WO2017022887A1 - Reporter plant system for detection of harmful non-degradable aromatic compounds and use thereof - Google Patents

Abstract

The present invention relates to a reporter plant system for the detection of harmful non-degradable aromatic compounds and a use thereof. The present invention can provide a reporter plant system which is very useful for the detection of harmful non-degradable aromatic compounds including toluene, and is able to detect harmful non-degradable aromatic compounds more sensitively and accurately than the prior art. Also, the present invention makes it possible to directly and simply recognize a human-inaccessible area rather than by means of an indirect external recognition system, and can be effectively used to develop a system capable of recognizing toxic substances in real life without using a chemical or physical apparatus.

Description

Reporter plant system for detection of hardly degradable harmful aromatic compounds and use thereof

The present invention relates to a reporter plant system for detecting hardly decomposable hazardous aromatic compounds and uses thereof.

When a non-degradable aromatic compound is released into nature through a food chain or other pathway, it is usually carcinogenic or acts as an environmental hormone by reacting with a polymer such as DNA or protein in cells with its structural similarity and high reactivity. Examples include dioxins, which are emitted during the combustion of automobile emissions and garbage, which not only cause cancer, but also cause reproductive and immune system abnormalities. Also, DDT (dichloro-diphenyl-trichloroethane) is produced as a pesticide. It acts as an environmental hormone that is harmful to the reproductive system. Hardly degradable aromatic compounds entering nature are classified as environmentally toxic substances to be removed first in developed countries. Instrumental chemical methods are used to measure these hardly decomposable aromatic compounds, but the economic and technical effects are not highlighted due to the high cost of the large equipment and the long time due to the complicated processing and the inability to use them. to be. In addition, these heavy equipment equipment is inconvenient to use in the field. Therefore, the development of technology to detect hardly decomposable aromatic compounds more quickly, simply and at low cost is important in terms of national and social aspects of implementing the Stockholm Environmental Convention and in terms of economic and environmental technologies that must solve problems in high cost and field application.

BTEX compounds refer to benzene, toluene, ethylbenzene and xylene. Recently, due to the rapid growth of industrial activities, a considerable amount of harmful pollutants are released into the natural environment, among which VOCs (volatile BTEX compounds, a representative oil compound of organic compounds, are becoming more contaminated due to leakages and accidents in oil storage and widespread use in industry. Pollution caused by these is widely found in the public drinking water system such as surface water source, ground water source, and treated drinking water. Most VOCs are found to be toxic organic chemicals that cause carcinogenicity. Directives and legislation are on the rise.

In order to measure such BTEX, chromatography-mass spectrometry (GC-MS) and the like have been conventionally used as an instrument chemical method, but such a method is expensive, takes a long time by complicated processing, and has no expertise. Silver is not easy to use and also requires heavy equipment, there was a limitation in use that can not be used in the field (Korean Patent Publication No. 10-2004-0076292). Therefore, BTEX compounds (benzene, toluene, ethylbenzene, xylene), which are oil-related harmful environmental pollutants, and 2,4,6-trinitrotoluene (TNT), which are derived from explosives, and 2,4-Dinitrotoluene (DNT) Efforts to develop technologies for efficiently detecting and removing hardly decomposable hazardous aromatic compounds have continued.

Meanwhile, Korean Patent No. 1430685 discloses an artificial biosensor for detecting a degradable harmful aromatic compound and a manufacturing method thereof, and Korean Patent No. 0539142 discloses a biosensor for detecting a BT extract and a method of manufacturing the same. have. However, there is no mention of the reporter plant system for detecting the hardly degradable harmful aromatic compound of the present invention and its use.

The present invention is derived from the above requirements, in the present invention, the TodST-IAA module operates in the presence of toluene to transform plant to produce plant growth hormone, and includes a DR5 promoter and a GUS gene which recognizes the same. By preparing a plant transformed with an RNAi expression vector comprising an expression vector or a DR5 promoter and a ChlH (Mg-chelatase H subunit) gene, the phenotype of the transformed plant compared to the non-transformed plant was confirmed. The invention has been completed.

In order to achieve the above object, the present invention is 1) Pseudomonas putida derived from todS gene, Pseudomonas putida derived from todT gene, Pseudomonas putida derived from the promoter (promoter) and plant growth hormone (plant growth hormone) Transformed rhizobacteria for the production of plant growth hormone in the presence of a hardly degradable noxious aromatic compound characterized by being transformed with an expression vector comprising a gene: and 2) a promoter and reporter gene specifically recognized by the plant growth hormone Provided is a reporter plant system for detecting hardly decomposable harmful aromatic compounds in soil, comprising a plant transformed with an RNAi expression vector comprising a promoter and a pigment generating gene that the expression vector or plant growth hormone specifically recognizes.

In addition, the present invention provides a method for producing a reporter plant system for detecting hardly decomposable harmful aromatic compounds in the soil.

The present invention also provides a method for detecting a hardly decomposable harmful aromatic compound in soil using a reporter plant system for detecting a hardly decomposable harmful aromatic compound in soil.

The present invention can provide a reporter plant system which is very useful for detecting hardly decomposable harmful aromatic compounds including toluene, and can more sensitively and accurately detect the hardly decomposable hazardous aromatic compounds than in the prior art. In addition, it is possible to recognize the direct simplicity rather than the indirect external recognition system of the area where people are not easily accessible, and it can be useful for developing a system that can recognize toxic substances in real life without using chemical / physical equipment. have.

Figure 1 shows a schematic diagram of toluene reporter plant production using Pseudomonas putida TodST-IAA module and DR5-GUS system of the present invention.

Figure 2 shows the biosynthetic pathway of plant growth hormone IAA (Indole-3-acetic acid) produced by bacteria. The purple arrow is the IAM (indole-3-acetamide) pathway and the red arrow is the IPyA (Indole-3-pyruvate) pathway.

Figure 3 shows the IAA production capacity of Pseudomonas putida 06iaaMH, 30iaaMH and ipdC strain of the present invention when treated with toluene.

Figure 4 shows the results of GUS expression of Arabidopsis plants using IAA production capacity of Pseudomonas putida 06iaaMH, 30iaaMH and ipdC strain of the present invention with or without toluene.

Figure 5 shows the root colonization capacity (root colonization capacity) of the Pseudomonas putida strain of the present invention.

Figure 6 shows a schematic diagram of toluene reporter transgenic plant production using Pseudomonas putida TodST-IAA module and Ch1H-RNAi system of the present invention.

7 shows a schematic diagram of a method for producing a pK7_DR5_Ch1H vector of the present invention.

Figure 8 shows the RNAi phenotype of the Ch1H gene when treated with Agrobacterium tumefasiens strains and IAA standards transformed with RNAi expression vector on the leaves of tobacco plants Nicotiana benthamiana with or without toluene. It is shown. Mock is a negative control treated with nothing.

9 is a cigarette in accordance with toluene or without (Nicotiana benthamiana) transfected with RNAi expression vectors on a leaf of the plant conversion was Agrobacterium Tome Pacific Enschede (Agrobacterium tumefasiens) strain, IAA-producing strain of Pseudomonas footage is (Pseudomonas putida) O6iaaMH strain and Pseudomonas When treated with Pseudomonas chlororaphis strain and IAA standards, the RNAi phenotype of the Ch1H gene is shown. Water control is a negative control with no treatment.

10 is a cigarette in accordance with toluene or without (Nicotiana benthamiana) transfected with RNAi expression vectors on a leaf of the plant conversion was Agrobacterium Tome Pacific Enschede (Agrobacterium tumefasiens) strain, IAA-producing strain of Pseudomonas footage is (Pseudomonas putida) O6iaaMH strain and Pseudomonas Chlorophyll content is shown when treated with Pseudomonas chlororaphis strain and IAA standards. Water control is a negative control with no treatment.

The present invention

1) Pseudomonas putida derived from todS gene, Pseudomonas putida- derived todT gene, Pseudomonas putida- derived todX gene promoter (promoter) and plant growth hormone (plant growth hormone) gene transformed with the expression vector Transformed rhizome bacteria for the production of plant growth hormone in the presence of a non-degradable harmful aromatic compound, characterized in that: and

2) a plant transformed with an expression vector comprising a promoter and a reporter gene specifically recognized by the plant growth hormone or an RNAi expression vector comprising a promoter and a pigment generating gene specifically recognized by the plant growth hormone Provided is a reporter plant system for detecting hardly decomposable harmful aromatic compounds in soil.

Specifically, the todS gene preferably has a nucleotide sequence of SEQ ID NO: 7, but is not limited thereto.

Specifically, the todT gene preferably has a nucleotide sequence of SEQ ID NO: 8, but is not limited thereto.

Specifically, the promoter of the todX gene preferably has a nucleotide sequence of SEQ ID NO: 9, but is not limited thereto.

The promoters of the todS gene, the todT gene, and the todX gene are composed of nucleotide sequences in which one or several bases are added, deleted, or substituted as long as they have the same activity in the nucleotide sequences of SEQ ID NO: 7, SEQ ID NO: 8, and SEQ ID NO: 9, respectively. It is preferred, but not limited to.

The promoters of the todS gene, the todT gene, and the todX gene are at least 80% homology, more specifically at least 90% homology, most specifically 95%, 96% to the nucleotide sequences of SEQ ID NO: 7, SEQ ID NO: 8 and SEQ ID NO: 9, respectively. It is preferably composed of a base sequence having a homology of at least 97%, 98%, 99% or 99.5%, but is not limited thereto.

The plant growth hormone is preferably IAA (indole acetic acid), cytokinin (cytokinin), gibberellin (gibberellin), ethylene (ethylene), abscisic acid (brassinosteroid), etc., but is not limited thereto. Do not.

The promoter specifically recognized by the plant growth hormone is preferably a DR5 promoter, a cytokinin receptor promoter, an ethylene receptor promoter, or a pathogenesis-related 1 promoter, but is not limited thereto. .

The reporter gene is composed of green fluorescent protein (GFP), alkaline phosphatase, luciferase, luciferase, beta-glucuronidase (GUS) and beta-galactosidase genes. It is preferably any one selected from the group, more preferably beta-glucuronidase (GUS) gene, but is not limited thereto.

The pigment generating gene is preferably a ChlH (Mg-chelatase H subunit) gene or a PDS (phytoene desaturase) gene, but is not limited thereto.

The rhizosphere bacteria are Pseudomonas putida , Paenibacillus polymyxa E681, Bacillus subtilis GB03, Bacillus pumilus INR7 is preferred, but not limited thereto.

The hardly decomposable hazardous aromatic compound may be a BTEX compound (benzene, toluene, ethylbenzene, xylene) or toluene compound (for example, 2,4,6-trinitrotoluene (2). , 4,6-trinitrotoluene, TNT)), more preferably toluene, but is not limited thereto.

The term “vector” is used to refer to a DNA fragment (s), a nucleic acid molecule, that is delivered into a cell. Vectors can replicate DNA and be reproduced independently in host cells. The term "carrier" is often used interchangeably with "vector". The term “expression vector” refers to a recombinant DNA molecule comprising a coding sequence of interest and a suitable nucleic acid sequence necessary to express a coding sequence operably linked in a particular host organism. Promoters, enhancers, termination signals and polyadenylation signals available in eukaryotic cells are known.

Preferred examples of plant expression vectors are Ti-plasmid vectors which, when present in a suitable host such as Agrobacterium tumerfaciens, can transfer part of themselves, the so-called T-region, into plant cells. Another type of Ti-plasmid vector (see EP 0 116 718 B1) is used to transfer hybrid DNA sequences to protoplasts from which current plant cells or new plants can be produced that properly insert hybrid DNA into the plant's genome. have. A particularly preferred form of the Ti-plasmid vector is the so-called binary vector as claimed in EP 0 120 516 B1 and US Pat. No. 4,940,838. Other suitable vectors that can be used to introduce the DNA according to the invention into a plant host are viral vectors, such as those which can be derived from double stranded plant viruses (eg CaMV) and single stranded viruses, gemini viruses, etc. For example, it may be selected from an incomplete plant viral vector. The use of such vectors can be advantageous especially when it is difficult to properly transform a plant host.

The expression vector will preferably comprise one or more selectable markers. The marker is typically a nucleic acid sequence having properties that can be selected by chemical methods, and all genes that can distinguish transformed cells from non-transformed cells. Examples include herbicide resistance genes such as glyphosate, phosphinothricin and glufosinate, kanamycin, G418, bleomycin, hygromycin, There are antibiotic resistance genes such as chloramphenicol, but are not limited thereto.

In the plant expression vector of the present invention, the promoter may be, but is not limited to, CaMV 35S, actin, ubiquitin, pEMU, MAS or histone promoter.

The term "promoter" refers to a region of DNA upstream from a structural gene and refers to a DNA molecule to which an RNA polymerase binds to initiate transcription. A "plant promoter" is a promoter capable of initiating transcription in plant cells. A "constitutive promoter" is a promoter that is active under most environmental conditions and developmental conditions or cell differentiation. Constitutive promoters may be preferred in the present invention because selection of the transformants may be made by various tissues at various stages. Thus, the constitutive promoter does not limit the selection possibilities.

In the plant expression vectors of the present invention, conventional terminators can be used, for example nopalin synthase (NOS), rice α-amylase RAmy1 A terminator, phaseoline terminator, Agrobacterium tumefaciens (Agrobacterium) terminators of the octopine gene of tumefaciens, but are not limited thereto. With regard to the need for terminators, such regions are generally known to increase the certainty and efficiency of transcription in plant cells. Therefore, the use of terminators is highly desirable in the context of the present invention.

Plant transformation refers to any method of transferring DNA to a plant. Such transformation methods do not necessarily have a period of regeneration and / or tissue culture. Transformation of plant species is now common for plant species, including both dicotyledonous plants as well as monocotyledonous plants. In principle, any transformation method can be used to introduce hybrid DNA according to the invention into suitable progenitor cells. The method is based on the calcium / polyethylene glycol method for protoplasts (Krens et al., 1982, Nature 296: 72-74; Negrutiu et al., 1987, Plant Mol. Biol. 8: 363-373), electroporation of protoplasts ( Shillito et al., 1985, Bio / Technol. 3: 1099-1102), microscopic injection into plant elements (Crossway et al., 1986, Mol. Gen. Genet. 202: 179-185), of various plant elements ( DNA or RNA-coated) particle bombardment (Klein et al., 1987, Nature 327: 70), in Agrobacterium tumerfaciens mediated gene transfer (non-invasion) by plant infiltration or transformation of mature pollen or vesicles. Integrity) can be appropriately selected from infection by virus (EP 0 301 316) and the like. Preferred methods according to the invention include Agrobacterium mediated DNA delivery. Especially preferred is the use of the so-called binary vector technology as described in EPA 120 516 and US Pat. No. 4,940,838.

In addition, the present invention

1) preparing an expression vector comprising a promoter and plant growth hormone gene of Pseudomonas putida- derived todS gene, Pseudomonas putida- derived todT gene, and Pseudomonas putida- derived todX gene ;

2) transforming the expression vector of step 1) to the rhizosphere bacteria to prepare a transformed rhizosphere bacterium for plant growth hormone production in the presence of a hardly decomposable harmful aromatic compound; And

3) RNAi expression comprising the expression vector comprising a promoter and a reporter gene that the plant growth hormone specifically recognizes the transformed rhizosphere bacteria of step 2) or a promoter and a pigment generating gene that the plant growth hormone specifically recognizes Provided is a method for producing a reporter plant system for detecting a non-degradable harmful aromatic compound in soil, comprising the step of treating the plant transformed with the vector.

In the method for producing a reporter plant system for detecting a hardly degradable noxious aromatic compound in soil of the present invention, each gene, plant growth hormone, rhizosphere bacteria, reporter gene, pigment generating gene and the like are as described above.

In addition, the present invention

1) A plant transformed with an RNAi expression vector comprising an expression vector comprising a promoter and a reporter gene specifically recognized by the plant growth hormone or a promoter and a pigment generating gene specifically recognized by the plant growth hormone in the test sample. Planting step;

2) transformed with an expression vector comprising a Pseudomonas putida derived todS gene, Pseudomonas putida derived todT gene, Pseudomonas putida derived todX promoter and a plant growth hormone gene Treating the transformed plant root bacteria for plant growth hormone production to a test sample in which the transformed plant of step 1) is grown in the presence of a hardly decomposable harmful aromatic compound; And

3) It provides a method for detecting hardly degradable harmful aromatic compounds in the soil comprising the step of confirming the color change of the transgenic plant planted after the treatment of the transformed rhizosphere bacteria of step 2).

The color change of the transgenic plant can be confirmed in comparison with the non-transformed plant, but is not limited thereto. That is, when toluene is present in the test sample, the plant transformed with the expression vector including the reporter gene may be colored through expression of the reporter gene, compared to the non-transformed plant, and RNAi including the pigment generating gene. Plants transformed with the expression vector may have a problem in the production of chloroplast pigment, and the plant may turn yellow. Therefore, the presence or absence of toluene can be detected through the color change of the transgenic plant.

Hereinafter, the present invention will be described in more detail with reference to Examples. These examples are only for explaining the present invention in more detail, it is obvious to those skilled in the art that the scope of the present invention is not limited by them.

Example 1 Preparation of Toluene Reporter Plant Using DR5-GUS System

(1) Pseudomonas putida ( Pseudomonas putida ) Fabrication of TodST-IAA Module

In order to recognize and toluene (toluene) to produce and amplify the signal that plants can react, the TodST module using the two-component system of microorganisms was used. In order to establish a system for producing plant hormone IAA (Indole-3-acetic acid) below TodT-BOX of this module, the artificial biosensor for detecting degradable harmful aromatic compound and its manufacturing method (Korean Patent No. 1430685) Pseudomonas putida KT2440 strain was used (FIG. 1). Auxin (auxin) is a representative plant growth hormone affects the growth of the cells, some bacteria in the plant root area to produce and secrete auxin, which can be absorbed by the plant and used for growth. Indole-3-acetic acid (IAA), a representative of auxin, is produced by various pathways in various bacteria. The most characteristic of these is the indole-3-acetamide (IAM) pathway, which is first converted to tryptophan by tryptophan-2-monooxygenase encoded by the iaaM gene. It is then made IAA by IAM hydrolase (amidase, IaaH) encoded by the iaaH gene, and iaaM and iaaH are found in many bacteria. In addition, the IPyA (Indole-3-pyruvate) pathway is a major pathway for synthesizing IAA in most plants, and is also present in various bacteria, and is initiated by conversion to IPyA by tryptophan aminotransferase. IPyA is oxidized to IAA after changing to IAAld (indole-3-acetaldehyde) while carboxyl group is removed by IPDC (Indolepyruvate decarboxylase) (FIG. 2). Thus, including the iaaM , iaaH and ipdC genes In order to produce a Pseudomonas (Pseudomonas) in and azo RY rilrum (Azospirillum) in strains with the expression vectors to produce high levels of IAA, iaaH and iaaM gene from Pseudomonas chloro lapis (Pseudomonas chlororaphis) O6 and 30-84 strains The ipdC gene was obtained from an Azospirillum brasilense Cd strain to prepare an expression vector. Pseudomonas chloro lapis (Pseudomonas chlororaphis) O6 and 30-84 strains, and azo RY rilrum bra chamber lances (Azospirillum brasilense) inoculated with the respective strain Cd KB (King's B) 3㎖ broth and incubated at 30 ℃ 24 hours. Then, the cells were collected by centrifugation and genomic DNA was extracted using NanoHelix PureHelix Genomic DNA Prep Kit (Column Type). Since genomic DNA as a template amplified iaaM , iaaH and ipdC using Roche's Expand High Fidelity PCR system. After amplifying the amplified iaaM , iaaH and ipdC gene fragments with the pSEVA641_TodX_RFP vector, Pseudomonas putida KT2440 strain (pBBRBB_TodST) was transformed using Bio-Rad's Gene Pulser Xcell Electroporation System, and colonies growing on LB agar medium containing 50 µg / ml of gentamicin were selected and Pseudomonas putida. ) O6iaaMH, Pseudomonas putida 30iaaMH and Pseudomonas putida ipdC strains were obtained.

(2) in vitro ( in vitro Operational Verification of Toluene-Dependent TodST-IAA Module

Pseudomonas putida O6iaaMH, Pseudomonas putida In (Pseudomonas putida) 30iaaMH and Pseudomonas footage is (Pseudomonas putida) IAA production whether the ipdC strains was confirmed with the naked eye through the flesh Corp. ski test (Salkowski test), the Pseudomonas footage with TodST-IAA module (Pseudomonas putida) strains The yield of IAA when treated with toluene was quantified by comparison with the standard curve of IAA. Strains were inoculated in YEM (0.1% yeast extract, mannitol 1%, K ₂ HPO ₄ 0.05%, magnesium sulfate 0.02%, sodium chloride 0.01%, PH 7.0) medium with 0.1% tryptophan and medium without Shake culture was performed at 30 ° C. at 170 rpm for 3 days. Centrifuge 1 ml of the culture, transfer the supernatant to a glass tube, and add 1 ml of Salkowski reagent (2 ml of 0.5M FeCl ₃ + 35% HClO ₄ 98.0 ml) for 25 minutes under dark conditions. Reacted. The absorbance was then measured at 530 nm using an UV spectrophotometer, and a standard curve was prepared using IAA (indole-3-acetic acid, Sigma, USA) as a standard and compared with the IAA standard curve. OD value was converted into IAA concentration. As a result, the footage is Pseudomonas (Pseudomonas putida) ip dC, O6iaa MH and MH iaa 30 strain having a TodST-IAA module as set forth in 3, when processing the toluene, about 31㎍ / ㎖ respectively, 38㎍ / ㎖ And 20 μg / ml of IAA, but did not produce IAA when not treated with toluene. In the Pseudomonas chlororaphis O6 strain producing IAA, it was confirmed that the color reaction occurred regardless of toluene treatment.

(3) Arabidopsis (Arabidopsis thaliana) GUS staining minutes using DR5-GUS analysis (histochemical assay)

GUS histochemistry using Arabidopsis thaliana DR5-GUS to confirm whether the produced IAA is recognized by plants when Pseudomonas putida strain with TodST-IAA module is treated with toluene A histochemical assay was performed. The back of Arabidopsis (Arabidopsis thaliana) DR5-GUS which the expression of the GUS gene controlled by the plant hormone grown 3 weeks, the Pseudomonas footage (Pseudomonas putida) strain KB liquid medium two days incubation and, OD ₆₀₀ = 5.0 the cells (Cell) was washed in PBS buffer. The cell suspension was then irrigated 10 ml each to Arabidopsis thaliana DR5-GUS , followed by 100 μM of toluene after 3 days. After 3 days of treatment, Arabidopsis thaliana DR5-GUS was extracted and stained with GUS to confirm GUS expression. Plants were placed in GUS staining reagent (100mM NaH ₂ PO ₄ , 5mM Potassium Ferricyanide, 5mM Potassium Ferrocyanide, 10mM EDTA, 0.1% Triton X-100, 5mg / ml X-Gluc) and soaked for 12 hours at 37 ° C. Were removed and washed until the plant became white in 50% ethanol. After that, blue-dyed plants were visually observed and confirmed. As a result, the Arabidopsis DR5-GUS treated with toluene after irrigation of a suspension of Pseudomonas putida as shown in FIG. 4 turned blue with GUS expression, but after treatment with toluene GUS was not expressed in Arabidopsis DR5-GUS which did not. Thus, remaining in the soil Pseudomonas putida strain with TodST-IAA module recognizes external toluene, confirming that the produced IAA can establish the reporter system independently of the IAA produced naturally in the cell under plant conditions. .

(4) Pseudomonas putida ( Pseudomonas putida Root Settlement Test

Pseudomonas putida was produced to observe the root zone fixation to confirm whether the plant exists while maintaining the interaction in the plant roots. Pseudomonas putida strains with TodST-IAA modules were cultured in KB liquid medium and 10 mL of cell suspensions of OD ₆₀₀ = 0.1, 1 and 10 were irrigated in the roots of tobacco plants. Then, the population of Pseudomonas putida present in the roots of tobacco plants for 0, 3, 7, 14 and 28 days was confirmed by the plate counting method. As a result, as shown in FIG. 5, Pseudomonas putida maintained 10 ⁴ CFU per root weight in the root of tobacco even after 4 weeks of irrigation treatment. Therefore, it was confirmed that Pseudomonas putida of the present invention is settled in the root zone of tobacco plants.

Example 2 Preparation of Toluene Reporter Transformed Object Using ChlH RNAi System

(1) acquisition of de-greeining genes and RNAi Expression Vector Construction

To develop a reporter in which the plant turns yellow, a wild tobacco species Nicotiana benthamiana was selected as a model plant, and the target gene was selected from tobacco Chl H (magnesium protoporphyrin chelatase H subunit). Chl H is an important enzyme that chelates magnesium in the chloroplasts of plants. When RNAi of this gene occurs, it causes problems in the production of pigments of chloroplasts and turns the plants yellow.

Thus, for the RNAi of Nicotiana benthamiana Chl H gene, the Chl H gene fragment was obtained using the primer set of Chl H in Table 1 below. Since each primer contains a position capable of recombination with a vector, a construct was constructed to express Chl H by recombinantly in an RNAi-enabled plasmid in Nicotiana benthamiana . Chl H RNAi vectors were prepared for pK7GWIWG2-I, a binary vector used for hairpin RNA expression. The bacteria's two-component system recognizes external VOCs (Volatile organic compounds) in TodS, which causes phosphorylation to activate TodT, moves into the nucleus, and binds to the TodT box. Indole-3-acetic acid) was produced. To allow the plant to recognize and respond to this hormone, the DR5 promoter, reported as an auxin response element, was used as a promoter for RNAi vectors. Genomic DNA was extracted from transgenic Arabidopsis seedlings inserted with DR5 :: GUS, and the gene fragment of about 300bp corresponding to the DR5 sequence and the -46 CaMV minimal promoter region was extracted using the primers of Table 1 below. Amplified. To replace the P35S promoter and the DR5 promoter in pK7GWIWG2-I, the attR-ChlH-attR-intron portion was amplified with the primers of Table 1 below, and amplified so as to be connected to the DR5 promoter, thereby obtaining an insert of about 1.2 kb. . Since the amplification was carried out with a primer including a position capable of recombination with the vector, pK7_DR5_ccdB vector was constructed through recombination. PK7GWIWG2 (Ⅰ) containing the ChlH gene was obtained through the gateway cloning system BP reaction to obtain the pDONR-ChlH vector, which is an RNAi vector containing the DR5 promoter and Chl H through the LR reaction with the pK7_DR5_ccdB vector. pK7_DR5_ChlH was obtained (FIG. 7).

Table 1 Primer used in the present invention

Primer name	SEQ ID NO:	Sequence (5'-3 ')	Target genes
attB1_NbChlHi_F	One	GGACAAGTTTGTACAAAAAAGCAGGCTCGAGCGGCCGCCCGGGCAGGTGGAGATGT	NbChlH
attB1_NbChlHi_R
	2	GGGGACCACTTTGTACAAGAAAGCTGGGTCATGAATTTGAGCTTGAAACTTGCCATTGT
rec-DR5-L	3	AGCTCAAGCTAAGCTTGACGGCCAGTGCCAAGCTTG	DR5 promoter
CaMV-linker-R	4	GGGGCCCGCTAAGCTTACCAT
linker-attR-L	5	ATGGTAAGCTTAGCGGGCCCCCAGGCGGCCGCA CTAGTGA
rec-HindIII-intron-R	6	AATGAACGCTAAGCTTAATATGACTCTCAATAAAGTCTCATACCAAC	pK7GWIWG2 (Ⅰ)

(2) Reporter plant driving verification using the prepared RNAi expression vector

The constructed pK7_DR5_Ch1H vector was transformed into the Agrobacterium tumefaciens GV2260 strain, and then Agrobacterium tumefaciens ( A. tumefaciens ) cell suspension on the leaves of Nicotiana benthamiana . Direct infiltration was performed. Then, after 1-2 days, IAA standards were infiltrated at various concentrations of 100 nM, 10 μM, 100 μM and 1 mM. As a result, as shown in FIG. 8, the Chl H phenotype was observed to change the color of the leaf only at the intersection of the IAA standard treatment group and the Agrobacterium tumefaciens treatment group. Part did not show the Chl H phenotype.

(3) Effect test of Pseudomonas putida in tobacco plants incorporating DR5-chlH RNAi vector

Pseudomonas putida cell suspension (OD ₆₀₀ ) treated with toluene to determine whether the Pseudomonas putida strain having the TodST-IAA module of the present invention exhibits a Chl H phenotype in response to IAA produced. = 0.1) was injected (infiltration) to observe whether the color of Nicotiana benthamiana leaves change. As a result, as shown in FIG. 9, Chl H RNAi turned yellow regardless of all treatments, but in DR5- chl H, the Pseudomonas putida O6iaaMH treatment, Pseudomonas putida treated with toluene, Pseudomonas chlorolapi treatment and IAA treatment only It was observed that the cross section treated with the bacterium tumefaciens strain turned yellow.

In addition, in order to quantify the phenotype of Chl H in response to IAA produced by Pseudomonas putida ( Pseudomonas putida ) strain, the chlorophyll content of the yellowed part of the tobacco plant was measured. As a result, as shown in FIG. 10, Chl H RNAi showed low chlorophyll content regardless of all treatments, but DR5- chl H showed high chlorophyll content in toluene-treated treatments, but Pseudomonas treated with toluene. Chlorophyll content was low only in Pseudomonas putida and IAA treatments.

Finally, IAA generated by Pseudomonas putida strain with TodST-IAA module in the presence of toluene was able to confirm the operation of the phyto-sensor system in which chl H RNAi occurred and changed the phenotype.

Claims (10)

1) Pseudomonas putida derived from todS gene, Pseudomonas putida- derived todT gene, Pseudomonas putida- derived todX gene promoter (promoter) and plant growth hormone (plant growth hormone) gene transformed with the expression vector Transformed rhizome bacteria for the production of plant growth hormone in the presence of a non-degradable harmful aromatic compound, characterized in that: and

2) a plant transformed with an expression vector comprising a promoter and a reporter gene specifically recognized by the plant growth hormone or an RNAi expression vector comprising a promoter and a pigment generating gene specifically recognized by the plant growth hormone A reporter plant system for detecting hardly decomposable hazardous aromatic compounds in soil.

According to claim 1, wherein the plant growth hormone IAA (indole acetic acid), cytokinin (cytokinin), gibberellin (gibberellin), ethylene (ethylene), abscisic acid (abscisic acid) or brassinosteroid (brassinosteroid) A reporter plant system for detecting difficult-to-decompose harmful aromatic compounds in soil.

The method of claim 1, wherein the promoter specifically recognized by the plant growth hormone is a DR5 promoter, a cytokinin receptor (cytokinin receptor) promoter, an ethylene receptor (ethylene receptor) promoter or a PR1 (pathogenesis-related 1) promoter A reporter plant system for detecting hardly decomposable hazardous aromatic compounds in soil.

The method of claim 1, wherein the reporter gene is a green fluorescent protein (GFP), alkaline phosphatase (alkaline phosphatase), luciferase (luciferase), beta-glucuronidase (GUS) and beta-galactosidase (β) -galactosidase) Reporter plant system for detecting hardly decomposable harmful aromatic compounds in soil, characterized in that any one selected from the group consisting of.

The reporter plant system of claim 1, wherein the pigment generating gene is a ChlH (Mg-chelatase H subunit) gene or a PDS (phytoene desaturase) gene.

According to claim 1, wherein the myobacterial bacteria Pseudomonas putida ( Pseudomonas putida ), Paenibacillus polymyxa ( Paenibacillus polymyxa ), Bacillus subtilis ( Bacillus subtilis ) or Bacillus pumilus ( Bacillus pumilus ) characterized in that Reporter plant system for the detection of hardly degradable harmful aromatic compounds.

The method of claim 1, wherein the hardly decomposable hazardous aromatic compound is toluene, benzene, ethylbenzene, xylene or 2,4,6-trinitrotoluene , TNT) reporter plant system for detecting a non-degradable harmful aromatic compound in the soil.

1) preparing an expression vector comprising a promoter and plant growth hormone gene of Pseudomonas putida- derived todS gene, Pseudomonas putida- derived todT gene, and Pseudomonas putida- derived todX gene ;

2) transforming the expression vector of step 1) to the rhizosphere bacteria to prepare a transformed rhizosphere bacterium for plant growth hormone production in the presence of a hardly decomposable harmful aromatic compound; And

3) RNAi expression comprising the expression vector comprising a promoter and a reporter gene that the plant growth hormone specifically recognizes the transformed rhizosphere bacteria of step 2) or a promoter and a pigment generating gene that the plant growth hormone specifically recognizes A method for producing a reporter plant system for detecting hardly decomposable harmful aromatic compounds in soil, comprising the step of treating a plant transformed with a vector.

1) A plant transformed with an RNAi expression vector comprising an expression vector comprising a promoter and a reporter gene specifically recognized by the plant growth hormone or a promoter and a pigment generating gene specifically recognized by the plant growth hormone in the test sample. Planting step;

2) transformed with an expression vector comprising a Pseudomonas putida derived todS gene, Pseudomonas putida derived todT gene, Pseudomonas putida derived todX promoter and a plant growth hormone gene Treating the transformed plant root bacteria for plant growth hormone production to a test sample in which the transformed plant of step 1) is grown in the presence of a hardly decomposable harmful aromatic compound; And

3) The method of detecting hardly degradable harmful aromatic compounds in soil comprising the step of confirming the color change of the transgenic plant planted after the treatment of the transformed rhizosphere bacteria of step 2).

10. The method of claim 9, wherein the color change of the transgenic plant is confirmed in comparison with the non-transformed plant.

Images