abundance of PHGI, the abundance of PHGII and/or a mathematical combination thereof is used as biomarker. In a further preferred embodiment, a mathematical combination of PHGI and PHGII abundance is used as biomarker, preferably wherein the ratio between the PHGII and the PHGI abundance (PHGII/PHGI ratio) is used as biomarker.
In another preferred embodiment, said target microorganism abundance determination is performed by gene quantification with a molecular method selected from the group consisting of quantitative Polymerase Chain Reaction (qPCR), PCR-pyrosequencing, fluorescence in-situ hybridization (FISH), microarrays, and PCR-ELISA, preferably quantification is performed by qPCR.
In a further preferred embodiment, wherein said target microorganism abundance determination is carried out by 16S rRNA gene quantification.
In yet another preferred embodiment, said intestinal sample is a feces sample.
Additional details and other preferred embodiments on the use of total FP, PHGI and/or PHGII abundance in an intestinal sample of a human subject as biomarker for the differential diagnosis of inflammatory bowel disease (IBD) phenotypes are as provided for the previous aspects of the invention.
A KIT FOR THE DIFFERENTIAL DIAGNOSIS OF INFLAMMATORY BOWEL DISEASE (IBD) PHENOTYPES
In one more aspect of the invention relates to a kit for the differential diagnosis of inflammatory bowel disease (IBD) phenotypes according to a method of any of the sixth to eight aspects, comprising:
- a reagent for determining the abundance of a target microorganism selected from the group consisting of Faecalibacterium prausnitzii members (total FP), Faecalibacterium prausnitzii phylogroup I members (PHGI), and Faecalibacterium prausnitzii phylogroup II members (PHGII); and instructions for use of said reagent(s) to determine the abundance levels of said target microorganism from a human intestinal sample.
In a preferred embodiment, said intestinal sample is a feces sample.
In another preferred embodiment, said reagent for determining PHGI abundance is selected from the group consisting of:
- a pair of nucleic acid primers consisting of oligonucleotide sequences SEQ ID NO: 1 and SEQ ID NO: 2 or an oligonucleotide sequence with at least 75% identity thereof, and/or - a probe consisting of oligonucleotide sequence SEQ ID NO: 3 or an oligonucleotide sequence with at least 75% of identity thereof.
In a further preferred embodiment, said reagent for determining PHGII abundance is selected from the group consisting of: - a pair of nucleic acid primers consisting of oligonucleotide sequences SEQ ID NO: 1 and SEQ ID NO: 2 or an oligonucleotide sequence with at least 75% identity thereof, and/or
- a probe consisting of oligonucleotide sequence SEQ ID NO: 4 or an oligonucleotide sequence with at least 75% identity thereof.
In yet another preferred embodiment, said reagent for determining total FP abundance is selected from the group consisting of:
- a pair of nucleic acid primers consisting of oligonucleotide sequences SEQ ID NO: 5 and SEQ ID NO: 6 or an oligonucleotide sequence with at least 75% identity thereof, and/or
- a probe consisting of oligonucleotide sequence SEQ ID NO: 7 or an oligonucleotide sequence with at least 75% identity thereof.
In an additionally preferred embodiment, said kit further comprises a reference reagent for normalizing data, preferably wherein said reagent are primers and/or a probe for the quantification of total bacteria.
Additional details and other preferred embodiments on a kit for the differential diagnosis of inflammatory bowel disease (IBD) phenotypes are as provided for the previous aspects of the invention.
ITEMS related to the method for detecting intestinal disease in a human subject
1. A method for detecting intestinal disease in a human subject comprising the following steps: a. determining the abundance of Faecalibacterium prausnitzii phylogroup I members (PHGI) in an intestinal sample from said subject;
b. optionally, determining the abundance of Faecalibacterium prausnitzii phylogroup II members (PHGII) in an intestinal sample from said subject; and
c. comparing the PHGI abundance, optionally the PHGII abundance and/or a mathematical combination thereof, in the subject sample with the corresponding values in a reference sample, wherein a significant deviation in the subject sample values with regard to said reference sample is indicative of intestinal disease.
2. The method according to item 1 , comprising the following steps:
a. determining the abundance of PHGI in an intestinal sample from said subject; and b. comparing the subject sample abundance levels with the levels in a reference sample, wherein a significant reduction of abundance levels in the subject sample with regard to said reference sample is indicative of intestinal disease.
3. The method according to item 1 , comprising the following steps:
a. determining the abundance of PHGI in an intestinal sample from said subject; b. determining the abundance of PHGII in an intestinal sample from said subject; and c. comparing the PHGI abundance, the PHGII abundance and/or a mathematical combination thereof, in the subject sample with the corresponding values in a reference sample, wherein a significant deviation in the subject sample values with regard to said reference sample is indicative of intestinal disease,
wherein preferably the ratio between the PHGII abundance and the PHGI abundance (PHGII/PHGI ratio) is determined; and the PHGII/PHGI ratio in said subject sample is compared with the PHGII/PHGI ratio in a reference sample.
4. The method according to any of items 1 to 3, wherein said method is used for the screening, for the diagnosis, for monitoring progression, for monitoring relapses, and/or for monitoring postsurgical recurrence of intestinal disease, and/or for determining efficacy of a treatment on intestinal disease; preferably for the screening and/or diagnosis of intestinal disease.
5. The method according to any of items 1 to 4, wherein PHGI and/or PHGII abundance determination is performed by gene quantification with a molecular method selected from the group consisting of quantitative Polymerase Chain Reaction (qPCR), PCR-pyrosequencing, fluorescence in-situ hybridization (FISH), microarrays, and PCR-ELISA, preferably quantification is performed by qPCR.
6. The method according to any of items 1 to 5, wherein PHGI and/or PHGII abundance determination is carried out by 16S rRNA gene quantification.
7. The method according to any of items 1 to 6, wherein PHGI abundance determination is carried out by quantifying a Faecalibacterium prausnitzii 16S rRNA gene sequence comprising or consisting of SEQ ID NO: 3. 8. The method according to any of items 1 to 7, wherein PHGI 16S rRNA gene quantification is performed with primers consisting of oligonucleotide sequences SEQ ID NO: 1 and SEQ ID NO: 2 or a sequence with at least 75% identity thereof; and/or a probe consisting of oligonucleotide sequence SEQ ID NO: 3 or a sequence with at least 75% identity thereof. 9. The method according to any of items 1 to 8, wherein PHGI 16S rRNA gene quantification is performed with primers consisting of oligonucleotide sequences SEQ ID NO: 1 and SEQ ID NO: 2, and a probe consisting of oligonucleotide sequence SEQ ID NO: 3.
10. The method according to any of items 1 to 9, wherein PHGII abundance determination is carried out by quantifying a Faecalibacterium prausnitzii 16S rRNA gene sequence comprising or consisting of SEQ ID NO: 4.
1 1. The method according to any of items 3 to 10, wherein PHGII 16S rRNA gene quantification is performed with primers consisting of oligonucleotide sequences SEQ ID NO: 1 and SEQ ID NO: 2 or a sequence with at least 75% identity thereof; and/or a probe consisting of oligonucleotide sequence SEQ ID NO: 4 or a sequence with at least 75% identity thereof. The method according to any of items 3 to 1 1 , wherein PHGII 16S rRNA gene quantification is performed with primers consisting of oligonucleotide sequences SEQ ID NO: 1 and SEQ ID NO: 2, and a probe consisting of oligonucleotide sequence SEQ ID NO: 4. The method according to any of items 5 to 12, wherein DNA is extracted from the intestinal sample prior to PHGI and/or PHGII gene quantification. The method according to any of items 1 to 13, wherein the PHGI and/or PHGII abundance levels are normalized, preferably wherein normalization is carried out with respect to total bacteria quantification. The method according to any of items 1 to 14, wherein said intestinal sample is a feces sample. The method according to any of items 1 to 15, wherein said reference sample is a healthy subject sample and/or the sample of a patient with intestinal disease in remission, preferably a sample of the same subject in remission. The method according to any of items 1 to 16, wherein said an intestinal disease is IBD, preferably wherein said IBD is Ulcerative colitis (UC) or Crohn's disease (CD), more preferably wherein said IBD is CD. The method according to any of items 1 to 17, wherein PHGI abundance is determined and a significant reduction of PHGI abundance levels in the subject sample with regard to said reference sample is indicative of CD, preferably of CD with ileal involvement (IC-CD or l-CD). The method according to any of items 1 to 18, wherein the PHGII/PHGI ratio is determined and a significant deviation in the subject sample values with regard to said reference sample is indicative of CD, preferably of CD with colonic involvement (C-CD or IC-CD). The method according to any of items 1 to 19, wherein said method further comprises detecting and/or quantifying one or more biomarkers of intestinal disease, preferably of IBD. The method according to any of items 1 to 20, wherein said method further comprises combining the results of PHGI abundance, PHGII abundance and/or said further biomarkers detection and/or quantification with other indicators of intestinal disease, preferably of IBD. The method according to any of items 1 to 21 , wherein said method further comprises storing the method results in a data carrier, preferably wherein said data carrier is a computer readable medium. Use of Faecalibacterium prausnitzii phylogroup I members (PHGI) abundance in an intestinal sample of a human subject as biomarker for the detection of intestinal disease. The use according to item 23, for the screening, for the diagnosis, for monitoring progression, for monitoring relapses, and/or for monitoring postsurgical recurrence of an intestinal disease, and/or for determining efficacy of a treatment on an intestinal disease; preferably for the screening or diagnosis of an intestinal disease. The use according to any of items 23 or 24, wherein PHGI abundance is used in combination with Faecalibacterium prausnitzii phylogroup II members (PHGII) abundance in an intestinal sample of said human subject, preferably wherein the ratio between the PHGII abundance and the PHGI abundance (PHGII/PHGI ratio) is determined. The use according to any of items 23 to 25, wherein PHGI and/or PHGII abundance determination is performed by gene quantification with a molecular method selected from the group consisting of quantitative Polymerase Chain Reaction (qPCR), PCR-pyrosequencing, fluorescence in-situ hybridization (FISH), microarrays, and PCR-ELISA, preferably quantification is performed by qPCR. The use according to any of items 23 to 26, wherein PHGI and/or PHGII abundance determination is carried out by 16S rRNA gene quantification. The use according to any of items 23 to 27, wherein said intestinal sample is a feces sample. The use according to any of items 23 to 28, wherein said intestinal disease is IBD, preferably wherein said IBD is Ulcerative colitis (UC) or Crohn's disease (CD), more preferably wherein said IBD is CD. A kit for detecting an intestinal disease according to a method of any of items 1 to 22, comprising: o a reagent for determining the abundance of Faecalibacterium prausnitzii phylogroup I members (PHGI);
o optionally, a reagent for determining the abundance of Faecalibacterium prausnitzii phylogroup II members (PHGII); and
o instructions for use of said reagent(s) to determine the abundance levels of PHGI, and optionally PHGII, from a human intestinal sample,
wherein preferably said intestinal sample is a feces sample. The kit according to item 30, for the screening, for the diagnosis, for monitoring progression, for monitoring relapses, and/or for monitoring postsurgical recurrence of an intestinal disease, and/or for determining efficacy of a treatment on an intestinal disease; preferably for the screening or diagnosis of an intestinal disease. The kit according to any of items 30 or 31 , wherein said reagent for determining PHGI abundance is selected from the group consisting of: o a pair of nucleic acid primers consisting of oligonucleotide sequences SEQ ID NO: 1 and SEQ ID NO: 2 or an oligonucleotide sequence with at least 75% identity thereof, and/or o a probe consisting of oligonucleotide sequence SEQ ID NO: 3 or an oligonucleotide sequence with at least 75% of identity thereof.
33. The kit according to any of items 30 to 32, wherein said reagent for determining PHGII abundance is selected from the group consisting of:
o a pair of nucleic acid primers consisting of oligonucleotide sequences SEQ ID NO: 1 and SEQ ID NO: 2 or an oligonucleotide sequence with at least 75% identity thereof, and/or o a probe consisting of oligonucleotide sequence SEQ ID NO: 4 or an oligonucleotide sequence with at least 75% identity thereof.
34. The kit according to any of items 30 to 33, further comprising a reference reagent for normalizing data, preferably wherein said reagent are primers and/or a probe for the quantification of total bacteria.
35. The kit according to any of items 30 to 34, wherein said intestinal disease is IBD, preferably wherein said IBD is Ulcerative colitis (UC) or Crohn's disease (CD), more preferably wherein said IBD is CD.
36. A nucleic acid sequence selected from the group consisting of SEQ ID NO: 1 , SEQ ID NO: 2, SEQ ID NO: 3, and SEQ ID NO: 4 or an oligonucleotide sequence with at least 75% identity thereof. 37. A method for determining the abundance of Faecalibacterium prausnitzii phylogroup I members
(PHGI) and/or the abundance of Faecalibacterium prausnitzii phylogroup II members (PHGII) in an intestinal sample from a subject wherein said determination is carried out by 16S rRNA gene quantification, wherein PHGI abundance determination is carried out by quantifying a Faecalibacterium prausnitzii 16S rRNA gene sequence comprising or consisting of SEQ ID NO: 3, and wherein PHGII abundance determination is carried out by quantifying a Faecalibacterium prausnitzii 16S rRNA gene sequence comprising or consisting of SEQ ID NO: 4.
38. The method according to item 37, wherein 16S rRNA gene quantification is carried out with a molecular method selected from the group consisting of quantitative Polymerase Chain Reaction (qPCR), PCR-pyrosequencing, fluorescence in-situ hybridization (FISH), microarrays, and PCR-
ELISA, preferably quantification is performed by qPCR.
39. The method according to any of items 37 or 38, wherein PHGI 16S rRNA gene quantification is performed with primers consisting of oligonucleotide sequences SEQ ID NO: 1 and SEQ ID NO: 2 or a sequence with at least 75% identity thereof; and/or a probe consisting of oligonucleotide sequence SEQ ID NO: 3 or a sequence with at least 75% identity thereof. 40. The method according to any of items 37 to 39, wherein PHGI 16S rRNA gene quantification is performed with primers consisting of oligonucleotide sequences SEQ ID NO: 1 and SEQ ID NO: 2, and a probe consisting of oligonucleotide sequence SEQ ID NO: 3.
41. The method according to any of items 37 to 40, wherein PHGII 16S rRNA gene quantification is performed with primers consisting of oligonucleotide sequences SEQ ID NO: 1 and SEQ ID NO: 2 or a sequence with at least 75% identity thereof; and/or a probe consisting of oligonucleotide sequence SEQ ID NO: 4 or a sequence with at least 75% identity thereof.
42. The method according to any of items 37 to 41 , wherein PHGII 16S rRNA gene quantification is performed with primers consisting of oligonucleotide sequences SEQ ID NO: 1 and SEQ ID NO: 2, and a probe consisting of oligonucleotide sequence SEQ ID NO: 4.
43. The method according to any of items 37 to 42, wherein DNA is extracted from the intestinal sample prior to PHGI and PHGII gene quantification.
44. The method according to any of items 37 to 43, wherein the PHGI and/or PHGII abundance levels are normalized, preferably wherein normalization is carried out with respect to total bacteria quantification.
45. The method according to any of items 37 to 44, wherein said intestinal sample is a feces sample.
ITEMS related to the method for the differential diagnosis of inflammatory bowel disease (IBD) phenotypes
A method for the differential diagnosis of inflammatory bowel disease (IBD) phenotypes in a human subject comprising the following steps: i. determining the abundance of a target microorganism in an intestinal sample from said subject, wherein said target microorganism is selected from the group consisting of Faecalibacterium prausnitzii members (total FP), Faecalibacterium prausnitzii phylogroup I members (PHGI) and Faecalibacterium prausnitzii phylogroup II members (PHGII); and ii. comparing the subject sample abundance of one or more of said target microorganisms and/or a mathematical combination thereof, with the corresponding values in a reference sample of the IBD phenotypes to be distinguished from to determine the IBD phenotype the subject is suffering from; wherein the subject sample presenting values significantly similar to one of said IBD phenotypes will be indicative that the subject is suffering from said IBD phenotype; and
wherein said IBD phenotypes are defined by at least the combination of two, preferably three, of the following parameters:
- disease location; IBD type; and
- age at diagnosis,
optionally, comprising the use of additional biomarkers for the definition of said IBD phenotypes. 2. The method according to item 1 , wherein said IBD phenotypes are selected from the group consisting of:
- CD phenotypes defined by one or more, preferably all, of the following parameters:
o disease location;
o age at diagnosis; and
o behavior;
UC phenotypes defined by one or more, preferably all, of the following parameters:
o disease location or extent; and
o severity. 3. The method according to any of items 1 or 2, wherein said IBD phenotypes are selected from the group consisting of:
- CD phenotypes consisting of ileal CD (l-CD), ileocolonic CD (IC-CD) and colonic CD (C-CD); and
UC phenotypes consisting of ulcerative proctitis (UC-E1 ), distal colitis (UC-E2) and extensive UC or pancolitis (UC-E3).
4. The method according to any of items 1 to 3, wherein said target microorganism is selected from the group consisting of PHGI and PHGII. 5. The method according to any of items 1 to 4, wherein the ratio between the PHGII abundance and the PHGI abundance (PHGII/PHGI ratio) is determined; and the PHGII/PHGI ratio in said subject sample is compared with the PHGII/PHGI ratio in a reference sample.
6. The method according to any of items 1 to 5, wherein said IBD phenotypes are UC-E3 and C-CD and the subject sample values are compared with a UC-E3 positive reference sample and/or a C-CD positive reference sample, wherein the subject sample presenting values significantly similar to UC- E3 or C-CD will be indicative that the subject is suffering from said IBD phenotype.
7. The method according to item 6, wherein said human subject has previously been diagnosed of IBD with colonic involvement.
8. The method according to any of items 6 or 7, wherein said target microorganism is the PHGII.
9. A method for diagnosing C-CD in a human subject suffering from IBD with colonic involvement comprising the following steps: i. determining the abundance of a target microorganism in an intestinal sample from said subject, wherein said target microorganism is selected from the group consisting of Faecalibacterium prausnitzii members (total FP), Faecalibacterium prausnitzii phylogroup I members (PHGI) and Faecalibacterium prausnitzii phylogroup II members (PHGII); and ii. comparing the subject sample abundance levels with the levels in a reference sample, wherein a significant reduction of abundance levels in the subject sample with regard to said reference sample is indicative of C-CD,
wherein preferably said target microorganism is the PHGII. 10. The method according to item 9, wherein said reference sample is a sample of a healthy subject and/or a sample of a patient with IBD in remission, preferably a sample of the same subject in remission.
1 1. The method according to any of items 1 to 5, wherein said IBD phenotypes are selected from the group consisting of l-CD, C-CD and IC-CD and the subject sample values are compared with an l-CD positive reference sample, a C-CD positive reference sample and/or a IC-CD positive reference sample, wherein the subject sample presenting values significantly similar to l-CD, C-CD or IC-CD will be indicative that the subject is suffering from said IBD phenotype. 12. The method according to item 1 1 , for determining extension of the disease to the colonic area (IC- CD) in a human subject who has previously been diagnosed with l-CD.
13. The method according to item 12, wherein said target microorganism is the PHGII.
The method according to item 13, for determining extension of the disease to the ileal area (IC-CD) a human subject who has previously been diagnosed with C-CD.
15. The method according to item 14, wherein said target microorganism is the PHGII.
16. A method for diagnosing IC-CD in a human subject suffering from l-CD or C-CD comprising the following steps:
i. determining the abundance of a target microorganism in an intestinal sample from said subject, wherein said target microorganism is selected from the group consisting of Faecalibacterium prausnitzii members (total FP), Faecalibacterium prausnitzii phylogroup I members (PHGI) and Faecalibacterium prausnitzii phylogroup II members (PHGII); and ii. comparing the subject sample PHGII abundance levels with the levels in a reference sample from said subject at around diagnose of l-CD or C-CD, wherein a significant reduction of abundance levels in the subject sample with regard to said reference sample is indicative of IC-CD,
wherein preferably, said target microorganism is the PHGII. The method according to any of items 1 to 16, wherein said target microorganism abundance determination is performed by gene quantification with a molecular method selected from the group consisting of quantitative Polymerase Chain Reaction (qPCR), PCR-pyrosequencing, fluorescence in- situ hybridization (FISH), microarrays, and PCR-ELISA, preferably quantification is performed by qPCR. The method according to any of items 1 to 17, wherein said target microorganism abundance determination is carried out by 16S rRNA gene quantification. The method according to any of items 1 to 18, wherein PHGI abundance determination is carried out by quantifying a Faecalibacterium prausnitzii 16S rRNA gene sequence comprising or consisting of SEQ ID NO: 3. The method according to any of items 1 to 19, wherein PHGI 16S rRNA gene quantification is performed with primers consisting of oligonucleotide sequences SEQ ID NO: 1 and SEQ ID NO: 2 or a sequence with at least 75% identity thereof; and/or a probe consisting of oligonucleotide sequence SEQ ID NO: 3 or a sequence with at least 75% identity thereof. The method according to any of items 1 to 20, wherein PHGI 16S rRNA gene quantification is performed with primers consisting of oligonucleotide sequences SEQ ID NO: 1 and SEQ ID NO: 2, and a probe consisting of oligonucleotide sequence SEQ ID NO: 3. The method according to any of items 1 to 21 , wherein PHGII abundance determination is carried out by quantifying a Faecalibacterium prausnitzii 16S rRNA gene sequence comprising or consisting of SEQ ID NO: 4. The method according to any of items 1 to 22, wherein PHGII 16S rRNA gene quantification is performed with primers consisting of oligonucleotide sequences SEQ ID NO: 1 and SEQ ID NO: 2 or a sequence with at least 75% identity thereof; and/or a probe consisting of oligonucleotide sequence SEQ ID NO: 4 or a sequence with at least 75% identity thereof. The method according to any of items 1 to 23, wherein PHGII 16S rRNA gene quantification is performed with primers consisting of oligonucleotide sequences SEQ ID NO: 1 and SEQ ID NO: 2, and a probe consisting of oligonucleotide sequence SEQ ID NO: 4. The method according to any of items 1 to 24, wherein total FP 16S rRNA gene quantification is performed with primers consisting of oligonucleotide sequences SEQ ID NO: 5 and SEQ ID NO: 6 or a sequence with at least 75% identity thereof; and/or a probe consisting of oligonucleotide sequence SEQ ID NO: 7 or a sequence with at least 75% identity thereof. 26. The method according to any of items 1 to 25, wherein total FP 16S rRNA gene quantification is performed with primers consisting of oligonucleotide sequences SEQ ID NO: 5 and SEQ ID NO: 6, and a probe consisting of oligonucleotide sequence SEQ ID NO: 7. 27. The method according to any of items 1 to 26, wherein DNA is extracted from the intestinal sample prior to the target microorganism gene quantification.
28. The method according to any of items 1 to 27, wherein said intestinal sample is a feces sample. 29. The method according to any of items 1 to 28, wherein the target abundance levels are normalized, preferably wherein normalization is carried out with respect to total bacteria quantification.
30. The method according to any of items 1 to 29, wherein said method further comprises detecting and/or quantifying one or more biomarkers of intestinal disease, preferably of IBD.
31. The method according to any of items 1 to 30, wherein said method further comprises combining the results of the target microorganism quantification and/or said further biomarkers detection and/or quantification with clinical signs and/or symptoms which are independent predictors of IBD. 32. The method according to any of items 1 to 31 , wherein said method further comprises storing the method results in a data carrier, preferably wherein said data carrier is a computer readable medium.
33. A method for the prognosis of inflammatory bowel disease (IBD) which comprises the determination of an IBD phenotype according to a method for the differential diagnosis of any of items 1 to 32 and establishing prognosis according to the determined IBD phenotype.
34. Use of Faecalibacterium prausnitzii members (total FP) abundance, Faecalibacterium prausnitzii phylogroup I members (PHGI) abundance and/or Faecalibacterium prausnitzii phylogroup II members (PHGII) abundance determined in an intestinal sample of a human subject; and/or a mathematical combination thereof as biomarker for the differential diagnosis of inflammatory bowel disease (IBD) phenotypes as defined in any of items 1 to 3.
35. The use according to item 34; wherein said IBD phenotypes are selected from the group consisting of:
- Ulcerative Colitis (UC) phenotypes consisting of ulcerative proctitis (UC-E1 ), distal colitis
(UC-E2) and extensive UC or pancolitis (UC-E3); and
- Crohn's disease (CD) phenotypes consisting of ileal CD (l-CD), ileocolonic CD (IC-CD) and colonic CD (C-CD).
The use according to any of items 34 or 35, wherein the abundance of PHGI, the abundance of PHGII and/or a mathematical combination thereof is used as biomarker. The use according to any of items 34 to 36, wherein a mathematical combination of PHGI and PHGII abundance is used as biomarker, preferably wherein the ratio between the PHGII and the PHGI abundance (PHGII/PHGI ratio) is used as biomarker. The use according to any of items 34 to 37, wherein said target microorganism abundance determination is performed by gene quantification with a molecular method selected from the group consisting of quantitative Polymerase Chain Reaction (qPCR), PCR-pyrosequencing, fluorescence in- situ hybridization (FISH), microarrays, and PCR-ELISA, preferably quantification is performed by qPCR. The use according to any of items 34 to 38, wherein said target microorganism abundance determination is carried out by 16S rRNA gene quantification. The use according to any of items 34 to 39, wherein said intestinal sample is a feces sample. A kit for the differential diagnosis of inflammatory bowel disease (IBD) phenotypes according to a method of any of items 1 to 33, comprising:
- a reagent for determining the abundance of a target microorganism selected from the group consisting of Faecalibacterium prausnitzii members (total FP), Faecalibacterium prausnitzii phylogroup I members (PHGI), and Faecalibacterium prausnitzii phylogroup II members (PHGII); and
instructions for use of said reagent(s) to determine the abundance levels of said target microorganism from a human intestinal sample. The kit according to item 41 , wherein said intestinal sample is a feces sample. The kit according to any of items 41 or 42, wherein said reagent for determining PHGI abundance is selected from the group consisting of:
- a pair of nucleic acid primers consisting of oligonucleotide sequences SEQ ID NO: 1 and SEQ ID NO: 2 or an oligonucleotide sequence with at least 75% identity thereof, and/or
- a probe consisting of oligonucleotide sequence SEQ ID NO: 3 or an oligonucleotide sequence with at least 75% of identity thereof. The kit according to any of items 41 to 43, wherein said reagent for determining PHGII abundance is selected from the group consisting of:
- a pair of nucleic acid primers consisting of oligonucleotide sequences SEQ ID NO: 1 and SEQ ID NO: 2 or an oligonucleotide sequence with at least 75% identity thereof, and/or
- a probe consisting of oligonucleotide sequence SEQ ID NO: 4 or an oligonucleotide sequence with at least 75% identity thereof. The kit according to any of items 41 to 44, wherein said reagent for determining total FP abundance is selected from the group consisting of:
- a pair of nucleic acid primers consisting of oligonucleotide sequences SEQ ID NO: 5 and SEQ ID NO: 6 or an oligonucleotide sequence with at least 75% identity thereof, and/or
- a probe consisting of oligonucleotide sequence SEQ ID NO: 7 or an oligonucleotide sequence with at least 75% identity thereof.
The kit according to any of items 41 to 45, further comprising a reference reagent for normalizing data, preferably wherein said reagent are primers and/or a probe for the quantification of total bacteria.
It is contemplated that any embodiment discussed in this specification can be implemented with respect to any method, kit, reagent, or use of the invention, and vice versa. It will be understood that particular embodiments described herein are shown by way of illustration and not as limitations of the invention. The principal features of this invention can be employed in various embodiments without departing from the scope of the invention. Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, numerous equivalents to the specific procedures described herein. Such equivalents are considered to be within the scope of this invention and are covered by the claims. All publications and patent applications mentioned in the specification are indicative of the level of skill of those skilled in the art to which this invention pertains. All publications and patent applications are herein incorporated by reference to the same extent as if each individual publication or patent application was specifically and individually indicated to be incorporated by reference. The use of the word "a" or "an" when used in conjunction with the term "comprising" in the claims and/or the specification may mean "one," but it is also consistent with the meaning of "one or more," "at least one," and "one or more than one." The use of the term "or" in the claims is used to mean "and/or" unless explicitly indicated to refer to alternatives only or the alternatives are mutually exclusive, although the disclosure supports a definition that refers to only alternatives and "and/or." Throughout this application, the term "about" is used to indicate that a value includes the inherent variation of error for the device, the method being employed to determine the value, or the variation that exists among the study subjects.
As used in this specification and claim(s), the words "comprising" (and any form of comprising, such as "comprise" and "comprises"), "having" (and any form of having, such as "have" and "has"), "including" (and any form of including, such as "includes" and "include") or "containing" (and any form of containing, such as "contains" and "contain") are inclusive or open-ended and do not exclude additional, unrecited elements or method steps. As used herein, the phrase "consisting essentially of limits the scope of a claim to the specified materials or steps and those that do not materially affect the basic and novel characteristic(s) of the claimed invention. As used herein, the phrase "consisting of excludes any element, step, or ingredient not specified in the claim except for, e.g., impurities ordinarily associated with the element or limitation. The term "or combinations thereof as used herein refers to all permutations and combinations of the listed items preceding the term. For example, "A, B, C, or combinations thereof is intended to include at least one of: A, B, C, AB, AC, BC, or ABC, and if order is important in a particular context, also BA, CA, CB, CBA, BCA, ACB, BAC, or CAB. Continuing with this example, expressly included are combinations that contain repeats of one or more item or term, such as BB, AAA, AB, BBC, AAABCCCC, CBBAAA, CABABB, and so forth. The skilled artisan will understand that typically there is no limit on the number of items or terms in any combination, unless otherwise apparent from the context. As used herein, words of approximation such as, without limitation, "about", "around", "approximately" refers to a condition that when so modified is understood to not necessarily be absolute or perfect but would be considered close enough to those of ordinary skill in the art to warrant designating the condition as being present. The extent to which the description may vary will depend on how great a change can be instituted and still have one of ordinary skilled in the art recognize the modified feature as still having the required characteristics and capabilities of the unmodified feature. In general, but subject to the preceding discussion, a numerical value herein that is modified by a word of approximation such as "about" may vary from the stated value by at least ±1 , 2, 3, 4, 5, 6, 7, 10, 12 or 15%.
EXAMPLES
Example 1. Materials and methods of F. prausnitzii phylogroups quantification in biopsy samples
1. Patients, clinical data and sampling.
A Spanish cohort consisting of 70 IBD (45 CD and 25 UC), 10 IBS, 20 CRC patients, and 31 H was enrolled (Table 13).
Subjects were recruited by the Gastroenterology Services of the Hospital Universitari Dr. Josep Trueta (Girona, Spain) and the Hospital Santa Caterina (Salt, Spain). Subjects were gender matched for all the groups. Concerning age, CD patients were younger than those in the H group (P<0.001 ), whereas CRC patients were significantly older than all the other groups (P<0.019). IBD patients were diagnosed according to standard clinical, pathological and endoscopic criteria and categorized according to the Montreal classification (Silverberg et al., Can J Gastroenterol. 2005, 19 Suppl A:5-36). IBS patients were diagnosed according to Rome III criteria (available at <http://www.romecriteria.org/criteria/>). The diagnosis of CRC was established by colonoscopy and biopsy, and data correlated with high risk of developing this disease was recorded. The control group consisted of subjects undergoing colonoscopy for different reasons as rectorrhagia (N=9), colorectal cancer familial history (N=1 1 ), and abdominal pain (N=1 1 ). Clinically relevant data of all the patients was collected. None of the subjects received antimicrobial treatment for at least two months before colonoscopy.
Prior to colonoscopy, patients were subjected to cleansing of the gastrointestinal tract using Casenglicol® following manufacturer's guidelines. During routine endoscopy, up to three biopsy samples per patient were taken from different locations along the gut (distal ileum, colon, and rectum) following standard procedures. All biopsies were immediately placed in sterile tubes without any buffer and stored at -80 °C following completion of the whole endoscopic procedure and upon analysis.
This work was approved by the Ethics Committee of Clinical Research of the Hospital Universitari Dr. Josep Trueta (Girona, Spain) and the Institut d'Assistencia Sanitaria of Girona (Salt, Spain) on 24th February 2009 and 21st April 2009, respectively. Informed consent from the subjects was obtained before enrollment.
Table 13. Sample size and clinical characteristics of subjects
Irritable bowel
Healthy* IBD Colorectal
syndrome Crohn's disease Ulcerative colitis cancer p value5
N (patients) 31 10 45 25 20
Age (mean years ± SO) 48.1+16.3 42.4+11.4 33 5:11.1 40 1:15 8 58 6:7 52 <0.001*
Male (N. %) 16 (51 6%) 2 (20 0%) 26 (57,7%) 16 i'64 0%) 14 (70 0%) 0 605'
Active (N. %) na na 28 (62 2%) 20 (80.0%) na 0 059-
Previous surgery (N. %) 0 nd 9 (20 0%) 1 (4.0%) nd 0 049' Smokers (N. %) 0 0 8 (17 8%) 2 (8 0%) 5 (25 0%) 0 327'
Treatment (N, %) " 0 087·
No treatment 12 (26.7%) 13 (52.0%)
esalazine na na 3 (6 7%) 3 (12.0%) na
Moderate immunosuppressant na na 16 (35.5%) 3 (12.0%) na
Anti-TNFa (infliximab, adalimumab) na na 10 (22.2%) 4 (16 0%) na
CO Montreal classification
Age of diagnosis (N, %) " 0.257* d.ag < 16v (A1) na na 5 (11 1%) 1 (4 0%) nd
diag 174% (A2) na na 33 (73.3%) 13 (52.0%) nd
diag >41y (A3) na na 5 (11 1%) 8 (32.0%) nd
Location (N. %) na lleal-CD (L1) na na 19 (42 2%) na na
Colonic-CD (12) na na 11 (24.4%) na na
lleocolonic-CD (L3) na na 14 (31 1%) na na
Behavior (N, %) " na
Non-stnctunng, non-penetrating (B1) na na 30 (66 7%) na na
Strictunng (B2) na na 9 (20 0%) na na
UC classification (N. %) " na
Ulcerative proctitis (E1) na na na 6 (24 0%) na
Distal UC (E2) na na na 11 (44.0%1 na
Extensive UC or ulcerative pancolitis (E3) na na na 6 (24.0%) na
IBS subtype (N, %) ** na
Diarrhea predominant type na 2 (20.0%) na na na
Constipation predominant type na 2 (20.0%) na na na
CRC subtype (N. %) " na
Sporadic na na na na 14 (70 0%)
Heredrtary- na na na na 3 (15.0%)
"Controls consisted of subjects who underwent colonoscopy for different reasons 3/31 rectorrhagta. 11/31 colorectal cancer famiial history and 11/31 abdominal pain
** Medical treatment at the time of sampling was available in 41/45 CD patients, and 23/25 UC patients Age of disease onset was available for 43/45 CD patients, and 22/25 UC patients; Disease behavior at last follow-up before the time of sampling was available in 39/45 CD patients, and none had penetrating CD (B3); Maximal disease extent at the time of sampling was available in 23/25 UC patients disease subtype was available in 4/10 irritable bowel syndrome patents, and none had alternating predominant type: presence or absence of relatives with CRC could only be clearly tracked in 17/20 CRC patients
""Patients were included within this category if a first grade relative has had also CRC
S Groups were compared by non-parametric statistical tests, and p value s0 05 was considered significant. * ¾a test .3 Mann-Whitney U test
2. Sample treatment and DNA extraction.
Prior to DNA extraction, biopsies were subjected to two mild ultrasound wash cycles to discard transient and loosely attached bacteria as previously reported (34). DNA was extracted using the NucleoSpin® Tissue Kit (Macherey-Nagel GmbH &Co., Duren, Germany). The support protocol for Gram positive bacteria and the RNAse treatment step were carried out. Genomic DNA was eluted with 10mM Tris-HCI (pH 7.4) and stored at -80 °C until use. DNA concentration and purity of the extracts were determined with a NanoDrop ND-100 spectrophotometer (NanoDrop Technologies, USA).
3. Primers and hydrolysis probes design, and set up of a PCR assay for F. prausnitzii phyloq roups.
In order to simultaneously quantify both F. prausnitzii phylogroups, a qPCR assay consisting of a unique pair of species-specific primers for F. prausnitzii and two hydrolysis probes targeting each F. prausnitzii phylogroup was designed.
Sequences of the 16S rRNA gene from F. prausnitzii and from closely related Ruminococcaceae were recovered from GenBank (Table 14) and aligned using Clustal W (Thompson JD et al. Nucleic Acids Res. 1994;22:4673-4680). Both primers and hydrolysis probes were manually designed, from consensus sequences (Table 14) specifically built for each purpose, following the guidelines set by Applied Biosystems (Foster City, CA, USA) for the design of primers and probes for allelic discrimination, and further checked using the software Primer Express® version 3.0 (Applied Biosystems, Foster City, CA, USA). Oligonucleotides were also evaluated using NetPrimer® software (PREMIER Biosoft International, California, USA) to check for primer-dimer structures, hairpins and possible cross dimer interactions. Resulting primers and probes are listed in Table 15.
Table 14. 16S rRNA gene sequences used to perform oligonucleotide design. GenBank accession numbers have been indicated. Sequences from F. prausnitzii isolates, related sequences recovered via molecular methods and sequences of the same gene from F. prausnitzii close relatives have been included.
Accession number Characteristics
AJ413954*1 Faecalibacterium prausnitzii 16S rRNA gene, strain ATCC 27768
X85022*1 F. prausnitzii DNA for 16S ribosomal RNA, strain ATCC 27766
AY305307*1 Butyrate-producing bacterium M21/2 16S ribosomal RNA gene
HQ457025*1 F. prausnitzii strain S4L/4 16S ribosomal RNA gene
HQ457024*1 F. prausnitzii strain S3L/3 16S ribosomal RNA gene
AJ270469*2 Butyrate-producing bacterium A2-165 16S rRNA gene
AJ270470*2 Butyrate-producing bacterium L2-6 16S rRNA gene
J N 037415*2 F. prausnitzii strain L2-15 16S ribosomal RNA gene
J N 037416*2 F. prausnitzii strain L2-39 16S ribosomal RNA gene
JN037417*2 F. prausnitzii strain L2-61 16S ribosomal RNA gene
HQ457026*2 F. prausnitzii strain HTF-A 16S ribosomal RNA gene
HQ457027*2 F. prausnitzii strain HTF-B 16S ribosomal RNA gene
HQ457028*2 F. prausnitzii strain HTF-C 16S ribosomal RNA gene
HQ457029*2 F. prausnitzii strain HTF-E 16S ribosomal RNA gene
HQ457030*2 F. prausnitzii strain HTF-F 16S ribosomal RNA gene
HQ457031*2 F. prausnitzii strain HTF-I 16S ribosomal RNA gene
HQ457032*2 F. prausnitzii strain HTF-60C 16S ribosomal RNA gene
HQ457033*2 F. prausnitzii strain HTF-75H 16S ribosomal RNA gene
AY169429* Faecalibacterium prausnitzii clone 1-84 16S ribosomal RNA gene, partial sequence Accession number Characteristics
AY169430* Faecalibacterium prausnitzii clone 1-88 16S ribosomal RNA gene, partial sequence
AY169427* Faecalibacterium prausnitzii clone 1-79 16S ribosomal RNA gene, partial sequence
AF132237* Uncultured bacterium adhufec13 16S ribosomal RNA gene, partial sequence
AF132236* Uncultured bacterium adhufec113 16S ribosomal RNA gene, partial sequence
AF132246* Uncultured bacterium adhufec218 16S ribosomal RNA gene, partial sequence
AF132265* Uncultured bacterium adhufec365 16S ribosomal RNA gene, partial sequence
Uncultured Faecalibacterium sp. clone FIRM8 16S ribosomal RNA gene, partial
AY494671* sequence
EF205929* Uncultured bacterium clone 46706
EF205662* Uncultured bacterium clone 58014
EF206222* Uncultured bacterium clone 56806
EF206249* Uncultured bacterium clone 57601
EF205881* Uncultured bacterium clone 35509
EF205761* Uncultured bacterium clone 59415
EF205681* Uncultured bacterium clone 58033
X98011 Anaerofilum agile 16S rRNA gene
X97852 Anaerofilum pentosovorans 16S rRNA gene
L09177 Clostridium cellulosi 16S ribosomal RNA (16S rRNA) gene
M59095 Clostridium leptum 16S ribosomal RNA
AJ305238 Clostridium leptum; DSM 753T
M59116 Clostridium sporosphaeroides 16S ribosomal RNA
X66002 Clostridium sporosphaeroides; DSM 1294
X81125 Clostridium viride 16S rRNA gene
L34618 Eubacterium desmolans 16S ribosomal RNA
L34625 Eubacterium siraeum 16S ribosomal RNA
AY445600 Ruminococcus albus strain 7 16S ribosomal RNA gene, complete
AY445594 Ruminococcus albus strain 8 16S ribosomal RNA gene, complete
AY445592 Ruminococcus albus strain B199 16S ribosomal RNA gene, complete
AY445596 Ruminococcus albus strain KF1 16S ribosomal RNA gene, complete
AY445602 Ruminococcus albus strain R013 16S ribosomal RNA gene, complete
X85099 Ruminococcus bromii 16S rRNA gene
L76600 Ruminococcus bromii small subunit ribosomal RNA (16S rDNA) gene
X85100 Ruminococcus callidus 16S rRNA gene
L76596 Ruminococcus callidus small subunit ribosomal RNA (16S rDNA)
AM915269 Ruminococcus flavefaciens partial 16S rRNA gene, type strain C94T=ATCC 19208
AF030449 Ruminococcus flavefaciens strain ATCC 49949 16S ribosomal RNA, partial sequence
AY445599 Ruminococcus flavefaciens strain B146 16S ribosomal RNA gene, complete sequence
AY445597 Ruminococcus flavefaciens strain FD1 16S ribosomal RNA gene, complete sequence
AY445595 Ruminococcus flavefaciens strain JM1 16S ribosomal RNA gene, complete sequence
AY445593 Ruminococcus flavefaciens strain C94 16S ribosomal RNA gene, complete sequence
AY445603 Ruminococcus flavefaciens strain LB4 16S ribosomal RNA gene, complete sequence
AY445601 Ruminococcus flavefaciens strain JF1 16S ribosomal RNA gene, complete sequence
Ruminococcus flavefaciens strain R13e2 16S ribosomal RNA gene, complete
AY445598 sequence
* Sequences used to obtain the F. prausnitzii 16S rRNA gene consensus sequence for oligonucleotides design Sequences used to obtain the F. prausnitzii phylogroup I 16S rRNA gene consensus sequence for specific hydrolysis probe design
2 Sequences used to obtain the F. prausnitzii phylogroup II 16S rRNA gene consensus sequence for specific hydrolysis probe design Table 15, 16S rRNA-targeted primers and probes used in this study.
Prl-nef and Probe® · PCR ccrcrtbns '
Target
Total _ _ , Annealhg end
RvVence
Figure imgf000080_0001
DMA IAC B iAC (18) 4© 95; 15 mm
CATGCCGCGTGTATC
Figure imgf000080_0002
18. Lopez-Siles M, Martinez-Medina M, Busquets D, et al. Mucosa-associated Faecalibacterium prausnitzii and Escherichia coli co-abundance can distinguish Irritable Bow Syndrome and Inflammatory Bowel Disease phenotypes. International Journal of Medical Microbiology. 2014;304:464-475
43. Huijsdens XW, Linskens RK, Mak M, et al. Quantification of Bacteria Adherent to Gastrointestinal
Mucosa by Real-Time PCR. J Clin Microbiol. 2002;40:4423-4427
44. Furet J-P, Firmesse O, Gourmelon M, et al. Comparative assessment of human and farm animal faeca microbiota using real-time quantitative PCR. FEMS Microbiolog Ecology. 2009;68:351-362
To determine the best reagent concentrations for the qPCR assay, experiments were performed using different primer and probe concentrations ranging from 50 to 900 nM. Those reagents concentrations that yield the maximum fluorescent signal and the lowest quantification cycle (Cq) value for 106 copies/reaction of the target DNA were chosen as optimal, and have therefore been used for further quantification in samples (as described in the qPCR assays section below).
Oligonucleotides specificity was checked against the Ribosomal Database Project II (RDP) (Maidak BL, et al., Nucleic Acids Research. 2001 ;29:173-174) and GenBank database through Seqmatch and BLAST (Altschul SF, et al. Nucleic Acids Research. 1997;25:3389-3402), respectively. Coverages were evaluated using the SILVA Probe Match and Evaluation Tool - TestProbe 3.0 (available at http://www.arb-silva.de/search/testprobe/). Finally, in vitro inclusivity/exclusivity test was performed including 89 bacterial strains, nine of which were F. prausnitzii (Table 16).
Linearity, efficiency and detection limit of the assay were determined. To determine the confident quantification range of the assay, decaplicate ten-fold dilutions (ranging from 2x108 to 2 target gene copies per reaction) of a linearized plasmid containing either a single copy of the 16S rRNA gene of F. prausnitzii S3L/3 (phylogroup I) or F. prausnitzii DSM 17677 (phylogroup II) were used. The linear range for quantification was considered for those concentrations having a SD value lower than 0.34 between replicates. Regression analysis plotting the obtained Cq against the logarithm of the number of target genes in the reaction was also performed. The efficiency of the qPCR assay was calculated using the formula: Efficiency= [10< /slope)]-1. As concerns to detection limit of the assay, a calibration curve of two-fold serial dilutions between 1 and 100 target copies of F. prausnitzii 16S rRNA gene was performed. Eight replicas of each dilution were assayed. Data was analyzed by a Probit test (Minitab® 14 Statistical Software, Pennsylvania, US), in which the ratio of positive/negative amplification events was plotted against the amount of target genes present per reaction.
4. Quantification standards for qPCR.
Standard DNA templates from F. prausnitzii strain S3L/3 (phylogroup I), and F. prausnitzii DSM 17677 (phylogroup II) were prepared as genetic constructs after PCR amplification as previously reported (Lane DJ. et al., E. Stackebrandt and M. Goodfellow (ed.)., John Willy and Sons; 1991 ; Weisburg WG, Barns SM, Pelletier DA, et al. J Bacteriol. 1991 ;173:697-703), and subsequent insertion of the whole 16S rRNA gene into a pCR®4-TOPO® cloning plasmid (Invitrogen, CA, USA) following manufacturer's guidelines. After purification with the NucleoSpin® Plasmid (Macherey-Nagel GmbH&Co., Duren, Germany), plasmids were linearized with Spel (F. prausnitzii) and quantified using Qubit™ Quantitation Platform (Invitrogen, Carlsbad, USA). Initial target concentration was inferred as previously reported (Lopez-Siles M, et al. International Journal of Medical Microbiology. 2014;304:464-475). Standard curves were obtained from ten-fold serial dilutions of the titrated suspension of linearized plasmids, and ranged from 20 to 2* 108 copies/reaction, which correspond to the linear dynamic range span for all the reactions. The standard curve built with F. prausn'AzW DSM 17677 16S rRNA gene was used for both the total bacteria and the total faecalibacteria 16S rRNA gene quantification, and standard curves obtained from either phylogroup were intercalibrated using the total F. prausnitzii primers and probe set. 5. qPCR assays.
Previously reported 16S rDNA-targeting primers and probe were used for total F. prausnitzii (Lopez-Siles M, et al. International Journal of Medical Microbiology. 2014;304:464-475), and total bacteria (Furet J-P, et al. FEMS Microbiology Ecology. 2009;68:351-362) quantifications, and amplification reactions were carried out as described previously (Lopez-Siles M, et al. International Journal of Medical Microbiology. 2014;304:464-475). The novel assay for F. prausnitzii phylogroups quantification was carried out in a total volume of 20 μΙ reactions containing: 1 * TaqMan® Universal PCR Master Mix 2* (Applied Biosystems, Foster City, CA, USA), 900 nM of each primer, 300 nM of each probe, and up to 50 ng of genomic DNA template. All primers and probes used in this study as well as PCR conditions are detailed in Table 15. Total F. prausnitzii, and total bacteria primers and hydrolysis probes were purchased from Applied Biosystems (Foster City, CA, USA), whereas primers and hydrolysis probes for F. prausnitzii phylogroups were acquired from Biomers (Ulm, Germany). The DNA of the internal amplification control (IAC) was synthesized by Bonsai technologies group (Alcobendas, Spain).
Samples were run in duplicate in the same plate. For data analysis, the mean of the duplicate quantifications was used. Duplicates were considered valid if the standard deviation between quantification cycles (Cq) was <0.34 (i.e. a difference of <10% of the quantity was tolerated). Quantification controls consisting of at least five reactions with a known number of target genes were performed to assess inter-run reproducibility. Inhibition was controlled on total F. prausnitzii quantification by adding 103 copies of IAC template to each reaction. It was considered that there was no inhibition if the obtained Cq was <0.34 different from those obtained when quantifying the IAC alone for any of the replicates. A no-template control consisting of a reaction without F. prausnitzii DNA as well as a non- amplification control which did not contain any DNA template (either bacterial or IAC) were also included in each run. Negative controls resulted in undetectable Cq values in all cases.
All quantitative PCR were performed using a 7500 Real Time PCR system (Applied Biosystems, Foster City, CA, USA). Data were collected and analyzed using the 7500 SDS system software version 1.4 (Applied Biosystems, Foster City, CA, USA). All quantifications were done under average PCR efficiencies of 89.51 ±7.06%.
6. Data normalization and statistical analysis.
As regards to qualitative analyses, absence of F. prausnitzii or its phylogroups was considered if no detection was obtained during the qPCR analysis, corresponding to samples that carried F. prausnitzii or the phylogroups below the detection limit (;'. e. 106.6, 1.10 and 2.39 16S rRNA genes per reaction for total F. prausnitzii, phylogroup I and phylogroup II, respectively). Pearson's χ2 test was used to compare the prevalence of F. prausnitzii and its phylogroups between groups of patients and by IBD disease location.
Referring to quantitative analyses, total F. prausnitzii, and phylogroups copy numbers were normalized to the total bacteria 16S rRNA gene copies. Data is given as the log10 of the ratio between 16S rRNA gene copies of the target microorganism and million of total bacterial 16S rRNA genes detected in the same sample.
The non-parametric Kruskal-Wallis test was used to test differences in variables with more than two categories such as diagnostics, CD and UC disease location, and current medication. Pairwise comparisons of subcategories of these variables were analyzed using a Mann-Whitney U test. This test was also used to compare, within a subgroup of patients, variables with two categories such as activity (active CD and UC patients when CDA 50 (Best, W.R., et al. Gastroenterology, 1976. 70(3): p. 439- 44.) and a Mayo score >3 (Pineton de Chambrun, G., L. et al. Nat Rev Gastroenterol Hepatol, 2010. 7(1 ): p. 15-29.), respectively), and intestinal resection.
In addition, the receiver operating characteristic (ROC) curve analysis, a plot of the true positive rate (sensitivity) versus false positive rate (1 -specificity), was applied to establish the usefulness of F. prausnitzii, and each phylogroup to distinguish amongst different intestinal disorders. The accuracy of discrimination was measured by the area under the ROC curve (AUC). An AUC approaching 1 indicates that the test is highly sensitive as well as highly specific whereas an AUC approaching 0.5 indicates that the test is neither sensitive nor specific.
All the statistical analyses were performed using the SPSS 15.0 statistical package (LEAD Technologies, Inc.). Significance levels were established for P values < 0.05.
Example 2. Features of the novel multiplex qPCR assay for F. prausnitzii phylogroups I and II.
A novel oligonucleotide set was designed to quantify the two recently described F. prausnitzii phylogroups (Table 15). The in silico analysis of the oligonucleotide set of choice showed that primer Fpra 136F-Fpra 232R were specific for F. prausnitzii and targeted all the isolates available to date, whereas the probes PHG1 180PR and PHG2 180PR specifically matched phylogroups I and II, respectively. These results were confirmed in vitro by the inclusivity-exclusivity tests (Table 16). Coverage of the Fpra 136F-Fpra 232R primers set was 74.85% of the sequences in the SILVA datasets. PHG1 180PR probe targeted 20.50% of the Faecalibacterium sp. sequences whereas PHG2 180PR probe coverage was 38.80% of the Faecalibacterium sp. sequences in this database. Approximately 25% of all Faecalibacterium sequences available in SILVA dataset are not targeted in silico by any of these assays. This discrepancy could be due to the existence of other phylogroups and/or because different phylogroup probes do not include all members within each phylogroup. Our results are still valid however to compare between diseases in our study, as the same criteria for the definition of phylogroup members has been used, i.e., PHGI has been defined by specific hybridation with SEQ ID NO:3 and PHGII with SEQ ID NO:4.
For both reactions reliable quantification was possible over a linear range span of 7 logarithms, starting at 20 target genes per reaction (R2=0.998), with an average efficiency of 85.68±3.23 % for phylogroup I and 90.31 ±3.40% for the phylogroup II. The detection limits were 1.10 and 2.39 target genes for phylogroup I and phylogroup II, respectively. Table 16. Growth conditions and source of the bacterial strains used in this study. The results obtained from the specificity tests are also included.
Source of DNA
information* Growth (2) Specificity test information
Strain/source
Phylogeny (1) Media T(°C) ?3T cnPCR qPHG1 qPH
Firmicutes
Faecalibacterium prausnitzii
M2GSC 37 10 + + - ATCC 27768T ATCC 27768
F. prausnitzii M21/2 nd M2GSC 37 10 + + -
F. prausnitzii S3L/3 nd M2GSC 37 10 + + -
F. prausnitzii S4L/4 nd M2GSC 37 10 + + -
F. prausnitzii A2-165 DSM 17677 M2GSC 37 10 + - +
F. prausnitzii L2-15 nd M2GSC 37 10 + - +
F. prausnitzii L2-39 nd M2GSC 37 10 + - +
F. prausnitzii L2-6 nd M2GSC 37 10 + - +
F. prausnitzii L2-61 nd M2GSC 37 10 + - +
Anaerofilum agile DSM4272 nc nc 1.6 + - -
Eubacterium siraeum DSM 15702 nc nc 6.9 + - -
Eubacterium halii DSM 17630 nc nc 1 + - -
Clostridium viride DSM6836 nc nc 10 + - -
Clostridium leptum DSM753 nc nc 10 + - -
Ruminococcus albus DSM20455 nc nc 10 + - -
Clostridium acetobutylicum CECT 979 AN 37 3.7 + - -
Clostridium botulinum type E CECT461 1 LiB 37 10 + - -
Bacillus cereus NCTC1 1 145 AN 30 10 + - -
Bacillus megaterium DSM319 AN 30 10 + - -
Bacillus sp. CECT 40 AN 30 10 + - -
Bacillus subtilis NCTC10400 AN 30 2.3 + - -
Bacillus subtilis sups, spizizwnii CECT 482 AN 30 10 + - -
Listeria grayi CECT931 BHI 37 10 + - -
Listeria innocua CECT 910 BHI 37 10 + - -
Paenibacillus polymyxa DSM372 BHI 37 2.1 + - -
Staphylococcus aureus ATCC9144 AN 37 10 + - -
Staphylococcus epidermidis CECT 231 AN 37 10 + - -
Enterococcus avium CECT 968 BHI 37 10 + - -
Enterococcus columbae CECT 4798 BHI 37 10 + - -
Enterococcus durans CECT 41 1 BHI 37 10 + - -
Enterococcus faecalis CECT 481 BHI 37 10 + - -
Enterococcus faecium CECT 410 BHI 37 10 + - -
Enterococcus gallinarum CECT 970 BHI 37 10 + - -
Enterococcus mundtii CECT 972 BHI 37 10 + - -
Lactobacillus acidophilus CECT 903 MRS 30 6.3 + - -
Lactococcus lactis CECT 185 MRS 30 3.8 + - -
Streptococcus agalactiae CECT 183 BHI 37 7.2 + - -
Streptococcus anginosus CECT 948 BHI 37 10 + - -
Streptococcus equi subsp. equi CECT 989 BHI 37 10 + - -
Streptococcus equinus CECT 213 BHI 37 10 + - -
Streptococcus intermedius CECT 803 BHI 37 10 + - -
Streptococcus mutans CECT 479 BHI 37 3.8 + - -
Streptococcus oralis CECT 907 BHI 37 10 + - -
Streptococcus pneumoniae CECT 993 BHI 37 10 + - -
Streptococcus pyogenes CECT 598 BHI 37 10 + - -
Streptococcus salivarus CECT 805 BHI 37 10 + - -
Streptococcus sanguinis CECT 480 BHI 37 5.5 + - -
Streptococcus sobrinus CECT 4034 BHI 37 6.5 + - -
Streptococcus suis CECT 958 BHI 37 10 + - -
Streptococcus thermophilus CECT 986 BHI 37 10 + - -
Streptococcus uberis CECT 994 BHI 37 10 + - -
Actinobacteria
Corynebacterium bovis DSM20582 MRS 37 4.8 + - -
Kocuria rhizophila DSM348 AN 30 2.3 + - - Source of DNA
information* Growth (2) Specificity test information
Strain/source
Phylogeny (1) Media T(°C) cnPCR qPHG1 qPHG2
Micrococcus luteus CECT 241 AN 30 2.6 + - -
Mycobacterium phlei CECT 3009 BHI 37 10 + - -
Streptomyces griseus DSM40236 PDA 30 10 + - -
Bifidobacterium adolescentis CECT 5781 AN 37 0.4 + - -
Bifidobacterium breve CECT 4839 AN 37 2.0 + - -
Bacteroidetes
Bacteroides fragilis DSM2151 nc nc 10 + - -
Bacteroides uniformis DSM6597 nc nc 10 + - -
Bacteroides vulgatus DSM1447 nc nc 10 + - -
Proteobacteria
Methylophilus methylotrophus DSM5691 CZ 30 10 + - -
Campylobacter jejuni DSM4688 BA 37 10 + - -
Citrobacter freundii CECT 401 AN 30 10 + - -
Enterobacter aerogenes CECT 684 AN 30 10 + - -
Enterobacter cloacae CECT 194 AN 30 10 + - -
Enterobacter sakazakii CECT 858 AN 30 10 + - -
Enterobacter sakazakii ATCC51329 AN 30 0.4 + - -
Enterobacter amnigenus
CECT 4078 AN 37 10 + - - (Sakazakii)
Enterobacter gergoviae
CECT 857 AN 37 10 + - - (Sakazakii)
Escherichia coli CECT 100 AN 37 10 + - -
Escherichia coli CECT 101 AN 37 10 + - -
Escherichia coli CECT 105 AN 37 10 + - -
Escherichia coli CECT 12242 AN 37 10 + - -
Escherichia coli CECT 831 AN 37 10 + - -
Escherichia coli CECT 4201 AN 37 10 + - -
Escherichia coli CECT 4084 AN 37 10 + - -
Escherichia coli CECT 405 AN 37 10 + - -
Escherichia coli ATCC 10536 AN 37 10 + - -
Klebsiella pneumoniae ssp.
CECT 143 AN 37 10 + - - pneumoniae
Proteus mirabilis CECT 170 AN 37 10 + - -
Salmonella LT2 CECT878 AN 37 10 + - -
Salmonella TA98 CECT880 AN 37 10 + - -
Serratia marcescens CECT846 AN 25 10 + - -
Shigella sonnei CECT457 AN 37 10 + - -
Pseudomonas aeruginosa CECT 532 AN 30 10 + - -
Pseudomonas fluorescens CECT 378 AN 30 10 + - -
Pseudomonas mendocina CECT320 AN 30 10 + - -
Pseudomonas putida CECT 324 AN 30 4.1 + - -
* Specificity test with human Xsomal DNA (Eurogentec, Belgium) was also performed
( ' ATCC: American Type Culture Collection (Manassas, VA, USA); CECT: Coleccion Espafiola de Cultivos Tipo (Valencia, Spain); DSMZ: Deutche Sammlung von Mikroorganismen and Zellkulturren (Braunschweig, Germany), NCTC: National Collection of Type Cultures (London, UK), nd: not deposited (stocks held by the authors, Rowett Institute of nutrition and Health, Aberdeen, United Kingdom). (2) nc: not cultured. BHI (Brain Heart Infusion Broth), AN (Nutrient Agar), BA (Blood Agar), MRS (Man, Rogosa and Sharpe medium ), LiB(Liver Broth, CECT medium #15), CZ (Colby and Zathman medium, DSMZ medium #606), PDA (Potato Dextrose Agar), M2GSC (modified Med2 of Hobson, (1 )).(3) ng of genomic DNA used for the inclusivity/exclusivity test. When possible, 10ng was used. The DNA was obtained from 1 ml of bacterial culture at the stationary growth phase or for nc strains, the dried culture directly obtained from the culture type collection was rehydrated with the appropriate buffer for DNA extraction and used for DNA purification. Example 3. Prevalence of mucosa-associated F. prausnitzii and phylogroups I and II along the gut in health and disease.
Prevalence of F. prausnitzii and both phylogroups as calculated from positive determinations over total samples was analyzed by disease status considering all the data across all sites (Figure 1 ). F. prausnitzii prevalence was lower in CD patients than in H (Figure 1 ). CD patients with l-CD feature lower F. prausnitzii prevalence than those with E1 , E2, E3 and C-CD. Prevalence values ranged from 81- 100%, except for l-CD whose value was significantly lower (down to 68%, P<0.046).
As far as the phylogroups are concerned, both were found to be less prevalent in CD patients (P<0.001 ) than in the H and CRC groups, particularly in those with ileal involvement (Figure 1 ). For CRC and UC patients, the prevalence remained similar to H. Nevertheless phylogroup I showed a trend of lower values in ulcerative pancolitis, which did not reach statistical significance (P=0.053) probably due to the low number of samples processed. Similarly IBS patients only had reduced prevalence of phylogroup I in comparison to H subjects.
Both phylogroups co-occurred in 85.4% and 85.0% of samples containing F. prausnitzii from H and CRC patients, respectively. Phylogroup I was exclusive in 10% of H and CRC subjects, whereas phylogroup II was found as the only representative in 4.2% of H subjects (Figure 2A). In contrast, 16% of IBS, 6% of UC and 22% of CD patients with F. prausnitzii carried neither phylogroup I nor II, which suggests the existence of other phylogroups. Differences in prevalences were observed between IBD disease location. All the patients with less severe UC (i.e. E1 and E2) had one or both F. prausnitzii phylogroups, resembling H subjects, whereas none of the phylogroups were detected in 23.1 % of ulcerative pancolitis patients despite having F. prausnitzii (Figure 2B). Similarly, 22.2% of all CD patients did not show either of the phylogroups. Within CD patients, 47.1 % of C-CD patients had both F. prausnitzii phylogroups whereas the presence of a unique phylogroup was more frequent (44.4% of IC- CD and 28.0% of l-CD patients) in those with ileal involvement. Remarkably whenever a single phylogroup was found in l-CD it always was the phylogroup II.
The majority of H and CRC subjects harbored both phylogroups far higher than the detectable level whereas IBS, and IBD patients feature a reduced prevalence of one of the phylogroups, particularly those with CD. Furthermore, phylogroup I and II were undetected in 16% of IBS and 22% of CD patients with F. praunsitzii. These results suggest an imbalance within the F. prausnitzii population in these diseases and suggest the existence of at least one more phylogroup.
Example 4. Abundances of mucosa-associated F. prausnitzii and phylogroups in health and disease.
The abundance of F. prausnitzii and its phylogroups from all the biopsies pooled together was compared amongst patients with different intestinal disorders and H subjects (Table 17). F. prausnitzii was less abundant in IBD and CRC patients as compared to healthy subjects (P<0.001 ), whereas IBS patients closely resembled the H group. As previously reported (Lopez-Siles M, et al. International Journal of Medical Microbiology. 2014;304:464-475), within UC patients, those with E1 and E3 presented F. prausnitzii loads similar to H subjects, whereas those with E2 had abundances between CD patients and H subjects. In CD patients, those with ileal involvement presented the lowest levels of this bacterium, whereas C-CD patients were similar to UC (Table 17).
F. prausnitzii phylogroup I load was reduced in all the intestinal diseases analyzed in comparison to H subjects, except for IBS patients, probably due to the low number of patients included and the high dispersion of data. This reduction was particularly conspicuous in CD patients, who had values 1000 times lower than H subjects (P<0.001 ). When analyzing data by disease location, all CD patients showed this marked reduction of phylogroup I abundance, as well as those UC patients with E3 that resembled more to CD patients than to those with other UC disease location. In contrast, F. prausnitzii phylogroup II abundance was only significantly reduced in CD patients in comparison to H (P<0.001 ) (Table 17), particularly in those with ileal involvement (either l-CD or IC-CD), suggesting that in these patients the depletion of F. prausnitzii affects the overall faecalibacteria community.
Table 17. Abundances of mucosa-associated F. prausnitzii and its phylogroups in controls (H), Irritable Bowel Syndrome (IBS), Ulcerative Colitis (UC), and Crohn's disease (CD) patients. Disease locations of UC and CD patients are analyzed as independent groups.
n patients
(n Phylogroup Phylogroup biopsies) F. prausnitzii^ |*§ ||*§
H 31 (48) 5.33±0.58 a 3.39±0.87 a 3.39+1.51 a
IBS 9 (19) 5.29±0.54 a b 2.53±1.22 a b 2.72+1.06 a b
CRC 20 (20) 4.42±0.58 c 2.66±0.91b 2.56+1.14 a b
UC 25 (50) 5.00±0.62 b 2.59±1.24 b 2.93+0.99 a
Location
Ulcerative proctitis (E1 ) 6 (14) 5.09±0.29 a 2.76±0.38 a b 3.22±0.43 a
Distal UC (E2) 1 1 (22) 4.49±0.59 b 2.58±1.15 a b 2.84±0.93 a b
Extensive UC or ulcerative pancolitis
(E3) 6 (10) 5.34±0.69 a 0.95±1.60 b c 3.13±1.02 a b
CD 45 (63) 4.26±1.34 c 0.71±1.65 c 1.54+1.47 °
Location
Meal-CD (L1 ) 19 (25) 3.97±1.42 c 0.43±1.33 c 1.14±1.54 b
Colonic-CD (L2) 1 1 (17) 5.06±1.07 a c 1.54±1.71 b c 2.63±1.51 a b lleocolonic-CD (L3) 14 (18) 4.30±1.12 b c 1.06±1.72b c 1.38±1.54 b
* Statistics was calculated separately for each variable (column). Groups of patients with similar abundances of F. prausnitzii or its phylogroups are indicated with the same superscript (a,b or c) whereas groups not sharing superscript are those with statistically different median abundance values (P<0.05) ® Median log10 16S rRNA gene copies/ million bacterial 16S rRNA gene copies ± standard deviations
Our data show that mucosa-associated F. prausnitzii loads are markedly reduced in CRC and CD patients, especially in those with ileal involvement. F. prausnitzii was below detection limits of the method (106.6 16S rRNA genes of F. prausnitzii per reaction) in 5% of CRC and 20% of CD patients. UC patients also featured a lower F. prausnitzii abundance than H subjects, but this depletion was four-times less prominent than the depletion observed in CD and CRC patients. Finally, abundance in IBS patients was similar to H subjects. Our study is in agreement with previous reports which found F. prausnitzii to be less abundant and/or prevalent in adult CD, UC and CRC. We have not observed depletion in F. prausnitzii load in IBS patients, although this observation could be biased by the small cohort size which also had not been classified by disease type.
In general terms, this quantitative analysis demonstrated that, while the depletion in phylogroup I abundance is a general feature in abnormal gut conditions, the depletion of F. prausnitzii phylogroup II seems to be specific to CD patients with ileal disease location. Example 5. Usefulness of mucosa-associated F. prausnitzii and phylogroup abundance as diagnostic biomarkers.
ROC curve analysis, applied to test the putative accuracy of total F. prausnitzii abundance as an indicator to differentiate between two groups of patients, confirmed that the reduction of this species load is a good discriminator for CRC patients from H and IBS patients, with AUC values greater than 0.8 (Figure 3) with an 80% of specificity and above 70% of sensitivity at a set threshold. Good discrimination was also observed between CD and H patients, although for the same specificity values, sensitivity was reduced to 62%. Interestingly, phylogroup I abundance was a more accurate indicator to distinguish H from IBD subjects, than total F. prausnitzii abundance (Figure 3). When comparing H subjects with UC more than 76.60% of sensitivity and above 57.14% of specificity at a set threshold were reached for all the disease locations but with the exception of ulcerative proctitis (E1 ). Specificity was improved up to 70% when considering exclusively E3 patients. In addition, phylogroup I abundance was a particularly accurate biomarker to distinguish H and CD patients (91.48% sensitivity, 73.02% specificity), especially those with l-CD in which 91.48% sensitivity and up to 88.00% of specificity could be reached. Although phylogroup II abundance can accurately discriminate H and CD subjects, AUC values were slightly lower than those obtained for phylogroup I, thus indicating that the latter is a more suitable biomarker for H status. In contrast, phylogroup II was a useful biomarker to discriminate within IBD subtypes as the best AUC values were obtained to distinguish between ulcerative pancolitis patients and those with CD with colonic involvement (phylogroup II AUC E3vsC-CD=0.817).
Figure 3 provides a heat map on the suitability of mucosa-associated F. prausnitzii, phylogroup I and phylogroup II abundances to be used as biomarkers to distinguish amongst different intestinal disorders and IBD subtypes (by location) determined by the area under the curve (AUC) obtained by receiver operating characteristic analysis (ROC curve). Figures 4 and 5 show the ROC curve, calculated AUC value and specificity and sensitivity values for the optimal cut-off point for selected group comparisons. Furthermore, Tables 29-35 at the end of the Examples section provide the ROC curve coordinates for those selected group comparisons.
In conclusion, it was found that mucosa-associated F. prausnitzii Phylogroup I (PHGI) abundance was a good biomarker of intestinal disease, notably of IBD, CD and l-CD, as PHGI abundance can accurately discriminate between H subjects and intestinal disease patients with an AUC for H vs IBS + IBD + CRC of 0.804. PHGI being also a better discriminator than total F. prausnitzii abundance (AUC: 0.724) or PHGII (AUC: 0.693). AUC of PHGI abundance for H + IBS vs IBD + CRC was of 0.753.
Furthermore, PHGI abundance was shown to discriminate between H subjects and IBD (UC + CD) patients with high accuracy (AUC: 0.816) and was better discriminator than total F. prausnitzii abundance (AUC: 0.720) or PHGII (AUC: 0.699).
In addition, PHGI abundance was a more accurate indicator than total F. prausnitzii load to distinguish H subjects from patients with CD (AUC: 0.858) with an 80% of specificity and 78% of sensitivity. Furthermore, sensitivity values as high as 91.48% could be reached, maintaining a good specificity of 73.02%. More specifically, PHGI abundance was shown to be a particularly good indicator of ileal location (l-CD) with a sensitivity of 91.48% a specificity of up to 88.00% could be reached. Accuracy values were also better than those obtained for total F. prausnitzii abundance and PHGII (PHGI AUC: 0.948 vs Total FP AUC: 0.875 and PHGII AUC: 0.772). On the other hand, PHGII abundance showed a good discrimination capacity within IBD subtypes. In particular, it was shown to distinguish between ulcerative pancolitis patients (UC-E3) and those with CD with colonic involvement (C-CD) with high accuracy (E3 vs C-CD AUC of 0.691 ), these two disorders may present similar clinical manifestations and both are located in the colonic area. Due to differences in treatment and management between UC and CD it is of relevance an accurate discrimination between UC-E3 and C-CD. Furthermore, PHGII was found to be a suitable discriminator between C-CD and IC-CD (AUC: 0.61 1 ), and thus might be used as an indicator of the progression of the disease from the colonic to the ileal region.
Example 6. F. prausnitzii and phylogroup abundances in mucosa in relation to patients clinical and treatment data.
1. Disease activity status
F. prausnitzii and the abundance of the phylogroups did not differ between active and inactive UC patients (Table 18). Although no statistical significance was reached, active CD patients showed a marked reduction on phylogroup I abundance with respect to CD patients in remission (P=0.106).
Table 18. F. prausnitzii and its phylogroups abundance in IBD patients by disease activity status. Active CD and UC were defined by a CDAI of >150 (Best, W.R., et al. Gastroenterology, 1976. 70(3): p. 439- 44.) and a Mayo score >3 (Pineton de Chambrun, G., L. et al. Nat Rev Gastroenterol Hepatol, 2010. 7(1 ): p. 15-29.), respectively.
Phylogroup
Diagnostics5 N F. prausnitzii* p- Phylogroup I* p- p- value value II* value
UC
active 41 4.80±0.41 0.344 2.62±1.32 0.720 2.92±1.02 0.623 inactive 8 5.02±0.66 2.69±0.78 3.18±0.87
CD
active 41 4.31 ±1.10 0.507 0.61 ±1.51 0.106 1.50±1.63 0.624 inactive 22 4.25±1.46 1.36±1.80 1.69±1.14
Median log10 16S rRNA gene copies/ million bacterial 16S rRNA gene copies ± standard deviations §UC, ulcerative colitis; CD, Crohn's disease
The fact that F. prausnitzii abundance, including both phylogroups, seems to remain lower under remission suggest that this depletion may be occurring at early disease stages or even prior to disease onset, and remains altered over time even if there is endoscopic and clinical remission. Despite no statistically significant differences being observed, active CD patients presented a reduction of phylogroup I levels in comparison with inactive patients.
2. Intestinal resection
F. prausnitzii abundance was reduced in those CD patients that underwent intestinal resection (Table 19). Interestingly, this could be attributable to lower phylogroup II abundance, that was 10-fold lower in resected CD patients than in those without intestinal surgery (P=0.001 ) whereas the phylogroup I load was only slightly lower between resected and non-resected patients.
Table 19. F. prausnitzii and its phylogroups abundance in inflammatory bowel disease patients depending on whether or not they have had intestinal resection during the course of the disease.
ylogroup
Diagnostics5 N F. prausnitzii* p- Ph p- Phylogroup p- value I* value II* value
UC
non-resected 43 4.85±0.61 1.000 2.51 ±1.21 0.136 2.92±0.96 0.727 resected 1 4.91 3.45 2.68
CD
non-resected 41 4.86±1.43 0.016 1.52±1.84 0.379 2.1 1 ±1.46 0.001 resected 13 3.74±0.78 0.45±1.07 0.65±0.84
Median log10 16S rRNA gene copies/ million bacterial 16S rRNA gene copies ± standard deviations
SUC, ulcerative colitis; CD, Crohn's disease
Lower numbers of F. prausnitzii were detected in resected CD patients. This reduction is also replicated with phylogroups counts. In this case nevertheless, statistical significant differences were only achieved for phylogroup II, probably because the depletion is more striking
3. Medication
Finally, as far as therapies are concerned, data were analyzed taking into account the medication of the patients at the time of sampling (Table 20). No differences in F. prausnitzii or in phylogroup abundances were observed between medications within any IBD. However, those CD patients who received no treatment or mesalazine had higher F. prausnitzii loads than those patients under moderate immunosupressants or anti-tumor necrosis factor. No medication was associated with the recovery of normal levels of these bacterial indicators.
In general terms, we have observed that the used medication does not restore the levels of mucosa-associated F. prausnitzii or its phylogroups, which is in agreement with a previous report (Lopez- Siles M, et al. International Journal of Medical Microbiology. 2014;304:464-475).
Table 20, F. pmmnitzii and its phylog roups abundances (median logi0 16S rRNA gene copies/ million bacterial 16S rRNA gene copies standard deviations) in inflammatory bowel disease by medication at sampling.
Diagnostics* N F. prausnttzlt* p-value Phylogroup 1* p-value Phylogroup II* p-val
UC
No treatment 25 4.95±0.65 2.51 ±1.32 2.93±1 .03
Mesalazine 6 5.02±0.33 0.904 2.53*0.84 0.806 3.31 ±0.98 0.832 moderate immunosuppresants 9 4.56±0.58 2.75±0.41 2.85±0.71
Anti-tumor necrosis factor 7 4,44±0.83 3.16±1 .93 2.92±1 .07
CD
No treatment 21 4.86±1 .66 0.69±2.04 2.70±1 .71
Mesalazine 3 5.10±0.41 0.225 1 .7U1 .67 0.854 2.63±1 ,89 0.738 moderate immunosuppresants 19 4.01 ±0.95 0.71 ±1 .45 1 .23±1 .48
Anti-tumor necrosis factor 16 4.01 ±1.43 0.67±1 .48 1 .49±1 .18
* Median log-to 1 SS rRNA gene copies/ million bacterial 1 SS rRNA gene copies ± standard deviations
SUC, ulcerative colitis; CD, Crohn's disease
4. Disease duration
Concerning disease duration, no statistically significant correlation was found between time from disease onset and F. prausnitzii and phylogroup abundances (Table 21 ).
Table 21. Spearman correlation coefficients and significance between years since disease onset and F. prausnitzii phylogroups abundances in fecal samples in Ulcerative Colitis (UC), and Crohn's disease (CD) patients.
Phylogroup Phylogroup
F. prausnitzii j M
Patients N Coef correl p-value Coef correl p-value Coef correl p-value
UC 46 0.076 0.616 0.225 0.133 0.015 0.922
CD 61 -0.013 0.919 0.1 19 0.359 -0.056 0.671
Median log10 16S rRNA gene copies/ million bacterial 16S rRNA gene copies ± standard
deviations
§UC, ulcerative colitis; CD, Crohn's disease
Example 7. Materials and methods of F. prausnitzii phylogroups quantification in faecal samples
1. Patients, clinical data and sampling.
A Spanish cohort consisting of 20 IBD (12 CD and 8 UC) and 12 H was enrolled (Table 22). Subjects were recruited by the Gastroenterology Services of the Hospital Universitari Dr. Josep Trueta (Girona, Spain) (Salt, Spain). Subjects were age and gender matched for all the groups. IBD patients were diagnosed according to standard clinical, pathological and endoscopic criteria and categorized according to the Montreal classification (Silverberg et al., Can J Gastroenterol. 2005, 19 Suppl A:5-36). Clinically relevant data of all the patients was collected. None of the subjects received antimicrobial treatment for at least one month before sample collection.
Each subject provided a faecal sample, which was collected at the Gastroenterology Services of the Hospital Universitari Dr. Josep Trueta in less than 24h after deposition. All samples were homogenized, aliquoted to 2ml tubes and stored at -80 °C until use.
This work was approved by the Ethics Committee of Clinical Research of the Hospital Universitari Dr. Josep Trueta (Girona, Spain) and the Institut d'Assistencia Sanitaria of Girona (Salt, Spain) on January 2015. Informed consent from the subjects was obtained before enrollment.
Table 22. Sample size and clinical characteristics of subjects.
Crohn's Ulcerative
Healthy disease colitis p valued
N (patients) 12 12 8
Age {mean years ± SO) 42.8+18.6 39.5±13.8 54.3+17.2 0,223*
Male (N, %) 5 (41 .7%) 7 (58.3%) 4 (50.0%) 0.547*
Active (N, %) na 6 (50.0%) 2 (25.0%) 0.502†
Previous surgery (N. %) 0 4 (50.0%) 1 ( 12.5%) 0.457†
Smokers (N, %) 3 (25.0%) 2 (24.0%) 0 0.005'
Treatment (N, %) " 0.569†
No treatment 2 (16.7%) 0
Mesalazine na 0 0
Moderate immunosuppressant na 3 (25.0%) 1 (12.5%)
Anti-TNF a (infliximab, adalimumab) na 7 (58.3%) 4 (25.0%)
CD Montreal classification*
Age of diagnosis (N, %) 0.319* diag < 16y (A1 ) na 2 (16.7%) 0
diag l 7- 0y (A2) na 7 (58.3%) 2 (25.0%)
diag >41 y (A3) na 3 (25.0%) 3 (37.5%)
Location (N, %) na
lleal-CD (L1 ) na 6 (50.0%) na
Colonic-CD (L2) na 3 (25.0%) na
lleocolonic-CD (L3) na 3 (25.0%) na
UC classification (N, %) ** na
Ulcerative proctitis (E1 ) na na 0
Distal UC (E2) na na 3 (37.5%)
Extensive UC or ulcerative pancolitis na na 1 (12.5%)
(E3)
IBD, Inflammatory bowel disease; TNF, tumor necrosis factor; nd, not determined; na, not applicable, nd. not determined
** Medical treatment at the time of sampling was available in 5/8 UC patients; Age of disease onset was available for 5/8 UC patients; Disease behavior at last follow-up before the time of sampling was not determined for any patient; Maximal disease extent at the time of sampling was available in 4/8 UC patients;
S Groups were compared by non-parametric statistical tests, and p value <0.05 was considered significant
t x2 test;* Mann-Whitney U test
Sample treatment and DNA extraction.
DNA was extracted from 200 mg-500 mg of fecal sample using the NucleoSpin® Soil Kit (Macherey-Nagel GmbH &Co., Duren, Germany). SL1 (700 μΙ) and Enhancer SX (150 μΙ) were added to each sample in order to improve DNA recovery. Afterwards, DNA was extracted and purified following the instructions from the manufacturer. Genomic DNA was eluted with 10mM Tris-HCI (pH 7.4) and stored at -80 °C until use. DNA concentration and purity of the extracts were determined with a NanoDrop ND-100 spectrophotometer (NanoDrop Technologies, USA).
3. qPCR assays.
qPCR assays were conducted as detailed in Example 1.
4. Data normalization and statistical analysis.
Data normalisation and statistical analyses were conducted as detailed in Example 1.
Example 8. Prevalence of fecal F. prausnitzii phylogroups I and II in health and disease.
Prevalence of F. prausnitzii phylogroups as calculated from positive determinations over total samples was analyzed both by disease status and by disease location (Table 23). Both phylogroups were found to be less prevalent in CD patients than in H subjects, particulary I those with l-CD. Interestingly, whereas C-CD patients had a lower prevalence of phylogroup I, those with IC-CD featured less prevalence of phylogroup II. In contrast, UC patients only had lower prevalence of phylogroup II with respect to H subjects, and this was only observed in those patients with E2. Additional assays with a larger cohort of patients should preferably be carried out in order to confirm the observed trends.
Table 23. Prevalence of F. prausnitzii phylogroups by diagnostics and IBD subtype.
Phylogroup I Phylogroup II
% absence presence absence presence
H 0 100 0 100
UC 0 100 33 67
CD 17 83 25 75
p-value 0.200 0.122
C-CD 33 67 0 100
IC-CD 0 100 33 67
l-CD 17 83 33 67
p-value 0.549 0.513
E2-Distal UC 0 100 33 67
E3-Pancolitis 0 100 0 100
p-value nd 0.505
In contrast to results in biopsy samples, all IBD patients carried at least one of the F. prausnitzii phylogroups. Both phylogroups co-occurred in all the samples from H, and in the majority of IBD patients (75% of UC and 66.7% of CD). Phylogroup I was exclusive in 25% of CD (two l-CD and one IC-CD) and 25% of UC (an E2 patient an another whose disease location could not be determined), whereas phylogroup II was found as the only representative in a CD patient (8.3% of CD subjects).
Example 9. Abundance of fecal F. prausnitzii phylogroups in health and disease.
The abundance of F. prausnitzii phylogroups from fecal samples was compared amongst patients with different intestinal disorders and H subjects (Table 24). F. prausnitzii phylogroup I load was reduced in all IBD patients analyzed in comparison to H subjects. This reduction was particularly conspicuous in CD patients, who had values 186 times lower than H subjects. However, the observed differences were not statistically supported, probably due to the low number of patients included and the high dispersion of data. When analyzing data by disease location, all CD patients showed this marked reduction of phylogroup I abundance. UC patients featured intermediate values between H and CD patients, and it cannot be determined if as observed in biopsies, those with E3 resembled more to CD patients than to those with other UC disease location as only a subject with this disease location was included in this study. F. prausnitzii phylogroup II abundance was also reduced in IBD patients in comparison to H (Table 24), particularly in those with colonic involvement (either C-CD or IC-CD), suggesting that in feces these patients the depletion of F. prausnitzii affects the overall fecalibacteria community. These results are in contrast with those observed in biopsy samples, where a reduction of phylogroup I I was observed only in patients with ileal involvement. Further analysis including a higher number of subjects with each disease location should be conducted to validate these observations. This could be explained either by a different distribution of this phylogroup between feces/mucosa or because inflammatory processes affect differently according to disease location.
Table 24. Abundances of faecal F. prausnitzii phylogroups in controls (H), Ulcerative Colitis (UC), and Crohn's disease (CD) patients. Disease locations of UC and CD patients are analyzed as independent groups. n patients Phylogroup l§ Phylogroup ll§
H 12 4.43±0.66 3.19+0.77
UC 8 3.15±2.36 2.04+1.98
Location
Distal UC (E2) 3 3.36±2.41 1.82±1.88
Extensive UC or ulcerative pancolitis
(E3) 1 4.25 3.17
CD 12 2.16±2.21 1.97+1.61
Location
Meal-CD (L1 ) 6 2.06±3.08 3.39±1.55
Colonic-CD (L2) 3 2.00±1.92 1.49±1.18
lleocolonic-CD (L3) 3 2.29±2.33 1.49±1.60
p-value 0.068 0.233
s Median log10 16S rRNA gene copies/ million bacterial 16S rRNA gene copies ± standard deviations
Interestingly, we observed that for H and UC patients there is an imbalance of both phylogroups abundances, where phylogroup II outnumbers by a factor of 10 phylogroup I quantity. In contrast CD patients featured similar abundances of both phylogroups. This is not in line with results observed in biopsy samples, in which we found that in H, CRC and IBS subjects the abundance of the two phylogroups was similar, whereas in IBD patients phylogroup II outnumbered phylogroup I. Here we have corroborated that in fecal samples differences in F. prausnitzii phylogroups loads exist between IBD locations. For instance, phylogroup II abundance is particularly compromised in patients with distal UC in comparison to those whith ulcerative pancolitis. In addition, this phylogroup also allowed to differenciate l-CD patients from those with colonic involvement.
Example 10. Usefulness of fecal F. prausnitzii phylogroups abundance as diagnostic biomarkers.
ROC curve analysis, applied to test the putative accuracy of F. prausnitzii phylogroups abundance in feces as an indicator to differentiate between two groups of patients, confirmed that the reduction of phylogroup I load is a good discriminator for CD patients from H (especially those with ileal involvement), with AUC values greater than 0.75 (Figure 6) with an 80% of specificity and above 58% of sensitivity at a set threshold. Similar values were obtained to discriminate between CD and UC entities, and the discrimination was excellent between IC-CD and E3, with AUC values greater than 0.9. In contrast, the discrimination capacity between H and UC patients for this indicator was lower in comparison to the results observed in biopsies.
Phylogroup II abundance could also discriminate H from IBD subjects, but was not appropriate to distinguish UC from CD patients. Whereas in biopsies we observed that AUC values from phylogroup II were slightly lower than those obtained for phylogroup I, the abundance of this indicator in feces was an excellent biomarker to distinguish E3 patients form those with CD with colonic involvement (either C-CD or IC-CD) (AUC =1.000).
Figure 6 provides a heat map on the suitability of F. prausnitzii, phylogroup I and phylogroup II abundances in feces to be used as biomarkers to distinguish amongst different IBD diagnostics and IBD subtypes (by location) determined by the area under the curve (AUC) obtained by receiver operating characteristic analysis (ROC curve). Figures 7 and 8 show the ROC curve, calculated AUC value and specificity and sensitivity values for the optimal cut-off point for selected group comparisons. Furthermore, Tables 35-41 at the end of the Examples section provide the ROC curve coordinates for those selected group comparisons.
In conclusion, PHGI abundance was confirmed as a good biomarker in feces for diagnosis of IBD, showing a good discrimination capacity between H subjects and IBD patients with an AUC of 0.720, and in particular for the diagnosis of CD with an AUC of 0.785. PHGI I abundance also shows a good correlation with CD, however the accuracy value (AUC: 0.715) is slightly lower than that obtained with PHGI abundance. Accordingly, PHGI abundance was confirmed as a good biomarker for detection of IBD and, in particular for detection of CD, in feces samples.
On the other hand, the value of PHGII abundance as biomarker for differential diagnosis between patients suffering from ulcerative pancolitis patients (UC-E3) and those with CD with colonic involvement (C-CD) has been confirmed in feces (AUC: 0.667), although the accuracy values are slightly lower than those obtained for mucosa samples.
In addition, it was confirmed that PHGII was a good discriminator between C-CD and IC-CD (AUC: 0.889), which suggests its potential value in determining extension of the disease to the ileal area (IC-CD) in a human subject who has previously been diagnosed with C-CD. Furthermore, despite ROC AUC values being slightly lower, PHGII was also pointed out as a suitable discriminator between l-CD and IC- CD (AUC: 0.667), and might be a useful biomarker for determining extension of the disease to the colonic area (IC-CD) in a human subject who has previously been diagnosed with l-CD.
Example 11. F. prausnitzii phylogroups abundances in feces in relation to patients clinical and treatment data.
1.Disease activity status
F. prausnitzii phylogroups abundances did not differ between active and inactive IBD patients (Table 25). In contrast to results observed in biopsies, active IBD patients had higher abundances than inactive. Although no statistical significance was reached, inactive UC patients showed a marked reduction on phylogroup I abundance with respect to UC patients in remission (P=0.068).
Table 25. F. prausnitzii phylogroups abundance in inflammatory bowel disease patients by disease activity status. Active CD and UC were defined by a CDAI of >150 (Best, W.R., et al. Gastroenterology, 1976. 70(3): p. 439-44.) and a Mayo score >3 (Pineton de Chambrun, G., L. et al. Nat Rev Gastroenterol Hepatol, 2010. 7(1 ): p. 15-29.), respectively.
Diagnostics5 N Phylogroup I* p-value Phylogroup II* p-value
UC
Active 2 4.99±0.15 0.064 2.76±1.97 0.355
Inactive 4 2.43±2.43 1.69±2.17
CD
Active
Inactive
Figure imgf000097_0001
Median log10 16S rRNA gene copies/ million bacterial 16S rRNA gene copies ± standard
deviations
UC. ulcerative colitis; CD. Crohn's disease
2. Intestinal resection
F. prausnitzii phylogroups abundance was reduced in those CD patients that underwent intestinal resection (Table 26), which is in line with results observed in biopsies. Interestingly, this could be attributable to lower numbers of both phylogroups. However, these results were not statistically supported probably because of the low number of patients and the high dispersion of data.
Table 26. F. prausnitzii phylogroups abundance in inflammatory bowel disease patients depending on whether or not they have had intestinal resection during the course of the disease.
Diagnostics8 N Phylogroup I* p-value Phylogroup II* p-value
UC
non-resected 5 4.38±2.57 1.000 1.36±2.12 1.000 resected 1 4.25 3.17
CD non-resected 8 2.85±2.23 0.368 2.22±1.69 0.368
resected 4 0.77±2.13 0.82±1.29
Median log10 16S rRNA gene copies/ million bacterial 16S rRNA gene copies ± standard
deviations
§UC, ulcerative colitis; CD, Crohn's disease
3. Disease duration
Concerning disease duration, no statistically significant correlation was found between time since disease onset and F. prausnitzii phylogroups abundances (Table 27), which is in line with results obtained in biopsy samples.
Table 27. Spearman correlation coefficients and significance between years since disease onset and F. prausnitzii phylogroups abundances in fecal samples in Ulcerative Colitis (UC), and Crohn's disease (CD) patients.
Phylogroup I Phylogroup II
Patients N Coef correl p-value Coef correl p-value
UC 6 0.154 0.805 0.667 0.219
CD 12 -0.127 0.695 -0.281 0.376
Median log10 16S rRNA gene copies/ million bacterial 16S rRNA gene copies ± standard
deviations
§UC, ulcerative colitis; CD, Crohn's disease
4. Medication at sampling
Finally, as far as therapies are concerned, data were analyzed taking into account the medication of the patients at the time of sampling (Table 28). No differences in F. prausnitzii phylogroups abundances were observed between medications within any disease. In contrast to biopsy, no trends between medications were observed in CD patients. Interestingly, UC patients with anti-tumor necrosis factor had similar abundances of both phylogroups in feces, to that observed in H subjects.
Table 28. F. prausnitzii phylogroups abundances (median Iog10 16S rRNA gene copies/ million bacterial 16S rRNA gene copies ± standard deviations) in inflammatory
Diagnostics8 N Phylogroup I* p-value Phylogroup II* p-value
UC
moderate immunosuppresants 1 -0.30 0.157 -0.53 0.157
Anti-tumor necrosis factor 4 4.63±0.40 3.53±1.26
CD
No treatment 2 1.71 ±3.54 0.528 2.01 ±1.46 0.891 moderate immunosuppresants 3 0.80±2.54 1.60±1.03
Anti-tumor necrosis factor 7 1.69±2.01 0.66±2.00
Median log10 16S rRNA gene copies/ million bacterial 16S rRNA gene copies ± standard deviations §UC, ulcerative colitis; CD, Crohn's disease
Finally, as regards to clinical data of the patients, we have observed that in feces both phylogroups loads remain lower under remission, which is in agreement with our results in biopsies. However, subsequent studies on larger cohorts of patients are needed to corroborate these observations, and follow up studies would also be interesting to determine their potential usefulness as a prognostic biomarker in feces.
In agreement with previous studies lower numbers of F. prausnitzii were detected in resected CD patients (Sokol, H., et al, Proc. Natl. Acad. Sci. U S A, 2008. 105(43): p. 16731-16736; Lopez-Siles, M., et al. International Journal of Medical Microbiology, 2014. 304(3-4): p. 464-475.) Our results about phylogroups load are in agreement with those observed in biopsies. In this case however, statistical significant differences were not achieved, probably because the small cohort of subjects engaged.
In general terms, we have observed that the used medication does not restore the levels of fecal F. prausnitzii phylogroups in feces of CD patients, which is in agreement with our observations based on biopsies.
Table 29. ROC curve coordinates in mucosa-associated samples for H vs IBS+IBD+CRC.
F. prausnitzii (total) Phylogroup I (PHGI) Phylogroup I (PHGII)
Sensitivity 1 - Specificity Sensitivity 1 - Specificity ^| Sensitivity 1 - Specificity
1 1 1 1 1
0.99342105 1 0.99342105 0.9787234 1
1 0.9868421 1 1 0.9868421 1 0.95744681 1
1 0.98026316 1 0.98026316 0.95744681 0.99342105
1 0.97368421 1 0.97368421 0.95744681 0.9868421 1
1 0.96710526 1 0.96710526 0.95744681 0.98026316
1 0.96052632 1 0.96052632 0.95744681 0.97368421
1 0.95394737 1 0.95394737 0.95744681 0.96710526
1 0.94736842 1 0.94736842 0.95744681 0.96052632
1 0.94078947 1 0.94078947 0.93617021 0.96052632
1 0.93421053 1 0.93421053 0.93617021 0.95394737
1 0.92763158 1 0.92763158 0.93617021 0.94736842
1 0.92105263 1 0.92105263 0.93617021 0.94078947
1 0.90131579 1 0.91447368 0.93617021 0.93421053
1 0.89473684 1 0.90789474 0.91489362 0.92763158
1 0.88815789 1 0.90131579 0.91489362 0.91447368
1 0.88157895 1 0.89473684 0.91489362 0.90789474
1 0.875 1 0.88815789 0.91489362 0.90131579
1 0.86842105 1 0.88157895 0.91489362 0.89473684
0.9787234 0.86842105 1 0.875 0.91489362 0.88815789
0.9787234 0.8618421 1 1 0.86842105 0.91489362 0.86842105
0.9787234 0.85526316 1 0.8618421 1 0.91489362 0.8618421 1
0.9787234 0.84868421 1 0.85526316 0.91489362 0.85526316
0.9787234 0.84210526 1 0.84210526 0.91489362 0.84868421
0.9787234 0.83552632 1 0.83552632 0.91489362 0.84210526
0.95744681 0.82894737 1 0.82894737 0.91489362 0.83552632
0.95744681 0.82236842 1 0.82236842 0.91489362 0.82894737
0.95744681 0.81578947 1 0.81578947 0.91489362 0.81578947
0.95744681 0.80921053 1 0.80921053 0.91489362 0.80921053
0.95744681 0.80263158 1 0.80263158 0.89361702 0.80921053
0.95744681 0.78947368 1 0.79605263 0.89361702 0.79605263
0.95744681 0.77631579 1 0.78947368 0.89361702 0.78289474
0.95744681 0.76973684 1 0.78289474 0.89361702 0.76973684
0.95744681 0.75 1 0.77631579 0.89361702 0.76315789
0.95744681 0.74342105 1 0.76973684 0.89361702 0.75657895
0.95744681 0.7368421 1 1 0.76315789 0.89361702 0.75
0.95744681 0.72368421 1 0.75657895 0.89361702 0.7368421 1
0.95744681 0.71052632 1 0.75 0.89361702 0.73026316
0.95744681 0.70394737 1 0.74342105 0.89361702 0.72368421
0.95744681 0.69078947 1 0.7368421 1 0.89361702 0.71710526
0.95744681 0.67763158 1 0.73026316 0.89361702 0.71052632
0.95744681 0.67105263 1 0.72368421 0.89361702 0.70394737
0.95744681 0.66447368 1 0.71710526 0.89361702 0.68421053
0.93617021 0.66447368 1 0.71052632 0.89361702 0.67763158 F. prausnitzii (total) Phylogroup I (PHGI) Phylogroup II (PHGII)
Sensitivity 1 - Specificity Sensitivity 1 - Specificity Sensitivity 1 - Specificity
0.93617021 0.65789474 0.70394737 0.89361702 0.67105263 0.93617021 0.65131579 0.69736842 0.89361702 0.66447368 0.93617021 0.63815789 0.69078947 0.87234043 0.66447368 0.93617021 0.63157895 0.68421053 0.87234043 0.65789474 0.93617021 0.625 0.67763158 0.87234043 0.65131579 0.93617021 0.61842105 0.67105263 0.87234043 0.64473684 0.93617021 0.61 18421 1 0.66447368 0.87234043 0.63815789 0.93617021 0.59868421 0.9787234 0.66447368 0.87234043 0.63157895 0.93617021 0.56578947 0.9787234 0.65789474 0.87234043 0.625 0.93617021 0.55921053 0.9787234 0.65131579 0.87234043 0.61842105 0.93617021 0.54605263 0.9787234 0.64473684 0.85106383 0.61842105 0.93617021 0.53947368 0.9787234 0.63815789 0.85106383 0.61 18421 1 0.93617021 0.53289474 0.9787234 0.63157895 0.85106383 0.60526316 0.93617021 0.52631579 0.95744681 0.63157895 0.82978723 0.60526316 0.91489362 0.52631579 0.95744681 0.61842105 0.82978723 0.59868421 0.89361702 0.52631579 0.95744681 0.60526316 0.82978723 0.59210526 0.87234043 0.51973684 0.95744681 0.59868421 0.82978723 0.58552632 0.87234043 0.51315789 0.95744681 0.59210526 0.82978723 0.57894737 0.87234043 0.5 0.95744681 0.58552632 0.82978723 0.57236842 0.85106383 0.5 0.95744681 0.57894737 0.80851064 0.55921053 0.82978723 0.49342105 0.93617021 0.57894737 0.78723404 0.55921053 0.80851064 0.47368421 0.93617021 0.57236842 0.76595745 0.55921053 0.78723404 0.47368421 0.93617021 0.56578947 0.76595745 0.55263158 0.76595745 0.47368421 0.93617021 0.55921053 0.74468085 0.55263158 0.74468085 0.46710526 0.93617021 0.55263158 0.74468085 0.54605263 0.74468085 0.45394737 0.93617021 0.54605263 0.74468085 0.53289474 0.74468085 0.44736842 0.93617021 0.53947368 0.74468085 0.52631579 0.74468085 0.44078947 0.93617021 0.53289474 0.74468085 0.51973684 0.74468085 0.43421053 0.93617021 0.52631579 0.74468085 0.51315789 0.74468085 0.42763158 0.91489362 0.51973684 0.74468085 0.50657895 0.72340426 0.42763158 0.91489362 0.51315789 0.74468085 0.49342105 0.72340426 0.42105263 0.91489362 0.50657895 0.74468085 0.4868421 1 0.72340426 0.41447368 0.91489362 0.5 0.74468085 0.48026316 0.72340426 0.40789474 0.91489362 0.49342105 0.70212766 0.48026316 0.68085106 0.40789474 0.91489362 0.4868421 1 0.70212766 0.46710526 0.68085106 0.40131579 0.89361702 0.4868421 1 0.70212766 0.46052632 0.68085106 0.39473684 0.87234043 0.4868421 1 0.70212766 0.45394737 0.68085106 0.38815789 0.87234043 0.48026316 0.70212766 0.44736842 0.65957447 0.375 0.85106383 0.48026316 0.70212766 0.44078947 0.63829787 0.35526316 0.82978723 0.47368421 0.70212766 0.43421053 0.63829787 0.34868421 0.82978723 0.45394737 0.70212766 0.42763158 0.63829787 0.33552632 0.82978723 0.44736842 0.70212766 0.42105263 0.63829787 0.32894737 0.82978723 0.43421053 0.70212766 0.41447368 0.61702128 0.32894737 0.82978723 0.42105263 0.70212766 0.40789474 0.61702128 0.31578947 0.82978723 0.41447368 0.68085106 0.39473684 0.61702128 0.30921053 0.82978723 0.40789474 0.68085106 0.38815789 F. prausnitzii (total) Phylogroup I (PHGI) Phylogroup I I (PHGII)
Sensitivity 1 - Specificity Sensitivity 1 - Specificity Sensitivity 1 - Specificity
0.61702128 0.30263158 0.82978723 0.40131579 0.68085106 0.38157895
0.61702128 0.28947368 0.80851064 0.39473684 0.68085106 0.375
0.61702128 0.28289474 0.78723404 0.39473684 0.68085106 0.3618421 1
0.59574468 0.26973684 0.78723404 0.38815789 0.68085106 0.35526316
0.59574468 0.26315789 0.78723404 0.375 0.68085106 0.34868421
0.57446809 0.26315789 0.78723404 0.36842105 0.68085106 0.34210526
0.55319149 0.26315789 0.78723404 0.3618421 1 0.68085106 0.33552632
0.55319149 0.24342105 0.78723404 0.35526316 0.65957447 0.33552632
0.4893617 0.24342105 0.78723404 0.34210526 0.65957447 0.32894737
0.4893617 0.2368421 1 0.78723404 0.33552632 0.65957447 0.31578947
0.4680851 1 0.2368421 1 0.78723404 0.32236842 0.65957447 0.30921053
0.4680851 1 0.19736842 0.78723404 0.30921053 0.65957447 0.29605263
0.44680851 0.19078947 0.78723404 0.30263158 0.63829787 0.29605263
0.42553191 0.19078947 0.76595745 0.30263158 0.61702128 0.27631579
0.40425532 0.19078947 0.76595745 0.28947368 0.59574468 0.27631579
0.40425532 0.18421053 0.76595745 0.27631579 0.59574468 0.26973684
0.40425532 0.17105263 0.74468085 0.26973684 0.59574468 0.26315789
0.38297872 0.15789474 0.74468085 0.26315789 0.59574468 0.25657895
0.38297872 0.14473684 0.74468085 0.25657895 0.55319149 0.25657895
0.36170213 0.13815789 0.74468085 0.25 0.55319149 0.25
0.34042553 0.13815789 0.72340426 0.25 0.55319149 0.24342105
0.34042553 0.13157895 0.70212766 0.25 0.55319149 0.23026316
0.34042553 0.125 0.70212766 0.24342105 0.53191489 0.22368421
0.29787234 0.125 0.70212766 0.2368421 1 0.5106383 0.22368421
0.27659574 0.1 1842105 0.70212766 0.22368421 0.5106383 0.21710526
0.27659574 0.1 1 18421 1 0.68085106 0.22368421 0.4893617 0.21710526
0.25531915 0.1 1 18421 1 0.68085106 0.21052632 0.4680851 1 0.21052632
0.23404255 0.09868421 0.68085106 0.20394737 0.4680851 1 0.20394737
0.23404255 0.09210526 0.68085106 0.19736842 0.4680851 1 0.19736842
0.21276596 0.08552632 0.65957447 0.19736842 0.4680851 1 0.19078947
0.21276596 0.07894737 0.65957447 0.19078947 0.4680851 1 0.17763158
0.19148936 0.07894737 0.65957447 0.17763158 0.42553191 0.17105263
0.17021277 0.07236842 0.63829787 0.17763158 0.42553191 0.15789474
0.17021277 0.06578947 0.59574468 0.17763158 0.40425532 0.15131579
0.17021277 0.05921053 0.57446809 0.17105263 0.38297872 0.15131579
0.17021277 0.05263158 0.55319149 0.17105263 0.38297872 0.13815789
0.14893617 0.05263158 0.55319149 0.16447368 0.36170213 0.13815789
0.14893617 0.04605263 0.55319149 0.15789474 0.36170213 0.13157895
0.14893617 0.03947368 0.53191489 0.15789474 0.36170213 0.125
0.14893617 0.03289474 0.53191489 0.15131579 0.36170213 0.1 1842105
0.12765957 0.03289474 0.53191489 0.14473684 0.34042553 0.1 1 18421 1
0.10638298 0.02631579 0.5106383 0.14473684 0.31914894 0.1 1 18421 1
0.08510638 0.02631579 0.5106383 0.13157895 0.31914894 0.09868421
0.06382979 0.02631579 0.4893617 0.13157895 0.29787234 0.09868421
0.06382979 0.01973684 0.4893617 0.125 0.27659574 0.09868421
0.06382979 0.01315789 0.4893617 0.1 1842105 0.27659574 0.09210526 F. prausnitzii (total) Phylogroup I (PHGI) Phylogroup I I (PHGII)
Sensitivity 1 - Specificity Sensitivity 1 - Specificity Sensitivity 1 - Specificity
0.04255319 0.00657895 0.4680851 1 0.1 1842105 0.25531915 0.09210526 0.0212766 0.00657895 0.4680851 1 0.1 1 18421 1 0.25531915 0.07894737 0 0.00657895 0.44680851 0.1 1 18421 1 0.23404255 0.07236842 0 0 0.42553191 0.1 1 18421 1 0.23404255 0.05921053
0.40425532 0.1 1 18421 1 0.23404255 0.05263158
0.38297872 0.1 1 18421 1 0.19148936 0.05263158
0.38297872 0.10526316 0.17021277 0.05263158
0.38297872 0.09210526 0.17021277 0.04605263
0.38297872 0.08552632 0.14893617 0.04605263
0.38297872 0.07894737 0.12765957 0.04605263
0.36170213 0.07236842 0.12765957 0.03947368
0.36170213 0.06578947 0.12765957 0.03289474
0.34042553 0.06578947 0.12765957 0.02631579
0.31914894 0.06578947 0.12765957 0.01973684
0.29787234 0.06578947 0.12765957 0.01315789
0.27659574 0.06578947 0.10638298 0.00657895
0.27659574 0.05263158 0.08510638 0.00657895
0.25531915 0.05263158 0.06382979 0.00657895
0.25531915 0.04605263 0.04255319 0.00657895
0.21276596 0.04605263 0.04255319 0
0.21276596 0.03947368 0.0212766 0
0.19148936 0.03947368 0 0
0.19148936 0.03289474
0.17021277 0.03289474
0.14893617 0.03289474
0.14893617 0.02631579
0.12765957 0.02631579
0.12765957 0.01973684
0.08510638 0.01973684
0.08510638 0.01315789
0.04255319 0.01315789
0.04255319 0.00657895
0.0212766 0.00657895
0 0.00657895
0 0 Table 30. ROC curve coordinates in mucosa-associated samples for H vs IBD.
F. prausnitzii (total) Phylogroup I (PHGI) Phylogroup II (PHGII)
Sensitivity 1 - Specificity Sensitivity 1 - Specificity ^| Sensitivity 1 - Specificity
1 1 1 1 1
0.991 15044 1 0.991 15044 0.9787234 1
1 0.98230088 1 0.98230088 0.95744681 1
1 0.97345133 1 0.97345133 0.95744681 0.991 15044
1 0.96460177 1 0.96460177 0.95744681 0.98230088
1 0.95575221 1 0.95575221 0.95744681 0.97345133
1 0.94690265 1 0.94690265 0.95744681 0.96460177
1 0.9380531 1 0.9380531 0.95744681 0.95575221
1 0.92920354 1 0.92920354 0.95744681 0.94690265
1 0.92035398 1 0.92035398 0.93617021 0.94690265
1 0.91 150442 1 0.91 150442 0.93617021 0.9380531
1 0.90265487 1 0.90265487 0.93617021 0.92920354
1 0.87610619 1 0.89380531 0.93617021 0.92035398
1 0.86725664 1 0.88495575 0.93617021 0.91 150442
1 0.85840708 1 0.87610619 0.91489362 0.90265487
1 0.84955752 1 0.86725664 0.91489362 0.88495575
1 0.84070796 1 0.85840708 0.91489362 0.87610619
1 0.83185841 1 0.84955752 0.91489362 0.86725664
0.9787234 0.83185841 1 0.84070796 0.91489362 0.84070796
0.9787234 0.82300885 1 0.83185841 0.91489362 0.83185841
0.9787234 0.81415929 1 0.82300885 0.91489362 0.82300885
0.9787234 0.80530973 1 0.81415929 0.91489362 0.81415929
0.9787234 0.79646018 1 0.80530973 0.91489362 0.79646018
0.95744681 0.79646018 1 0.78761062 0.91489362 0.78761062
0.95744681 0.78761062 1 0.77876106 0.89361702 0.78761062
0.95744681 0.77876106 1 0.76991 15 0.89361702 0.77876106
0.95744681 0.76991 15 1 0.76106195 0.89361702 0.76106195
0.95744681 0.75221239 1 0.75221239 0.89361702 0.75221239
0.95744681 0.74336283 1 0.74336283 0.89361702 0.74336283
0.95744681 0.73451327 1 0.73451327 0.89361702 0.73451327
0.95744681 0.71681416 1 0.72566372 0.89361702 0.72566372
0.95744681 0.7079646 1 0.71681416 0.89361702 0.71681416
0.95744681 0.6991 1504 1 0.7079646 0.89361702 0.7079646
0.95744681 0.68141593 1 0.6991 1504 0.89361702 0.6991 1504
0.95744681 0.66371681 1 0.69026549 0.89361702 0.69026549
0.95744681 0.6460177 1 0.68141593 0.89361702 0.67256637
0.95744681 0.63716814 1 0.67256637 0.89361702 0.66371681
0.93617021 0.63716814 1 0.66371681 0.89361702 0.65486726
0.93617021 0.62831858 1 0.65486726 0.89361702 0.6460177
0.93617021 0.61061947 1 0.6460177 0.87234043 0.6460177
0.93617021 0.60176991 1 0.63716814 0.87234043 0.63716814
0.93617021 0.59292035 1 0.62831858 0.87234043 0.62831858
0.93617021 0.5840708 1 0.61946903 0.87234043 0.61946903
0.93617021 0.57522124 1 0.61061947 0.87234043 0.61061947 F. prausnitzii (total) Phylogroup I (PHGI) Phylogroup II (PHGII)
Sensitivity 1 - Specificity Sensitivity 1 - Specificity Sensitivity 1 - Specificity
0.93617021 0.53982301 1 0.60176991 0 .87234043 0.60176991
0.93617021 0.53097345 0.9787234 0.60176991 0 .87234043 0.59292035
0.93617021 0.52212389 0.9787234 0.59292035 0 .85106383 0.59292035
0.93617021 0.51327434 0.9787234 0.5840708 0 .85106383 0.5840708
0.93617021 0.50442478 0.9787234 0.57522124 0 .82978723 0.5840708
0.91489362 0.50442478 0.9787234 0.56637168 0 .82978723 0.57522124
0.89361702 0.50442478 0.95744681 0.56637168 0 .82978723 0.56637168
0.87234043 0.49557522 0.95744681 0.55752212 0 .82978723 0.55752212
0.87234043 0.48672566 0.95744681 0.54867257 0 .82978723 0.54867257
0.85106383 0.48672566 0.95744681 0.53982301 0 .80851064 0.53982301
0.82978723 0.4778761 1 0.95744681 0.53097345 0 .78723404 0.53982301
0.80851064 0.46902655 0.95744681 0.52212389 0 .76595745 0.53982301
0.78723404 0.46902655 0.93617021 0.52212389 0 .74468085 0.53982301
0.76595745 0.46902655 0.93617021 0.51327434 0 .74468085 0.53097345
0.74468085 0.46017699 0.93617021 0.50442478 0 .74468085 0.52212389
0.74468085 0.44247788 0.93617021 0.49557522 0 .74468085 0.51327434
0.74468085 0.43362832 0.93617021 0.48672566 0 .74468085 0.49557522
0.72340426 0.43362832 0.91489362 0.4778761 1 0 .74468085 0.48672566
0.72340426 0.42477876 0.91489362 0.46902655 0 .74468085 0.4778761 1
0.72340426 0.4159292 0.91489362 0.46017699 0 .70212766 0.4778761 1
0.68085106 0.4159292 0.91489362 0.45132743 0 .70212766 0.46902655
0.68085106 0.40707965 0.91489362 0.44247788 0 .70212766 0.46017699
0.68085106 0.39823009 0.89361702 0.44247788 0 .70212766 0.45132743
0.65957447 0.38938053 0.87234043 0.44247788 0 .70212766 0.44247788
0.63829787 0.37168142 0.87234043 0.43362832 0 .70212766 0.43362832
0.63829787 0.36283186 0.85106383 0.43362832 0 .70212766 0.42477876
0.63829787 0.3539823 0.82978723 0.42477876 0 .70212766 0.4159292
0.63829787 0.34513274 0.82978723 0.39823009 0 .70212766 0.40707965
0.61702128 0.34513274 0.82978723 0.38053097 0 .70212766 0.39823009
0.61702128 0.32743363 0.82978723 0.37168142 0 .68085106 0.39823009
0.61702128 0.31858407 0.82978723 0.36283186 0 .68085106 0.38938053
0.61702128 0.30973451 0.80851064 0.3539823 0 .68085106 0.38053097
0.61702128 0.30088496 0.78723404 0.3539823 0 .68085106 0.37168142
0.61702128 0.2920354 0.78723404 0.33628319 0 .68085106 0.36283186
0.59574468 0.27433628 0.78723404 0.32743363 0 .68085106 0.3539823
0.59574468 0.26548673 0.78723404 0.31858407 0 .68085106 0.34513274
0.57446809 0.26548673 0.78723404 0.30088496 0 .68085106 0.33628319
0.55319149 0.26548673 0.78723404 0.2920354 0 .68085106 0.32743363
0.55319149 0.25663717 0.78723404 0.27433628 0 .65957447 0.32743363
0.4893617 0.25663717 0.78723404 0.26548673 0 .65957447 0.30973451
0.4680851 1 0.25663717 0.76595745 0.26548673 0 .65957447 0.30088496
0.4680851 1 0.22123894 0.76595745 0.25663717 0 .65957447 0.28318584
0.44680851 0.21238938 0.76595745 0.24778761 0 .63829787 0.28318584
0.42553191 0.21238938 0.74468085 0.24778761 0 .61702128 0.26548673
0.40425532 0.21238938 0.74468085 0.23893805 0 .59574468 0.26548673
0.40425532 0.20353982 0.72340426 0.23893805 0 .59574468 0.25663717 F. prausnitzii (total) Phylogroup I (PHGI) Phylogroup II (PHGII)
Sensitivity 1 - Specificity Sensitivity 1 - Specificity Sensitivity 1 - Specificity
0.40425532 0.19469027 0.70212766 0.23893805 0.59574468 0.24778761
0.38297872 0.18584071 0.70212766 0.2300885 0.55319149 0.24778761
0.38297872 0.16814159 0.70212766 0.22123894 0.55319149 0.23893805
0.36170213 0.15929204 0.68085106 0.22123894 0.55319149 0.2300885
0.34042553 0.15929204 0.68085106 0.21238938 0.53191489 0.22123894
0.34042553 0.15044248 0.68085106 0.20353982 0.5106383 0.22123894
0.34042553 0.14159292 0.65957447 0.20353982 0.5106383 0.21238938
0.29787234 0.14159292 0.65957447 0.19469027 0.4893617 0.21238938
0.27659574 0.13274336 0.65957447 0.176991 15 0.4680851 1 0.20353982
0.27659574 0.12389381 0.63829787 0.176991 15 0.4680851 1 0.19469027
0.25531915 0.12389381 0.59574468 0.176991 15 0.4680851 1 0.18584071
0.23404255 0.10619469 0.57446809 0.16814159 0.4680851 1 0.16814159
0.21276596 0.09734513 0.55319149 0.16814159 0.42553191 0.16814159
0.21276596 0.08849558 0.55319149 0.15929204 0.42553191 0.15929204
0.19148936 0.08849558 0.53191489 0.15929204 0.40425532 0.15044248
0.17021277 0.07964602 0.53191489 0.15044248 0.38297872 0.15044248
0.17021277 0.07079646 0.53191489 0.14159292 0.38297872 0.13274336
0.17021277 0.0619469 0.5106383 0.14159292 0.36170213 0.13274336
0.14893617 0.0619469 0.5106383 0.12389381 0.36170213 0.12389381
0.14893617 0.05309735 0.4893617 0.12389381 0.36170213 0.1 1504425
0.14893617 0.04424779 0.4680851 1 0.12389381 0.34042553 0.10619469
0.12765957 0.04424779 0.4680851 1 0.1 1504425 0.31914894 0.10619469
0.10638298 0.03539823 0.44680851 0.1 1504425 0.31914894 0.09734513
0.08510638 0.03539823 0.42553191 0.1 1504425 0.29787234 0.09734513
0.06382979 0.03539823 0.40425532 0.1 1504425 0.27659574 0.09734513
0.06382979 0.02654867 0.38297872 0.1 1504425 0.25531915 0.09734513
0.06382979 0.01769912 0.38297872 0.09734513 0.25531915 0.08849558
0.04255319 0.00884956 0.38297872 0.08849558 0.23404255 0.07964602
0.0212766 0.00884956 0.38297872 0.07964602 0.23404255 0.0619469
0 0.00884956 0.36170213 0.07964602 0.23404255 0.05309735
0 0 0.36170213 0.07079646 0.19148936 0.05309735
0.34042553 0.07079646 0.17021277 0.05309735
0.31914894 0.07079646 0.17021277 0.04424779
0.29787234 0.07079646 0.14893617 0.04424779
0.27659574 0.07079646 0.12765957 0.04424779
0.27659574 0.05309735 0.12765957 0.03539823
0.25531915 0.05309735 0.12765957 0.02654867
0.25531915 0.04424779 0.12765957 0.01769912
0.21276596 0.04424779 0.10638298 0.00884956
0.21276596 0.03539823 0.08510638 0.00884956
0.19148936 0.03539823 0.06382979 0.00884956
0.17021277 0.03539823 0.04255319 0.00884956
0.14893617 0.03539823 0.04255319 0
0.14893617 0.02654867 0.0212766 0
0.12765957 0.02654867 0 0
0.12765957 0.01769912 F. prausnitzii (total) Phylogroup I (PHGI) Phylogroup II (PHGII)
Sensitivity 1 - Specificity Sensitivity 1 - Specificity Sensitivity 1 - Specificity
0.08510638 0.01769912
0.04255319 0.01769912
0.04255319 0.00884956
0.0212766 0.00884956
0 0.00884956
0 0
Table 31. ROC curve coordinates in mucosa-associated samples for H vs CD.
F. prausnitzii (total) Phylogroup I (PHGI) Phylogroup I I (PHGII)
Sensitivity 1 - Specificity Sensitivity 1 - Specificity Sensitivity 1 - Specificity
1 1 1 1 1 1
1 0.98412698 1 0.98412698 0.9787234 1
1 0.96825397 1 0.96825397 0.95744681 1
1 0.95238095 1 0.95238095 0.95744681 0.98412698
1 0.93650794 1 0.93650794 0.95744681 0.96825397
1 0.92063492 1 0.92063492 0.95744681 0.95238095
1 0.9047619 1 0.9047619 0.95744681 0.93650794
1 0.88888889 1 0.88888889 0.95744681 0.92063492
1 0.87301587 1 0.87301587 0.95744681 0.9047619
1 0.85714286 1 0.85714286 0.93617021 0.9047619
1 0.84126984 1 0.84126984 0.93617021 0.88888889
1 0.82539683 1 0.82539683 0.93617021 0.87301587
1 0.77777778 1 0.80952381 0.93617021 0.85714286
1 0.76190476 1 0.79365079 0.91489362 0.84126984
1 0.74603175 1 0.77777778 0.91489362 0.80952381
1 0.73015873 1 0.76190476 0.91489362 0.79365079
1 0.71428571 1 0.74603175 0.91489362 0.77777778
0.9787234 0.71428571 1 0.73015873 0.91489362 0.74603175
0.9787234 0.6984127 1 0.71428571 0.91489362 0.73015873
0.9787234 0.68253968 1 0.6984127 0.91489362 0.71428571
0.9787234 0.66666667 1 0.68253968 0.91489362 0.6984127
0.95744681 0.66666667 1 0.66666667 0.89361702 0.6984127
0.95744681 0.65079365 1 0.65079365 0.89361702 0.68253968
0.95744681 0.63492063 1 0.63492063 0.89361702 0.65079365
0.95744681 0.61904762 1 0.61904762 0.89361702 0.63492063
0.95744681 0.6031746 1 0.6031746 0.89361702 0.61904762
0.95744681 0.58730159 1 0.58730159 0.89361702 0.6031746
0.95744681 0.57142857 1 0.57142857 0.89361702 0.58730159
0.95744681 0.53968254 1 0.55555556 0.89361702 0.57142857
0.95744681 0.50793651 1 0.53968254 0.89361702 0.55555556
0.95744681 0.49206349 1 0.52380952 0.89361702 0.53968254
0.93617021 0.49206349 1 0.50793651 0.89361702 0.52380952
0.93617021 0.47619048 1 0.49206349 0.89361702 0.50793651
0.93617021 0.46031746 1 0.47619048 0.89361702 0.49206349
0.93617021 0.44444444 1 0.46031746 0.87234043 0.49206349
0.93617021 0.42857143 1 0.44444444 0.87234043 0.47619048
0.93617021 0.41269841 0.9787234 0.44444444 0.87234043 0.46031746
0.93617021 0.3968254 0.9787234 0.42857143 0.87234043 0.44444444
0.91489362 0.3968254 0.9787234 0.41269841 0.87234043 0.42857143
0.89361702 0.3968254 0.95744681 0.41269841 0.85106383 0.42857143
0.87234043 0.38095238 0.95744681 0.3968254 0.85106383 0.41269841
0.85106383 0.38095238 0.95744681 0.38095238 0.82978723 0.41269841
0.82978723 0.38095238 0.95744681 0.36507937 0.82978723 0.3968254
0.80851064 0.38095238 0.93617021 0.36507937 0.82978723 0.38095238 F. prausnitzii (total) Phylogroup I (PHGI) Phylogroup I (PHGII)
Sensitivity 1 - Specificity ^| Sensitivity 1 - Specificity ^| Sensitivity 1 - Specificity
0.78723404 0.38095238 0.93617021 0.34920635 0.80851064 0.38095238
0.76595745 0.38095238 0.93617021 0.33333333 0.78723404 0.38095238
0.74468085 0.38095238 0.93617021 0.31746032 0.76595745 0.38095238
0.74468085 0.34920635 0.91489362 0.3015873 0.74468085 0.38095238
0.72340426 0.34920635 0.91489362 0.28571429 0.74468085 0.36507937
0.68085106 0.34920635 0.91489362 0.26984127 0.74468085 0.34920635
0.68085106 0.33333333 0.89361702 0.26984127 0.70212766 0.34920635
0.65957447 0.31746032 0.87234043 0.26984127 0.70212766 0.33333333
0.63829787 0.3015873 0.85106383 0.26984127 0.70212766 0.31746032
0.63829787 0.28571429 0.82978723 0.26984127 0.70212766 0.3015873
0.63829787 0.26984127 0.82978723 0.25396825 0.70212766 0.28571429
0.61702128 0.26984127 0.80851064 0.25396825 0.68085106 0.28571429
0.61702128 0.25396825 0.78723404 0.25396825 0.68085106 0.26984127
0.61702128 0.23809524 0.78723404 0.23809524 0.68085106 0.25396825
0.59574468 0.23809524 0.78723404 0.22222222 0.65957447 0.25396825
0.57446809 0.23809524 0.78723404 0.20634921 0.65957447 0.22222222
0.55319149 0.23809524 0.78723404 0.19047619 0.65957447 0.20634921
0.4893617 0.23809524 0.78723404 0.15873016 0.63829787 0.20634921
0.4680851 1 0.23809524 0.76595745 0.15873016 0.61702128 0.19047619
0.4680851 1 0.22222222 0.74468085 0.15873016 0.59574468 0.19047619
0.44680851 0.20634921 0.72340426 0.15873016 0.55319149 0.19047619
0.42553191 0.20634921 0.70212766 0.15873016 0.55319149 0.17460317
0.40425532 0.20634921 0.68085106 0.15873016 0.53191489 0.17460317
0.38297872 0.19047619 0.65957447 0.15873016 0.5106383 0.17460317
0.36170213 0.17460317 0.65957447 0.14285714 0.4893617 0.17460317
0.34042553 0.17460317 0.63829787 0.14285714 0.4680851 1 0.15873016
0.34042553 0.15873016 0.59574468 0.14285714 0.4680851 1 0.14285714
0.29787234 0.15873016 0.57446809 0.12698413 0.4680851 1 0.12698413
0.27659574 0.15873016 0.55319149 0.12698413 0.42553191 0.12698413
0.25531915 0.15873016 0.53191489 0.12698413 0.40425532 0.12698413
0.23404255 0.14285714 0.5106383 0.12698413 0.38297872 0.12698413
0.21276596 0.12698413 0.5106383 0.1 1 1 1 1 1 1 1 0.36170213 0.12698413
0.19148936 0.12698413 0.4893617 0.1 1 1 1 1 1 1 1 0.36170213 0.1 1 1 1 1 1 1 1
0.17021277 0.1 1 1 1 1 1 1 1 0.4680851 1 0.1 1 1 1 1 1 1 1 0.34042553 0.0952381
0.17021277 0.0952381 0.44680851 0.1 1 1 1 1 1 1 1 0.31914894 0.0952381
0.14893617 0.0952381 0.42553191 0.1 1 1 1 1 1 1 1 0.29787234 0.0952381
0.14893617 0.07936508 0.40425532 0.1 1 1 1 1 1 1 1 0.27659574 0.0952381
0.12765957 0.07936508 0.38297872 0.1 1 1 1 1 1 1 1 0.25531915 0.0952381
0.10638298 0.06349206 0.38297872 0.0952381 0.23404255 0.0952381
0.08510638 0.06349206 0.36170213 0.0952381 0.23404255 0.07936508
0.06382979 0.06349206 0.36170213 0.07936508 0.23404255 0.06349206
0.06382979 0.04761905 0.34042553 0.07936508 0.19148936 0.06349206
0.06382979 0.03174603 0.31914894 0.07936508 0.17021277 0.06349206
0.04255319 0.01587302 0.29787234 0.07936508 0.14893617 0.06349206
0.0212766 0.01587302 0.27659574 0.07936508 0.12765957 0.06349206
0 0.01587302 0.27659574 0.06349206 0.12765957 0.04761905 F. prausnitzii (total) Phylogroup 1 (PHGI) Phylogroup I I (PHGII)
Sensitivity 1 - Specificity Sensitivity 1 - Specificity Sensitivity 1 - Specificity
0 0 0.25531915 0.06349206 0.12765957 0.03174603
0.21276596 0.06349206 0.10638298 0.01587302
0.19148936 0.06349206 0.08510638 0.01587302
0.17021277 0.06349206 0.06382979 0.01587302
0.14893617 0.06349206 0.04255319 0.01587302
0.14893617 0.04761905 0.04255319 0
0.12765957 0.04761905 0.0212766 0
0.12765957 0.03174603 0 0
0.08510638 0.03174603
0.04255319 0.03174603
0.04255319 0.01587302
0.0212766 0.01587302
0 0.01587302
0 0
Table 32. ROC curve coordinates i mucosa-associated samples for vs l-CD. F. prausnitzii (total) Phylogroup I (PHGI) Phylogroup II (PHGII)
Sensitivity 1 - Specificity Sensitivity 1 - Specificity Sensitivity 1 - Specificity
1 1 1 1 1 1
1 0.96 1 0.96 0.9787234 1
1 0.92 1 0.92 0.95744681 1
1 0.88 1 0.88 0.95744681 0.96
1 0.84 1 0.84 0.95744681 0.92
1 0.8 1 0.8 0.95744681 0.88
1 0.76 1 0.76 0.93617021 0.88
1 0.72 1 0.72 0.93617021 0.84
1 0.68 1 0.68 0.93617021 0.8
1 0.6 1 0.64 0.91489362 0.76
1 0.56 1 0.6 0.91489362 0.72
0.9787234 0.56 1 0.56 0.91489362 0.68
0.9787234 0.52 1 0.52 0.91489362 0.64
0.95744681 0.52 1 0.48 0.91489362 0.6
0.95744681 0.48 1 0.44 0.89361702 0.6
0.95744681 0.44 1 0.4 0.89361702 0.56
0.95744681 0.4 1 0.36 0.89361702 0.52
0.95744681 0.36 1 0.32 0.89361702 0.48
0.95744681 0.32 1 0.28 0.89361702 0.44
0.93617021 0.32 0.9787234 0.28 0.89361702 0.4
0.93617021 0.28 0.9787234 0.24 0.87234043 0.4
0.93617021 0.24 0.95744681 0.24 0.87234043 0.36
0.91489362 0.24 0.93617021 0.24 0.85106383 0.36
0.89361702 0.24 0.93617021 0.2 0.82978723 0.36
0.87234043 0.24 0.93617021 0.16 0.82978723 0.32
0.85106383 0.24 0.91489362 0.16 0.80851064 0.32
0.82978723 0.24 0.91489362 0.12 0.78723404 0.32
0.80851064 0.24 0.89361702 0.12 0.76595745 0.32
0.78723404 0.24 0.87234043 0.12 0.74468085 0.32
0.76595745 0.24 0.85106383 0.12 0.74468085 0.28
0.74468085 0.24 0.82978723 0.12 0.70212766 0.28
0.74468085 0.16 0.80851064 0.12 0.68085106 0.28
0.72340426 0.16 0.78723404 0.12 0.68085106 0.24
0.68085106 0.16 0.78723404 0.08 0.65957447 0.24
0.65957447 0.12 0.78723404 0.04 0.65957447 0.2
0.63829787 0.12 0.76595745 0.04 0.65957447 0.16
0.61702128 0.12 0.74468085 0.04 0.63829787 0.16
0.61702128 0.08 0.72340426 0.04 0.61702128 0.16
0.59574468 0.08 0.70212766 0.04 0.59574468 0.16
0.57446809 0.08 0.68085106 0.04 0.55319149 0.16
0.55319149 0.08 0.65957447 0.04 0.53191489 0.16
0.4893617 0.08 0.63829787 0.04 0.5106383 0.16
0.4680851 1 0.08 0.59574468 0.04 0.4893617 0.16
0.4680851 1 0.04 0.57446809 0.04 0.4680851 1 0.16 F. prausnitzii (total) Phylogroup I (PHGI) Phylogroup II (PHGII)
Sensitivity 1 - Specificity Sensitivity 1 - Specificity Sensitivity 1 - Specificity
0.44680851 0.04 0.55319149 0. .04 0.4680851 1 0. .12
0.42553191 0.04 0.53191489 0. .04 0.42553191 0. .12
0.40425532 0.04 0.5106383 0. .04 0.40425532 0. .12
0.38297872 0.04 0.4893617 0. .04 0.38297872 0. .12
0.36170213 0.04 0.4680851 1 0. .04 0.36170213 0. .12
0.34042553 0.04 0.44680851 0. .04 0.34042553 0. .12
0.29787234 0.04 0.42553191 0. .04 0.31914894 0. .12
0.27659574 0.04 0.40425532 0. .04 0.29787234 0. .12
0.25531915 0.04 0.38297872 0. .04 0.27659574 0. .12
0.23404255 0.04 0.36170213 0. .04 0.25531915 0. .12
0.21276596 0.04 0.36170213 0 0.23404255 0. .12
0.19148936 0.04 0.34042553 0 0.23404255 0. .08
0.17021277 0.04 0.31914894 0 0.23404255 0. .04
0.14893617 0.04 0.29787234 0 0.19148936 0. .04
0.12765957 0.04 0.27659574 0 0.17021277 0. .04
0.10638298 0.04 0.25531915 0 0.14893617 0. .04
0.08510638 0.04 0.21276596 0 0.12765957 0. .04
0.06382979 0.04 0.19148936 0 0.12765957 0
0.04255319 0.04 0.17021277 0 0.10638298 0
0.0212766 0.04 0.14893617 0 0.08510638 0
0 0.04 0.12765957 0 0.06382979 0
0 0 0.08510638 0 0.04255319 0
0.04255319 0 0.0212766 0
0.0212766 0 0 0
0 0
Table 33. ROC curve coordinates in mucosa-associated samples for E3 vs C-CD.
F. prausnitzii (total) Phylogroup I (PHGI) Phylogroup II (PHGII)
Sensitivity 1 - Specificity Sensitivity 1 - Spi i ilii il y ^^^^W Ί ιι Mikity 1 - Specificity
1 1 1 1 1 1
1 0.941 17647 1 0.941 17647 1 0.941 17647
1 0.88235294 1 0.88235294 1 0.88235294
1 0.82352941 1 0.82352941 1 0.82352941
0.9 0.82352941 1 0.76470588 0.9 0.76470588
0.9 0.76470588 1 0.70588235 0.9 0.70588235
0.9 0.70588235 1 0.64705882 0.9 0.64705882
0.9 0.64705882 0.9 0.64705882 0.9 0.58823529
0.9 0.58823529 0.8 0.64705882 0.8 0.58823529
0.8 0.58823529 0.7 0.64705882 0.8 0.52941 176
0.7 0.58823529 0.6 0.64705882 0.7 0.52941 176
0.7 0.52941 176 0.6 0.58823529 0.7 0.47058824
0.7 0.47058824 0.5 0.58823529 0.7 0.41 176471
0.7 0.41 176471 0.5 0.52941 176 0.7 0.352941 18
0.6 0.41 176471 0.4 0.52941 176 0.6 0.352941 18
0.5 0.41 176471 0.4 0.47058824 0.6 0.2941 1765
0.5 0.352941 18 0.4 0.41 176471 0.5 0.2941 1765
0.4 0.352941 18 0.4 0.352941 18 0.5 0.23529412
0.3 0.352941 18 0.4 0.23529412 0.4 0.23529412
0.2 0.2941 1765 0.3 0.23529412 0.4 0.17647059
0.2 0.23529412 0.3 0.17647059 0.4 0.1 1764706
0.1 0.23529412 0.3 0.1 1764706 0.3 0.1 1764706
0.1 0.17647059 0.2 0.1 1764706 0.3 0.05882353
0 0.17647059 0.1 0.05882353 0.2 0.05882353
0 0.1 1764706 0 0.05882353 0.1 0.05882353
0 0.05882353 0 0 0 0.05882353
0 0 0 0
Table 34. ROC curve coordinates in mucosa-associated samples for I ) vs IC-CD. F. prausnitzii (total) Phylogroup I (PHGI) Phylogroup II (PHGII)
Sensitivity 1 - Specificity Sensitivity 1 - Specificity Sensitivity 1 - Specificity
1 1 1 1 1 1
1 0.96 1 0.96 1 0.96
1 0.92 0.94444444 0.96 1 0.92
1 0.88 0.94444444 0.92 0.94444444 0.92
1 0.84 0.94444444 0.88 0.94444444 0.88
1 0.8 0.94444444 0.84 0.94444444 0.84
1 0.76 0.94444444 0.8 0.94444444 0.8
0.94444444 0.76 0.94444444 0.76 0.88888889 0.8
0.94444444 0.72 0.88888889 0.76 0.88888889 0.76
0.94444444 0.68 0.88888889 0.72 0.83333333 0.76
0.88888889 0.68 0.88888889 0.68 0.83333333 0.72
0.83333333 0.6 0.83333333 0.68 0.77777778 0.72
0.77777778 0.6 0.83333333 0.64 0.77777778 0.68
0.77777778 0.56 0.83333333 0.6 0.77777778 0.64
0.72222222 0.56 0.83333333 0.56 0.77777778 0.6
0.66666667 0.56 0.77777778 0.56 0.72222222 0.6
0.66666667 0.52 0.72222222 0.56 0.72222222 0.56
0.61111111 0.52 0.66666667 0.56 0.66666667 0.56
0.61111111 0.48 0.66666667 0.52 0.66666667 0.52
0.55555556 0.48 0.66666667 0.48 0.66666667 0.48
0.55555556 0.44 0.66666667 0.44 0.61111111 0.48
0.55555556 0.4 0.66666667 0.4 0.55555556 0.48
0.55555556 0.36 0.61111111 0.4 0.5 0.48
0.5 0.32 0.55555556 0.4 0.5 0.44
0.44444444 0.32 0.55555556 0.36 0.44444444 0.44
0.44444444 0.28 0.55555556 0.32 0.44444444 0.4
0.38888889 0.28 0.55555556 0.28 0.44444444 0.36
0.33333333 0.28 0.5 0.28 0.38888889 0.36
0.33333333 0.24 0.5 0.24 0.33333333 0.36
0.27777778 0.24 0.44444444 0.24 0.27777778 0.36
0.27777778 0.16 0.38888889 0.24 0.22222222 0.36
0.27777778 0.12 0.38888889 0.2 0.22222222 0.32
0.22222222 0.12 0.38888889 0.16 0.22222222 0.28
0.22222222 0.08 0.33333333 0.16 0.16666667 0.28
0.16666667 0.08 0.33333333 0.12 0.16666667 0.24
0.16666667 0.04 0.27777778 0.12 0.11111111 0.2
0.11111111 0.04 0.22222222 0.12 0.11111111 0.16
0.05555556 0.04 0.16666667 0.12 0.05555556 0.16
0 0.04 0.16666667 0.08 0.05555556 0.12
0 0 0.16666667 0.04 0 0.12
0.11111111 0.04 0 0.08
0.11111111 0 0 0.04
0.05555556 0 0 0 Table 35. ROC curve coordinates in mucosa-associated samples for C-CD vs IC-CD.
F, prausnitzu ( total} Phylogroup l fPHGl) Phylogrou ll (PHGII)
Sensitivity 1 - Specificity Sensitivity 1 - Specificity Sensitivity 1 - Specificity
1 1 1 1 1 1
1 0.94444444 1 0.94444444 0.94117647 1
0.94117547 0.94444444 0.94117647 0.94444444 0.88235294 1
0.94117647 0.88888889 0.88235294 0.94444444 0.88235294 0.94444444
0.94117647 0.83333333 0.82352941 0.94444444 0.88235294 0.88888889
0.8.8235294 0.83333333 0.82352941 0.88888889 0,82352941 0,83333333
0.88235294 0.77777778 0.76470588 0.88888889 0.82352941 0.77777778
0.88235294 0.72222222 0.76470588 0.83333333 0.76470588 0.77777778
0.88235294 0.66666667 0.76470588 0.77777778 0.76470588 0.72222222
0.82352941 0.66666667 0.70588235 0.77777778 0.70588235 0,66666667
Q.82352941 0,61111111 0.70588235 0.72222222 0.70588235 0.61111111
0.76470588 0.61111111 0.64705882 0.72222222 0.70588235 0.55555556
0.76470588 0.55555556 0.64705882 0.66666667 0.70588235 0.5
Q.70588235 0.55555556 0.5.8823529 0,66666667 0,64705882 0.5
0.70588235 0.5 0.58823529 0.61111111 0.58823529 0.5
0.647058.82 0.5 0.58823529 0.55555556 0.58823529 0,44444444
0.647058.82 0.44444444 0.52941176 0.55555556 0.58823529 0.38888889
0.58823529 0.44444444 0.52941176 0.5 0.58823529 0.33333333
0.58823529 0.38888889 0.52941176 0.44444444 0.58823529 0.27777778
0.588235.29 0.3.3.333333 0.52941176 0.38888889 0.58823529 0.22222222
0.58823529 0.27777778 0.47058824 0.38888889 0.52941176 0.22222222
Q.52941176 0.27777778 0.41176471 0.38888889 0.47058824 0.22222222
0.47058824 0.27777778 0.41176471 0.33333333 0.47058824 0.16666667
0.47058824 0.22222222 0.41176471 0.27777778 0.41176471 0.16666667
0.41176471 0.22222222 0.41176471 0.22222222 0.35294118 0.16666667
0.41176471 0.16666667 0.41176471 0.16666667 0.29411765 0.16666667
0.35294118 0.16666667 0.35294118 0.16666667 0.29411765 0.11111111
Q.35294118 0.11111111 0.23529412 0.16666667 0.23529412 0.11111111
0.29411765 0.11111111 0.17647059 0.16666667 0.17647059 0.11111111
0.23529412 0.11111111 0.11764706 0.16666667 0.17647059 0.05555556
0.17647059 Q. Ill 11111 0.11764706 0.11111111 0.11764706 0.05555556
0.11764706 0.11111111 0.05882353 0.11111111 0.05882353 0.05555556
0.05882353 0.11111111 0 0.11111111 0.05882353 0
0 0.11111111 0 0.0555555-6 0 0
0 0.05555556 0 0
0 0 Table 36. ROC curve coordinates in faecal samples for comparison H vs IBD.
F. prausnitzii (total) Phylogroup I (PHGI) Phylogroup II (PHGII) vity 1■ ■ Specificity Sensitivity 1 - Specificity Sensitivity 1 - Specificity
1 1 1 1 1 1
1 0,95 1 0,94444444 1 0,94444444
1 0,9 1 0,88888889 1 0,88888889
1 0,85 1 0,83333333 1 0,83333333
1 0,8 1 0,77777778 1 0,77777778
1 0,75 1 0,72222222 1 0,72222222
1 0,7 1 0,66666667 1 0,66666667
1 0,65 1 0,61111111 1 0,61111111
1 0,6 1 0,55555556 1 0,55555556
1 0,55 1 0,5 1 0,5
1 0,5 0,91666667 0,5 1 0,44444444
1 0,45 0,83333333 0,5 0,91666667 0,44444444
0,8 0,45 0,75 0,5 0,83333333 0,44444444
0,6 0,45 0,75 0,44444444 0,75 0,44444444
0,4 0,45 0,66666667 0,44444444 0,66666667 0,44444444
0,2 0,45 0,66666667 0,38888889 0,66666667 0,38888889
0,2 0,4 0,66666667 0,33333333 0,58333333 0,38888889
0 0,4 0,66666667 0,27777778 0,58333333 0,33333333
0 0,35 0,58333333 0,27777778 0,5 0,33333333
0 0,3 0,5 0,22222222 0,5 0,27777778
0 0,25 0,41666667 0,22222222 0,41666667 0,27777778
0 0,15 0,33333333 0,22222222 0,33333333 0,27777778
0 0,1 0,25 0,22222222 0,25 0,27777778
0 0,05 0,25 0,16666667 0,16666667 0,27777778
0 0 0,16666667 0,16666667 0,16666667 0,22222222
0,16666667 0,11111111 0,16666667 0,16666667
0,16666667 0,05555556 0,08333333 0,16666667
0,08333333 0,05555556 0,08333333 0,05555556
0,08333333 0 0,08333333 0
0 0 0 0
Table 37. ROC curve coordinates in faecal samples for comparison H vs CD.
F. prausnitzii (total) Phylogroup I (PHGI) Phylogroup II (PHGII)
Sensitivity 1 - Specificity Sensitivity 1 - Spi i ilii il y ^^^^W Ί ιι Mikity 1 - Specificity
1 1 1 1 1 1
1 0.91666667 1 0.91666667 1 0.91666667
1 0.83333333 1 0.83333333 1 0.83333333
1 0.75 1 0.75 1 0.75
1 0.66666667 1 0.66666667 1 0.66666667
1 0.58333333 1 0.58333333 1 0.58333333
1 0.5 1 0.5 1 0.5
1 0.41666667 1 0.41666667 1 0.41666667
0.8 0.41666667 0.8 0.41666667 0.8 0.41666667
0.6 0.41666667 0.6 0.41666667 0.6 0.41666667
0.4 0.41666667 0.4 0.41666667 0.4 0.41666667
0.2 0.41666667 0.4 0.33333333 0.4 0.33333333
0.2 0.33333333 0.2 0.33333333 0.4 0.25
0 0.33333333 0.2 0.25 0.2 0.25
0 0.25 0.2 0.16666667 0 0.25
0 0.16666667 0 0.16666667 0 0.16666667
0 0.08333333 0 0.08333333 0 0.08333333
0 0 0 0 0 0
Table 38. ROC curve coordinates in faecal samples for comparison H vs l-CD.
F. prausnitzii (total) Phylogroup I (PHGI) Phylogroup II (PHGII)
Sensitivity 1 - Specificity 1 Sensitivity 1■ Specificity 1 Sensitivity 1 - Specificity
1 1 1 1 1 1
1 0.83333333 1 0.83333333 1 0.83333333
1 0.66666667 1 0.66666667 1 0.66666667
1 0.5 1 0.5 1 0.5
0.8 0.5 0.8 0.5 1 0.33333333
0.6 0.5 0.6 0.5 0.8 0.33333333
0.4 0.5 0.4 0.5 0.6 0.33333333
0.2 0.5 0.4 0.33333333 0.4 0.33333333
0.2 0.33333333 0.2 0.33333333 0.4 0.16666667
0 0.33333333 0.2 0.16666667 0.2 0.16666667
0 0.16666667 0 0.16666667 0 0.16666667
0 0 0 0 0 0
Table 39. ROC curve coordinates in faecal samples for comparison C-CD vs E3-UC.
F. prausnitzii (total) Phylogroup I (PHGI) Phylogroup I (PHGII)
Sensitivity 1 - Specificity Sensitivity 1 - Specificity ^^^^H Sensitivity 1 - Specificity
1 1 1 1 1 1
1 0.66666667 1 0.66666667 0.66666667 1
1 0.33333333 1 0.33333333 0.66666667 0
0 0.33333333 0 0.33333333 0.33333333 0
0 0 0 0 0 0
Table 40. ROC curve coordinates in faecal samples for comparison l-CD vs IC-CD.
F. prausnitzii (total) Phylogroup I (PHGI) Phylogroup I (PHGII)
Sensitivity 1 - Specificity Sensitivity 1 - Specificity Sensitivity 1 - Specificity
1 1 1 1 1 1
1 0.83333333 1 0.83333333 1 0.83333333
1 0.66666667 1 0.66666667 1 0.66666667
0.66666667 0.66666667 0.66666667 0.66666667 1 0.5
0.66666667 0.5 0.33333333 0.66666667 0.66666667 0.5
0.33333333 0.5 0.33333333 0.5 0.66666667 0.33333333
0.33333333 0.33333333 0.33333333 0.33333333 0.33333333 0.33333333
0.33333333 0.16666667 0.33333333 0.16666667 0 0.33333333
0 0.16666667 0 0.16666667 0 0.16666667
0 0 0 0 0 0 Table 41. ROC curve coordinates in faecal samples for comparison C-CD vs IC-CD.
F. prausnitzii (total) Phylogroup I (PHGI) Phylogroup II (PHGII)
Sensitivity 1 - Specificity Sensitivity 1 - Specificity J Sensitivity 1 - Specificity
1 1 1 1 1 1 1 0.66666667 0.66666667 1 1 0.66666667
0.66666667 0.66666667 0.66666667 0.66666667 1 0.33333333 0.66666667 0.33333333 0.66666667 0.33333333 0.66666667 0.33333333 0.33333333 0.33333333 0.33333333 0.33333333 0.66666667 0 0.33333333 0 0.33333333 0 0.33333333 0
0 0 0 0 0 0
Example 12. Material and methods of total F.prausnitzii, F.prausnitzii phylogroups and E.coli quantification in fecal samples.
1. Patients, clinical data and sampling
Eleven (1 1 ) healthy subjects and twenty-three (23) patients diagnosed of inflammatory bowel disease (IBD); 10 diagnosed of Crohn disease (CD) and 13 diagnosed of Ulcerative Colitis (UC) were recruited by the Gastroenterology Service of the Hospital Universitari Dr. Josep Trueta (Girona, Spain). From those volunteers, sixty-seven (67) fecal samples (26 CD, 30 UC, 1 1 Healthy) were obtained during different times along their treatment. (Table 42).
Subjects recruited as IBD patients were diagnosed according to standard clinical, pathological and endoscopic criteria and categorized according to the Montreal classification (Silverberg et al., Can J Gastroenterol. 2005, 19 SuppI A:5-36). The control group consisted of healthy subjects without any known gastrointestinal disorder, was recruited according to clinical standards. Clinically relevant data (as for example, age, sex, calprotectin levels or years of disease) from all the patients was also collected. All of them signed up the corresponding informed consent. Exclusion criteria included: antimicrobial treatment within one month before colonoscopy and prior surgery.
Table 42. Clinical and sampling data of the studied subjects
Figure imgf000120_0001
This work was approved by the Ethics Committee of Clinical Research of the Hospital Universitari Dr. Josep Trueta (Girona, Spain) and the Institut d'Assistencia Sanitaria of Girona (Salt, Spain) on 18th May of 2016.
2. Sample collection, preservation and storage
Each subject contributed with fecal samples, which were collected at the Gastroenterology Service of the Hospital Universitari Dr. Josep Trueta in less than 24h after deposition. All samples from all subjects were homogenized, aliquoted into 10ml tubes and stored at -80 °C until use. 3. Sample treatment and DNA extraction
DNA was extracted using NucleoSpin® Soil Kit (Macherey-Nagel GmbH &Co., Duren, Germany). Briefly, 30-70mg of fecal sample were placed in a Nucleospin bead-tube. 700μΙ of SL1 and 150μΙ of Enhancer (SX) were added to each sample in order to improve DNA recovery. Afterwards, DNA was extracted and purified following the instructions from the manufacturer. Genomic DNA was eluted with 10ΟμΙ of elution buffer and stored at -20 °C until use. DNA concentration of the extracts was determined with a Qubit fluorimeter (Invitrogen detection Technologies, USA) using Qubit dsDNA High Sensitivity Assay Kit. Prior to qPCR analysis, DNA concentration was adjusted to 8ng^l with free DNA water.
4. Quantitative real-time PCR (qPCR) of DNA extracted from fecal samples
DNA from fecal samples was analysed by quantitative real-time PCR. More specifically, we assessed the quantity of Total Faecalibacterium prausnitzii (FT), Faecalibacterium prausnitzii phylogroup I (PHGI), Faecalibacterium prausnitzii phylogroup II (PHGII) and Escherichia coli (EC). The bacterial sequences were quantified using a quantitative real time PCR with Taqman probe-based assays. Primers and qPCR conditions were as described in Example 1.
Samples were run in duplicate in the same plate. For data analysis, the mean of the duplicate quantifications was used. Bacterial abundances for each sample were expressed as Ct normalized to total DNA concentration, where the Ct (cyclethreshold) is defined as the number of q-PCR cycles required for the fluorescent signal to cross the threshold. Ct levels are inversely proportional to the logarithm of target nucleic acid concentration in the sample. The real time assays undergo 40 cycles of amplification.
Methodological differences were introduced with regards to Example 1. Bacteria copy number were not normalized to the total bacteria 16S rRNA gene copies, but Ct were normalized to total DNA concentration. The novel assay for FT, PHGI, PHGII and EC was composed of GoTaq qPCR Master Mix 2x (Promega, Wisconsin, USA) instead of Taqman Universal PCR Master Mix (Applied Biosystems, Foster City, CA, USA). All bacteria primers were purchased from Macrogen (Seoul, Korea). And all quantitative PCR were performed using AriaMx PCR System (Stratagene by Agilent, Santa Clara, CA, USA), and analyzed using the AriaMx Software version1.2 (Stratagene by Agilent, Santa Clara, CA, USA). All the differences introduced were validated and none differences between the methods were observed.
5. Methods of statistical analysis
Statistical normal distribution of the data was analyzed through Kolmorov-Smirnov test. According to whether there was a statistical normal distribution of the data or not, an adequate statistical test to compare the following groups was used. Normal t-test was used to compare groups distributed normally whereas Mann-Withney non-parametric test was used to compare groups without normal distribution. Analyzed groups were: Healthy vs CD, Healthy vs UC and CD vs UC, and different locations of both diseases: ileal (I), ileocolonic (IC) and colonic (C) for CD and distal (E2) and extensive (E3) for UC. For these groups, analyzed variables the quantification expressed in Ct of the four bacterial sequences described herein corresponding to Total F. prausnitzii (FT), phylogroup I (PHGI), phylogroup II (PHGII) and E. coli; and
- the ratio of the quantification of these four bacterial sequences.
The different ratios between Total F. prausnitzii, phylogroup I, phylogroup II and E. coli have been obtained by subtracting the quantification levels of a first sequence by the quantification levels of a second sequence.
In addition, the receiver operating characteristic (ROC) curve analysis, a plot of the true positive rate (sensitivity) versus false positive rate (1 -specificity), was performed to evaluate the usefulness of F. prausnitzii, and each phylogroup to differentiate amongst different intestinal disorders. The accuracy of discrimination was measured by the area under the ROC curve (AUC). While, an AUC approaching 1 indicates that the test is highly sensitive as well as highly specific, an AUC approaching 0.5 indicates that the test is neither sensitive nor specific. Sensitivity and specificity values are expressed in percent (%). All the statistical analyses were performed using SPSS 15.0 statistical package (LEAD Technologies, Inc.). Significance levels were established for P values < 0.05. The graphics were performed using GraphPad Prism 6.
Example 13. Prevalence of fecal F. prausnitzii phylogroups I and II in health and disease
Prevalence of F. prausnitzii phylogroups as calculated from positive determinations over total samples was analyzed both by disease status (CD and UC) and by disease location (ileal (I), ileocolonic (IC) and colonic (C) for CD and distal (E2) and extensive (E3) for UC) (Table 43). Both phylogroups were less prevalent in CD patients than in healthy individuals, but phylogrup I was significantly more reduced than phylogroup II. Interestingly, phylogroup I had lower prevalence in C-CD samples than l-CD and IC-CD while phylogroup II reduction was exclusive for C-CD.
In contrast to example 8, UC patients only had lower prevalence of phylogroup I when compared to healthy individuals. This lower prevalence was exclusive for Extensive UC compared to Distal UC. Table 43. Prevalence of F. prausnitzii phylogroups by diagnostics and IBD subtype.
PHGI PHGII
% Absence Presence Absence Presence
H 0 100 0 100
UC 10 90 0 100
CD 31 69 8 92
p-value 0.030* 0.204
l-CD 17 83 0 100
IC-CD 21 79 0 100
C-CD 80 20 40 60
p-value 0.033* 0.009**
E2-Distal UC 0 100 0 100
E3-Extensive UC 19 81 0 100
p-value 0, 180 nd
Example 14. Abundance of fecal Total F.prausnitzii, phylogroups and E.coli in health and disease
The abundance of the biomarkers from fecal samples was compared amongst healthy subjects (H) and patients with different IBD by separately (H vs CD, H vs UC) (Table 44;_Figures 9A to 9E). Healthy subjects were also compared to IBD (considering both CD and UC patients together) (Figures 9F to 9I).
Total F. prausnitzii load was reduced in IBD patients analyzed in comparison to H subjects (Figure 9A). While in CD patients the observed differences were statistically different, in UC patients the differences were not statistically supported.
F.prausnitzii PHGI and PHGII Ct were increased, so its abundances were reduced in IBD patients in comparison to H (Figures from 9B and 9C). While, PHGI abundance was significantly decreased just in CD patients (Figure 9C), PHGII abundance was decreased in both CD and UC patients (Figure 9C). E.coli abundance was significantly increased in IBD in comparison to H subjects (Figure 9D). This increase was particularly marked in CD patients. Furthermore, E.coli abundance was significantly increased in CD patients compared to UC patients (Figure 9E).
As was expected, when comparing H to IBD disease, both total F.prausnitzii and its phylogroups abundance were reduced in IBD patients (Figures 9F to 9H), while E.coli load was increased (Figure 91).
In conclusion, in CD patients the microbiological profile is characterized by a decrease of FT, PHGI and PHGII abundance and an increase of E.coli. For UC patients, microbiological profile is defined by a decrease of PHGII and an increase of E.coli. Table 44. Abundance of fecal Total Faecalibacterium prausnitzii (FT), phylogroup I (PHGI), phylogroup II (PHGII) and Escherichia coli (EC) in controls (H), Ulcerative Colitis (UC), and Crohn's disease (CD) patients. Disease locations of CD patients had been analyzed as independent groups.
n Samples FT PHGI PHGII EC
H 1 1 14.39±0.83 17.45±1.54 16.26±0.95 27.98±4.37
UC 30 16.24±4.78 21.85±8.28 18.84±5.23 24.69±4.45
CD 26 15.49±1.44 25.44±10.3 20.4±6.37 21.98±4.06
H vs CD 0.014* 0.045* 0.004** 0.001***
H vs UC 0.206 0.172 0.050* 0.047*
p-value
CD vs UC 0.297 0.201 0.1 16 0.021*
H vs IBD 0.048* 0.069 0.009** 0.007**
*p-value<0.05 **p-value<0.01 ***p-value<0.001
Biomarkers ratios were also compared between healthy and both CD and UC samples (Table 45). Ratios FT/EC, PHGI/EC and PHGI l/EC were significantly increased in IBD samples compared to health. Moreover, significant differences were also observed for the three ratios amongst CD, UC and healthy individuals (Figure 10A, Figure 10B and Figure 10C). FT/PHGI ratio was also significantly increased in CD compared to healthy samples (Figure 10D). Finally, statistically differences were not observed in PHGI/PHGII and FT/PHGI ratios amongst the three groups.
Moreover, when contrasting H ratios with IBD ratios, significant differences were also observed FT/EC, PHGI/EC and PHGII/EC (Figure 10E to 10G).
In conclusion, due to the differences observed when comparing CD or UC with H or between them, we may conclude that IBD samples are represented by changes in FT/EC, PHGI/EC and PHGII/EC counts in the fecal microbiological profile, and changes in FT/PHGI is exclusive for UC samples.
Table 45. Bacterial abundances represented by ratio of different bacterial markers (expressed in Ct)
FT/EC PHGI/PHGII PHGI/EC PHGII/EC FT/PHGI FT/PHGII
CD -6.49±4.88 5.04±9.46 3.47±12.87 -1.58±9.29 -9.95±9.43 -4.91 ±5.96 UC -8.38±7.67 3.01 ±7.54 -2.84±10.29 -5.85±8.09 -5.54±6.62 -2.60±1.82
Healthy -13.58±4.68 1.19±2.25 -10.53±4.43 -1 1.72±4.98 -3.06±1.74 -1.87±0.81
H vs CD 0.043* 0.522 0.017* 0.017* 0.189 0.305 H vs UC 0.000** 0.398 0.000** 0.000** 0.052* 0.101 p-value
CD vs UC 0.027* 0.988 0.021* 0.025* 0.234 0.147 H vs IBD 0.002** 0.680 0.001** 0.001** 0.093 0.092
*p-value<0.05 **p-value<0.01 ***p-value<0.001
Example 15. Usefulness of fecal F. prausnitzii pylogroups abundance as diagnostic biomarkers
ROC curve analysis was performed to test the putative accuracy of fecal F. prausnitzii total, its phylogroups and E. coli abundance as indicators to differentiate between two groups of patients. Results are provided in Figure 1 1. The microbiological profile which best discriminate the healthy digestive status is composed by E.coli (HvsCD-AUC:0.860, with an 81.8 of sensitivity and 76.9 of specificity, figure 1 1 A; A vsUC-AUC:0.715, with an 72.7 of sensitivity and 66.7 of specificity, figure 1 1 D), FT/PHGI (HvsCD-AUC:0.706, with an 63.6 of sensitivity and 73.1 of specificity, figure 1 1 B; /- vsUC-AUC:0.647, with an 63.6 of sensitivity and 70 of specificity, figure 1 1 E) and FT/PHGII (HvsCD-AUC:0.675, with an 54.5 of sensitivity and 65.4 of specificity, figure 1 1 C; /- vsUC-AUC: 0.682 with an 72.7 of sensitivity and 63.3 of specificity, figure 1 1 F). Figures from 1 1A to 1 1 F describe the performance of bacterial biomarker defining healthy individuals. Several markers were confirmed as good discriminators for CD patients, with AUC values greater than 0.70 (Figures 1 1 G to 1 1 L). More specifically, Total F.prausnitzii (AUC:0.755, with an 80.8 of sensitivity and 72.7 of specificity, figure 1 1G), F.prausnitizii phylogroup I (AUC:0.710 with an 65.4 of sensitivity and 81 .8 of specificity, figure 1 1 H), F.prausnitizii phylogroup II (AUC:0.797 with an 76.9 of sensitivity and 72.7 of specificity, figure 1 11), FT/EC (AUC:0.867 with an 80.1 of sensitivity and 81.8 of specificity, figure 1 1 J), PHGI/EC (AUC:0.885 with an 88 of sensitivity and 72.7 of specificity, figure 1 1 K) and PHGII/EC (AUC:0.874 with an 80.1 of sensitivity and 81 .8 of specificity, figure 1 1 L).
The same markers were confirmed as good discriminators for UC, but in contrast, the marker's capacity of discrimination was lower in comparison to the results observed in CD patients with AUC between 0.745 and 0.635 (Figures 1 1 M to 1 1 R): Total F.prausnitzii (AUC:0.635, with an 63.3 of sensitivity and 72.7 of specificity, figure 1 1 M), F.prausnitizii phylogroup I (AUC:0.642 with an 60 of sensitivity and 63.6 of specificity, figure 1 1 N), F.prausnitizii phylogroup II (AUC:0.700 with an 63.3 of sensitivity and 63.6 of specificity, figure 1 10), FT/EC (AUC:0.727 with an 70 of sensitivity and 72.7 of specificity, figure 1 1 P), PHGI/EC (AUC:0.745 with an 70 of sensitivity and 72.7 of specificity, figure 1 1 Q) and PHGII/EC (AUC:0.745 with an 80 of sensitivity and 63.6 of specificity, figure 1 1 R).
Finally, to discriminate between CD and UC diseases, two markers and three ratios were found to be good discriminators with AUC between 0.600 and 0.669 (Figures 1 1 S to 1 1X): F.prausnitizii phylogroup I (AUC:0.600 with an 61.5 of sensitivity and 60 of specificity, figure 1 1 S), F.prausnitizii phylogroup II (AUC:0.623 with an 65.4 of sensitivity and 66.7 of specificity, figure 1 1T), E.coli (AUC:0.672 with an 60 of sensitivity and 57.7 of specificity, figure 1 1 U), FT/EC (AUC:0.642 with an 61.5 of sensitivity and 56.7 of specificity, figure 1 1V), PHGI/EC (AUC:0.669 with an 61.5 of sensitivity and 66.7 of specificity, figure 1 1W) and PHGII/EC (AUC:0.662 with an 61.5 of sensitivity and 63.3 of specificity, figure 1 1X).
Furthermore, to distinguish between H and IBD (both CD and UC diseases together), three markers and three ratios proved to be good discriminators with AUC between 0.674 and 0.805 (Figures 1 1 Y to 1 1AD): Total F.prausnitizii (AUC:0.691 with an 71.4 of sensitivity and 72.7 of specificity, figure 1 1 Y), F.prausnitizii phylogroup I (AUC:0.674 with an 60.7 of sensitivity and 72.7 of specificity, figure 1 1Z), F.prausnitizii phylogroup II (AUC:0.745 with an 69.6 of sensitivity and 72.7 of specificity, figure 1 1AA), FT/EC (AUC:0.789 with an 80.4 of sensitivity and 72.7 of specificity, figure 1 1 AB), PHGI/EC (AUC:0.805 with an 76.8 of sensitivity and 72.7 of specificity, figure 1 1AC) and PHGII/EC (AUC:0.797 with an 73.2 of sensitivity and 72.7 of specificity, figure 1 1 AD).
In conclusion, the best discriminators were found to be the ratios FT/EC, PHGI/EC and PHGII/EC for CD disease, with AUC values above 0.850 and sensitivities and specificities over 80%.
With regards to UC, even though marker's capacity of discrimination was lower, the best discriminators proved to be the ratios PHGI/EC and PHGII/EC with AUC values of 0.745 and sensitivities over 70%. The following Figures provide the ROC curve, AUC value and specificity and sensitivity values for optimal cut-off point for all the markers described above.
Example 16. Abundance of Total F.prausnitzii, phylogroups and E.coli in CD with different lesion location and its usefulness as biomarkers for differential diagnosis by disease location/extension
Example 16.1. Abundance
CD samples were analyzed by disease location, ileal (l-CD), colonic (C-CD) and ileocolonic (IC-CD) locations were studied.
Total F. prausnitzii and phylogroup I (PHGI) abundances were significantly decreased in patients with inflammation located in the colon, while PHGI I was significantly increased in ileal location. (Table 46, Figure 12). Table 46. Abundance of fecal Total Faecalibacterium prausnitzii (FT), phylogroup I (PHGI), phylogroup II (PHGII) and Escherichia coli (EC) in colon, ileocolonic and ileal locations.
n Samples FT PHGI PHGII EC
Colonic-CD 5 16.77±2.08 36.01 ±8.91 27.12±1 1.91 20±5.02 lleocolonic-CD 14 15±1.04 22.07±9.84 19.60±3.19 22.09±4.29
Meal-CD 6 15.84±1.02 25.46±8.03 17.56±1.02 22.92±2.82
C-CD vs IC-CD 0.046* 0.026* 0.055 1.00 p-value IC-CD vs l-CD 0.583 1.00 0.046* 1.00
C-CD vs l-CD 0.745 0.222 0.032* 0.774 *p-value<0.05 **p-value<0.01 ***p-value<0.001
Ratios within the markers were also compared by the different locations studied. FT/PHGI and PHGI/EC showed significant differences when comparing colonic and ileocolonic locations, whereas FT/PHGII showed significant differences between colonic and ileal locations (Table 47, Figure 13).
Table 47. Bacterial abundances represented by ratio of different bacterial markers (expressed in Ct)
FT/EC PHGI/PHGII PHGI/EC PHGII/EC FT/PHGI FT/PHGII
Colonic-CD -3.23±6.24 8.89±1 1.31 16.01 ±13.69 7.12±15.94 -19.25±7.74 -10.35±1 1.80 lleocolonic-CD -7.10±4.99 2.47±9.45 -0.02±12.29 -2.49±6.59 -7.07±9.15 -4.60±2.86
Meal-CD -7.08±2.75 7.90±8.35 2.54±8.85 -5.36±2.77 -9.62±8.14 -1.72±0.27
C-CD vs IC-
0.420 0.635 0.05* 0.128 0.040* 0.171 CD
p-value
IC-CD vs l-CD 1.00 0.775 1.00 1.00 1.00 0.882
C-CD vs l-CD 0.609 1.00 0.223 0.076 0.242 0.005*
*p-value<0.05 **p-value<0.01 ***p-value<0.001 Example 16.2 Usefulness
ROC curve analysis was performed to test the putative accuracy of fecal F. prausnitzii total, its phylogroups and E. coli abundance as well as the ratios thereof as indicators to differentiate between different disease locations.
Ileal location in CD patients
As we can observe in Figure 14, four markers were confirmed as good discriminators for ileal location in CD patients, with AUC between 0.632 and 0.789. More specifically, Total F.prausnitzii (AUC:0.632, with an 83.3 of sensitivity and 47.4 of specificity, figure 14A), E.coli (AUC:0.667, with an 83.3 of sensitivity and 57.9 of specificity, figure 14B), PHGI/PHGII (AUC:0.71 1 , with an 83.3 of sensitivity and 57.9 of specificity, figure 14C) and FT/PHGII (AUC:0.789, with an 83.3 of sensitivity and 78.9 of specificity, figure 14D).
Ileocolonic location in CD patients
Regarding to ileocolonic location, just one marker was confirmed as good discriminator, FT/PHGI with and AUC of 0.779, a sensitivity of 78.6 and a specificity of 72.7 (figure 15).
Colonic location in CD patients
Finally, for colonic location in CD patients, seven markers were confirmed as good discriminators (Figure 16). More specifically, Total F.prausnitzii (AUC:0.755, with an 80.0 of sensitivity and 75.0 of specificity, figure 16A), PHGI (AUC:0.845, with an 80.0 of sensitivity and 80.0 of specificity, figure 16B), PHGII (AUC:0.685, with an 60.0 of sensitivity and 85.0 of specificity, figure 16C), FT/EC (AUC:0.770, with an 80.0 of sensitivity and 80.0 of specificity, figure 16D), PHGI/PHGII (AUC:0.640, with an 60.0 of sensitivity and 55.0 of specificity, figure 16E), PHGI/EC (AUC:0.770, with an 80.0 of sensitivity and 85.0 of specificity, figure 16F) and PHGII/EC (AUC:0.670, with an 60.0 of sensitivity and 80.0 of specificity, figure 16G).
Example 17. Abundance of Total F.prausnitzii, phylogroups and E.coli in C-CD and UC and its usefulness as biomarkers for differential diagnosis between C-CD and UC
Differential diagnose between colonic CD and UC is relevant in clinical practice. We have thus compared the bacterial markers and ratios between these two groups. Lower abundance for F. prausnitzii phylogroup I and II and E.coli is observed in CD patients with colonic lesion when compared to UC patients (Table 48). With regards to the ratios, PHGI/EC, PHGII/EC and FT/PHGI show significant differences between these two groups (Table 49). Table 48. Abundance of fecal Total Faecalibacterium prausnitzii (FT), phylogroup I (PHGI), phylogroup II (PHGII) and Escherichia coli (EC) in colonic CD location and UC patients. FT PHGI PHGII Ecoli
Colonic-CD 16.7±2.08 36.01 ±8.91 27.12±1 1.90 20.0±5.07
UC 16.3±4.78 21.84±8.27 18.83±5.22 24.68±4.4§
p-value 0.724 0.020* 0.054* 0.048*
Table 49. Bacterial abundances represented by ratio of different bacterial markers (expressed in Ct). FT/EC PHGI/PHGII PHGI/EC PHGII/EC FT/PHGI FT/PHGII
Colonic-CD -3.23±6.23 8.89±1 1.31 16.01 ±13.69 7.12±15.94 -19.24±7.74 -10.35±1 1.79
UC -8.38±7.66 3.01 ±7.53 -2.83±10.29 -5.85±8.09 -5.54±6.62 -2.59±1.82 p-value 0.069 0.369 0.08* 0.043* 0.013* 0.345 ROC curve analysis was performed to test the putative accuracy of fecal F. prausnitzii total, its phylogroups and E. coli abundance and its ratios as indicators to differentiate between CD patients with colonic lesions and UC patients. As we can observe in Figure 17, three markers were confirmed as good discriminators for UC, with AUC between 0.637 and 0.880. More specifically, E.coli (AUC:0.780, with an 80 of sensitivity and 80 of specificity, figure 17A), FT/PHGI (AUC:0.880, with an 73.3 of sensitivity and 100 of specificity, figure 17B), FT/PHGII (AUC:0.637, with an 80 of sensitivity and 60 of specificity, figure 17C).
To discriminate colonic location CD patients seven markers were relevant: FT (AUC:0.740, with an 80 of sensitivity and 73.3 of specificity, figure 18A), PHGI (AUC:0.83, with an 80 of sensitivity and 90 of specificity, figure 18B), PHGII (AUC:0.773, with an 80 of sensitivity and 66.7 of specificity, figure 18C), FT/EC (AUC:0.760, with an 80 of sensitivity and 90 of specificity, figure 18D), PHGI/PHGII (AUC:0.663, with an 60 of sensitivity and 66.7 of specificity, figure 18E), PHGI/EC (AUC:0.860, with an 80 of sensitivity and 100 of specificity, figure 18F), PHGII/EC (AUC:0.787, with an 80 of sensitivity and 80 of specificity, figure 18G).
In conclusion, the best markers for differential diagnose between UC and colonic lesion in CD patients are: EC, PHGI, FT/PHGI, PHGI/EC and PHGII/EC.
Example 18. Bacterial biomarkers abundance and its usefulness in determining disease activity in Crohn disease and ulcerative colitis Example 18.1 Abundance
The abundance of the biomarkers from fecal samples was compared in CD and UC patients according to whether or not calprotectin values were lower or greater than 250μg/g. Calprotectin concentration is as a non-invasive marker of inflammation of the intestinal mucosa that it is usually used as reference marker for the determination of IBD disease activity, namely values of calprotectin greater than 250μg/g have been regarded as a sign of high level of inflammatory response (Table 50). Total F. prausnitzii and phylogroups load was significantly reduced in the group with calprotectin levels over 250μg/g, however, while FT was reduced in both CD and UC (Figure 19A and 19B), PHGII abundance was just reduced in CD patients (Figure 19C) and PHGI in UC patients (Figure 19D). Moreover, E. coli abundance did not show significant differences.
In conclusion, total F. prausnitzii has been found to be a marker of active disease (i.e., associated with calprotectin values of over 25C^g/g). Furthermore, interestingly, while PHGI appears to be a marker exclusive for active UC, PHGII has been found to be a marker exclusive for active CD.
Table 50. Abundance of faecal Total Faecalibacterium prausnitzii (FT), phylogroup I (PHGI), phylogroup II (PHGII) and Escherichia coli (EC) in CD and UC patients between different ranges of calprotectin
Figure imgf000129_0001
Ratios, FT/EC, FT/PHGI, FT/PHGII, PHGI/PHGII, PHGI/EC and PHGII/EC were also compared in CD and UC patients according to calprotectin values (Table 51 ). Regarding CD patients just the ratio PHGII/EC showed a trend to increase significantly (Figure 20D), while in UC patients, three markers were significantly represented, FT/PHGI (Figure 20A), PHGI/PHGII (Figure 20B) and PHGI/EC (Figure 20C). These data are in agreement with the above results, studying the markers independently, where active CD disease was represented by PHGII and active UC was represented by PHGI.
Table 51. Ratios of FT/EC, FT/PHGI, FT/PHGII, PHGI/EC and PHGII/EC in CD and UC patients between calprotectin over or under 250μg/g
Figure imgf000129_0002
Moreover, correlations between calprotectin concentration and the different markers and its ratios in CD and UC patients were studied by a Spearman Correlation. As was expected, FT was positively correlated with calprotectin concentration both in CD and UC, furthermore, while PHGI was also positively correlated with fecal calprotectin in UC patients, PHGII showed a positive tendency to correlate in CD (Table 52). As far as ratios is concerned, only trends were observed (Table 52).
Table 52. Spearman correlation between calprotectin concentration and abundance and ratios of faecal Total Faecalibacterium prausnitzii (FT), phylogroup I (PHGI), phylogroup II (PHGII) and Escherichia coli (EC) in CD and UC patients
Figure imgf000130_0001
Example 18.2 Usefulness
Afterwards, ROC curve analysis was performed to test the putative accuracy of fecal F. prausnitzii total, its phylogroups, E. coli abundance and their ratios as indicators to differentiate between calprotectin levels under and over 250μg g.
Different markers were confirmed as good discriminators for CD disease (Figure 21 ), more concretely: Total F. rausnitzii (AUC:0.940, with an 80 of sensitivity and 100 of specificity, figure 21 A), F.prausnitizii phylogroup I (AUC:0.820 with an 80 of sensitivity and 60 of specificity, figure 21 B), F.prausnitizii phylogroup II (AUC: 1.000 with an 100 of sensitivity and 100 of specificity, figure 21 C), FT/EC (AUC:0.840 with an 80 of sensitivity and 80 of specificity, figure 21 D), PHGI/EC (AUC:0.640 with an 60 of sensitivity and 80 of specificity, figure 21 E) and PHGII/EC (AUC:0.880 with an 100 of sensitivity and 80 of specificity, figure 21 F).
Furthermore, as regards to UC, several markers were validated as good discriminators (Figure 22): Total F. prausnitzii (AUC:0.900, with an 100 of sensitivity and 75 of specificity, figure 22A), F.prausnitizii phylogroup I (AUC:1.000 with an 100 of sensitivity and 100 of specificity, figure 22B), F.prausnitizii phylogroup II (AUC:0.700 with an 60 of sensitivity and 87.5 of specificity, figure 22C), FT/EC (AUC:0.725 with an 60 of sensitivity and 87.5 of specificity, figure 22D), FT/PHGII (AUC:0.725 with an 80 of sensitivity and 62.5 of specificity, figure 22E), PHGI/PHGII (AUC:0.825 with an 80 of sensitivity and 87.5 of specificity, figure 22F), PHGI/EC (AUC:0.925 with an 100 of sensitivity and 87.5 of specificity, figure 22G) and PHGII/EC (AUC:0.700 with an 60 of sensitivity and 807.5of specificity, figure 22H).
It is important to emphasize, that although some of the markers are common discriminators for both diseases, PHII for CD and PHI for UC disease appear to be perfect discriminators for calprotectin levels over 250μg g, being the AUC of 1.000 and both the sensitivity and specificity of 100% (Figure 21 C and 22B, respectively).
Example 19. Bacterial biomarkers abundance and its usefulness for disease monitoring Crohn's disease and ulcerative colitis patients
Fecal samples were collected from 8 Crohn's disease (CD) patients and 7 Ulcerative colitis (UC) patients (with more than 6 months of diagnose) at two different time points in clinical practice checkups (TO and T1 ). Disease activity was defined in terms of inflammatory response and the inflammatory activity was followed up in both groups of patients by measuring the concentration of fecal calprotectin. Levels of fecal calprotectin above 250μg g were considered as high level of inflammatory response and levels under 250μg g were considered as a non-inflammatory response.
For each of these groups of patients, two subgroups were defined only considering its calprotectin measures independently of the treatment:
(+) Increased inflammatory activity: patients with an increase of fecal calprotectin levels over 250μg g between the two-time point samples.
(-) Decreased inflammatory activity: patients with a decreased of fecal calprotectin levels under 250μg g between the two-time point samples.
Abundances of Total Faecalibacterium prausnitzii (FT), phylogroup I (PHGI), phylogroup II (PHGII) and Escherichia coli (EC) were analyzed in the two-time point samples and compared according to its inflammatory activity evolution.
In CD patients with different inflammatory activity evolution, non-statistical differences were observed in bacterial markers abundances (Table 53) and ratios (Table 54).
In contrast, UC presented statistically significant differences for FT and PHGI (Table 55) were observed. The abundances of these two markers were significantly reduced in patients presenting an increase of inflammatory activity during the monitoring period. Similarly, ratio FT/PHGI also presented significant differences in UC patients with an evolution of increased inflammatory activity (Table 56).
In order to test the correlation between two-time point samples (Table 57), both Pearson and Spearman correlation test were performed. Significant correlation was detected in UC patients for FT and a tendency was observed in PHGII/EC.
In conclusion, determination of bacterial markers abundance and its ratios can be relevant for the follow up of UC patients, especially FT, PHGI and FT/PHGI. Table 53. Abundances of bacterial markers in two-time point sample (TO and T1 ) in Crohn's disease patients (CD) with different inflammatory evolution according calprotectin measure: increased inflammatory activity (+) and decreased inflammatory activity (-).
FT PHGI PHGII EC
Calprotectin TO T1 TO Tl TO T1 TO T1
16.60 15.91 40.00 40.00 22.07 21.46 17.57 19.13
+
16.75 14.15 20 07 15.64 18.88 16 25 21.72 22 97
Average 16.67±0.10 15.03±1.24 30.04±14.1 27.82+17.22 20.47+2.25 18.86±3.68 19.64±2.93 21.05+2.71 P-Value 0.180 ns 0.1» 0.180
16.17 17.40 40.00 40.00 40.00 40.00 15.91 16.18
14.38 13.72 15.86 15.60 22.66 19.31 24.03 20.30
17.30 16.81 23.87 25.92 19.01 18.49 25.06 24.83
-
14 17 15.22 19.92 19.60 15.31 16.08 24.97 18 85
14.53 13 58 16.57 15.81 18.19 15.96 24 92 33.82
19.96 14.38 40.00 20.07 21 49 17.76 20.16 28.31
Average 16.09+2.25 15.19*1.61 26.04±11.18 22.83+9.21 22.78*8.82 21.27+9.27 22.51+3.74 23.72+6.58
P -Value ns ns 0.138 ns
Figure imgf000133_0001
ε m
Figure imgf000134_0001
Table 56. Rales of bacteria! markers in tee-lme point sample (TO and T1 ) in ulcerative colitis patients (UC) w i different intammatory evoluton according calprotectin measure: increased inflammatoryactivity (+) and decreased inflammatoryactivity {-).
Figure imgf000135_0001
Table 57. Pearson and Spearman correlation between abundance and ratios of bacterial markers in two- time point sample (TO and T1 ) in Crohn's disease patient (CD) with different inflammatory evolution according calprotectin measure: increased inflammatory activity (+) and decreased inflammatory activity (-)■
Figure imgf000136_0001
Figure imgf000136_0002
Example 20. Bacterial biomarkers abundance and its usefulness in the prediction of treatment efficacy in Crohn's disease and ulcerative colitis
Fecal samples of 4 Crohn's disease (CD) and 3 Ulcerative colitis (UC) patients with active disease in terms of inflammatory response and naive to biological treatment were collected. Its inflammatory response (measured by calprotectin concentration) to biological treatment (anti-TNF agents) was recorded and patients were grouped according to their response to treatment: -Responders: Subjects showing a decrease of calprotectin levels below 250μg G after biological treatment induction. *
-Non-responders: Subjects showing an increase of calprotectin levels after biological induction. *
*lnduction: Time period where different treatment dosage are given to achieve the therapeutic dose.
The abundance of fecal Total F. prausnitzii, phylogroup I, phylogroup II and E. coli of these patients before biological treatment were studied in order to determine the potential of treatment efficacy prediction of these bacterial markers (Table 16). Either in CD or UC patients, differences between responders and non-responders were no significantly different, probable due to the low number of subjects included in the study. Nonetheless, tendencies were observed (Figure 23). FT Ct of CD and UC were 28.57% and 26.58% increased in non-responders compared to responders. PHGI Ct were also increased in UC and CD (26.80% and 53.94%, respectively). PHGII Ct were 66.82% increased in non-responders of UC. On contrast, EC Ct were reduced in non-responders of UC and CD (-20.91 % and 14.53%, respectively).
CD non-responder subjects were found to be characterized by a microbiological profile with low load of FT and PHGI, and high load of EC. UC non-responders were characterized by low load of FT and PHGII, and high load of EC.
Table 58. Abundance of fecal Total Faecalibacterium prausnitzii (FT), phylogroup I (PHGI), phylogroup II (PHGII) and Escherichia coli (EC) in CD and UC patients between responders and non-responders
Figure imgf000137_0001
Ratios between the abundance of fecal Total F. prausnitzii, phylogroup I, phylogroup II and E. coli were also calculated: FT/EC, FT/PHGI, FT/PHGII, PHGI/PHGII, PHGI/EC and PHGII/EC (Table 59). Once again due to the small sample size, just tendencies were observed. More marked differences were seen in UC, where FT/EC, FT/PHGII and PHGI/PHGII ratios tended to increase in non-responder subjects, whereas in non-responder CD patients only the FT/EC ratio tended to increase (Figure 24).
Table 59. FT/EC, FT/PHGI, FT/PHGII, PHGI/PHGII, PHGI/EC and PHGII/EC ratios in CD and UC patients sub classified as responders and non-responders
Grou PHGI/PH
Condition FT/EC FT/PHGI FT/PHGII PHGI/EC PHGII/EC P Gil
Res ponder
10.23±0.8 -3.62±3.02 -4.71 ±5.05 -1.10±8.07 -1.78±9.04 -5.52±5.86 s
1
CD
Non
Res ponder -2.59±3.37 1 1.68±1 1. -1.83±0.41 9.85±12.3 9.60±14.5 -0.76±2.95
Mean
s 8
Res ponder -9.07 -1.65 -7.42 -7.42 -7.42 -1 1.69 s (n=1 ) (n=1 ) (n=1 ) (n=1 ) (n=19) (n=1 )
UC
Non
1.17±12.8 -2.13±2.13 -2.70±0.26 -0.57±2.40 3.30±14.9 3.87±12.5 responders Despite the small number of patients studied, interesting trends have been observed between patients whose calprotectin levels respond to a biological treatment versus those who not.
In example 2, abundance of fecal Total F.prausnitzii, phylogroups and E.coli in health and disease was determined. It was shown that E.coli abundance was increased both in CD and UC patients, whereas PHGII was diminished and FT and PHGI were decreased in CD patients, all when compared to healthy patients.
We have observed in the present example, that an increased E.colis abundance either a decreased FT and its phylogroups' load could predict the inflammatory response in both UC and CD patients under anti- TNF treatment.
Concluding that, it is likely that, improved calprotectin values are associated with improved microbial status, being the markers' values in responders patients closer to those observed in a healthy condition.

Claims

An in vitro method for determining the abundance of Faecalibacterium prausnitzii phylogroup I members (PHGI) and/or of Faecalibacterium prausnitzii phylogroup II members (PHGII) in an intestinal sample from a subject;
wherein PHGI abundance determination comprises the use of a primer and/or probe with sequence SEQ ID NO: 3 or a sequence with at least 75% identity thereof; and
wherein PHGII abundance determination comprises the use of a primer and/or a probe with sequence SEQ ID NO: 4 or a sequence with at least 75% identity thereof.
A method for the obtaining of useful information for the detection of an intestinal disease in a human subject and/or for the prediction of the efficacy of a drug in the therapeutic treatment of an intestinal disease in a human subject, comprising the determination of the abundance of PHGI and/or of PHGII according to a method of claim 1 ;
wherein said intestinal disease is selected from the group consisting of inflammatory bowel disease (IBD), irritable bowel syndrome (IBS) and colorectal cancer (CRC).
A method for detecting an intestinal disease in a human subject comprising the following steps:
a. determining the abundance of Faecalibacterium prausnitzii phylogroup I members (PHGI) and/or Faecalibacterium prausnitzii phylogroup II members (PHGII) in an intestinal sample from said subject according to a method of claim 1 ; and
b. comparing the PHGI and/or PHGII abundance, and/or a mathematical combination thereof, and/or optionally a mathematical combination of any of these with Total F. Prausnitzii (FT) abundance and/or E.coli (EC) abundance, in the subject sample with the corresponding values in a reference sample,
wherein a significant deviation in the subject sample values with regard to said reference sample is indicative of intestinal disease;
wherein said intestinal disease is selected from the group consisting of inflammatory bowel disease (IBD), irritable bowel syndrome (IBS) and colorectal cancer (CRC); and wherein said reference sample is preferably a healthy subject sample and/or the sample of a patient with intestinal disease in remission.
4. The method according to claim 3, wherein said method is a method for the screening and/or
diagnosis of an intestinal disease in a human subject and said reference sample is a healthy subject sample and/or the sample of a subject with intestinal disease in remission.
A method according to claim 3, wherein said method is a method for monitoring the activity and/or progression of an intestinal disease in a human subject and said reference sample is a previous sample of the same subject. 6 A method for predicting the efficacy of a treatment in a human subject suffering from IBD, wherein said method comprises: a. determining the abundance of Faecalibacterium prausnitzii phylogroup I members (PHGI) and/or Faecalibacterium prausnitzii phylogroup II members (PHGII) in an intestinal sample from said subject according to a method of claim 1 ; and
b. comparing the PHGI and/or PHGII abundance, and/or a mathematical combination thereof, and/or optionally a mathematical combination of any of these with Total F. Prausnitzii (FT) abundance and/or E.coli (EC) abundance, in the subject sample with the corresponding values in a reference sample,
wherein a significant deviation in the subject sample values with regard to said reference sample is indicative of increased possibilities of response to the treatment; and
wherein said reference sample is preferably a healthy subject sample or a sample of a patient with intestinal disease in remission.
7. The method according to any of claims 3 to 6, wherein said intestinal disease is IBD, preferably Ulcerative colitis (UC) or Crohn's disease (CD), more preferably CD.
8. A method for the differential diagnosis of inflammatory bowel disease (IBD) phenotypes in a human subject comprising the following steps: determining the abundance of Faecalibacterium prausnitzii phylogroup I members (PHGI) and/or Faecalibacterium prausnitzii phylogroup II members (PHGII) in an intestinal sample from said subject according to a method of claim 1 ; and b. comparing the PHGI and/or PHGII abundance, and/or a mathematical combination thereof, and/or optionally a mathematical combination of any of these with Total F. Prausnitzii (FT) abundance and/or E.coli (EC) abundance, in the subject sample with the corresponding values in a reference sample of the IBD phenotypes to be distinguished from to determine the IBD phenotype the subject is suffering from;
wherein the subject sample presenting values significantly similar to one of said IBD phenotypes will be indicative that the subject is suffering from said IBD phenotype.
The method according to claim 8, wherein said IBD phenotypes are selected from the group consisting of:
- CD phenotypes defined by one or more, preferably all, of the following parameters:
o disease location;
o age at diagnosis; and
o behavior;
UC phenotypes defined by one or more, preferably all, of the following parameters:
o disease location or extent; and
o severity.
The method according to any of claims 8 or 9, wherein said IBD phenotypes are selected from the group consisting of: - CD phenotypes consisting of ileal CD (l-CD), ileocolonic CD (IC-CD) and colonic CD (C-CD); and
UC phenotypes consisting of ulcerative proctitis (UC-E1 ), distal colitis (UC-E2) and extensive UC or pancolitis (UC-E3).
The method according to any of claims 8 or 9, wherein the IBD phenotypes to be distinguished from are C-CD from UC or C-CD from UC-E3.
The method according to any of claims 1 to 11 , wherein PHGI and/or PHGII abundance determination, and optionally the FT and/or EC abundance determination, is performed by a molecular method selected from the group consisting of quantitative Polymerase Chain Reaction (qPCR), PCR-pyrosequencing, fluorescence in-situ hybridization (FISH), microarrays, and PCR- ELISA, preferably quantification is performed by qPCR.
13. The method according to any of claims 1 to 12, wherein PHGI abundance determination is performed with primers with sequences SEQ ID NO: 1 and SEQ ID NO: 2, or a sequence with at least 75% identity thereof; and a probe with sequence SEQ ID NO: 3 or a sequence with at least 75% identity thereof.
14. The method according to any of claims 1 to 13, wherein PHGII abundance determination is performed with primers with sequences SEQ ID NO: 1 and SEQ ID NO: 2, or a sequence with at least 75% identity thereof; and a probe with sequence SEQ ID NO: 4 or a sequence with at least 75% identity thereof.
15. The method according to any of claims 3 to 14, wherein FT abundance determination is performed with primers with sequence SEQ ID NO: 5 and SEQ ID NO: 6, or a sequence with at least 75% identity thereof; and a probe with sequence SEQ ID NO: 7 or a sequence with at least 75% identity thereof.
16. The method according to any of claims 3 to 15, wherein EC abundance determination is performed with primers with sequence SEQ ID NO: 14 and SEQ ID NO: 15, or a sequence with at least 75% identity thereof; and a probe with sequence SEQ ID NO: 16 or a sequence with at least 75% identity thereof. 17. The method according to any of claims 3 to 16, wherein said mathematical combination with FT abundance and/or EC abundance is a ratio selected from the group consisting of: PHGI abundance/EC abundance, PHGII abundance/EC abundance, FT abundance/PHGI abundance, and FT abundance/PHGI I abundance, wherein abundance determination is performed by qPCR and is expressed as threshold cycle (Ct) value and said ratio is obtained by subtracting from the first Ct value the second Ct value.
18. The method according to any of claims 1 to 17, wherein DNA is extracted from the intestinal sample prior to PHGI and/or PHGII, and optionally of FT and/or EC abundance determination.
19. The method according to any of claims 1 to 18, wherein the PHGI and/or PHGII abundance levels, and optionally the FT and/or EC abundance levels, are normalized, preferably wherein normalization is carried out with respect to total bacteria quantification or by DNA concentration.
20. The method according to any of claims 1 to 19, wherein said intestinal sample is selected from the group consisting of a mucosal biopsy and a feces sample, preferably is a feces sample.
21. The method according to any of claims 1 to 20, wherein said method further comprises detecting and/or quantifying one or more other biomarkers of intestinal disease, preferably of IBD, and optionally comprises combining the results of PHGI abundance, PHGII abundance and/or said further biomarkers detection and/or quantification with other indicators of intestinal disease.
22. The method according to any of claims 1 to 21 , wherein said method further comprises storing the method results in a data carrier, preferably wherein said data carrier is a computer readable medium.
23. Use of Faecalibacterium prausnitzii phylogroup I members (PHGI) and/or Faecalibacterium prausnitzii phylogroup II members (PHGII) abundance, and/or a mathematical combination thereof, and/or optionally a mathematical combination of any of these with Total F. Prausnitzii (FT) abundance and/or E.coli (EC) abundance, in an intestinal sample of a human subject as biomarker for the detection of an intestinal disease, and/or for predicting the efficacy of a drug in the treatment of an intestinal disease,
wherein the abundance of PHGI and/or PHGII in an intestinal sample from said subject is determined according to a method of claim 1 ; and
wherein said intestinal disease is selected from the group consisting of inflammatory bowel disease (IBD), irritable bowel syndrome (IBS) and colorectal cancer (CRC). 24. The use according to claim 23, wherein said intestinal disease is an inflammatory bowel disease (IBD), preferably Ulcerative colitis (UC) or Crohn's disease (CD), more preferably CD.
25. Use of Faecalibacterium prausnitzii phylogroup I members (PHGI) and/or Faecalibacterium prausnitzii phylogroup II members (PHGII) abundance, and/or mathematical combinations thereof, and/or optionally a mathematical combination of any of these with Total F. Prausnitzii (FT) abundance and/or
(EC) E.coli abundance, in an intestinal sample of a human subject as biomarker for the differential diagnosis of IBD phenotypes,
wherein the abundance of PHGI and/or PHGII in an intestinal sample from said subject is determined according to a method of claim 1.
26. The use according to any of claims 23 to 25 wherein said mathematical combination with FT abundance and/or EC abundance is a ratio selected from the group consisting of: PHGI abundance/EC abundance, PHGII abundance/EC abundance, FT abundance/PHGI abundance, and FT abundance/PHGI I abundance,
wherein abundance is expressed as threshold cycle (Ct) value and said ratio is obtained by subtracting from the first Ct value the second Ct value.
27. A kit comprising:
a. a reagent for determining the abundance of Faecalibacterium prausnitzii phylogroup I members (PHGI) consisting of a primer and/or probe with sequence SEQ ID NO: 3 or a sequence with at least 75% identity thereof; and/or
b. a reagent for determining the abundance of Faecalibacterium prausnitzii phylogroup I I members (PHGII) consisting of a primer and/or a probe with sequence SEQ ID NO: 4 or a sequence with at least 75% identity thereof; and
c. optionally, instructions for use of said reagent(s) to determine the abundance of PHGI, and/or
PHGII, from a human intestinal sample.
28. Use of a kit according to claim 27, for detecting an intestinal disease, for predicting the efficacy of a drug in the treatment of an intestinal disease, and/or for the differential diagnosis of IBD phenotypes; wherein said intestinal disease is selected from the group consisting of inflammatory bowel disease (IBD), irritable bowel syndrome (IBS) and colorectal cancer (CRC).
29. A nucleic acid molecule with a sequence selected from the group consisting of SEQ ID NO: 1 or a sequence with at least 80% identity thereof; SEQ ID NO: 2 or a sequence with at least 90% identity thereof; SEQ ID NO: 3 or a sequence with at least 80% identity thereof; and SEQ ID NO: 4 or a sequence with at least 85% identity thereof.
PCT/EP2016/069188 2015-08-11 2016-08-11 Method for the quantification of faecalibacterium prausnitzii phylogroup i and/or phylogroup ii members and the use thereof as biomarkers WO2017025617A1 (en)

Priority Applications (17)

Application Number Priority Date Filing Date Title
KR1020187006886A KR102726075B1 (en) 2015-08-11 2016-08-11 Method for quantifying members of Faecalibacterium prausnitzii phylogroup I/or phylogroup II and their use as biomarkers
US15/751,805 US11299788B2 (en) 2015-08-11 2016-08-11 Method for the quantification of Faecalibacterium prausnitzii phylogroup I and/or phylogroup II members and the use thereof as biomarkers
ES16754468T ES2901465T3 (en) 2015-08-11 2016-08-11 Procedure for the quantification of the members of phylogroup I and/or phylogroup II of Faecalibacterium prausnitzii and their use as biomarkers
HRP20211757TT HRP20211757T1 (en) 2015-08-11 2016-08-11 Method for the quantification of faecalibacterium prausnitzii phylogroup i and/or phylogroup ii members and the use thereof as biomarkers
AU2016306627A AU2016306627B2 (en) 2015-08-11 2016-08-11 Method for the quantification of faecalibacterium prausnitzii phylogroup I and/or phylogroup II members and the use thereof as biomarkers
MX2018001697A MX390884B (en) 2015-08-11 2016-08-11 METHOD FOR THE QUANTIFICATION OF MEMBERS OF PHYLOGROUP I AND/OR PHYLOGROUP II OF FAECALIBACTERIUM PRAUSNITZII AND THEIR USE AS BIOMARKERS.
DK16754468.3T DK3334838T3 (en) 2015-08-11 2016-08-11 PROCEDURE FOR THE QUANTIFICATION OF THE FAECALIBACTERIUM PRAUSNITZII PHYLOGRAPH I AND / OR PHYLOGRUPE II MEMBERS AND ITS USE AS BIOMARKERS
CN202211643379.9A CN115976239A (en) 2015-08-11 2016-08-11 Method for quantifying members of the relatives I and/or II of C.putida and use thereof as biomarkers
HK18116361.7A HK1257108B (en) 2015-08-11 2016-08-11 Method for the quantification of faecalibacterium prausnitzii phylogroup i and/or phylogroup ii members and the use thereof as biomarkers
CA2995308A CA2995308A1 (en) 2015-08-11 2016-08-11 Method for the quantification of faecalibacterium prausnitzii phylogroup i and/or phylogroup ii members and the use thereof as biomarkers
CN201680059564.XA CN108474037A (en) 2015-08-11 2016-08-11 Pu Shi dwell bacillus faecalis relationship group I and/or relationship group II member quantitative approach and its purposes as biomarker
EP16754468.3A EP3334838B1 (en) 2015-08-11 2016-08-11 Method for the quantification of faecalibacterium prausnitzii phylogroup i and/or phylogroup ii members and the use thereof as biomarkers
SI201631380T SI3334838T1 (en) 2015-08-11 2016-08-11 Method for the quantification of faecalibacterium prausnitzii phylogroup i and/or phylogroup ii members and the use thereof as biomarkers
JP2018527012A JP7095210B2 (en) 2015-08-11 2016-08-11 Methods for quantifying members of Faecalibacterium prausnitzii phylogenetic group I and/or phylogenetic group II and their use as biomarkers
IL257461A IL257461B (en) 2015-08-11 2018-02-11 Method for the quantification of faecalibacterium prausnitzii phylogroup i and/or phylogroup ii members and the use thereof as biomarkers
JP2021173197A JP2022031644A (en) 2015-08-11 2021-10-22 Methods for quantifying members of Faecalibacterium prausnitzii phylogenetic group I and/or phylogenetic group II and their use as biomarkers
US17/683,926 US20220307075A1 (en) 2015-08-11 2022-03-01 Method for the quantification of faecalibacterium prausnitzii phylogroup i and/or phylogroup ii members and the use thereof as biomarkers

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
EP15382427.1A EP3130680A1 (en) 2015-08-11 2015-08-11 Method for the detection, follow up and/or classification of intestinal diseases
EP15382427.1 2015-08-11

Related Child Applications (2)

Application Number Title Priority Date Filing Date
US15/751,805 A-371-Of-International US11299788B2 (en) 2015-08-11 2016-08-11 Method for the quantification of Faecalibacterium prausnitzii phylogroup I and/or phylogroup II members and the use thereof as biomarkers
US17/683,926 Continuation US20220307075A1 (en) 2015-08-11 2022-03-01 Method for the quantification of faecalibacterium prausnitzii phylogroup i and/or phylogroup ii members and the use thereof as biomarkers

Publications (2)

Publication Number Publication Date
WO2017025617A1 true WO2017025617A1 (en) 2017-02-16
WO2017025617A8 WO2017025617A8 (en) 2017-06-08

Family

ID=53938288

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2016/069188 WO2017025617A1 (en) 2015-08-11 2016-08-11 Method for the quantification of faecalibacterium prausnitzii phylogroup i and/or phylogroup ii members and the use thereof as biomarkers

Country Status (15)

Country Link
US (2) US11299788B2 (en)
EP (2) EP3130680A1 (en)
JP (2) JP7095210B2 (en)
KR (1) KR102726075B1 (en)
CN (2) CN108474037A (en)
AU (1) AU2016306627B2 (en)
CA (1) CA2995308A1 (en)
DK (1) DK3334838T3 (en)
ES (1) ES2901465T3 (en)
HR (1) HRP20211757T1 (en)
IL (1) IL257461B (en)
MX (1) MX390884B (en)
PT (1) PT3334838T (en)
SI (1) SI3334838T1 (en)
WO (1) WO2017025617A1 (en)

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2018220237A1 (en) 2017-06-02 2018-12-06 Goodgut Sl Grape skin for use in the treatment of dysbiosis
WO2019115755A1 (en) * 2017-12-15 2019-06-20 Vib Vzw A new inflammation associated, low cell count enterotype
WO2020093040A1 (en) * 2018-11-02 2020-05-07 The Regents Of The University Of California Methods to diagnose and treat cancer using non-human nucleic acids
WO2020182922A1 (en) 2019-03-13 2020-09-17 Goodgut S.L. Improved method for the screening, diagnosis and/or monitoring of colorectal advanced neoplasia, advanced adenoma and/or colorectal cancer
WO2023049838A1 (en) * 2021-09-23 2023-03-30 Flagship Pioneering Innovations Vi, Llc Diagnosis and treatment of diseases and conditions of the intestinal tract
WO2024181851A1 (en) * 2023-02-28 2024-09-06 Enterobiome Inc. Method for predicting therapeutic response of pharmabiotics and treatment method of various diseases using the same

Families Citing this family (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2015108177A1 (en) * 2014-01-20 2015-07-23 富士レビオ株式会社 Method for measuring modified nucleobase using guide probe, and kit therefor
JP7307683B2 (en) * 2017-11-02 2023-07-12 株式会社ジーシー Oral examination method using information on bacterial groups related to clinical indicators
CZ308092B6 (en) * 2018-09-08 2020-01-02 Výzkumný ústav veterinárního lékařství, v. v. i. Method of detecting Faecalibacterium prausnitzii by real-time PCR and primers for this detection method of F. prausnitzii
CN114015761A (en) * 2021-09-24 2022-02-08 上海交通大学医学院附属瑞金医院 Application of excrement tyrDC gene abundance as biomarker for predicting levodopa curative effect
EP4386091A1 (en) * 2022-12-14 2024-06-19 The BioArte Limited A method for taxonomic classification up to species level of bacteria
WO2025064645A1 (en) * 2023-09-19 2025-03-27 Flagship Pioneering Innovations Vi, Llc Compositions and methods for treating inflammatory bowel disease

Citations (13)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6174681B1 (en) 1999-03-05 2001-01-16 Mayo Foundation For Medical Education And Research Method and probe set for detecting cancer
WO2003068788A1 (en) 2002-02-13 2003-08-21 Medimolecular Pty. Ltd. Method of isolating nucleic acids from stool samples
US20060051769A1 (en) * 2004-09-03 2006-03-09 Affymetrix, Inc. Methods of genetic analysis of E. coli
US20120213772A1 (en) * 2009-07-16 2012-08-23 The Regents Of The University Of California Metabolic biomarkers of Crohn's Disease
US20120238468A1 (en) * 2009-10-05 2012-09-20 Aak Patent B.V. Methods for diagnosing irritable bowel syndrome
WO2014137211A1 (en) * 2013-03-05 2014-09-12 Rijksuniversiteit Groningen Use of faecali bacterium prausnitzii htf-f (dsm 26943) to suppress inflammation.
WO2014138999A1 (en) * 2013-03-14 2014-09-18 University Of Ottawa Methods for the diagnosis and treatment of inflammatory bowel disease
US8906610B2 (en) * 2010-02-08 2014-12-09 The Regents Of The University Of California Using phylogenetic probes for quantification of stable isotope labeling and microbial community analysis
WO2014197607A1 (en) * 2013-06-05 2014-12-11 The Regents Of The University Of California Detection of tick-borne diseases
US20150038352A1 (en) * 2006-03-31 2015-02-05 Affymetrix, Inc. Analysis of methylation using nucleic acid arrays
EP2876167A1 (en) * 2013-11-21 2015-05-27 Institut Gustave Roussy Microbiota composition, as a marker of responsiveness to chemotherapy, and use of microbial modulators (pre-,pro- or synbiotics) for improving the efficacy of a cancer treatment
CN104745620A (en) * 2015-03-03 2015-07-01 昆明理工大学 Plant expression vector of broad bean VFPPIC gene and application of plant expression vector
WO2015132273A1 (en) * 2014-03-03 2015-09-11 Institut D´Investigació Biomèdica De Girona Dr. Josep Trueta Method for diagnosing colorectal cancer from a human feces sample by quantitive pcr, primers and kit

Family Cites Families (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
FR2820145B1 (en) * 2001-01-31 2004-01-23 Aventis Pharma Sa YEAST STRAIN PRODUCING INDEPENDENT STEROIDS
US20060068433A1 (en) * 2004-09-20 2006-03-30 Godfrey Tony E Multiple mode multiplex reaction quenching method
US7696334B1 (en) * 2002-12-05 2010-04-13 Rosetta Genomics, Ltd. Bioinformatically detectable human herpesvirus 5 regulatory gene
CA2566286A1 (en) 2004-05-11 2005-12-08 Rnai Co., Ltd. Polynucleotide causing rna interfere and method of regulating gene expression with the use of the same
EP2520935A3 (en) * 2006-08-09 2013-02-13 Homestead Clinical Corporation Organ-specific proteins and methods of their use
WO2011140208A2 (en) * 2010-05-04 2011-11-10 University Of Florida Research Foundation, Inc. Methods and compositions for diagnosing and treating autoimmune disorders
WO2012170478A2 (en) 2011-06-06 2012-12-13 The University Of North Carolina At Chapel Hill Methods and kits for detecting adenomas, colorectal cancer, and uses thereof
AU2013340414B2 (en) * 2012-10-23 2019-05-02 Caris Science, Inc. Aptamers and uses thereof
MX2015006491A (en) * 2012-11-23 2015-12-03 Seres Health Inc Synergistic bacterial compositions and methods of production and use thereof.

Patent Citations (13)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6174681B1 (en) 1999-03-05 2001-01-16 Mayo Foundation For Medical Education And Research Method and probe set for detecting cancer
WO2003068788A1 (en) 2002-02-13 2003-08-21 Medimolecular Pty. Ltd. Method of isolating nucleic acids from stool samples
US20060051769A1 (en) * 2004-09-03 2006-03-09 Affymetrix, Inc. Methods of genetic analysis of E. coli
US20150038352A1 (en) * 2006-03-31 2015-02-05 Affymetrix, Inc. Analysis of methylation using nucleic acid arrays
US20120213772A1 (en) * 2009-07-16 2012-08-23 The Regents Of The University Of California Metabolic biomarkers of Crohn's Disease
US20120238468A1 (en) * 2009-10-05 2012-09-20 Aak Patent B.V. Methods for diagnosing irritable bowel syndrome
US8906610B2 (en) * 2010-02-08 2014-12-09 The Regents Of The University Of California Using phylogenetic probes for quantification of stable isotope labeling and microbial community analysis
WO2014137211A1 (en) * 2013-03-05 2014-09-12 Rijksuniversiteit Groningen Use of faecali bacterium prausnitzii htf-f (dsm 26943) to suppress inflammation.
WO2014138999A1 (en) * 2013-03-14 2014-09-18 University Of Ottawa Methods for the diagnosis and treatment of inflammatory bowel disease
WO2014197607A1 (en) * 2013-06-05 2014-12-11 The Regents Of The University Of California Detection of tick-borne diseases
EP2876167A1 (en) * 2013-11-21 2015-05-27 Institut Gustave Roussy Microbiota composition, as a marker of responsiveness to chemotherapy, and use of microbial modulators (pre-,pro- or synbiotics) for improving the efficacy of a cancer treatment
WO2015132273A1 (en) * 2014-03-03 2015-09-11 Institut D´Investigació Biomèdica De Girona Dr. Josep Trueta Method for diagnosing colorectal cancer from a human feces sample by quantitive pcr, primers and kit
CN104745620A (en) * 2015-03-03 2015-07-01 昆明理工大学 Plant expression vector of broad bean VFPPIC gene and application of plant expression vector

Non-Patent Citations (107)

* Cited by examiner, † Cited by third party
Title
"World Gastroenterology Organisation Global Guidelines", INFLAMMATORY BOWEL DISEASE: A GLOBAL PERSPECTIVE, June 2009 (2009-06-01)
ALTSCHUL SF ET AL., NUCLEIC ACIDS RESEARCH, vol. 25, 1997, pages 3389 - 3402
ANDOH ET AL., CURRENT PHARMACEUTICAL DESIGN, vol. 15, 2009, pages 2066 - 2073
ANONYMOUS: "EM_PAT:HK237957", 9 December 2014 (2014-12-09), XP055319697, Retrieved from the Internet <URL:http://ibis.internal.epo.org/exam/dbfetch.jsp?id=EM_PAT:HK237957> [retrieved on 20161115] *
ANONYMOUS: "GS_NUC_ALERT:US2015038352.149432", 5 February 2015 (2015-02-05), XP055319828, Retrieved from the Internet <URL:http://ibis.internal.epo.org/exam/dbfetch.jsp?id=GS_NUC_ALERT:US2015038352.149432> [retrieved on 20161116] *
ANONYMOUS: "GSN:AFE87984", 9 March 2006 (2006-03-09), XP055319831, Retrieved from the Internet <URL:http://ibis.internal.epo.org/exam/dbfetch.jsp?id=GSN:AFE87984> [retrieved on 20161116] *
ANONYMOUS: "GSN:BBS66443", 11 December 2014 (2014-12-11), XP055319707, Retrieved from the Internet <URL:http://ibis.internal.epo.org/exam/dbfetch.jsp?id=GSN:BBS66443> [retrieved on 20161115] *
ANONYMOUS: "GSN:BCM17194", 1 July 2015 (2015-07-01), XP055319699, Retrieved from the Internet <URL:http://ibis.internal.epo.org/exam/dbfetch.jsp?id=GSN:BCM17194> [retrieved on 20161115] *
ARUMUGAM ET AL., NATURE, vol. 473, 2011, pages 174 - 180
BACH ET AL., J MICROBIOL METHODS., vol. 49, no. 3, 2002, pages 235 - 45
BALAMURUGAN ET AL., J GASTROENTEROL HEPATOL, vol. 23, 2008, pages 1298 - 1303
BARCENILLA ET AL., APPL ENVIRON MICROBIOL, vol. 66, 2000, pages 1654 - 1661
BAUMGART ET AL., ISME J., vol. 1, 2007, pages 403 - 418
BESIDES, JIA ET AL., FEMS MICROBIOL LETT., vol. 310, 2010, pages 138 - 144
BEST, W.R. ET AL., GASTROENTEROLOGY, vol. 70, no. 3, 1976, pages 439 - 44
BUSQUETS D ET AL: "Anti-tumour Necrosis Factor Treatment with Adalimumab Induces Changes in the Microbiota of Crohn's Disease", JOURNAL OF CROHN'S AND COLITIS, vol. 9, no. 10, 4 July 2015 (2015-07-04), NL, pages 899 - 906, XP055319550, ISSN: 1873-9946, DOI: 10.1093/ecco-jcc/jjv119 *
CARLSSON ET AL., SCAND J GASTROENTEROL., vol. 48, 2013, pages 1136 - 1144
CHEIFETZ A; ITZKOWITZ S., J CLIN GASTROENTEROL., vol. 38, no. 5, May 2004 (2004-05-01), pages S44 - 50
CORLESS ET AL., J CLIN MICROBIOL, vol. 38, no. 5, 2000, pages 1747 - 52
DUNCAN ET AL., INT J SYST EVOL MICROBIOL, vol. 52, 2002, pages 2141 - 2146
ECKBURG ET AL., SCIENCE, vol. 308, 2005, pages 1635 - 1638
FARMER ET AL., AM J GASTROENTEROL, vol. 95, 2000, pages 3184 - 3188
FLECKNA ET AL., MOL CELL PROBES, vol. 21, no. 4, 2007, pages 282 - 7
FLORKOWSKI M. C., CLIN BIOCHEM REV., vol. 29, no. 1, 2008, pages S83 - S87
FRANK ET AL., PROC NATL ACAD SCI USA., vol. 104, 2007, pages 13780 - 13785
FURET J-P ET AL., FEMS MICROBIOLOGY ECOLOGY, vol. 68, 2009, pages 351 - 362
GEBOES ET AL., J CLIN PATHOL, vol. 58, 2005, pages 1133 - 1134
GHOSHAL ET AL., INT J INFLAM, 2012, pages 151085
GIULIETTI ET AL., METHODS, vol. 25, 2001, pages 386 - 401
GREINER ET AL., PREVENTIVE VETERINARY MEDICINE, vol. 45, 2000, pages 23 - 41
HANSEN ET AL., AM J GASTROENTEROL, vol. 107, 2012, pages 1913 - 1922
HARMSEN ET AL., APPL ENVIRON MICROBIOL, vol. 68, 2002, pages 2982 - 2990
HARVEY-BRADSHAW, LANCET, vol. 315, no. 8167, 1980, pages 514
HOLD ET AL., APPL ENVIRON MICROBIOL., vol. 69, 2003, pages 4320 - 4324
JIA ET AL., FEMS MICROBIOL LETT, vol. 310, 2010, pages 138 - 144
JIA W ET AL: "Is the abundance of Faecalibacterium prausnitzii relevant to Crohn's disease?", FEMS MICROBIOLOGY LETTERS, vol. 310, no. 2, 2 August 2010 (2010-08-02), pages 138 - 144, XP055025118, ISSN: 0378-1097, DOI: 10.1111/j.1574-6968.2010.02057.x *
JOHNSON M ET AL., NUCLEIC ACIDS RES., vol. 1, 2008, pages 36
KABEERDOSS ET AL., BMC GASTROENTEROL., vol. 13, 2013, pages 20
KALLIOMAKI ET AL., J ALLERGCLINLMMUNOL, vol. 107, 2001, pages 129 - 134
KENNEDY A. ET AL., PLOS ONE, vol. 9, no. 2, 2014, pages E88982
KONIKOFF; DENSON, INFLAMM BOWEL DIS., vol. 12, no. 6, 2006, pages 524 - 34
LANCET., vol. 315, no. 8167, 1980, pages 514
LANE DJ. ET AL.: "PCR amplification as previously reported", 1991, JOHN WILLY AND SONS
LOPEZ-SILES ET AL., APPL ENVIRON MICROBIOL, vol. 78, 2012, pages 420 - 428
LOPEZ-SILES ET AL., APPL ENVIRON MICROBIOL., vol. 78, 2012, pages 420 - 428
LOPEZ-SILES ET AL., INTERNATIONAL JOURNAL OF MEDICAL MICROBIOLOGY, vol. 304, 2014, pages 464 - 475
LOPEZ-SILES M ET AL., INTERNATIONAL JOURNAL OF MEDICAL MICROBIOLOGY, vol. 304, 2014, pages 464 - 475
LOPEZ-SILES M ET AL: "Changes in the Abundance of Faecalibacterium prausnitzii Phylogroups I and II in the Intestinal Mucosa of Inflammatory Bowel Disease and Patients with Colorectal Cancer", INFLAMMATORY BOWEL DISEASES, vol. 22, no. 1, 1 January 2016 (2016-01-01), US, pages 28 - 41, XP055319233, ISSN: 1078-0998, DOI: 10.1097/MIB.0000000000000590 *
LOPEZ-SILES M ET AL: "Cultured representatives of two major phylogroups of human colonic Faecalibacterium prausnitzii can utilize pectin, uronic acids, and host-derived substrates for growth", APPLIED AND ENVIRONMENTAL MICROBIOLOGY, vol. 78, no. 2, 18 November 2011 (2011-11-18), pages 420 - 428, XP002694537 *
LOPEZ-SILES M ET AL: "Mucosa-associated Faecalibacterium prausnitzii and Escherichia coli co-abundance can distinguish Irritable Bowel Syndrome and Inflammatory Bowel Disease phenotypes", INTERNATIONAL JOURNAL OF MEDICAL MICROBIOLOGY, vol. 304, no. 3-4, 1 May 2014 (2014-05-01), DE, pages 464 - 475, XP055319224, ISSN: 1438-4221, DOI: 10.1016/j.ijmm.2014.02.009 *
LOPEZ-SILES M ET AL: "Mucosa-associated Faecalibacterium prausnitzii phylotype richness is reduced in patients with Inflammatory Bowel Disease", APPLIED AND ENVIRONMENTAL MICROBIOLOGY, vol. 81, no. 21, 21 August 2015 (2015-08-21), pages 7582 - 7592, XP009186741, ISSN: 0099-2240 *
LOPEZ-SILES M: "PhD Thesis. Ecophysiology and phylogeny of Faecalibacterium prausnitzii in healthy and diseased gut. Application in inflammatory bowel disease diagnostics.", 1 November 2015 (2015-11-01), GIRONA, pages i-xxvi, 1 - 181, XP055319220, Retrieved from the Internet <URL:http://www.tdx.cat/bitstream/handle/10803/369044/tmls1de1.pdf?sequence=3&isAllowed=y> [retrieved on 20161114] *
LOPEZ-SILES, M. ET AL., INTERNATIONAL JOURNAL OF MEDICAL MICROBIOLOGY, vol. 304, no. 3-4, 2014, pages 464 - 475
LOUIS ET AL., FEMS MICROBIOL LETT, vol. 294, 2009, pages 1 - 8
M CORIST ET AL., JOURNAL OF MICROBIOLOGICAL METHODS, vol. 50, no. 2, 2002, pages 131 - 139
MACHIELS ET AL., GUT, 2013
MAIDAK BL ET AL., NUCLEIC ACIDS RESEARCH, vol. 29, 2001, pages 173 - 174
MANICHANH ET AL., NAT. REV. GASTROENTEROL. HEPATOL, vol. 9, 2012, pages 599 - 608
MANICHANH ET AL., NAT. REV. GASTROENTEROL. HEPATOL., vol. 9, 2012, pages 599 - 608
MARTINEZ-MEDINA M ET AL: "Abnormal Microbiota Composition in the Ileocolonic Mucosa of Crohn's Disease Patients as Revealed by Polymerase Chain Reaction-Denaturing Gradient Gel Electrophoresis", 1 December 2006 (2006-12-01), XP055133834, Retrieved from the Internet <URL:http://onlinelibrary.wiley.com/store/10.1097/01.mib.0000235828.09305.0c/asset/3780121207_ftp.pdf?v=1&t=hyk5xfwo&s=43567508f19ad917da5f8aa981095acca2c809c3> [retrieved on 20140807] *
MCLAUGHLIN ET AL., THERAP ADV GASTROENTEROL, vol. 3, 2010, pages 335 - 348
MIQUEL ET AL., CURR OPIN MICROBIOL, vol. 16, 2013, pages 255 - 261
MIQUEL S ET AL: "Faecalibacterium prausnitzii and human intestinal health", CURRENT OPINION IN MICROBIOLOGY, vol. 16, no. 3, 1 June 2013 (2013-06-01), pages 255 - 261, XP055185963, ISSN: 1369-5274, DOI: 10.1016/j.mib.2013.06.003 *
M'KOMA A. E., WORLD J GASTROINTEST SURG, vol. 6, no. 11, 2014, pages 208 - 219
MOWAT ET AL., GUT, 2011, pages 1 - 37
NADKARNI ET AL., MICROBIOLOGY, vol. 148, 2002, pages 257 - 66
NAGALINGAM NA; LYNCH SV, INFLAMM BOWEL DIS, vol. 18, 2012, pages 968 - 984
NAVA GM; STAPPENBECK TS., GUT MICROBES., vol. 2, 2011, pages 99 - 104
NOLTE, ADV. CLIN. CHEM., vol. 33, 1998, pages 201 - 235
PINETON DE CHAMBRUN, G., L. ET AL., NAT REV GASTROENTEROL HEPATOL, vol. 7, no. 1, 2010, pages 15 - 29
RAJILIC-STOJANOVIC ET AL., GASTROENTEROLOGY, vol. 141, 2011, pages 1792 - 1801
RODRIGUEZ A ET AL., METHODS MOL BIOL., vol. 1275, 2015, pages 31 - 56
ROUX ET AL., FEMS MICROBIOL ECOL, vol. 78, 2011, pages 617 - 628
SATSANGI ET AL., GUT, vol. 55, 2006, pages 749 - 753
SCHWIERTZ ET AL., J PEDIATR, vol. 157, 2010, pages 240 - 244
SILVERBERG ET AL., CAN J GASTROENTEROL, vol. 19, no. A, 2005, pages 5 - 36
SILVERBERG ET AL., CAN J GASTROENTEROL., vol. 19, no. A, 2005, pages 5 - 36
SMITH CJ; OSBORN AM., FEMS MICROBIOL ECOL., vol. 67, no. 1, 2009, pages 6 - 20
SOKOL ET AL., INFLAMM BOWEL DIS, vol. 15, 2009, pages 1183 - 1189
SOKOL ET AL., INFLAMM BOWEL DIS., vol. 15, 2009, pages 1183 - 1189
SOKOL ET AL., PROC NATL ACAD SCI U S A., vol. 105, 2008, pages 16731 - 16736
SOKOL ET AL., PROC NATL ACAD SCI USA., vol. 105, 2008, pages 16731 - 16736
SOKOL, H. ET AL., PROC. NATL. ACAD. SCI. USA, vol. 105, no. 43, 2008, pages 16731 - 16736
SOSTEGNI ET AL., ALIMENT PHARMACOL THER., vol. 17, no. 2, 2003, pages 11 - 7
SPILLER RC., BEST PRACTICE & RESEARCH CLINICAL GASTROENTEROLOGY, vol. 18, 2004, pages 641 - 661
SUAU ET AL., SYSTEMATIC AND APPLIED MICROBIOLOGY, vol. 24, 2001, pages 139 - 145
SUTHERLAND ET AL., GASTROENTEROLOGY, vol. 92, 1987, pages 1894 - 8
SUZUKI ET AL., APPL ENVIRON MICROBIOL, vol. 66, no. 11, 2000, pages 4605 - 14
SWIDSINSKI ET AL., INFLAMM BOWEL DIS, vol. 14, 2008, pages 147 - 161
SWIDSINSKI ET AL., INFLAMM BOWEL DIS., vol. 14, 2008, pages 147 - 161
SWIDSINSKI ET AL., WORLD J GASTROENTEROL, vol. 11, 2005, pages 1131 - 1140
SWIDSINSKI ET AL., WORLD J GASTROENTEROL., vol. 11, 2005, pages 1131 - 1140
THOMPSON JD ET AL., NUCLEIC ACIDS RES., vol. 22, 1994, pages 4673 - 4680
TKACHUK ET AL., GENET. ANAL. TECH. APPL, vol. 8, 1991, pages 67 - 74
TRASK ET AL., TRENDS GENET., vol. 7, no. 5, 1991, pages 149 - 154
TRUE LOVE; WITTS, JOURNAL OF CROHN'S AND COLITIS, vol. 2, 2008, pages 1 - 23
VAN RHEENEN ET AL., BMJ, vol. 341, 2010, pages C3369
VERMEIREN ET AL., FEMS MICROBIOL ECOL, vol. 79, 2012, pages 685 - 696
WALKER A W ET AL: "Dominant and diet-responsive groups of bacteria within the human colonic microbiota", THE I S M E JOURNAL: MULTIDISCIPLINARY JOURNAL OF MICROBIAL ECOLOGY, vol. 5, no. 2, 5 August 2010 (2010-08-05), United Kingdom, pages 220 - 230, XP055222676, ISSN: 1751-7362, DOI: 10.1038/ismej.2010.118 *
WALKER ET AL., ISME J., 2011, pages 220 - 230
WEIER ET AL., EXPERT REV. MOL. DIAGN, vol. 2, no. 2, 2002, pages 109 - 119
WEINSTOCK B.M, NATURE, vol. 489, 2012, pages 250 - 256
WEISBURG WG; BARNS SM; PELLETIER DA ET AL., J BACTERIOL, vol. 173, 1991, pages 697 - 703
WHITNEY D ET AL., JOURNAL OF MOLECULAR DIAGNOSTICS, AMERICAN SOCIETY FOR INVESTIGATIVE PATHOLOGY, vol. 6, no. 4, 2004, pages 386 - 395
WILLING ET AL., INFLAMM BOWEL DIS., vol. 15, 2009, pages 653 - 660
WRZOSEK ET AL., BMC BIOL., vol. 11, 2013, pages 61
ZWEIG MH; CAMPBELL G, CLINICAL CHEMISTRY, vol. 39, 1993, pages 561 - 577

Cited By (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2018220237A1 (en) 2017-06-02 2018-12-06 Goodgut Sl Grape skin for use in the treatment of dysbiosis
WO2019115755A1 (en) * 2017-12-15 2019-06-20 Vib Vzw A new inflammation associated, low cell count enterotype
US11649508B2 (en) 2017-12-15 2023-05-16 Vib Vzw Inflammation associated, low cell count enterotype
WO2020093040A1 (en) * 2018-11-02 2020-05-07 The Regents Of The University Of California Methods to diagnose and treat cancer using non-human nucleic acids
EP3874068A4 (en) * 2018-11-02 2022-08-17 The Regents of the University of California Methods to diagnose and treat cancer using non-human nucleic acids
WO2020182922A1 (en) 2019-03-13 2020-09-17 Goodgut S.L. Improved method for the screening, diagnosis and/or monitoring of colorectal advanced neoplasia, advanced adenoma and/or colorectal cancer
WO2023049838A1 (en) * 2021-09-23 2023-03-30 Flagship Pioneering Innovations Vi, Llc Diagnosis and treatment of diseases and conditions of the intestinal tract
WO2024181851A1 (en) * 2023-02-28 2024-09-06 Enterobiome Inc. Method for predicting therapeutic response of pharmabiotics and treatment method of various diseases using the same

Also Published As

Publication number Publication date
US11299788B2 (en) 2022-04-12
US20190024146A1 (en) 2019-01-24
MX390884B (en) 2025-03-21
EP3334838A1 (en) 2018-06-20
ES2901465T3 (en) 2022-03-22
EP3130680A1 (en) 2017-02-15
HRP20211757T1 (en) 2022-02-18
KR102726075B1 (en) 2024-11-04
JP2022031644A (en) 2022-02-22
DK3334838T3 (en) 2021-11-15
JP7095210B2 (en) 2022-07-05
MX2018001697A (en) 2019-04-29
WO2017025617A8 (en) 2017-06-08
SI3334838T1 (en) 2022-01-31
KR20180048696A (en) 2018-05-10
IL257461B (en) 2022-05-01
AU2016306627A1 (en) 2018-03-15
US20220307075A1 (en) 2022-09-29
AU2016306627B2 (en) 2022-01-13
PT3334838T (en) 2021-11-23
IL257461A (en) 2018-04-30
CN115976239A (en) 2023-04-18
CN108474037A (en) 2018-08-31
HK1257108A1 (en) 2019-10-11
CA2995308A1 (en) 2017-02-16
JP2018525035A (en) 2018-09-06
EP3334838B1 (en) 2021-10-06

Similar Documents

Publication Publication Date Title
US20220307075A1 (en) Method for the quantification of faecalibacterium prausnitzii phylogroup i and/or phylogroup ii members and the use thereof as biomarkers
Lopez-Siles et al. Mucosa-associated Faecalibacterium prausnitzii and Escherichia coli co-abundance can distinguish Irritable Bowel Syndrome and Inflammatory Bowel Disease phenotypes
Willing et al. A pyrosequencing study in twins shows that gastrointestinal microbial profiles vary with inflammatory bowel disease phenotypes
Lopez-Siles et al. Changes in the abundance of Faecalibacterium prausnitzii phylogroups I and II in the intestinal mucosa of inflammatory bowel disease and patients with colorectal cancer
Kabeerdoss et al. Alterations of mucosal microbiota in the colon of patients with inflammatory bowel disease revealed by real time polymerase chain reaction amplification of 16S ribosomal ribonucleic acid
KR102354660B1 (en) Method for diagnosing colorectal cancer from a human feces sample by quantitative pcr, primers and kit
US20180171389A1 (en) Method of treating crohn&#39;s disease
Sánchez et al. Evaluation of the viasure Neisseria gonorrhoeae ciprofloxacin resistant assay for the simultaneous identification and direct detection of ciprofloxacin susceptibility
Chotiprasitsakul et al. A superior test for diagnosis of Clostridium difficile-associated diarrhea in resource-limited settings
WO2020087130A1 (en) Prognosis and treatment of inflammatory bowel disease
Maestri et al. Standardisation and validation of an in-house quantitative real-time polymerase chain reaction (qPCR) assay for the diagnosis of Clostridioides difficile infection
HK1257108B (en) Method for the quantification of faecalibacterium prausnitzii phylogroup i and/or phylogroup ii members and the use thereof as biomarkers
KR20210141552A (en) Improved methods for screening, diagnosing and/or monitoring advanced colorectal neoplasia, advanced adenoma, and/or colorectal cancer
HK1249134A1 (en) Biomarkers for colorectal cancer related diseases
Koyama et al. Investigation of pure lung microbiota in patients with lung cancer after eliminating upper airway contamination: a prospective cohort study
RU2834789C2 (en) Improved method of screening, diagnosing and/or monitoring advanced colorectal neoplasia, advanced adenoma and/or colorectal cancer
Minh et al. An evaluation of using multiplex Real-Time PCR assay for the identification of factors causing hospital bacterial infections
Sabat-Mir et al. Mireia Lopez-Siles1, Margarita Martinez-Medina1, Romà Surís-Valls1, Xavier Aldeguer2, Miriam
Majaliwa et al. Diagnostic performance of biopsy-based methods for determination of Helicobacter pylori infection in dyspeptic Mozambican patients
KR20240084503A (en) Diagnosis of Colon Cancer Based on Fecal Microbiota
Zhou Enterococcus faecium: from evolutionary insights to practical interventions
HK1232919A1 (en) Method for diagnosing colorectal cancer from a human feces sample by quantitive pcr
HK1232919B (en) Method for diagnosing colorectal cancer from a human feces sample by quantitive pcr

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 16754468

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 2995308

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: MX/A/2018/001697

Country of ref document: MX

WWE Wipo information: entry into national phase

Ref document number: 257461

Country of ref document: IL

ENP Entry into the national phase

Ref document number: 2018527012

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 20187006886

Country of ref document: KR

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 2016754468

Country of ref document: EP

ENP Entry into the national phase

Ref document number: 2016306627

Country of ref document: AU

Date of ref document: 20160811

Kind code of ref document: A