WO2017013599A1 - Method for treatment of traumatic brain injury targeting aggregated peptides - Google Patents

Method for treatment of traumatic brain injury targeting aggregated peptides Download PDF

Info

Publication number
WO2017013599A1
WO2017013599A1 PCT/IB2016/054318 IB2016054318W WO2017013599A1 WO 2017013599 A1 WO2017013599 A1 WO 2017013599A1 IB 2016054318 W IB2016054318 W IB 2016054318W WO 2017013599 A1 WO2017013599 A1 WO 2017013599A1
Authority
WO
WIPO (PCT)
Prior art keywords
brain injury
peptides
traumatic brain
agent
individual
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/IB2016/054318
Other languages
English (en)
French (fr)
Inventor
Lars Lannfelt
Hans Basun
Erik Rollman WAARA
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Bioarctic AB
Original Assignee
Bioarctic Neuroscience AB
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Bioarctic Neuroscience AB filed Critical Bioarctic Neuroscience AB
Priority to AU2016295650A priority Critical patent/AU2016295650A1/en
Priority to CA2991856A priority patent/CA2991856A1/en
Priority to JP2018503215A priority patent/JP2018522891A/ja
Priority to CN201680042690.4A priority patent/CN107849125A/zh
Priority to US15/746,283 priority patent/US11327080B2/en
Priority to EP16742413.4A priority patent/EP3325506A1/en
Publication of WO2017013599A1 publication Critical patent/WO2017013599A1/en
Anticipated expiration legal-status Critical
Priority to JP2022079211A priority patent/JP2022113682A/ja
Ceased legal-status Critical Current

Links

Classifications

    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • G01N33/6893Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids related to diseases not provided for elsewhere
    • G01N33/6896Neurological disorders, e.g. Alzheimer's disease
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • A61P25/28Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00Drugs for disorders of the cardiovascular system
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/505Medicinal preparations containing antigens or antibodies comprising antibodies
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/435Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
    • G01N2333/46Assays involving biological materials from specific organisms or of a specific nature from animals; from humans from vertebrates
    • G01N2333/47Assays involving proteins of known structure or function as defined in the subgroups
    • G01N2333/4701Details
    • G01N2333/4709Amyloid plaque core protein
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00Detection or diagnosis of diseases
    • G01N2800/28Neurological disorders
    • G01N2800/2814Dementia; Cognitive disorders
    • G01N2800/2821Alzheimer
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00Detection or diagnosis of diseases
    • G01N2800/28Neurological disorders
    • G01N2800/2871Cerebrovascular disorders, e.g. stroke, cerebral infarct, cerebral haemorrhage, transient ischemic event
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00Detection or diagnosis of diseases
    • G01N2800/50Determining the risk of developing a disease
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00Detection or diagnosis of diseases
    • G01N2800/52Predicting or monitoring the response to treatment, e.g. for selection of therapy based on assay results in personalised medicine; Prognosis
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00Detection or diagnosis of diseases
    • G01N2800/70Mechanisms involved in disease identification
    • G01N2800/7047Fibrils-Filaments-Plaque formation

Definitions

  • This invention is directed to prevention, alleviation, treatment and diagnosis of traumatic brain injury.
  • Acute brain injury encompasses a group of common disorders, comprising, e.g., traumatic brain injury (TBI), hypoxi and stroke, leading to severe pathological consequences.
  • TBI traumatic brain injury
  • hypoxi hypoxi
  • stroke leading to severe pathological consequences.
  • TBI is the most common cause of death and disability in persons between 15 and 30 years of age. The most severe injuries can result in prolonged disorders of unconsciousness. From 10 to 15% of patients with severe TBI are discharged from acute care in a vegetative state (Levin et al., 1991 Arch Neurol; 48:580-5). Twenty three European reports with findings from national studies from Denmark, Sweden, Finland, Portugal, Germany, and from regions within Norway, Sweden, Italy, Switzerland, Spain, Denmark, Ireland, the U.K. and France reported an aggregate hospitalized plus fatal TBI incidence rate of about 235 per 100,000
  • Amyloid-beta in the form of ⁇ plaques and intra-axonal ⁇ deposits, have been found in one-third of patients with fatal TBI who did not have symptoms of preexisting clinical dementia or cognitive deficits (Roberts et al., J Neurol Neurosurg Psychiatry. 1994;57:419-25). As early as 2 hours after severe brain injury, increased levels of soluble ⁇ peptide and deposition of amyloid plaques are evident in the brains of 30% of survivors, regardless of their age (Ikonomovic et al., Exp Neurol
  • Brain microdialysis has among other applications been used clinically to detect early signs of metabolic deterioration that may provide early warning signs of secondary insults after acute brain injury.
  • Microdialysis catheters have at the same time been used to measure levels of ⁇ .
  • has the ability to self-associate and can form different assemblies ranging from dimers to oligomers of various sizes, including protofibrils, which are larger soluble oligomers, to insoluble aggregates of fibrils.
  • the formation and accumulation of ⁇ fibrils in amyloid plaques in the brain was previously linked to neurodegenerative disease, in particular Alzheimer's disease.
  • recent data suggest a more important role for the non-fibrillary and soluble, toxic species of ⁇ , as biochemical analyses of brains have indicated that the concentrations of non-fibrillary forms of ⁇ correlate well with synaptic loss and presence of dementia.
  • WO 02/0391 1 describes the ⁇ protofibril to be of special importance in the development of certain neurodegenerative diseases, in particular Alzheimer's disease, and antibodies with high affinity and selectivity for ⁇ protofibrils were produced as disclosed in WO 05/123775 and WO 07/108756. Such an antibody is now in clinical trials for treatment of Alzheimer's disease.
  • the invention is directed to a method of preventing, alleviating or treating traumatic brain injury in an individual.
  • the method comprises administering to the individual a therapeutically effective and physiologically acceptable amount of an agent capable of reducing the amount of one or more aggregated forms of one or more peptides in the brain.
  • the invention is directed to an agent capable of reducing the amount of one or more aggregated forms of one or more peptides in the brain, for use in preventing, alleviating or treating traumatic brain injury.
  • the invention is directed to a method for predication of the risk of an individual for complications after a traumatic brain injury, comprising detecting one or more aggregated forms of one or more peptides prone to aggregate as a result of a traumatic brain injury event, in the brain of the individual, wherein an increased level of such aggregates in the brain indicates an increased risk for complications.
  • Figs. 1 A and 1 B show protofibril and oligomer ⁇ binding as described in the Example.
  • Fig. 1A shows protofibril ⁇ levels in patient samples detected with the mAb158 sandwich ELISA. Each bar represents a mean value and standard deviation (SD) from two ELISA experiments performed on two different occasions.
  • Fig. 1 B shows oligomer ⁇ levels in patient samples detected with the mAb82E1 sandwich ELISA. Each bar represents a mean value and SD from two ELISA experiments performed on two different occasions. The absence of a bar indicates that the value was below the assay limit of detection.
  • Figs. 2A and 2B show monomeric ⁇ 40 and 42 binding as described in the Example. Fig.
  • FIG. 2A shows total monomeric ⁇ x-40 and x-42 levels (N-terminal truncated and full-length monomers, wherein at least amino acid 40 and 42, respectively, is present) detected by mid-region mAb4G8.
  • Each bar represents a mean and SD from two ELISA experiments performed on two different occasions. Six of the values from the Alzheimer's Disease (AD) sample panel are out-of scale and are instead shown above each bar as even thousands of pg per mg total protein.
  • Fig. 2B shows full-length monomeric ⁇ 1 -40 and 1 -42 levels detected by N-terminal mAb6E10. Each bar represents a mean from one ELISA experiment with SD showing variation between duplicate ELISA wells.
  • Certain peptides in the brain have been identified as being prone to aggregate as a result of an acute brain injury.
  • the aggregates that are formed provide a severe contribution to the damages to vital functions that are most often the result already in the acute phase.
  • Methods and means are provided according to the invention for acute treatments and diagnosis, targeting precursors of these peptides, the peptides themselves, or aggregated forms thereof. Accordingly, several possibilities for therapy are available in order to reach the goal that is to eliminate or substantially reduce the amount of aggregates in the brain.
  • the methods and agents of the invention target amyloid- ⁇ ( ⁇ ), ⁇ - synuclein and/or tau peptide and/or tau peptide derivatives, e.g.
  • protofibrils refers to larger soluble oligomers.
  • the protofibrils have an apparent molecular weight greater than 100 kDa. In more specific
  • the protofibrils have an apparent molecular weight greater than 100 kDa, and a curvilinear structure of 4-1 1 nm in diameter and less than 200 nm in length.
  • Such protofibrils are described, for example, by Walsh et al, The Journal of Biological Chemistry, 272(35) :22364-22372 (1997), and Walsh et al, The Journal of Biological Chemistry, 274(36) :25945-25952 (1999), both of which are incorporated herein by reference.
  • the methods and agents of the invention target the neurotoxic ⁇ protofibrils.
  • prevention, alleviation, treatment and/or diagnosis of a traumatic brain injury is achieved by the use of antibodies against one or more species comprising such a peptide.
  • peptide(s) will be used while the scientific literature sometimes refers to them as protein(s).
  • target peptides in the brain provide efficient therapy in a new medical indication, i.e., situations with an acute brain injury event.
  • These target peptides in the brain are characterized by the formation of aggregates in response to an acute brain injury event.
  • the group of peptides prone to aggregate, under these conditions comprises amyloid peptides, in particular the ⁇ peptide, a-synuclein and tau peptide.
  • the invention will in the following be illustrated mainly by exemplification with an amyloid peptide, ⁇ , one member from the group of peptides in the brain, prone to aggregate as a result of an acute brain injury event.
  • the invention covers as well, other peptides prone to aggregate in a similar way, as a result of an acute brain injury event.
  • the elimination or substantial reduction can be obtained in several different ways.
  • the peptide e.g., ⁇
  • APP Amyloid Precursor Protein
  • the peptide is part of a receptor expressed in vivo, e.g. the Amyloid Precursor Protein (APP), and is cleaved off with one or more enzymes.
  • APP Amyloid Precursor Protein
  • Substances affecting these processes in the ⁇ system are, e.g., a-secretase agonists, antagonists of ⁇ -secretase and ⁇ -secretase.
  • Reduction of ⁇ peptide can also be achieved by stimulation of ⁇ degrading enzymes, e.g., by insulin degrading enzyme (IDE), neprilysin and others.
  • IDE insulin degrading enzyme
  • Elimination or at least substantial reduction of aggregated forms of the peptides may also be achieved by substances inhibiting the aggregation process as such, i.e., making the peptide monomers less prone to aggregate at all or preventing low molecular weight aggregates to undergo further aggregation to the most likely larger toxic aggregates, in particular, the protofibrils, i.e., larger soluble oligomers.
  • this can be achieved by administering substances which bind to peptide monomers and/or the low molecular weight aggregates, preventing them from further aggregation.
  • Elimination of aggregated forms can of course also be achieved by administering substances targeting one or more of such aggregated forms for elimination of the species from the system, e.g., by disintegration to amino acids and/or monomers or less toxic small aggregates.
  • antibodies designed to have high affinity for aggregated forms of ⁇ , ⁇ -synuclein or tau peptide are used.
  • the invention is directed to the use of antibodies designed to have high affinity for, in particular, the protofibrils, for example, protofibrils of ⁇ , ⁇ - synuclein or tau peptide.
  • the toxic oligomeric or protofibril forms can be eliminated by an antibody-mediated uptake by microglial cells.
  • the toxicity of oligomeric forms, in particular, protofibrils is reduced, e.g., by administration of substances destroying or blocking toxic sites on the protofibrils.
  • methods of preventing, alleviating and/or treating traumatic brain injury comprise administering to an individual an effective amount of an agent for reducing the amount of one or more aggregated forms of the peptide(s), e.g., with antibodies specific for peptides prone to aggregation after an acute brain injury, or their aggregated forms.
  • antibodies against ⁇ or aggregated forms of ⁇ are used to reduce the amount of one or more aggregated forms of the peptide(s), in order to enhance arousal and/or behavioral responsiveness, to avoid prolonged disorders of unconsciousness, and/or to alter the pace of recovery or improve the functional outcome.
  • antibody is initially administered during the acute phase as an intravenous infusion, intravenous or subcutaneous injection or delivered directly into the brain ventricles or intrathecally. Administration can be prolonged and used during the inpatient neurorehabilitation to further improve recovery.
  • peptides prone to aggregate after an acute brain injury event, and which in monomer, oligomer and protofibril forms are the target for the methods according to the invention, may appear in various lengths, e.g. as a result of "imperfect" cleavage reactions in connection with production or as a result of the action of various enzymes at some stage.
  • the full length peptide, the ⁇ peptide is in most cases 1 -39, 1 -40, 1 -41 , 1 -42 and 1 -43.
  • truncations at one or both (N-terminal and/or C-terminal) ends of the peptides are far from uncommon, and the 1 -28, 3-40/42, 1 1 -40/42, 17-40/42 and 24-35 are just a few examples of ⁇ peptides with various lengths which may appear in the in vivo system.
  • the truncated peptides can aggregate to the oligomer, protofibril and fibril forms mentioned above which means that in vivo aggregated forms of ⁇ may contain various combinations and amounts of full length and truncated forms. Aggregated forms of truncated ⁇ , including protofibrils, are also targets of the present methods. Antibodies against such truncated protofibrils are disclosed in WO 05/123775 and WO
  • Further variants of the peptides, prone to aggregate, may comprise mutated forms, where one or more of the amino acids in the peptide sequence are exchanged for a different amino acid.
  • the Flemish (A21 G), Arctic (E22G), Dutch (E22Q), Italian (E22K) and Iowa (D23N) mutations are well known and characterized.
  • the Arctic mutation has been found to be of interest with regard to aggregation as it easily forms fairly stable and toxic ⁇ protofibrils.
  • Antibodies against aggregated forms of such mutants, including protofibrils thereof, are also suitable for use in the present methods.
  • Another peptide in the brain is a-synuclein which also aggregates under certain conditions to give various oligomer forms, protofibrils and fibrils.
  • This peptide and its aggregated forms are strongly linked to the development of Parkinson's disease and Dementia with Lewy bodies.
  • efforts have been focused on the development of therapies targeting the various ⁇ -synuclein aggregated species.
  • Several antibodies targeting the ⁇ -synuclein protofibrils are disclosed in WO 201 1 /104696, which is hereby incorporated by reference in its entirety, and are also suitable for use in the present methods.
  • a method wherein a person suffering from, or suspected to be a victim of an acute brain injury event, is treated with an agent targeting one or more of these peptides and/or aggregates already formed from such peptides.
  • an agent targeting one or more of these peptides and/or aggregates already formed from such peptides.
  • soluble and/or insoluble aggregated forms are targeted.
  • the agent is administered to exert its effect in the brain and must penetrate the blood brain barrier if administered systemically. A possible administration is directly into the brain parenchyma.
  • the agent is an antibody targeting protofibrils.
  • the agent is an antibody targeting ⁇ protofibrils.
  • An example of a suitable drug candidate is a humanized antibody based on mAb158, disclosed in WO 07/108756, which provides a detailed disclosure of the antibody and is incorporated herein by reference in its entirety.
  • an antibody targeting peptides prone to aggregate and/or one or more aggregated forms thereof should have high affinity for one or more of these species.
  • the antibody has high affinity for one or more protofibril(s).
  • High affinity is defined as an ELISA method IC50 (the concentration of antibody needed to inhibit 50% of the assay signal) of less than 10 ⁇ 7 M, less than 10 ⁇ 8 M, less than 10 ⁇ 9 M, less than 10 ⁇ 10 M, or assay 10 ⁇ 11 M.
  • the antibodies are of IgG class, e.g.
  • lgG1 or lgG4 subclass or combinations or mutations thereof in addition retain high Fc receptor binding and low C1 (C1 q) binding, effective in clearance of the targeted peptide specie(s) and with reduced risk of inflammation.
  • the amount of aggregates is reduced at least by 30%, 40%, 50%, 60%, 70%, 80% or 90% compared to a control. Even as low as 1 % reduction may have significant clinical benefits.
  • the time range from the traumatic brain injury event to treatment in accordance with the invention should be as short as possible. This means that a patient reaching the emergency unit of a hospital with a suspected traumatic brain injury should be treated immediately in accordance with the present invention, and at least for a period in which increased levels of peptide aggregates caused by the traumatic brain injury event are present.
  • this invention also pertains to a chronic / preventive treatment of TBI with an agent reducing neurodegeneration which may cause dementia and Alzheimer's disease.
  • an individual at risk of later complications from TBI can be the subject of preventive treatment.
  • the formation of aggregates as a result of the brain injury event is of course of diagnostic or perhaps more correctly predictive value, alone or in combination with traditional characteristics of a brain disease of this type.
  • the formation of aggregates of this type in the brain after a traumatic brain injury event indicates a risk for severe complications.
  • labeled substances targeting one or more of the peptide aggregates for example, a labeled antibody
  • the localization and amount of aggregates can be measured, e.g. by PET or MRI techniques.
  • fluorescent, magnetic, or radio-labeled antibodies may be employed.
  • tissue of body fluid samples can be collected for in vitro analysis.
  • antibodies against one or more of the aggregated forms, e.g., the protofibrils are of great importance in such methods.
  • a method of preventing, alleviating or treating traumatic brain injury in an individual comprising administering to the individual a therapeutically effective and physiologically acceptable amount of an agent capable of reducing the amount of one or more aggregated forms of one or more peptides in the brain of the individual.
  • the traumatic brain injury is a result of an acute brain injury event. In one embodiment of this aspect, the traumatic brain injury is a result of physical brain injury event. In one embodiment of this aspect, the traumatic brain injury is a result of brain injury caused by stroke or hypoxia.
  • the one or more peptides are selected from the group consisting of ⁇ peptides, alpha-synuclein peptides and tau-peptides.
  • the one or more aggregated forms of peptides are aggregated ⁇ peptides in the form of protofibrils.
  • the agent is an antibody.
  • the antibody binds ⁇ protofibrils.
  • the traumatic brain injury is mild traumatic brain injury. In one embodiment of this aspect, the traumatic brain injury is medium traumatic brain injury. In one embodiment of this aspect, the traumatic brain injury is severe traumatic brain injury.
  • the individual is a carrier of an
  • the individual is of
  • Apolipoprotein E3/E4 or Apolipoprotein E4/E4 genotype are Apolipoprotein E3/E4 or Apolipoprotein E4/E4 genotype.
  • an agent capable of reducing the amount of one or more aggregated forms of one or more peptides, in the brain, for use in preventing, alleviating or treating traumatic brain injury.
  • the agent is a medicament for use in preventing, alleviating or treating traumatic brain injury.
  • the traumatic brain injury is a result of an acute brain injury event. In one embodiment of this aspect, the traumatic brain injury is a result of physical brain injury event. In one embodiment of this aspect, the traumatic brain injury is a result of brain injury caused by stroke or hypoxia.
  • the one or more peptides are selected from the group consisting of ⁇ peptide, alpha-synuclein peptide and tau-peptides.
  • the one or more aggregated forms of peptides are aggregated ⁇ peptides in the form of protofibrils.
  • the agent is an antibody.
  • the antibody binds ⁇ protofibrils.
  • said traumatic brain injury is mild traumatic brain injury. In one embodiment of this aspect, said traumatic brain injury is medium traumatic brain injury. In one embodiment of this aspect, said traumatic brain injury is severe traumatic brain injury.
  • said agent for use is for an individual being a carrier of an Apolipoprotein E4 allele. In one embodiment of this aspect, said agent for use is for an individual being of Apolipoprotein E3/E4 or Apolipoprotein E4/E4 genotype.
  • a method for predication of the risk for complications after a traumatic brain injury in an individual comprising detecting one or more aggregated forms of one or more peptides prone to aggregate as a result of a traumatic brain injury event, in the brain of the individual, wherein an increased level of such one or more aggregates in the brain indicates an increased risk for complications.
  • the one or more peptides are selected from the group consisting of ⁇ peptides, alpha-synuclein peptides and tau-peptides.
  • the one or more aggregated forms of peptides are aggregated ⁇ peptides in the form of protofibrils.
  • the one or more aggregated forms of peptides are detectable with an antibody.
  • the one or more aggregated forms of peptides are detectable with an antibody that binds ⁇ protofibrils.
  • the method further comprises determination of Apolipoprotein genotype.
  • Example 1 The following non limiting example illustrates certain aspects of the invention.
  • Example 1 illustrates certain aspects of the invention.
  • This Example studied twelve severe TBI subjects.
  • Characteristics of the twelve severe TBI subjects are provided in Table 1 below: Table 1 .
  • DC Decompressive craniectomy
  • M male
  • F female
  • L left
  • R right
  • T temporal
  • F frontal
  • P parietal
  • Ccx removal of cortical contusion
  • GMS motor component of the Glasgow Coma Scale
  • SPR sports-related
  • MVA motor-vehicle accident
  • HBO hit by object
  • Thi thoracic injury
  • Efx extremity fracture
  • Ffx facial fracture
  • GOS Glasgow Outcome Scale
  • beta-amyloid
  • AA amyloid angiopathy
  • APP amyloid precursor protein
  • AS axonal swelling.
  • ⁇ 1 -42 peptides were purchased from American Peptide Company, CA, USA (batch # 12077006T). Lyophilized peptides were dissolved to 100 ⁇ in 10mM NaOH. ⁇ 1 -42 protofibrils were prepared by diluting the ⁇ 1 -42 peptide to 50 ⁇ in 0.1 M Phosphate buffer containing 0.3 M NaCI, pH 7.4. The preparation was incubated for 30 min at 37°C and then centrifuged at 1 6000xg for 5 min to pellet potential large aggregates.
  • the supernatants were further purified from monomers by size exclusion chromatography (Superdex 75 column, GE Healthcare, Sweden) at a flow rate of 0.08 ml/min in 0.05M Phosphate buffer, 0.15M NaCI, pH 7.4, and protofibrils were collected in the void fraction as previously described (Nilsberth C et al., (2001 ) Nat Neurosci 4, 887-893; Walsh DM et al., (1997) J Biol Chem 272, 22364-22372; Sehlin D et al., (2012) PloS One 7, e32014).
  • the mAb158 sandwich ELISA previously described in Englund H et al. (2007 J Neurochem 103, 334-345), specifically detects ⁇ protofibrils without interference from ⁇ monomers.
  • the protofibril-selective monoclonal mouse antibody mAb158 (lgG2a, BioArctic Neuroscience, Sweden) was formulated in sterile PBS (pH 7.5) at a concentration of 2 mg/ml and has previously been characterized.
  • ELISA plates were coated with 2 ⁇ g/ml mAb158 in PBS overnight at +4°C and blocked with 1 % BSA in PBS for 1 h.
  • TBS extracts were diluted fivefold and incubated in duplicates for 2 h at 22°C with shaking (600 rpm), thereafter biotinylated mAb158 (0.5 ⁇ g/ml) was added and the plates were incubated for another hour. Streptavidin-HRP (Mabtech, Sweden 1 : 5000) was used as detection agent (1 h incubation). Plates were developed with TMB substrate and the reaction was stopped after 25 min by the addition of 2M H 2 SO 4 .
  • Optical density was measured at 450 nm and sample concentrations were calculated from an ⁇ 42 protofibril standard curve using a 4-parameter equation. Data was recalculated together with the total protein dataset and presented as pg protofibril per mg total protein in each sample.
  • the mAb82E1 sandwich ELISA detects ⁇ oligomers/protofibrils (dimers to protofibrils) without binding ⁇ monomers (Tucker S et al., (2015) J Alzheimer's Dis. 2015;43(2):575-88, Supplementary Fig. 4).
  • mAb82E1 is an antibody that detects the N-terminus of ⁇ -secretase cleaved ⁇ (IBL, Japan). In the mAb82E1 sandwich ELISA described here, pure mAb82E1 is used for capture and the same biotinylated antibody for detection.
  • the sandwich ELISA protocol for mAb82E1 was in essence the same as for mAb158 sandwich ELISA above, with the exceptions that both coating of the ELISA plate and detection was carried out at a mAb82E1 concentration of 0.25 ⁇ g/ml. Sample concentrations were calculated from an ⁇ 42 protofibril standard curve using a 4-parameter equation. Data was re-calculated together with the total protein dataset and presented as pg oligomer per mg total protein in each sample.
  • K15199E-2) of ⁇ 38, ⁇ 40 and ⁇ 42 in a three-in-one (triplex) well format were obtained from Meso Scale Discovery (Rockville, MD, USA). TBS extracts were subject to denaturation and monomerisation by boiling in 1 % SDS prior to 10-fold dilution and addition to duplicate wells. The same final concentration of SDS (0.1 %) was added to the ⁇ standards supplied with the kits, and this procedure has been shown not to interfere with the assay (data not shown). Data was re-calculated and presented as pg ⁇ per mg total protein in each sample.
  • HAMA Human Anti-Mouse Antibodies
  • Apolipoprotein E (ApoE) genotyping was performed essentially as described in Hixson and Vernier (J Lipid Res 1990, Mar;31 (3):545-8) with slight modification of the primer sequences.
  • Genomic DNA was prepared from 25 mg brain tissue using a commercial kit (QIAamp DNA Mini Kit, cat no 51304). 40 ng DNA was PCR amplified using Taq polymerase as described by the manufacturer (Thermo Scientific, cat no AB0908) using forward ApoE primer (AGACGCGGGCACGGCTGTCCAAGGAGC) (SEQ ID NO: 1 ) and reverse ApoE primer (TCGCGGGCCCCGGCCTGGTACACTGC) (SEQ ID NO: 2) with the addition of 5% DMSO.
  • the PCR cycling completed 35 rounds of: denaturation 95 "C - 1 min, annealing, 95°C - 1 min and elongation 72°C - 1 .5 min.
  • the 244 bp PCR product was cleaved using the restriction enzyme Hha I according to the manufacturer (Thermo Scientific, cat no. 10819870) and the digested fragments were separated on a high resolution 4% MetaPhorTM agarose gel (Lonza, cat no 50181 ).
  • Traumatic brain injury is an established risk factor of Alzheimer's disease (AD).
  • a hallmark pathological finding in AD brains is insoluble plaques of amyloid-beta ( ⁇ ) although recent evidence suggests that soluble and neurotoxic ⁇ oligomers (OLs) and protofibrils (PFs) may be more important causes of cognitive impairment and neurodegeneration.
  • ⁇ plaques were previously observed within hours in a subset of TBI patients, persisting up to several years after severe TBI. However, the role for the potentially neurotoxic ⁇ OLs and PFs in TBI has not been established.
  • Enzyme-linked immunosorbent assay was used to evaluate the presence of ⁇ oligomers and protofibrils (OLs) in brain tissue, surgically resected during the first post-injury week in the described 12 severe TBI patients (mean 49.6 years, range 19 - 74) due to life threatening brain swelling and/or intracranial pressure elevations.
  • post-mortem brain tissue from neurologically intact (Nl) patients dying from unrelated causes were used as controls.
  • ⁇ OLs (median 129 (range 29 - 342) vs. 0 (range 0-0) pg/mg total protein, p ⁇ 0.01 ) and PFs (median 17.5 (range 0 - 626) vs. 0 (range 0-0) pg/mg total protein, p ⁇ 0.01 ) levels were increased in TBI patients when compared to the control group.
  • the levels of ⁇ OLs and PFs in brain tissue were also higher in TBI (median OLs 129, range 29 - 342 and PFs 17.5, range 0 - 626 pg/mg total protein) in
  • PCR amplification and Hha I restriction was performed in three separate experiments with similar results.
  • Four out of 12 TBI patients with high ⁇ protofibril levels (Fig. 1 A) were identified as being of E3/E4 genotype.
  • 7 patients with low or undetectable ⁇ protofibril levels are of E3/E3 genotype and 1 patients with low or undetectable ⁇ protofibril levels is of E2/E4 genotype.
  • the E3/E4 genotype is the most common genotype in the AD group and among the Hydrocephalus controls 1 out of 4 patients carry the E3/E4 genotype, a frequency similar to what is expected in the general population

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Immunology (AREA)
  • Neurosurgery (AREA)
  • Neurology (AREA)
  • Biochemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Hematology (AREA)
  • Urology & Nephrology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Microbiology (AREA)
  • General Physics & Mathematics (AREA)
  • Genetics & Genomics (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Cell Biology (AREA)
  • Food Science & Technology (AREA)
  • Physics & Mathematics (AREA)
  • Analytical Chemistry (AREA)
  • Pathology (AREA)
  • Heart & Thoracic Surgery (AREA)
  • Hospice & Palliative Care (AREA)
  • Psychiatry (AREA)
  • Cardiology (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
PCT/IB2016/054318 2015-07-21 2016-07-20 Method for treatment of traumatic brain injury targeting aggregated peptides Ceased WO2017013599A1 (en)

Priority Applications (7)

Application Number Priority Date Filing Date Title
AU2016295650A AU2016295650A1 (en) 2015-07-21 2016-07-20 Method for treatment of traumatic brain injury targeting aggregated peptides
CA2991856A CA2991856A1 (en) 2015-07-21 2016-07-20 Method for treatment of traumatic brain injury targeting aggregated peptides
JP2018503215A JP2018522891A (ja) 2015-07-21 2016-07-20 凝集ペプチドを標的とする外傷性脳損傷の治療方法
CN201680042690.4A CN107849125A (zh) 2015-07-21 2016-07-20 用于治疗靶向聚集的肽的创伤性脑损伤的方法
US15/746,283 US11327080B2 (en) 2015-07-21 2016-07-20 Method for treatment of traumatic brain injury targeting aggregated peptides
EP16742413.4A EP3325506A1 (en) 2015-07-21 2016-07-20 Method for treatment of traumatic brain injury targeting aggregated peptides
JP2022079211A JP2022113682A (ja) 2015-07-21 2022-05-13 凝集ペプチドを標的とする外傷性脳損傷の治療方法

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US201562195183P 2015-07-21 2015-07-21
US62/195,183 2015-07-21
US201662288813P 2016-01-29 2016-01-29
US62/288,813 2016-01-29

Publications (1)

Publication Number Publication Date
WO2017013599A1 true WO2017013599A1 (en) 2017-01-26

Family

ID=56550266

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/IB2016/054318 Ceased WO2017013599A1 (en) 2015-07-21 2016-07-20 Method for treatment of traumatic brain injury targeting aggregated peptides

Country Status (7)

Country Link
US (1) US11327080B2 (https=)
EP (1) EP3325506A1 (https=)
JP (2) JP2018522891A (https=)
CN (1) CN107849125A (https=)
AU (1) AU2016295650A1 (https=)
CA (1) CA2991856A1 (https=)
WO (1) WO2017013599A1 (https=)

Families Citing this family (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10501531B2 (en) 2013-03-13 2019-12-10 Prothena Biosciences Limited Tau immunotherapy
PT3452507T (pt) 2016-05-02 2022-12-20 Prothena Biosciences Ltd Imunoterapia anti-tau
MY198194A (en) 2016-05-02 2023-08-09 Prothena Biosciences Ltd Antibodies Recognizing Tau
KR102784294B1 (ko) 2017-05-02 2025-03-19 프로테나 바이오사이언시즈 리미티드 타우 인식 항체
JP7630834B2 (ja) 2019-03-03 2025-02-18 プロセナ バイオサイエンシーズ リミテッド タウ認識抗体

Citations (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2002003911A2 (en) 2000-07-07 2002-01-17 Lars Lannfelt Prevention and treatment of alzheimer's disease
WO2005123775A1 (en) 2004-06-21 2005-12-29 Bioarctic Neuroscience Ab Antibodies specific for soluble amyloid beta peptide protofibrils and uses thereof
WO2006069081A2 (en) * 2004-12-22 2006-06-29 Washington University In St. Louis USE OF ANTI-Aβ ANTIBODY TO TREAT TRAUMATIC BRAIN INJURY
WO2007108756A1 (en) 2006-03-23 2007-09-27 Bioarctic Neuroscience Ab Improved protofibril selective antibodies and the use thereof
WO2011001366A1 (en) 2009-06-29 2011-01-06 Bioartic Neuroscience Ab N-terminal truncated amyloid beta protofibrils/ oligomers for use in therapeutic and diagnostic methods for alzheimer's disease
WO2011104696A1 (en) 2010-02-26 2011-09-01 Bioarctic Neuroscience Ab Protofibril-binding antibodies and their use in therapeutic and diagnostic methods for parkinson's disease, dementia with lewy bodies and other alpha-synucleinopathies
WO2013168174A1 (en) * 2012-05-08 2013-11-14 Ramot At Tel-Aviv University Ltd. Apoe4 antibodies for treatment of neurodegenerative conditions
US20150004169A1 (en) * 2009-08-28 2015-01-01 The Board Of Regents Of The University Of Texas System Methods of Treating Brain Injury
WO2015035190A1 (en) * 2013-09-05 2015-03-12 Cornell University Gene therapy for alzheimer's and other neurodegenerative diseases and conditions

Family Cites Families (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
DE1257584T1 (de) 2000-02-24 2003-05-28 Lilly Co Eli Humanisierte antikörper, die amyloid beta peptid demarkieren
FR2945538B1 (fr) 2009-05-12 2014-12-26 Sanofi Aventis Anticorps humanises specifiques de la forme protofibrillaire du peptide beta-amyloide.
AU2010286501B2 (en) 2009-08-28 2015-06-11 The Board Of Regents Of The University Of Texas System Antibodies that bind Tau oligomers
WO2012064836A1 (en) * 2010-11-10 2012-05-18 Genentech, Inc. Methods and compositions for neural disease immunotherapy
US20150315267A1 (en) * 2012-12-07 2015-11-05 Thierry Bussiere A method of reducing brain amyloid plaques using anti-ab antibodies
US20150126390A1 (en) * 2013-09-12 2015-05-07 Washington University Multiplex avidity profiling of protein aggregates
WO2016005466A2 (en) 2014-07-10 2016-01-14 Bioarctic Neuroscience Ab IMPROVED Aß PROTOFIBRIL BINDING ANTIBODIES

Patent Citations (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2002003911A2 (en) 2000-07-07 2002-01-17 Lars Lannfelt Prevention and treatment of alzheimer's disease
WO2005123775A1 (en) 2004-06-21 2005-12-29 Bioarctic Neuroscience Ab Antibodies specific for soluble amyloid beta peptide protofibrils and uses thereof
WO2006069081A2 (en) * 2004-12-22 2006-06-29 Washington University In St. Louis USE OF ANTI-Aβ ANTIBODY TO TREAT TRAUMATIC BRAIN INJURY
WO2007108756A1 (en) 2006-03-23 2007-09-27 Bioarctic Neuroscience Ab Improved protofibril selective antibodies and the use thereof
WO2011001366A1 (en) 2009-06-29 2011-01-06 Bioartic Neuroscience Ab N-terminal truncated amyloid beta protofibrils/ oligomers for use in therapeutic and diagnostic methods for alzheimer's disease
US20150004169A1 (en) * 2009-08-28 2015-01-01 The Board Of Regents Of The University Of Texas System Methods of Treating Brain Injury
WO2011104696A1 (en) 2010-02-26 2011-09-01 Bioarctic Neuroscience Ab Protofibril-binding antibodies and their use in therapeutic and diagnostic methods for parkinson's disease, dementia with lewy bodies and other alpha-synucleinopathies
WO2013168174A1 (en) * 2012-05-08 2013-11-14 Ramot At Tel-Aviv University Ltd. Apoe4 antibodies for treatment of neurodegenerative conditions
WO2015035190A1 (en) * 2013-09-05 2015-03-12 Cornell University Gene therapy for alzheimer's and other neurodegenerative diseases and conditions

Non-Patent Citations (24)

* Cited by examiner, † Cited by third party
Title
ALLAL BOUTAJANGOUT ET AL: "Passive immunization targeting pathological phospho-tau protein in a mouse model reduces functional decline and clears tau aggregates from the brain", JOURNAL OF NEUROCHEMISTRY, vol. 118, no. 4, 1 August 2011 (2011-08-01), pages 658 - 667, XP055081677, ISSN: 0022-3042, DOI: 10.1111/j.1471-4159.2011.07337.x *
AMANDINE JULLIENNE ET AL: "Juvenile traumatic brain injury induces long-term perivascular matrix changes alongside amyloid-beta accumulation", JOURNAL OF CEREBRAL BLOOD FLOW & METABOLISM, vol. 34, no. 10, 1 October 2014 (2014-10-01), US, pages 1637 - 1645, XP055304569, ISSN: 0271-678X, DOI: 10.1038/jcbfm.2014.124 *
BARD F ET AL: "Peripherally administered antibodies against amyloid beta-peptide enter the central nervous system and reduce pathology in a mouse model of Alzheimer disease", NATURE MEDICINE, NATURE PUBLISHING GROUP, NEW YORK, NY, US, vol. 6, no. 8, 1 August 2000 (2000-08-01), pages 916 - 919, XP002591991, ISSN: 1078-8956 *
ENGLUND H ET AL., J NEUROCHEM, vol. 103, 2007, pages 334 - 345
FADEN ALAN I ET AL: "Chronic Neurodegeneration After Traumatic Brain Injury: Alzheimer Disease, Chronic Traumatic Encephalopathy, or Persistent Neuroinflammation?", NEUROTHERAPEUTICS, ELSEVIER INC, US, vol. 12, no. 1, 25 November 2014 (2014-11-25), pages 143 - 150, XP035446848, ISSN: 1933-7213, [retrieved on 20141125], DOI: 10.1007/S13311-014-0319-5 *
FINDER VERENA H ET AL: "Amyloid-beta aggregation", NEURODEGENERATIVE DISEASES, KARGER AG, BASEL, CH, vol. 4, no. 1, 1 January 2007 (2007-01-01), pages 13 - 27, XP009129526, ISSN: 1660-2854, DOI: 10.1159/000100355 *
HIXSON; VERNIER, J LIPID RES, vol. 31, no. 3, March 1990 (1990-03-01), pages 545 - 8
IKONOMOVIC ET AL., EXP NEUROL, vol. 190, 2004, pages 192 - 203
KARTHIKEYAN BALAKRISHNAN ET AL: "Impact of amyloid [beta] aggregate maturation on antibody treatment in APP23 mice", ACTA NEUROPATHOLOGICA COMMUNICATIONS, vol. 125, no. 5618, 4 July 2015 (2015-07-04), pages 699, XP055304256, DOI: 10.1186/s40478-015-0217-z *
LARS LANNFELT ET AL: "Perspectives on future Alzheimer therapies: amyloid-[beta] protofibrils - a new target for immunotherapy with BAN2401 in Alzheimer's disease", ALZHEIMERS RES THER, vol. 6, no. 2, 1 January 2014 (2014-01-01), London, UK, pages 16, XP055304859, ISSN: 1758-9193, DOI: 10.1016/S1474-4422(09)70299-6 *
LEVIN ET AL., ARCH NEUROL, vol. 48, 1991, pages 580 - 5
MAGNONI ET AL., ARCH NEUROL, vol. 67, 2010, pages 1068 - 73
MAGNONI SANDRA ET AL.: "New perspectives on amyloid beta dynamics after acute brain injury", ARCHIVES OF NEUROLOGY, vol. 67, no. 9, 1 September 2010 (2010-09-01), XP009191763 *
NILSBERTH C ET AL., NAT NEUROSCI, vol. 4, 2001, pages 887 - 893
PATRICIA M. WASHINGTON ET AL: "Experimental Traumatic Brain Injury Induces Rapid Aggregation and Oligomerization of Amyloid-Beta in an Alzheimer's Disease Mouse Model", JOURNAL OF NEUROTRAUMA., vol. 31, no. 1, 1 January 2014 (2014-01-01), US, pages 125 - 134, XP055304642, ISSN: 0897-7151, DOI: 10.1089/neu.2013.3017 *
ROBERTS ET AL., J NEUROL NEUROSURG PSYCHIATRY, vol. 57, 1994, pages 419 - 25
SEHLIN D ET AL., PLOS ONE, vol. 7, 2012, pages E32014
TAGLIAFERRI ET AL., ACTA NEUROCHIR (WIEN, vol. 148, 2006, pages 255 - 68
TUCKER S ET AL., J ALZHEIMER'S DIS. 2015, vol. 43, no. 2, 2015, pages 575 - 88
TUCKER S ET AL.: "The murine version of BAN2401 (mAb158) selectively reduces amyloid-beta protofibrils in brain and cerebrospinal fluid of tg-ArcSwe mice.", JOURNAL OF ALZHEIMER'S DISEASE, vol. 43, no. 2, 1 January 2015 (2015-01-01), pages 575 - 588, XP009191785 *
WALSH DM ET AL., J BIOL CHEM, vol. 272, 1997, pages 22364 - 22372
WALSH ET AL., THE JOURNAL OF BIOLOGICAL CHEMISTRY, vol. 272, no. 35, 1997, pages 22364 - 22372
WALSH ET AL., THE JOURNAL OF BIOLOGICAL CHEMISTRY, vol. 274, no. 36, 1999, pages 25945 - 25952
YUKIKO HORI ET AL: "Role of Apolipoprotein E in [beta]-Amyloidogenesis", JOURNAL OF BIOLOGICAL CHEMISTRY, vol. 290, no. 24, 12 June 2015 (2015-06-12), US, pages 15163 - 15174, XP055304253, ISSN: 0021-9258, DOI: 10.1074/jbc.M114.622209 *

Also Published As

Publication number Publication date
AU2016295650A1 (en) 2018-01-25
EP3325506A1 (en) 2018-05-30
US11327080B2 (en) 2022-05-10
CN107849125A (zh) 2018-03-27
JP2018522891A (ja) 2018-08-16
US20180209994A1 (en) 2018-07-26
CA2991856A1 (en) 2017-01-26
JP2022113682A (ja) 2022-08-04

Similar Documents

Publication Publication Date Title
JP2022113682A (ja) 凝集ペプチドを標的とする外傷性脳損傷の治療方法
Zhao et al. β2-Microglobulin coaggregates with Aβ and contributes to amyloid pathology and cognitive deficits in Alzheimer’s disease model mice
Reichenbach et al. Inhibition of Stat3‐mediated astrogliosis ameliorates pathology in an Alzheimer's disease model
US9730979B2 (en) Methods for decreasing set in inhibiting protein phosphatase 2A (PP2A) and/or increasing the activity of cyclin-dependent kinase 5 (CDK5) by an APOE peptide
Li et al. Astrocyte-derived TNF-α-activated platelets promote cerebral ischemia/reperfusion injury by regulating the RIP1/RIP3/AKT signaling pathway
EP3101424B1 (en) Diagnosis of a neuroautoimmune disease
DK2809336T3 (en) FACTOR XII INHIBITORS FOR TREATMENT OF NEUROLOGICAL INFLAMMATORY DISEASES
EP1172378A1 (en) Human beta-amyloid antibody and use thereof for treatment of alzheimer's disease
Abu Hamdeh et al. Rapid amyloid‐β oligomer and protofibril accumulation in traumatic brain injury
Kaur et al. Intracellular DAMPs in neurodegeneration and their role in clinical therapeutics
JP7834637B2 (ja) 治療用融合タンパク質
Tambaro et al. Blood–brain and blood–cerebrospinal fluid passage of BRICHOS domains from two molecular chaperones in mice
TW202035438A (zh) 阿茲海默症之判定藥及判定方法
WO2018078018A2 (en) Detection of hypocretin-1 and -2
KR102276941B1 (ko) 류마티스 관절염 치료용 펩티드 및 그의 용도
US10889625B2 (en) Peptide-based methods for treating neurological injury
EP4058470A2 (en) Novel peptide compositions and methods of treating neurological injury
EP1476179A2 (en) Methods of preventing or treating brain ischemia or brain injury
CN111617232A (zh) 一类 ApoE 受体蛋白短肽阻断剂在阿尔茨海默病的应用
US9045525B2 (en) Amyloid β-protein-specific production-inhibiting polypeptide
Saxena et al. High-Mobility Group Box-1 and Its Potential Role in Perioperative Neurocognitive Disorders. Cells 2021, 10, 2582
WO2025184593A1 (en) Tau-targeting therapy for alzheimer's disease and other tauopathies
KR20260024607A (ko) 아밀로이드 베타와 특이적으로 결합하는 클러스터린 펩타이드 및 이의 용도
WO2024255822A1 (zh) Dir结合剂及其用途
Oyesola et al. SLEEP DEPRIVATION AND COFFEE CONSUMPTION INDUCED CHANGES IN BMI, BLOOD PRESSURE AND BLOOD GLUCOSE IN MALE WISTAR ALBINO RATS

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 16742413

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 2991856

Country of ref document: CA

ENP Entry into the national phase

Ref document number: 2018503215

Country of ref document: JP

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 15746283

Country of ref document: US

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2016295650

Country of ref document: AU

Date of ref document: 20160720

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 2016742413

Country of ref document: EP