KR101699017B1 - Repoter plant system for non-degradable harmful aromatic compound detection and uses thereof - Google Patents
Repoter plant system for non-degradable harmful aromatic compound detection and uses thereof Download PDFInfo
- Publication number
- KR101699017B1 KR101699017B1 KR1020150110918A KR20150110918A KR101699017B1 KR 101699017 B1 KR101699017 B1 KR 101699017B1 KR 1020150110918 A KR1020150110918 A KR 1020150110918A KR 20150110918 A KR20150110918 A KR 20150110918A KR 101699017 B1 KR101699017 B1 KR 101699017B1
- Authority
- KR
- South Korea
- Prior art keywords
- plant
- gene
- promoter
- growth hormone
- plant growth
- Prior art date
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8201—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
- C12N15/8202—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation by biological means, e.g. cell mediated or natural vector
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
- G01N33/5008—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
- G01N33/5082—Supracellular entities, e.g. tissue, organisms
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Biomedical Technology (AREA)
- Chemical & Material Sciences (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Zoology (AREA)
- Organic Chemistry (AREA)
- Cell Biology (AREA)
- Wood Science & Technology (AREA)
- General Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Immunology (AREA)
- Physics & Mathematics (AREA)
- Urology & Nephrology (AREA)
- Hematology (AREA)
- Plant Pathology (AREA)
- Biophysics (AREA)
- Medicinal Chemistry (AREA)
- Analytical Chemistry (AREA)
- Food Science & Technology (AREA)
- Pathology (AREA)
- General Physics & Mathematics (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Toxicology (AREA)
- Tropical Medicine & Parasitology (AREA)
Abstract
Description
The present invention relates to a reporter plant system for the detection of harmful aromatic compounds and to their use.
When a degradable aromatic compound is released into the body through a food chain or other pathway, it usually reacts with a polymer such as DNA or protein in its structural similarity and high reactivity to act as a carcinogen or an environmental hormone. For example, dioxins emitted from automobile exhaust gas and waste incineration are not only cancer-causing substances but also reproductive and immune system abnormalities. Also, dichloro-diphenyl-trichloroethane (DDT) is produced as an insecticide It acts as a harmful environmental hormone to the reproductive system. The degradable aromatic compounds introduced into nature are classified as environmental toxic substances which should be removed as priority in developed countries. In order to measure such a degradable aromatic compound, an instrumental chemical method is utilized, but it takes a long time due to a high cost due to an enormous amount of equipment and complicated treatment, and it is not easy for anyone to utilize it. to be. Also, these heavy equipment can not be used in the field. Therefore, it is important to develop technologies to detect degradation aromatic compounds more quickly, simply, and inexpensively, in terms of the national social aspect in which the Stockholm Environmental Conventions must be implemented, and the economic and environmental technologies that must solve problems at high cost and field applications.
BTEX compounds refer to benzene, toluene, ethylbenzene and xylene. Recently, due to the rapid growth of industrial activities, a considerable amount of harmful pollutants have been released into the natural environment. Among them, VOCs (volatile BTEX compounds, a representative oil of organic compounds, are becoming more polluted due to leaks and accidents in oil stores and widespread use in industry. Most of the VOCs have been found to be toxic organic chemicals that cause carcinogenesis. Therefore, the pollution caused by volatile organic substances in drinking water Guidelines and legislation have been strengthened.
In order to measure such BTEX, conventionally, chromatographic-mass spectrometry (GC-MS) has been utilized by an instrumental chemical method. However, such a method is costly, takes a long time due to complicated processing, Is not easy to use and requires a heavy equipment and there is a limitation in the use that can not be utilized in the field (Korean Patent Laid-Open No. 10-2004-0076292). Therefore, it is expected that 2,4,6-trinitrotoluene (TNT) and 2,4-dinitrotoluene (DNT), which are toluene compounds derived from explosives, and BTEX compounds (benzene, toluene, ethylbenzene, Efforts to develop technologies for efficiently detecting and removing harmful aromatic compounds have been continuing.
Korean Patent No. 1430685 discloses an artificial biosensor for detecting harmful aromatic compounds and a method for manufacturing the same, and Korean Patent No. 0539142 discloses a biosensor for detection of biotyx and a method for producing the same. have. However, the reporter plant system for detecting the refractory aromatic compounds of the present invention and the use thereof are not mentioned.
The present invention has been made in view of the above-mentioned needs, and it is an object of the present invention to provide a DRST promoter and a GUS gene encoding a rhodobacterial bacterium which transforms to produce plant growth hormone by activating the TodST-IAA module in the presence of toluene, A plant transformed with an expression vector or an RNAi expression vector containing a DR5 promoter and a ChlH (Mg-chelatease H subunit) gene was prepared, and its phenotype was confirmed to be changed in the color of the transgenic plant compared to the non- Thereby completing the invention.
In order to accomplish the above object, the present invention provides a method for producing a Pseudomonas putida- derived todS gene, a Pseudomonas putida- derived todT gene, a Pseudomonas putida- derived todX gene promoter and a plant growth hormone, And 2) a promoter and a reporter gene specifically recognized by the plant growth hormone, wherein the plant growth hormone is transformed with an expression vector comprising the gene encoding the plant growth hormone, And a plant transformed with an RNAi expression vector containing a promoter and a pigment-producing gene specifically recognized by an expression vector or a plant growth hormone. The present invention also provides a reporter plant system for detecting soil-degradable harmful aromatic compounds.
The present invention also provides a method for producing a reporter plant system for detecting harmful aromatic compounds in soil.
The present invention also provides a method for detecting harmful aromatic compounds in the soil using the reporter plant system for detecting the harmful aromatic compounds in the soil.
The present invention can provide a reporter plant system which is very useful for the detection of harmful aromatic compounds containing toluene, and can more accurately and sensitively detect the refractory harmful aromatic compounds than the prior art. In addition, it can be directly recognized as an indirect recognition system that is not easily accessible to people, and can be used to develop a system capable of recognizing toxic substances in real life without using chemical / physical devices have.
BRIEF DESCRIPTION OF THE DRAWINGS FIG. 1 is a schematic diagram of the Pseudomonas sp. putida ) This is a schematic diagram of the production of a toluene reporter plant using the TodST-IAA module and the DR5-GUS system.
2 shows a biosynthetic pathway of IAA (Indole-3-acetic acid), a plant growth hormone produced by bacteria. The purple arrow indicates the indole-3-acetamide (IAM) path and the red arrow indicates the IPyA (Indole-3-pyruvate) path.
FIG. 3 shows the ability of the Pseudomonas putida 06iaaMH, 30iaaMH and ipdC strain of the present invention to produce IAA when treated with toluene.
FIG. 4 shows GUS expression results of Arabidopsis thaliana using IAA production ability of Pseudomonas putida 06iaaMH, 30iaaMH and ipdC strain according to the present invention with or without toluene.
Figure 5 is the footage (Pseudomonas Pseudomonas according to the present invention putida ) strain of the present invention.
Figure 6 is the footage (Pseudomonas according to the present invention Pseudomonas putida ) The TodST-IAA module and the Ch1H-RNAi system were used to construct a transgenic plant.
7 is a schematic diagram of a method for producing the pK7_DR5_Ch1H vector of the present invention.
Figure 8 shows the effect of smoking on tobacco ( Nicotiana The RNAi phenotype of the Ch1H gene is shown when the Agrobacterium tumefasiens strain transformed with the RNAi expression vector and the IAA standard material were treated at different concentrations on the leaf of the benthamiana plant. Mock is a negative control that did not do anything.
FIG. 9 shows the effect of the presence of toluene on tobacco ( Nicotiana Agrobacterium tumefasiens strain transformed with an RNAi expression vector on a leaf of a benthamiana plant, Pseudomonas sp . strain IAA producing strain putida) O6iaaMH strain and Pseudomonas chloro lapis (Pseudomonas chlororaphis ) and the IAA standard, the RNAi phenotype of the ChlH gene. Water control is a negative control without any treatment.
Figure 10 is a graph showing the effect of tobacco ( Nicotiana Agrobacterium tumefasiens strain transformed with an RNAi expression vector on a leaf of a benthamiana plant, Pseudomonas sp . strain IAA producing strain putida) O6iaaMH strain and Pseudomonas chloro lapis (Pseudomonas chlororaphis ) and IAA standard material, chlorophyll content. Water control is a negative control without any treatment.
The present invention
1) The Pseudomonas footage (Pseudomonas wherein the transformant is transformed with an expression vector comprising a todS gene derived from Pseudomonas putida , a todT gene derived from Pseudomonas putida , a promoter of Pseudomonas putida derived todX gene, and a plant growth hormone gene. Transgenic rhizobia for plant growth hormone production in the presence of aromatic compounds: and
2) a plant transformed with an expression vector containing a promoter and a reporter gene specifically recognized by plant growth hormone or an RNAi expression vector comprising a promoter and a pigment producing gene specifically recognized by plant growth hormone To provide a reporter plant system for detecting soil-degradable harmful aromatic compounds.
Specifically, the todS gene preferably has the nucleotide sequence of SEQ ID NO: 7, but is not limited thereto.
Specifically, the todT gene preferably has the nucleotide sequence of SEQ ID NO: 8, but is not limited thereto.
Specifically, the promoter of the todX gene preferably has the nucleotide sequence of SEQ ID NO: 9, but is not limited thereto.
The promoters of the todS gene, the todT gene and the todX gene are composed of base sequences in which one or several bases are added, deleted, and substituted, respectively, as long as they have the same activity in the nucleotide sequences of SEQ ID NO: 7, SEQ ID NO: 8 and SEQ ID NO: But is not limited thereto.
The promoters of the todS gene, the todT gene and the todX gene have at least 80% homology, more specifically at least 90% homology, most specific 95%, 96% homology to the nucleotide sequence of SEQ ID NO: 7, SEQ ID NO: , 97%, 98%, 99%, or 99.5% or more homology.
Preferably, the plant growth hormone is indole acetic acid (IAA), cytokinin, gibberellin, ethylene, abscisic acid, brassinosteroid, and the like. Do not.
The promoter specifically recognized by the plant growth hormone is preferably DR5 promoter, cytokinin receptor promoter, ethylene receptor promoter, and PR1 (pathogenesis-related 1) promoter, but is not limited thereto .
The reporter gene is composed of green fluorescent protein (GFP), alkaline phosphatase, luciferase, beta-glucuronidase (GUS) and beta-galactosidase genes , And more preferably a beta-glucuronidase (GUS) gene, but the present invention is not limited thereto.
The chromogenic gene may be a ChlH (Mg-chelatease H subunit) gene or a PDS (phytoene desaturase) gene, but is not limited thereto.
The rhizosphere bacteria are Pseudomonas putida , Paenibacillus polymyxa E681, Bacillus subtilis , GB03, Bacillus pumilus INR7, but is not limited thereto.
The refractory harmful aromatic compound may be a BTEX compound (benzene, toluene, ethylbenzene, xylene) or a toluene compound (for example, 2,4,6-trinitrotoluene (2 , 4,6-trinitrotoluene, TNT), more preferably toluene, but is not limited thereto.
The term "vector" is used to refer to a DNA fragment (s), nucleic acid molecule, which is transferred into a cell. The vector replicates the DNA and can be independently regenerated in the host cell. The term "carrier" is often used interchangeably with "vector ". The term "expression vector" means a recombinant DNA molecule comprising a desired coding sequence and a suitable nucleic acid sequence necessary for expressing a coding sequence operably linked in a particular host organism. Promoters, enhancers, termination signals and polyadenylation signals available in eukaryotic cells are known.
A preferred example of a plant expression vector is a Ti-plasmid vector which is capable of transferring a so-called T-region to a plant cell when it is present in a suitable host such as Agrobacterium tumefaciens. Other types of Ti-plasmid vectors (see
The expression vector will preferably comprise one or more selectable markers. The marker is typically a nucleic acid sequence having a property that can be selected by a chemical method, and includes all genes capable of distinguishing a transformed cell from a non-transformed cell. Examples include herbicide resistance genes such as glyphosate, phosphinothricin and glufosinate, kanamycin, G418, Bleomycin, hygromycin, But are not limited to, antibiotic resistance genes such as chloramphenicol.
In the plant expression vector of the present invention, the promoter may be CaMV 35S, actin, ubiquitin, pEMU, MAS or histone promoter, but is not limited thereto.
The term "promoter " refers to the region of DNA upstream from the structural gene and refers to a DNA molecule to which an RNA polymerase binds to initiate transcription. A "plant promoter" is a promoter capable of initiating transcription in plant cells. A "constitutive promoter" is a promoter that is active under most environmental conditions and developmental conditions or cell differentiation. Constructive promoters may be preferred in the present invention because the choice of transformants can be made by various tissues at various stages. Thus, constitutive promoters do not limit selectivity.
In the plant expression vectors of the present invention, conventional terminators can be used. Examples thereof include nopaline synthase (NOS), rice α-amylase RAmy1 A terminator, phaseoline terminator, Agrobacterium and the terminator of the Octopine gene of Tumefaciens, but the present invention is not limited thereto. Regarding the need for terminators, it is generally known that such regions increase the certainty and efficiency of transcription in plant cells. Therefore, the use of a terminator is highly desirable in the context of the present invention.
Transformation of a plant means any method of transferring DNA to a plant. Such transformation methods do not necessarily have a regeneration and / or tissue culture period. Transformation of plant species is now common for plant species, including both terminal plants as well as dicotyledonous plants. In principle, any transformation method can be used to introduce the hybrid DNA according to the present invention into suitable progenitor cells. The method is based on the calcium / polyethylene glycol method for protoplasts (Krens et al., 1982, Nature 296: 72-74; Negrutiu et al., 1987, Plant Mol. Biol. 8: 363-373) 1986, Mol. Gen. Genet. 202: 179-185), the use of various plant elements (such as, for example, Shillito et al., 1985, Bio / Technol.3: 1099-1102) (DNA or RNA-coated) particle impact method (Klein et al., 1987, Nature 327: 70), infiltration of plants or Agrobacterium tumefaciens mediated gene transfer by transformation of mature pollen or micro- Virus infection (
In addition,
1) The Pseudomonas footage (Pseudomonas preparing an expression vector containing a putida- derived todS gene, a Pseudomonas putida- derived todT gene, a Pseudomonas putida- derived todX gene promoter, and a plant growth hormone gene;
2) transforming the expression vector of step 1) into rhizobacteria to produce transformed rhizobacteria for the production of plant growth hormone in the presence of a decomposable harmful aromatic compound; And
3) expressing the transformed rhizobia of step 2) with an expression vector containing a promoter and a reporter gene specifically recognizing the plant growth hormone or an RNAi expression including a promoter and a pigment producing gene specifically recognized by the plant growth hormone To a plant transformed with a vector of the present invention.
In the method for producing a reporter plant system for detecting harmful aromatic compounds in soil in accordance with the present invention, each gene, plant growth hormone, rhizosphere bacterium, reporter gene, pigment production gene and the like are as described above.
In addition,
1) A plant transformed with an RNAi expression vector comprising a promoter recognized specifically by plant growth hormone and an expression vector containing a reporter gene or a promoter and a pigment producing gene specifically recognized by plant growth hormone, Planting;
2) the footage Pseudomonas (Pseudomonas wherein the transformant is transformed with an expression vector comprising a todS gene derived from Pseudomonas putida , a todT gene derived from Pseudomonas putida , a promoter of Pseudomonas putida derived todX gene, and a plant growth hormone gene. Treating the transformed rhizobia for producing plant growth hormone in the presence of an aromatic compound to a test sample planted with the transformed plant of step 1); And
3) detecting the color change of the transgenic plant after the treatment of the transformed rhizobia in step 2).
The color change of the transgenic plant can be confirmed by comparison with the non-transgenic plant, but is not limited thereto. That is, when toluene is present in the test sample, the plant transformed with the expression vector containing the reporter gene as compared with the non-transgenic plant can express color through expression of the reporter gene, and RNAi Plants transformed with the expression vector may have problems in pigmentation of the chloroplast and the plant may turn yellow. Therefore, the presence or absence of toluene can be detected through the color change of the transformed plant.
Hereinafter, the present invention will be described in more detail with reference to Examples. It is to be understood by those skilled in the art that these embodiments are merely illustrative of the present invention and that the scope of the present invention is not limited thereto.
Example One. DR5 - GUS System using toluene ( toluene Reporter plant production
(1) Pseudomonas Putida ( Pseudomonas putida ) TodST - IAA Production of module
In order to recognize toluene and produce and amplify the signals that plants can react to, the TodST module using a two component system of microorganisms was used. To construct a system for producing plant hormone IAA (indole-3-acetic acid) below the TodT-BOX of this module, an artificial biosensor for detecting harmful aromatic compounds and a method for manufacturing the same (Korean Patent No. 1430685) Pseudomonas putida ) KT2440 strain (Fig. 1). Auxin is a typical plant growth hormone that affects the growth of cells. Some germs produce and secrete auxin in plant rhizosphere, which can be absorbed by plants and used for growth. Representative IAA (Indole-3-acetic acid) among auxins is produced by various pathways in various bacteria. The most distinctive feature is the IAM (indole-3-acetamide) pathway, where tryptophan is first converted to IAM by tryptophan-2-monooxygenase encoded by the iaaM gene (IaaH), which is encoded by the IaaH gene encoded by the iaaH gene, and IAaM and iaaH are found in many bacteria. In addition, the IPyA (Indole-3-pyruvate) pathway is the main pathway for the synthesis of IAA in most plants, and also exists in many bacteria, beginning with the conversion to IPyA by tryptophan aminotransferase. IPyA is converted to IAAld (indole-3-acetaldehyde) by carboxy removal by IPDC (Indolepyruvate decarboxylase) and then oxidized to IAA (Fig. 2). Thus, iaaM , iaaH, and ipdC Gene-containing In order to use an expression vector to produce a Pseudomonas (Pseudomonas) in and azo RY rilrum (Azospirillum) in strains producing high levels of IAA, iaaM and iaaH The gene is Pseudomonas chlorampais chlororaphis O6 and 30-84 strains, and ipdC Gene was produced in the azo RY rilrum bra chamber lances (Azospirillum brasilense) expression vector obtained from Cd strain. Pseudomonas chloramphenicol chlororaphis) O6 and 30-84 strains, and azo RY rilrum bra chamber lances (Azospirillum brasilense ) Cd were inoculated into 3 ml of KB (King's B) liquid medium and cultured at 30 ° C for 24 hours. Then, the cells were collected by centrifugation, and genomic DNA was extracted using the PureHelix Genomic DNA Prep Kit (Column Type) manufactured by Nanohelix. Then , iaaM , iaaH and ipdC were amplified using Roche's Expand High Fidelity PCR system using genomic DNA as a template. Amplified by the iaaM, iaaH gene and ipdC pieces pSEVA641_TodX_RFP vector and ligation (ligation) after Pseudomonas footage is (Pseudomonas putida ) The strain KT2440 (pBBRBB_TodST) Bio-Rad's Gene Pulser Xcell Electroporation was transformed using the system, gentamicin (Gentamicin) to screen the colonies growing on LB agar medium added with 50㎍ / ㎖ the footage Pseudomonas (Pseudomonas putida ) O6iaaMH, Pseudomonas putida 30iaaMH and Pseudomonas footage is (Pseudomonas putida ) ipdC strain.
(2) Invitro ( in vitro ) Toluene-dependent TodST - IAA Verify module operation
Pseudomonas putida ) O6iaaMH, Pseudomonas putida (Pseudomonas putida) 30iaaMH and Pseudomonas footage is (Pseudomonas putida) IAA production ipdC whether the strain was confirmed by the naked eye through the flesh Corp. ski test (Salkowski test), TodST-IAA is Pseudomonas footage with modules (Pseudomonas putida ) treated with toluene was quantitated by comparing the IAA production with the standard curve of IAA. The strain was inoculated in the medium supplemented with 0.1% tryptophan and the medium not added with YEM (yeast extract 0.1%, mannitol 1%, K 2 HPO 4 0.05%, magnesium sulfate 0.02%, sodium chloride 0.01%, pH 7.0) And cultured for 3 days at 30 DEG C with shaking at 170 rpm. 1 ml of the culture was centrifuged, and the supernatant was transferred to a glass tube. 1 ml of Salkowski reagent (2 ml of 0.5 M FeCl 3 + 98.0 ml of 35% HClO 4 ) was added, Lt; / RTI > Then, the absorbance was measured at 530 nm using a UV spectrophotometer. A standard curve was prepared using IAA (indole-3-acetic acid, Sigma, USA) as a reference material and compared with the IAA standard curve The OD value was converted to the IAA concentration. As a result, the Pseudomonas footage with TodST-IAA module as disclosed in Figure 3 (Pseudomonas putida) ip dC, O6iaa MH and MH iaa 30 strains when treated with toluene, respectively, about 31㎍ / ㎖, 38㎍ / ㎖ natjiman and shown to produce 20㎍ / ㎖ IAA in. When the processing has not toluene It was confirmed that IAA is not produced. Pseudomonas which produces IAA ( Pseudomonas chlororaphis O6 strains showed color reaction regardless of toluene treatment.
(3) Arabidopsis thaliana ( Arabidopsis thaliana ) DR5 - GUS Using GUS Histochemical analysis histochemical assay )
Pseudomonas footage with TodST-IAA module, (Pseudomonas Putida was treated with toluene to confirm that the produced IAA was recognized by plants. Arabidopsis ( Arabidopsis thaliana DR5 - GUS were used for histochemical assay. Arabidopsis ( Arabidopsis thaliana) in which the expression of the GUS gene is regulated by plant hormones thaliana) DR5 - GUS grown to three weeks later, the footage Pseudomonas (Pseudomonas putida ) was cultured in KB liquid medium for 2 days, and OD 600 = 5.0 cells were washed in PBS buffer. The cell suspension was then suspended in Arabidopsis thaliana ) DR5 - GUS , and after 3 days, 100 .mu.M of toluene was inoculated. Three days after the treatment, Arabidopsis thaliana DR5 - GUS was stained for GUS staining to confirm GUS expression. The plants were immersed in GUS staining reagent (100 mM NaH 2 PO 4 , 5 mM Potassium Ferricyanide, 5 mM Potassium Ferrocyanide, 10 mM EDTA, 0.1% Triton X-100 and 5 mg / Was removed and washed in 50% ethanol until the plant turned white. It was then confirmed by visual observation of the blue-stained plant. As a result, as shown in FIG. 4, the Arabidopsis thaliana DR5 - GUS treated with the suspension of Pseudomonas putida and then treated with toluene showed a change in blue color due to the expression of GUS, but after treatment with toluene GUS was not expressed in Arabidopsis DR5-GUS . Therefore, Pseudomonas footage with TodST-IAA module, (Pseudomonas putida ) recognized the external toluene, it could be confirmed under plant conditions that the produced IAA could establish a reporter system independently of intracellularly produced IAA.
(4) Pseudomonas Putida ( Pseudomonas putida )of Rhizome Settling power Verification
Root fixation ability was observed to confirm that the produced Pseudomonas putida existed while maintaining the interaction at the plant roots. Pseudomonas footage with TodST-IAA module, (Pseudomonas putida ) were cultivated in KB liquid medium, and 10 ml of a cell suspension of OD 600 = 0.1, 1 and 10 was added to the roots of tobacco plants. The population of Pseudomonas putida , present in tobacco plant rhizosphere for 0, 3, 7, 14 and 28 days, was identified by the plate counting method. As a result, Pseudomonas putida maintained 10 4 CFU per root weight in the tobacco root after 4 weeks of gauging treatment, as shown in Fig. Therefore, it was confirmed that Pseudomonas putida of the present invention was settled in the rhizosphere of tobacco plants.
Example 2. ChlH RNAi System using toluene ( Toluene Reporter Transgenic Plants
(One) Non-greening ( De - greeining ) Gene acquisition and RNAi Production of expression vector
Nicotiana benthamiana , a wild tobacco species, was selected as a model plant and Chl H (magnesium protoporphyrin chelatase H subunit) of tobacco was selected as a target gene to develop a repoter in which the plant turns yellow. Chl H is an important enzyme that chelates magnesium in the chloroplast of a plant. When RNAi of this gene occurs, there is a problem in generation of chloroplast pigment and the plant turns yellow (Fig. 6).
Thus, Nikko tiahna Ventana Mia or (Nicotiana For the RNAi of the benthamiana Chl H gene, the Chl H gene fragment was obtained using the primer set of Chl H shown in Table 1 below. Each primer contains a site that can be recombined with the vector, so constructs were constructed so that the plasmid capable of RNAi in Nicotiana benthamiana expresses Chl H through recombination. Chl H RNAi vector was constructed for pK7GWIWG2-I, a binary vector used for hairpin RNA expression. The two-component systems of bacteria control the external volatile organic compounds (VOCs) in TodS, and when the toxin is activated and the TodT is activated and moved into the nucleus and bound to the TodT box, the plant hormone IAA Indole-3-acetic acid. The DR5 promoter, reported as an auxin response element, was used as a promoter of the RNAi vector in order to allow plants to recognize and respond to this hormone. Genomic DNA was extracted from Transgenic Arabidopsis seedling in which DR5 :: GUS was inserted and the gene fragment of approximately 300 bp corresponding to the DR5 nucleotide sequence and -46 CaMV minimal promoter portion was extracted using the primer shown in Table 1 below Respectively. To replace the P35S promoter and the DR5 promoter in pK7GWIWG2-Ⅰ, the attR-ChlH-attR-intron moiety was amplified with the primer shown in Table 1 below and amplified so as to be linked to the DR5 promoter to obtain an insert of about 1.2 kb . The vector was amplified with a primer containing a site capable of recombination. Thus, a pK7_DR5_ccdB vector was constructed by recombination. ChlH The pDONR-ChlH vector was obtained from the pK7GWIWG2 (Ⅰ) gene through the gateway cloning system BP reaction (Gateway reaction BP reaction), and the pK7_DR5_ChlH vector, which has the DR5 promoter and Chl H, (Fig. 7).
GCCCGGGCAGGTGGAGATGT
TTGAGCTTGAAACTTGCCATTGT
GCTTG
CA CTAGTGA
AAAGTCTCATACCAAC
(2) RNAi Verification of reporter plant using expression vector
The constructed pK7_DR5_Ch1H vector was transformed into Agrobacterium tumefaciens GV2260 strain, and the suspension of Agrobacterium tumefaciens cells was directly infiltrated into the leaves of Nicotiana benthamiana . One to two days later, IAA standard material was infiltrated at various concentrations of 100 nM, 10 μM, 100 μM and 1 mM. As a result, we observed that the IAA standard treatment with Agrobacterium Tome Pacific Enschede (A. tumefaciens) treatment the color of the leaves in Chl H phenotype only in the intersection of yellow change, as disclosed in Figure 8, Mock and do not intersect The Chl H phenotype did not appear.
(3) DR5 - chlH RNAi In a tobacco plant in which a vector was introduced, Pseudomonas putida ( Pseudomonas putida ) Effectiveness test
Footage Pseudomonas having TodST IAA-module of the present invention is (Pseudomonas putida) Pseudomonas footage a strain in response to IAA producing to determine if the phenotype of Chl represents H, treatment of the toluene (Pseudomonas Putida cell suspension (OD 600 = 0.1) was infiltrated into Nicotiana benthamiana ) were observed. As a result, even in the Chl H RNAi as described in 9, but turns yellow, regardless of all treatments, DR5- chl H in toluene is treated with footage Pseudomonas (Pseudomonas putida) was also observed in the treatment group with Pseudomonas O6iaaMH chloro lapis treatment and IAA treated only with Agrobacterium Tome Pacific Enschede (A. tumefaciens) The strains are processed cross section that varies yellow.
In addition, Pseudomonas sp . O6iaaMH ( Pseudomonas The chlorophyll content in the yellow part of tobacco plants was measured in order to quantify the phenotype of Chl H in response to IAA produced by S. putida . As a result, as shown in FIG. 10, chlorophyll content was low in Chl H RNAi irrespective of all treatments, whereas DR5- chl H showed a normal chlorophyll content in the untreated rice, but the toluene-treated Pseudomonas Pseudomonas Putida and IAA treatments showed low chlorophyll content.
Finally, the Pseudomonas footage with the presence of toluene TodST-IAA module (Pseudomonas The activity of the phyto-sensor system, which changes the phenotype, was confirmed by the production of chl H RNAi by IAA produced by putida strain.
<110> Korea Research Institute of Bioscience and Biotechnology <120> Reporter plant system for non-degradable harmful aromatic compound detection and uses thereof <130> PN15148 <160> 9 <170> Kopatentin 2.0 <210> 1 <211> 56 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 1 ggacaagttt gtacaaaaaa gcaggctcga gcggccgccc gggcaggtgg agatgt 56 <210> 2 <211> 59 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 2 ggggaccact ttgtacaaga aagctgggtc atgaatttga gcttgaaact tgccattgt 59 <210> 3 <211> 36 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 3 agctcaagct aagcttgacg gccagtgcca agcttg 36 <210> 4 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 4 ggggcccgct aagcttacca t 21 <210> 5 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 5 atggtaagct tagcgggccc ccaggcggcc gcactagtga 40 <210> 6 <211> 47 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 6 aatgaacgct aagcttaata tgactctcaa taaagtctca taccaac 47 <210> 7 <211> 2937 <212> DNA <213> Pseudomonas putida <400> 7 atgagctcct tggatagaaa aaagcctcaa aatagatcga aaaataatta ttataatatc 60 tgcctcaagg agaaaggatc tgaagagctg acgtgtgaag aacatgcacg catcatattt 120 gatgggctct acgagtttgt gggccttctt gatgctcatg gaaatgtgct tgaagtgaac 180 caggtcgcat tggagggggg cgggattact ctggaagaaa tacgagggaa gccattctgg 240 aaggcgcgtt ggtggcaaat ttcaaaaaaa accgaggcga cccaaaagcg acttgttgaa 300 actgcatcat ccggtgaatt tgttcgctgt gatgttgaga ttcttggaaa atcaggtgga 360 agagaggtaa tagccgtcga tttttcattg ctgccaattt gcaatgaaga agggagcatt 420 gtttaccttc ttgcggaagg gcgcaatatt accgataaga agaaagccga ggccatgctg 480 gcgttgaaga accaggaatt ggagcagtcg gttgagtgta tccgaaaact cgataatgcg 540 aagagtgatt tctttgccaa ggtgagccat gagttgcgca ctccgctgtc tttgattcta 600 gggccactgg aagccgttat ggcggcagag gctgggcgtg aatcgccgta ttggaagcag 660 tttgaggtca ttcagcgtaa tgcaatgacc ctgttgaaac aggttaacac gctgcttgac 720 ttggcgaaaa tggacgcccg gcagatgggg ctttcctatc ggcgagccaa tcttagtcag 780 ctcacccgta ctattagctc gaattttgaa ggaatagccc agcaaaaatc aataacgttc 840 gatacaaaac tgcctgtaca gatggtcgct gaggtggatt gtgagaaata cgaacgcatt 900 atccttaact tgctttccaa tgcgtttaaa ttcacccctg acggggggct tatccgttgc 960 tgtcttagtt tgagtcgacc aaattatgcc ttggttactg tatctgatag cgggccgggt 1020 attcctcctg cactgcgtaa agaaatattt gaacgtttcc accagctaag ccaggaaggt 1080 caacaagcta cgcggggtac aggcttgggg ctttccattg tgaaagaatt cgttgaattg 1140 caccgtggaa caatttctgt aagtgatgcc ccgggcgggg gggcgctttt tcaggtaaag 1200 ctgccgctga atgctcctga aggtgcttat gttgcgagta acaccgcgcc gcgaagagat 1260 aatcctcagg tcgtggatac ggatgagtac cttttgctgg cgcccaatgc ggaaaatgaa 1320 gccgaggtgc ttccatttca atccgaccag cctcgggtgc taatcgttga agataaccct 1380 gatatgcgtg gttttataaa ggactgtctc agtagcgact atcaagttta tgttgcaccc 1440 gacggtgcaa aggcattgga gttgatgtca aacatgccgc cagacctgtt gattacagac 1500 ctgataatgc ctgttatgag cggcgatatg ctggttcacc aagtgcgtaa gaaaaatgaa 1560 ctttcacata tcccgatcat ggtgctgtcg gccaagtcag acgcagaact gcgtgtgaaa 1620 ttgctctccg agtcggtgca ggactttctt cttaagccat tttctgctca tgagctacga 1680 gcgcgtgtaa gcaatctggt atccatgaag gtggcaggcg atgcgttgcg taaggagctt 1740 tccgatcagg gggatgatat tgcgatactt actcaccgtc tgatcaaaag tcgccatcgt 1800 cttcagcaga gtaacatcgc attatccgcc tcggaagcgc gttggaaagc agtgtatgaa 1860 aactctgcgg ccggtattgt actgaccgac ccggaaaacc gaatactcaa cgccaatcct 1920 gcatttcaac gcattaccgg atatggggaa aaggatttgg agggactttc catggagcaa 1980 ttgactccat ctgacgaaag cccacagata aagcagcgtc tggccaattt gcttcagggt 2040 gggggagcgg aatacagtgt ggagcgctcc tatctatgca aaaatggttc tacgatttgg 2100 gccaatgcga gtgtctcgct gatgcctcaa cgtgtcggtg aatctccagt tatactgcag 2160 atcatcgatg acatcactga gaagaaacaa gcacaggaaa atcttaacca attgcagcaa 2220 caacttgtgt acgtttcccg atcagctacg atgggtgaat ttgcagccta tattgcacac 2280 gagataaacc aaccgctctc ggcgatcatg accaatgcca atgctggcac acgttggtta 2340 ggtaatgagc catctaacat cccagaggct aaagaggcac tggctcgcat tatccgagat 2400 tccgaccgcg ctgcagaaat tatccgtatg gtacgctcct tcctgaagcg tcaagaaacg 2460 gtgctgaaac cgattgatct aaaagcactg gtaactgata caagcctgat acttaaggcc 2520 cctagtcaga ataacagtgt caatttggat gttgttgcgg atgatgaact ccctgagata 2580 tggggggatg gtgtacagat ccagcagttg ataataaatc tggctatgaa cgctattgaa 2640 gcgatcagcc aagccgactg tgaaaccagg cagctaaccc tgtcattctc aggcaatgat 2700 acaggtgatg cgcttgttat ctcagtgaaa gatacaggtc caggtatttc agagaggcag 2760 atggcgcagt tgttcaacgc attctacacc acaaaaaaag aagggcttgg tatgggattg 2820 gcaatctgtc ttacaatcac ggaagtgcat aacggtaaaa tatgggttga gtgcccgccc 2880 gctgggggtg cttgtttcct ggtaagtatc cctgccagac agggctccgg cacatga 2937 <210> 8 <211> 621 <212> DNA <213> Pseudomonas putida <400> 8 atgagtgatc gggcatctgt tatctatatc ctcgatgacg acaatgcagt actggaagca 60 ctgagcagct tggtgcgttc aatcggcctg agtgtcgagt gtttttcatc cgctagcgta 120 ttcctgaacg atgtcaatcg ctctgcctgt ggctgtctaa ttttggatgt ccgtatgccc 180 gagatgagcg ggttggatgt gcaacgacaa ctgaaagagc ttggcgagca aatccccatt 240 atttttatca gcggccacgg tgatattccg atggcagtca aagcgatcaa ggcgggtgcg 300 gtagacttct tcactaaacc ttttcgagaa gaggagctgc ttggcgctat tcgcgccgcg 360 ctgaagttgg cgccccagca gagatcaaac gctccccgag tcagcgagct taaagagaat 420 tacgaaagcc tcagcaaacg cgagcaacag gtgcttaagt tcgtcttgcg aggatatcta 480 aacaagcaga cggctctaga gcttgatata tcggaagcaa cagtgaaagt gcaccgccat 540 aatatcatga ggaaaatgaa agtatcttca atccaggatc tggttcgagt aactgagcgg 600 ctcaaggata gcctggaata g 621 <210> 9 <211> 360 <212> DNA <213> Pseudomonas putida <400> 9 gatcaacgca ttgagcgcca ccagcatgtt caggtctgag gttttcatcg acatcaggtt 60 atcaacctgc tcgtggacct gagggaaact gccgtggcgg cgacggggct tgcgcgtaag 120 cccccgctat acgaccagcc tgttcgaaag ccgcaaagtg cttaggtttg ggtgcatatc 180 catcagaagc ggcataaacc atcgtttatc acagttaaac tttggttttc taagttgcga 240 tagccatata aacccataag ccaaaaaaca atatttccca gggcgtgatt gtaatactgt 300 gcgtgctcta aggcggtgtt tgcctacttc actttataaa aaaaataaga tgtggaagga 360 360
Claims (10)
2) an expression vector comprising a promoter and a reporter gene specifically recognized by the plant growth hormone or a plant transformed with an RNAi expression vector comprising a promoter and a pigment producing gene specifically recognized by the plant growth hormone Wherein the plant is a plant for detecting harmful aromatic compounds in soil.
2) transforming the expression vector of step 1) into rhizobacteria to produce transformed rhizobacteria for the production of plant growth hormone in the presence of a decomposable harmful aromatic compound; And
3) an expression vector containing a promoter and a reporter gene specifically recognizing the plant growth hormone in the step 2), or a promoter and a pigment-producing gene specifically recognized by the plant growth hormone To a plant transformed with an RNAi expression vector. ≪ RTI ID = 0.0 > 21. < / RTI >
2) An expression vector containing a promoter and a reporter gene specifically recognized by the plant growth hormone or an RNAi expression vector containing a promoter and a pigment producing gene specifically recognized by the plant growth hormone, Planting the plant;
3) treating the transformed rhizobia of step 1) with a test sample planted with the transformed plant of step 2); And
4) detecting the color change of the transgenic plant cultured after the treatment of the transformed rhizobia in the step 3).
Priority Applications (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| KR1020150110918A KR101699017B1 (en) | 2015-08-06 | 2015-08-06 | Repoter plant system for non-degradable harmful aromatic compound detection and uses thereof |
| PCT/KR2015/011937 WO2017022887A1 (en) | 2015-08-06 | 2015-11-06 | Reporter plant system for detection of harmful non-degradable aromatic compounds and use thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| KR1020150110918A KR101699017B1 (en) | 2015-08-06 | 2015-08-06 | Repoter plant system for non-degradable harmful aromatic compound detection and uses thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| KR101699017B1 true KR101699017B1 (en) | 2017-01-23 |
Family
ID=57943175
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| KR1020150110918A KR101699017B1 (en) | 2015-08-06 | 2015-08-06 | Repoter plant system for non-degradable harmful aromatic compound detection and uses thereof |
Country Status (2)
| Country | Link |
|---|---|
| KR (1) | KR101699017B1 (en) |
| WO (1) | WO2017022887A1 (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107365729B (en) * | 2017-08-25 | 2020-10-16 | 山东烟草研究院有限公司 | Paenibacillus polymyxa and application thereof |
| CN113373102B (en) * | 2021-07-05 | 2022-09-09 | 青岛农业大学 | Photosynthetic bacteria for detecting explosives and preparation method and application thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101619341A (en) * | 2008-06-30 | 2010-01-06 | 财团法人生物技术开发中心 | Transformant used for detecting concentration and degradation efficiency of organic pollutants and detection method thereof |
| KR20130054669A (en) * | 2011-11-17 | 2013-05-27 | 한국생명공학연구원 | Artificial biosensor for non-degradable harmful aromatic compound detection and manufacturing method thereof |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6117643A (en) * | 1997-11-25 | 2000-09-12 | Ut Battelle, Llc | Bioluminescent bioreporter integrated circuit |
| WO2003100084A1 (en) * | 2002-05-23 | 2003-12-04 | National Research Council Of Canada | A new biosensor |
-
2015
- 2015-08-06 KR KR1020150110918A patent/KR101699017B1/en active IP Right Grant
- 2015-11-06 WO PCT/KR2015/011937 patent/WO2017022887A1/en active Application Filing
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101619341A (en) * | 2008-06-30 | 2010-01-06 | 财团法人生物技术开发中心 | Transformant used for detecting concentration and degradation efficiency of organic pollutants and detection method thereof |
| KR20130054669A (en) * | 2011-11-17 | 2013-05-27 | 한국생명공학연구원 | Artificial biosensor for non-degradable harmful aromatic compound detection and manufacturing method thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| WO2017022887A1 (en) | 2017-02-09 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Hwang et al. | Agrobacterium-mediated plant transformation: biology and applications | |
| Wu et al. | AGROBEST: an efficient Agrobacterium-mediated transient expression method for versatile gene function analyses in Arabidopsis seedlings | |
| MX2008002615A (en) | Methods and compositions for the expression of a polynucleotide of interest. | |
| CN111886337A (en) | Use of morphogenetic factors for improving gene editing | |
| CA2992488A1 (en) | Ochrobactrum-mediated transformation of plants | |
| Nonaka et al. | Super-Agrobacterium ver. 4: improving the transformation frequencies and genetic engineering possibilities for crop plants | |
| Tran et al. | Effect of antibiotics on callus regeneration during transformation of IR 64 rice | |
| Nagata et al. | Engineering expression of bacterial polyphosphate kinase in tobacco for mercury remediation | |
| Novakova et al. | Cloning the bacterial bphC gene into Nicotiana tabacum to improve the efficiency of PCB phytoremediation | |
| López‐Arredondo et al. | A novel dominant selectable system for the selection of transgenic plants under in vitro and greenhouse conditions based on phosphite metabolism | |
| CN116391038A (en) | Engineered Cas endonuclease variants for improved genome editing | |
| Ditt et al. | The plant cell defense and Agrobacterium tumefaciens | |
| Kumar et al. | Expression of an endo α-1, 3-Glucanase gene from Trichoderma harzianum in rice induces resistance against sheath blight | |
| KR101699017B1 (en) | Repoter plant system for non-degradable harmful aromatic compound detection and uses thereof | |
| Broer et al. | Examination of the putative horizontal gene transfer from transgenic plants to agrobacteria | |
| García-Almodóvar et al. | Combination of site-specific recombination and a conditional selective marker gene allows for the production of marker-free tobacco plants | |
| CN101333541B (en) | Naphthaline dioxygenase plant expression vector, construct process thereof and applications | |
| Ke et al. | Manipulation of discriminatory T-DNA delivery by Agrobacterium into cells of immature embryos of barley and wheat | |
| US20190040404A1 (en) | Plant promoter and 3' utr for transgene expression | |
| US9822375B2 (en) | Method of transforming cells | |
| Rathore et al. | Capability of the plant-associated bacterium, Ensifer adhaerens strain OV14, to genetically transform its original host Brassica napus | |
| Stepanova et al. | Obtaining transgenic alfalfa plants for improved phytoremediation of petroleum-contaminated soils | |
| CN109699499B (en) | Transgenic arabidopsis thaliana for repairing soil polluted by PCBs | |
| Basavaraju et al. | A modified in-planta transformation technique to generate stable gain-in function transformants in a recalcitrant indica rice genotype | |
| CN109415420B (en) | Plant promoters and 3' UTRs for transgene expression |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| E701 | Decision to grant or registration of patent right | ||
| GRNT | Written decision to grant | ||
| FPAY | Annual fee payment |
Payment date: 20191210 Year of fee payment: 4 |