WO2017010805A1 - 미생물 프로토타이핑 유전자 회로 기반 신규 미생물자원 탐색 시스템 - Google Patents

미생물 프로토타이핑 유전자 회로 기반 신규 미생물자원 탐색 시스템 Download PDF

Info

Publication number
WO2017010805A1
WO2017010805A1 PCT/KR2016/007613 KR2016007613W WO2017010805A1 WO 2017010805 A1 WO2017010805 A1 WO 2017010805A1 KR 2016007613 W KR2016007613 W KR 2016007613W WO 2017010805 A1 WO2017010805 A1 WO 2017010805A1
Authority
WO
WIPO (PCT)
Prior art keywords
phenol
gene
promoter
activity
sensor cell
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/KR2016/007613
Other languages
English (en)
French (fr)
Inventor
이승구
나유진
김하성
성원재
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Korea Research Institute of Bioscience and Biotechnology KRIBB
Original Assignee
Korea Research Institute of Bioscience and Biotechnology KRIBB
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Korea Research Institute of Bioscience and Biotechnology KRIBB filed Critical Korea Research Institute of Bioscience and Biotechnology KRIBB
Priority claimed from KR1020160088411A external-priority patent/KR101937180B1/ko
Publication of WO2017010805A1 publication Critical patent/WO2017010805A1/ko
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/70Vectors or expression systems specially adapted for E. coli
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/80Vectors or expression systems specially adapted for eukaryotic hosts for fungi
    • C12N15/81Vectors or expression systems specially adapted for eukaryotic hosts for fungi for yeasts
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/02Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving viable microorganisms
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N21/00Investigating or analysing materials by the use of optical means, i.e. using sub-millimetre waves, infrared, visible or ultraviolet light
    • G01N21/62Systems in which the material investigated is excited whereby it emits light or causes a change in wavelength of the incident light
    • G01N21/63Systems in which the material investigated is excited whereby it emits light or causes a change in wavelength of the incident light optically excited
    • G01N21/64Fluorescence; Phosphorescence

Definitions

  • the present invention is a substrate containing a "phenolic compound” that can be used to detect intracellular enzyme activity, a gene encoding a transcriptional regulator that is expressed by detecting a phenolic compound and a lower reporter gene operated by the transcriptional regulator Gene circuit comprising, sensor cell comprising the gene circuit, and new microbial strains having the activity of the target enzyme using the sensor cell co-cultured with the sensor cell to directly detect and search for the activity It is about how to.
  • sequence-based search technology is performed to identify DNA sequences, perform PCR reactions, and obtain amplified genes. screening).
  • genomic information is rapidly increasing, its utility is increasing day by day, and there is an advantage that only the desired gene can be specifically selected, but it can be used only when the exact information of the target gene is known.
  • the applicable subject is limited to a part of the genetic source.
  • activity-based screening techniques for selecting genes based on gene function, ie, enzyme activity
  • the method of separating microorganisms directly from environmental samples such as soil, river, factory wastewater, seawater and forest has been mainly used. Less than 1%, only a very small amount.
  • a strategy has been actively attempted to construct genetic resources in the form of metagenome libraries by separating DNA directly from environmental samples without culturing microorganisms. Accordingly, there is also a great interest in the development of screening techniques to directly detect industrially useful enzyme activity in the metagenome library.
  • High-speed assay techniques for enzymatic activity include (1) automated multi-analysis techniques using well-plates, (2) observing color or halo in solid media, and (3) deficient microorganisms.
  • the selective separation method used is mainly used. These methods have the advantage of clearly selecting the genes of the desired function because they are based on the actual activity of the enzyme, but there is a limitation in the versatility of the technology because it requires one detection technology to match the individual enzyme activity. In addition, the effect is further reduced when there is a problem such as low transcription, translation, or expression of foreign genes in the host cell or protein folding, secretion.
  • the present inventors have developed a gene circuit composed of a transcriptional regulator in which its expression is induced by phenol and a lower reporter gene actuated by the transcriptional regulator and a sensor cell comprising the same.
  • a transcriptional regulator in which its expression is induced by phenol and a lower reporter gene actuated by the transcriptional regulator and a sensor cell comprising the same.
  • the present invention provides a substrate comprising a "phenolic compound” that can be used to detect intracellular enzymatic activity, a gene encoding a transcriptional regulator that is expressed by detecting a phenolic compound, and a lower reporter gene operated by the transcriptional regulator.
  • the present invention is (1) the gene expression control region, the first promoter whose activity is regulated by the gene expression control region, and the expression is regulated by the activation of the first promoter, fluorescent protein
  • a first gene construct comprising; a reporter gene comprising a gene encoding a gene and a gene encoding an enzyme involved in nutritional requirements (auxotrophic);
  • a gene of a transcriptional regulator that regulates expression by the second promoter and the second promoter and binds to the gene expression control site only in the presence of a phenolic compound to activate the second promoter. It provides a genetic circuit for detecting the presence of a phenolic compound, including; a second gene construct.
  • the present invention also provides a sensor cell comprising the gene circuit.
  • the present invention provides a method for detecting and searching for a novel microbial strain retaining the activity of the target enzyme using a substrate comprising the "phenolic compound" that can be used for detecting the sensor cell and intracellular enzyme activity. do.
  • the present invention is a.
  • a reporter gene comprising a gene encoding a; a first gene construct comprising;
  • the present invention relates to a technology (MP-GESS: Microbe prototyping based genetic enzyme screening system) to easily identify and isolate a novel microbial resource retaining the target enzyme activity in nature using a genetic circuit.
  • MP-GESS Microbe prototyping based genetic enzyme screening system
  • phenolic compound is a substrate that can be used to detect the enzyme activity in the cell, phenol, 2-chlorophenol, 2-iodine phenol, 2-fluorophenol, o-cresol, 2-ethylphenol, m-cresol, 2-nitrophenol, catechol, 2-methoxyphenol, 2-aminophenol, 2,3-dichlorophenol, 3-chlorophenol, 2,3-dimethylphenol, 3-nitrophenol, 4-chloro Phenol, p-cresol, 2,5-dichlorophenol, 2,5-dimethylphenol and the like. Substrates containing such "phenolic compounds” are also referred to as "phenol-tag substrates.”
  • the reporter gene and the first promoter for regulating the expression of the reporter gene are operably linked.
  • the site where the transcriptional regulator binds to induce the expression of the downstream reporter gene activates the first promoter of the reporter gene such that the transcriptional regulator binds to express the downstream reporter gene. It is done.
  • a gene encoding a transcriptional regulator that recognizes the phenolic compound and induces expression of a downstream reporter protein and a second promoter that regulates the expression of the transcriptional regulator are operably linked. It features.
  • the "transcription regulator” is a protein that preferably regulates the expression of the degradation enzyme of the substrate including the phenolic compound, and operates a promoter that controls the expression of the phenolic compound degradation enzyme by detecting phenol. And a protein inducing expression of a reporter linked to such a promoter.
  • genes that show the degradation activity of aromatic organic compounds such as phenol, xylene, toluene, and benzene are mainly found in the genus Pseudomonas and Acinetobacter, and these genes are multifunctional with multigene expression. It is composed of operon and expressed by ⁇ 54 dependent transcriptional regulation.
  • Representative transcriptional regulators include DmpR, DmpR variant, XylR, MopR, PhhR, PhlR, TbuT, etc.
  • DmpR which is involved in phenol degradation metabolism in Pseudomonas putida
  • XylR which is involved in metabolism of toluene and xylene
  • DmpR or XylR to detect toluene, xylene or phenol contaminated with the natural environment has been studied in the concept of microbial biosensor.
  • This NtrC family expression regulator is a combination of a domain that recognizes activators such as phenol and xylene (A domain), a domain that has ATPase activity (C domain), and a domain that binds to DNA (D domain). It is composed. Therefore, in the absence of a phenol molecule, the A domain inhibits transcription. However, when the phenol molecule binds to inhibit the A domain, the transcriptional activation function of the C and D domains appears. Recently, studies on improving specificity through research using genetics and genetic engineering methods using specificity of A domain have been known.
  • the transcriptional regulator preferably used in the present invention may be dmpR, or a variant thereof, which is a regulatory protein of P. putida-derived phenol-degrading operon.
  • dmpR is the ⁇ 54 -dependent transcriptional activity regulatory portion of the dmp operon gene, which shows the degradation activity of aromatic organic compounds such as phenol, xylene, toluene and benzene.
  • the dmp operon derived from P. putida consists of 15 genes, among which dmpKLMNOP codes for the enzymes required for phenol hydroxylation, and dmpQBCDEFGHI codes for the metalytic pathway that degrades catechol intermediates.
  • dmpKLMNOP of operon expression is ⁇ 54-dependent transcription factor in dmpR is activated by binding to the operator of the dmp dmpK top, transcription factors for dmpR itself is known as ⁇ 70 dependent.
  • the variant of dmpR is, for example, E135K, where the 135th E of the dmpR amino acid sequence is K-mutated, in addition to E172K, D135N, D135N and E172K, F65L, L184I, F42Y, R109C, L113V, D116N, F122L, K6E And one or more of F42S, Q10R and K117M, Q10R, D116G and K117R, D116V may be a variant in which amino acid residues are mutated, but is not limited thereto, and the variant may have a high affinity for a phenolic compound, thus Various variants, including single or multiple mutations at the periphery, as well as variants of various dmpRs
  • the "gene expression control site” is a site that controls the entire gene circuit.
  • the transcriptional regulator inhibits transcription, but when the phenolic molecule binds to inhibit the A domain, transcriptional activation function by C and D domains appears to bind to the OpR (Operator for Reporter) site. Which is modulated by ⁇ 54 dependency.
  • promoter means a promoter that regulates the expression of a transcriptional regulator or a promoter that controls the expression of a reporter protein.
  • a promoter of dmpR or dmp operon of Pseudomonas or a promoter for general protein expression may be High expression promoters, including trc, T7, lac and ara promoters, may be used for high expression of foreign proteins.
  • Phce which is a high expression vector that does not require an inducer, may be used.
  • ⁇ 54 -dependent promoter (PECO) of E. coli may be used as a promoter for regulating the expression of the reporter protein.
  • PPU Pseudomonas putida
  • yeast PYST
  • the like depending on the host of MP-GESS.
  • the gene circuit may include not only the promoter, but preferably, a ribosome binding site (RBS) and / or a transcription terminator that facilitates expression of the reporter protein. That is, as a site for controlling the expression of the regulatory protein, in addition to the promoter may include RBS and / or transcription terminator.
  • RBS ribosome binding site
  • protein expression starts with AUG (methionine) or GUG (valine), which is an initiation codon in mRNA, and the distinction between AUG or GUG where the ribosome is located at a residue inside the protein and AUG and GUG as protein initiation codon is the purine base of DNA.
  • AUG or GUG where the ribosome is located at a residue inside the protein and AUG and GUG as protein initiation codon is the purine base of DNA.
  • RBS or Shine-Dalgarno (SD) sequence
  • SD Shine-Dalgarno
  • the gene circuit constructed in the present invention uses a transcriptional regulator of Pseudomonas, which is different from E. coli, which is a host of the gene circuit, in the case of ⁇ 54 dependent gene expression.
  • ⁇ 54 binding sites and ⁇ 54 factors themselves are very different from E. coli, they are used in combination with Pseudomonas RBS (RBSPPU), or E. coli RBS (RBS ⁇ ), or all strains to facilitate the expression of reporter proteins in host E. coli.
  • Possible RBS (RBSx) can be used.
  • the transcription terminator may preferably be rrnBT1T2 or tL3, and in addition to this, the transcription terminator may be used to construct the present invention using any transcription terminator commonly used in the art.
  • the reporter protein is composed of a fluorescent protein and an enzyme involved in trophic composition.
  • the fluorescent protein preferably, GFP, GFP UV , or RFP can be used, but as long as the object of the present invention can be achieved, the fluorescent protein that can be used in the present invention is not limited to these examples.
  • the enzymes involved in the nutritional constituents lose the ability of microorganisms to synthesize certain amino acids, nucleotide groups, vitamins, etc., due to mutations, and thus cannot grow in the medium, and thus, the components that cannot be synthesized as nutrients necessary for growth.
  • the required auxotroph represents an enzyme that allows the synthesis of the deficient substance.
  • enzymes involved in nutrient composition include but not limited to DAAT (D-amino acid aminotransferase) enzyme, which allows the glutamic acid nutrient component microorganism to survive in an environment deficient in glutamic acid. It doesn't happen.
  • DAAT D-amino acid aminotransferase
  • the reporter may be a dual reporter (dual reporter) consisting of both fluorescent proteins and enzymes involved in nutrition, and multiple reporters consisting of two or more reporters.
  • dual reporter dual reporter
  • any known method may be used for the sequential transformation of metagenome libraries and phenol sensing redesign gene circuits into suitable microbial hosts.
  • electroporation may be preferably used.
  • the present invention also provides a sensor cell comprising the gene circuit.
  • the genetic circuit may be provided in the form of a vector or a microorganism containing the vector.
  • the cell is preferably, but is not limited to any bacteria, such as E. coli, fungi, such as yeast, plant cells, animal cells and the like.
  • the Escherichia coli may be a trophyotrophic host cell, and preferably, glutamic acid trophyotrophic host cell, but is not limited thereto.
  • the present invention also provides a method for detecting and searching for a novel microbial strain retaining the activity of the target enzyme using the sensor cell.
  • the method is a
  • Step (2) may be co-cultured with the natural microbial strain or the environmental sample comprising the same is expected to have the target enzyme and mixed with the phenol-tag substrate and the sensor cell.
  • step (2) comprises: forming a colony by culturing in an environment in which the phenol-tag substrate is treated in a natural microorganism or an environmental sample comprising the same, which is expected to possess the target enzyme; And co-culturing the formed colonies and the sensor cells together.
  • the sensor cells can be co-cultured by spraying the sensor cell culture onto colonies formed from natural microorganisms or environmental samples comprising the same.
  • the sensor cells can be used immediately after thawing without storage after storage at low temperature.
  • the colony sensor cells after forming a colony by forming a colony on a culture medium containing tyrosine as a substrate, E. coli or Citrobacter prepundi or TPL, the colony sensor cells are sprayed and cultured, the sheet Fluorescence expressed by sensor cells in the vicinity of Lobacter Freundy or TPL producing E. coli was confirmed (FIG. 6D).
  • the nutrient may be glutamic acid, but is not limited thereto.
  • the phenol-tag substrate is designed according to the activity of the target enzyme in step (1).
  • the phenol-tag substrate includes a binding site that can be degraded by the activity of the enzyme of interest and phenol bound through the binding site.
  • the phenol-tag substrate by specifically designing the phenol-tag substrate to be suitable for the activity of the target enzyme, that is, by designing the binding site or functional group or the like in accordance with the activity of the enzyme to be searched, the microorganism which simply produces a phenolic compound.
  • the senor comprising the gene circuit in an environment in which a specific nutrient is deficient by treating the phenol-tag substrate to a natural microbial strain or an environmental sample including the same, which is expected to have a target enzyme in step (2). Incubate with cells. Since the genetic circuit introduced into the sensor cell contains the DAAT gene, even if the sensor cell is placed in an environment that is a trophogenic strain and lacks nutritional substances, the DAAT gene is expressed in the introduced genetic circuit. If you can, you can survive.
  • step (3) the sensor cell in which the expression of the reporter protein is induced by the phenolic compound produced by the activity of the target enzyme is identified and selected. If the target enzyme is present in a natural microorganism strain or an environmental sample containing the same, a phenolic compound will be produced by the activity of the target enzyme when the phenol-tag substrate designed as described above is treated, and the phenolic compound thus produced. Since the compound will induce the expression of the reporter protein in the sensor cell in the vicinity of the natural microorganism strain or the environmental sample containing the same, it is possible to search for a novel strain having the target enzyme by confirming the expression of the reporter protein as described above. .
  • step (4) the microbial strain adjacent to the sensor cell from which the expression of the reporter protein selected as described above is induced is isolated.
  • the microbial strain isolated as described above has a target enzyme.
  • the isolated microbial strain can be verified once again whether there is actually the activity of the target enzyme, 16s rRNA analysis can be identified which bacteria to the isolated microbial strain.
  • the timing of substrate addition can be controlled to separate the activation stages of the cell growth-redesigned genetic circuit in order to optimize the enzymatic reaction.
  • Compounds capable of producing phenolic compounds by enzymatic reactions include esters (-, -OOC-) and ethers (ether, -OC-) modified with phenolic hydroxyl groups (hydroxy, -OH).
  • Glycoside (-O-Glc), phospho-ester (-O-PO3), ortho-, meta-, para- position alkyl (-CH 3 ), hydroxyl (-OH), car Compound (-COOH), amino (-NH 2 ), thiol (-SH), amide (amide, -NH-CO- or -CO-NH-), sulfide (-S-SH), halogen group (- Phenol derivatives or benzene ring compounds in which Cl, -Br, and -F) are introduced, but are not limited thereto.
  • ester compound ester, -OOC-
  • ether compound ether, -OC-
  • glycoside compound glycoside, -O
  • esterase lipase
  • glycosidase glycosidase
  • phosphatase pita It can be used for the purpose of detecting phytase activity.
  • the phenol-tag substrate is a new methyl group (-CH 3 ), hydroxyl group (-OH), carboxyl (-COOH), amino group (-NH 2 ), hydrogen sulfide in one position of ortho-, meta-, para- It may be a material prepared by introducing (-SH).
  • the phenolic compound linked through the amide group is amidase, pep It can be used for the purpose of detecting peptidase activity, and by using a phenol compound linked through a sulfide group, it can be used for the purpose of detecting intracellular redox levels.
  • a phenol compound linked to a new carbon bond ie, Ph-C- (R)
  • Ph-C- (R) Ph-C- (R)
  • Benzene ring material may be used as the phenol-tag substrate, and in this case, oxidase activity such as monooxygenase and dioxygenase, which are involved in the oxidation of aromatic compounds, may be detected.
  • Phenolic compounds bound to halogen such as chlorine (Cl), bromine (Br) and fluorine (F) may also be used as the substrate.
  • halogen such as chlorine (Cl), bromine (Br) and fluorine (F)
  • enzymatic activity of dehalogenation or isomerization that changes the position of halogen by acting on the above halogenated phenolic compound can be detected according to the present invention.
  • the activity of transferases that transfer covalent bonds to other organic molecules or syntheses that generate new covalent bonds can also be detected by the present invention. Therefore, using the various phenol-tag substrates presented in the present invention, specific hydrolase, oxido-reductase, isomerase, lyase, transfer Enzymes can be detected.
  • the substrate used for detecting the enzyme activity in the cell is a phenol-tag substrate, and represents various synthetic substrates including phenol, o / p-nitrophenol, o / p-chlorophenol and the like.
  • the phenolic material is produced from the original phenol-tag substrate. For example, when E. coli ⁇ -galactosidase (lacZ) acts on phenyl- ⁇ -glucoside, a phenol component is produced according to the enzyme activity.
  • an enzyme gene when introduced into a sensor cell containing a gene circuit for detecting a phenolic compound, and a phenol-tag substrate is treated to a microbial strain retaining the activity of a target enzyme,
  • concentration of the phenolic compound changes depending on the function and activity of the intracellular enzyme gene. Therefore, it is possible to easily identify microbial strains possessing the desired activity of the desired enzyme through the degree of reaction to fluorescence and nutrient composition by the expression-inducing function of the phenolic compound.
  • the fluorescent protein used as a reporter in the present invention and enzymes involved in nutritional urine composition can be applied not only to a high sensitivity measurement method, but also expressed in the cells because they are limited to specific cells without passing through the cell membrane. Individual characteristics of the foreign genes will be exercised. Therefore, since individual single cells serve as independent reactors and analyzers, a large amount of millions to tens of millions as a means of detecting the activity of expression-induced reporters by detecting phenolic compounds produced by enzymatic reactions. Samples may also be measured using a fluorescence flow cytometer (FACS), microcolony fluorescence image analysis, fluorescence spectrum analysis, mass screening using nutritional selection media.
  • FACS fluorescence flow cytometer
  • the gene circuit of the present invention and the sensor cell including the same include a fluorescent protein as a reporter gene together with related enzymes in nutritional components for controlling the survival of the sensor cell, the novel sensor having the activity of the sensor cell and the desired target enzyme
  • a fluorescent protein as a reporter gene together with related enzymes in nutritional components for controlling the survival of the sensor cell
  • the novel sensor having the activity of the sensor cell and the desired target enzyme
  • FIG. 1 is a schematic diagram showing the main configuration of the microbial prototyping-based enzyme gene screening system (MP-GESS) of the present invention.
  • MP-GESS microbial prototyping-based enzyme gene screening system
  • FIG. 2 is a schematic diagram showing an operation of the MP-GESS construct of the present invention.
  • Figure 3 is a graph showing the growth and fluorescence by phenol of the trophyotrophic host comprising the MP-GESS construct of the present invention.
  • FIG. 4A shows a system in which a phenolic compound inducing dmpR activation operates a GFP-coding gene or an antibiotic resistance gene
  • FIG. 4A (B) shows that a target enzyme in a cell produces phenol from a substrate molecule, DmpR is activated by phenol and indicates the expression of downstream GFP coding genes
  • 4B is a diagram illustrating the introduction of a D-AAT coding gene at the N-terminus of EGFP and transformation of this system with WM335, a D-glutamate trophic host, and FIG. 4B (B). Screening system based on cell-cell communication. Phenolic molecules are used not only as enzyme activity markers but also as signal transmitters, and phenol activates the transcription factor (dmpR) to induce the expression of D-AAT and GFP-coding genes.
  • dmpR transcription factor
  • 5 is a graph showing the extent of proliferation of transformants when antibiotic resistance genes or trophyotrophic genes are introduced into the phenotypic reporter.
  • Figure 6a shows a chemical reaction that shows the production of phenol, pyruvate and ammonia by the degradation of L-tyrosine by tyrosine-phenol lyase (TPL) enzyme.
  • Figure 6b shows two methods for detecting microorganisms with target enzyme activity using the sensor cells of the present invention.
  • 6c is a result of verifying activity of sensor cells confirmed based on a one-step protocol.
  • 6D is a result of verifying activity of sensor cells confirmed based on a two-step protocol.
  • Figure 7a shows a chemical reaction showing the production of p-nitrophenol and cellobiose by the degradation of pNPG2 by fibrinolytic enzymes
  • Figure 7b shows the process of searching for microorganisms having fibrinolytic activity in soil samples .
  • FIG. 8 is a photograph showing fluorescence images of four colonies isolated from soil from metagenome samples.
  • 9 is a graph showing fibrinolytic activity on various substrates of the seven candidate microorganisms selected.
  • Figure 11 shows the results of sequence similarity analysis with other strains by comparison of the whole strain of the ORF sequence.
  • FIG. 12 is a comparison of the functions of Pseudomonas fluorescence Pf0-1 strains found to be the most similar strains by sequence comparison analysis with new strains. It is a graph showing the top ten functions of the function (left) only in the strain (left) and the function (right) only in the Pseudomonas fluorescein Pf0-1 strain.
  • 13A and 13B are photographs showing images of Pseudomonas genus # 46-2 strains using a scanning electron microscope and a transmission electron microscope, respectively.
  • FIG. 14A shows the reaction of phenylphosphate to phenol and phosphate by phosphatase
  • FIG. 14B shows seven candidate microorganisms selected as sensor cells
  • FIG. 14C shows sensor cells as negative control.
  • FIG. 14D is a result of confirming the presence of sensor cells by PCR of 10 selected colonies of FIGS. 14B and 14C.
  • FIG. 15A shows green fluorescence and bright field images of 36 colonies selected using microscopic analysis with GFP filters after incubating soil samples and sensor cells using the two step protocol of Example 8, FIG. Specific enzyme activity of the candidate colonies in dogs was measured using their crude extracts.
  • Example 1 microbial prototyping-based enzyme gene screening system ( MP -GESS)
  • D-amino acid aminotransferase was added to the GESS gene construct using dmpR or dmpR variants, which are transcription regulators of Pseudomonas putida- derived phenol-degrading operons.
  • a dual reporter-type GESS construct was constructed using additional amino-acid aminotransferase (DAAT) gene. The DAAT gene is expressed in the presence of phenol.
  • DAAT additional amino-acid aminotransferase
  • glutamic acid was used auxotrophic E. coli (Escherichia coli, WM335) as a host cell of the MP-GESS construct.
  • FIG. 1 A schematic diagram of the MP-GESS configuration is shown in FIG. 1, and Table 1 shows the components of the MP-GESS and the characteristics of each configuration.
  • Transcription regulator dmpR or dmpR variants Pseudomonas Derived / Phenolic Compounds Reporter Protein DAAT, EGFP Host cell survival, fluorescence expression including MP-GESS Control part Electronic regulator coupling site Transcription Factor Binding / Reporter Expression Activation Promoter 1 Promoter for expression of transcriptional regulator (P X ) Transcription Factor Expression Promoter 2 Reporter Protein Expression Promoter (P R ) Reporter Protein Expression Ribosomal binding site RBS Promote reporter protein expression Transcription Terminator rrnBT1T2, tL3 (t) Warrior Termination Explode tag ssrA DAAT half-life adjustment
  • the operating aspect of the MP-GESS construct is shown in FIG. Specifically, the MP-GESS construct was introduced into glutamic acid trophic coliform to make sensor cells. Cultured sensor cells are cultured in a medium without glutamic acid, and if killed, cultivated with a phenol-producing strain and a phenol-degradable substrate is added, the phenol produced by the phenol-producing strain is used to control the MP-GESS. Since the DAAT gene of the truck expresses and the sensor cell survives, and the EGFP expresses and fluoresces, it is possible to search for a phenol-producing strain depending on the survival of the sensor cell.
  • the MP-GESS construct is the top of the N-terminus of pGESSv4 (ACS Synthetic Biology (2014) 3 (3): 163-167) or pGESS (E135K) (ACS Synthetic Biology (2014) 3 (3): 163-167) It can be produced by inserting the DAAT gene into.
  • the fragment of 6,185bp was amplified by PCR using pGESSv4 as a template and the following SEQ ID NO: 1 and SEQ ID NO: 2.
  • the DAAT gene was obtained by the following procedure. DNA of Bacillus subtilis 168 (Microorganism Resource Center, Korean Collection for Type Cultures) was used as a template, and after amplifying the PCR product of about 800 bp using the sequences of SEQ ID NO: 3 and SEQ ID NO: 4, The final 852 bp length PCR product was obtained by performing PCR once more using the 800 bp PCR product as a template and the sequences of SEQ ID NO: 5 and SEQ ID NO: 6 having homology with the vector pGESSv4.
  • the sequence of SEQ ID NO: 6 contains an ssrA tag (underlined) that controls the life of the DAAT.
  • the ssrA tag is a kind of destruction tag that can control the half-life of the protein when inserted into the C-terminus of the protein, and can control the half-life of the fluorescent protein in Escherichia coli or Pseudomonas.
  • SEQ ID NO: 7 AANDENYALAA amino acid sequence (ssrA tag; amino acid sequence corresponding to the underline of the sequence of SEQ ID NO: 6) by controlling the half-life of DAAT to reduce the non-specific response of MP-GESS.
  • the amplified and secured pGESSv4 vector and DAAT gene were cloned by Gibson assembly method (Gibson Assembly Master Mix, NEB, UK) to complete the production of MP-GESS construct.
  • the MP-GESS plasmid was transformed into E. coli WM335 strain.
  • Escherichia coli WM335 strain is a glutamic acid trophic strain and does not grow unless additional glutamic acid is added to the growth medium (Biosci Biotechnol Biochem. 1998 Jan; 62 (1): 193-5).
  • a single colony of Escherichia coli WM335 strain containing MP-GESS construct was added to LB medium and 0.1 mg / ml of D-glutamic acid, followed by shaking culture at 37 ° C. for 24 hours to be used as a seed.
  • M9 liquid medium ((1l Na 2 HPO 4 ⁇ 7H 2 O 6.78g, KH 2 PO 4 3g, NaCl 0.5g, NH 4 Cl 1g, 2mM MgSO 4 , 0.1 mM CaCl 2 , 0.4% (w / v) Glucose, 0.01% (w / v) thiamine is added to the suspension) to determine whether the reaction to phenol.
  • the glutamic acid trophic host cell into which the MP-GESS construct was introduced did not grow when glutamic acid was absent, but it was confirmed that fluorescence was expressed while growing only when the DAAT gene was expressed by phenol (FIG. 3). From the above results, it can be seen that glutamic acid trophic constituent host cells into which the MP-GESS construct of the present invention is introduced, that is, sensor cells, are viable by phenol.
  • Cm- (chloramphenicol) and Tc- (tetracycline) resistance genes were amplified by PCR from pACYC184 (New England Biolabs, Ipswitch, MA, USA), and the Km- (kanamycin) resistance gene was pET27b (EMD Millipore, Darmstadt, Germany). Amplified by PCR.
  • PGESSv4 a DmpR-based GESS plasmid (ACS Synthetic Biology (2014) 3 (3): 163-167), was used as a template, and SEQ ID NO: 10 (Vector-F1: aaggagatatacatatggtgagcaagggcg) and SEQ ID NO: 11 (Vector-R1: atgtatatctccttctccaggttggcggat) PCR was performed using the primers to amplify 6,185 bp fragments.
  • PGESS-Cm, pGESS-Tc, and pGESS-Km were introduced into the N-terminus of EGFP in the amplified antibiotic resistance gene using the same cloning method as in pGESS-DAAT of Example ⁇ 1-1>. Construct was constructed. Next, DH5 ⁇ Escherichia coli cells containing each plasmid were incubated overnight at 37 ° C., and the preculture was diluted 10 6 fold, with different combinations of phenol (1-1000 ⁇ M) and antibiotics (0, 10, 20). , And 30 ⁇ g / mL), and spread spread to LB-plate selection medium. pGESS-Tc was investigated for the detection of tyrosine phenolases.
  • DH5 ⁇ Escherichia coli cells comprising pGESS-Tc transformed with pHCEIIB-TPL were placed on LB solid medium containing 1 mM tyrosine, 10 ⁇ M PLP, 30 ⁇ g / mL tetracycline and incubated at 30 ° C. for 48 hours.
  • the cells with pGESS-Cm and pGESS-Tc increased the survival in proportion to the phenol concentration of the medium, showing very little viability in the absence of phenol (Fig. 5 (A), (B)) .
  • Cells with pGESS-Cm showed similar profiles as cells with pGESS-Tc, whereas cells transformed with pGESS-Km showed the lowest viability among the three tested strains (FIG. 5).
  • pGESS-Tc higher fluorescence intensity of colonies was observed at increased phenol concentrations.
  • Cells with pGESS-DAAT increased the number of colonies with increasing phenol concentration.
  • antibiotic resistance genes can be used to screen for microorganisms with specific enzymatic activity, but by adding antibiotic resistance genes as an additional reporter with green fluorescent protein, any metagenomic gene with antibiotic resistance activity can be expressed in sensor cell colonies. It can lead to formation, which can lead to false positive rates.
  • E. coli host-based metagenome screening it is not possible to grow natural microorganisms on plates containing antibiotics. Therefore, in order to screen microorganisms having a specific enzymatic activity in the metagenome microorganisms, it is more efficient to introduce a trophic constitutive gene as in Example ⁇ 1-2> rather than to use an antibiotic resistance gene. Additional experiments were performed using MP-GESS with genes encoding AAT and fluorescent reporters.
  • TPL tyrosin-phenol lyase
  • the MP-GESS vector is as shown in Example ⁇ 1-2> Introduced glutamic trophyotrophic Escherichia coli cells, ie, sensor cells, were cultured and cultured with 0.75% (w / v) agar solution, and placed in a solid medium in which TPL producing cells were grown. After culturing for 12 hours, survival and fluorescence expression of sensor cells into which MP-GESS constructs were introduced by fluorescence microscopy were observed (one-step protocol of FIG. 6B).
  • the treatment time of the sensor cells was the same as in Example ⁇ 2-1> except that the colony was formed after 12 hours of incubation with TPL-producing Citrobacter preoundi cells or TPL-producing E. coli (Fig. 6b two-step protocol).
  • Example 3> One-step protocol based microbial discovery: microbial discovery with fibrinolytic activity in soil samples Example ⁇ 1- 2> of Coculture with sensor cells and microorganisms to be searched)
  • Example 3 Whether or not the seven candidate microorganisms selected in Example 3 has fibrinolytic activity was confirmed using various substrates. After culturing the selected candidate microorganisms at 30 °C, and treated with celLyticB, lysozyme, DNase, respectively, the lysate was used as coenzyme solution. After reacting pNPG2 with pNPG3 (para-nitrophenyl cellotrioside) as a substrate for 2 hours at 45 ° C, the degraded pNP (para-nitrophenol) was measured at 405 nm at an optical density (Victor).
  • pNPG2 para-nitrophenyl cellotrioside
  • the negative control group was prepared by adding a substrate to the buffer without coenzyme solution, using no substrate (None) and nothing (NC) in each candidate microbial sample, and 0.02% c-tech as a positive control group.
  • PC no substrate
  • NC nothing
  • filter paper (1 ⁇ 3 cm), 1% (w / v) Avicel and 2% (w / v) CMC were also used as substrates.
  • Each reaction was carried out at 45 °C, after the enzyme reaction the sample was measured for activity by the DNS reducing sugar quantification method.
  • pNPG2, Avicel, and filter paper are substrates of exo fibrinase
  • pNPG3 are substrates of endo type fibrinase.
  • the # 25-1 and # 46-2 strains reacted with Avicel, and the activities against pNPG2 and pNPG3 were confirmed in samples except for the # 34-1 and # 46-1 strains.
  • the strain # 46-2 had a high activity on the filter paper, and because of this property may be useful for crystalline fiber breakdown (Fig. 9). From the above results, it was confirmed that the strain of the fibrinase activity can be searched by the E. coli WM335 strain containing MP-GESS sensor cell of the present invention.
  • Example 5 Example Identification of species of candidate microorganisms selected in 3
  • 16s rRNA analysis was performed to identify the microbial species of colonies selected in Example 4.
  • 16s rRNA sequencing was performed on 6 microbial resources except # 34-1 which were not cultured.
  • Table 2 shows the similarity results between each candidate microorganism and previously known microorganisms.
  • # 25-1 showed more than 97% similarity to Bacillus cereus ATCC14579 (T), and # 34-2 and # 46-1 showed more than 99% similarity to Pseudomonas thringiensis ATCC10792 It was analyzed.
  • # 46-2 which has a relatively high activity on the filter paper, it was analyzed to be 93% similar to Pseudomonas koreensis Ps 9-14 (T), confirming that strain # 46-2 was a novel microorganism. It was deposited in the microbial resource center with the accession number KCTC32541. Microorganisms # 25-2 and # 43 were found to be more than 98% similar to Pseudomonas koreensis Ps 9-14.
  • the sensor cell of the present invention MP-GESS-containing E. coli WM335 can be detected strains with fibrinolytic activity, the detected strains are similar to Bacillus cereus, Pseudomonas trigiensis, Pseudomonas corriensis, It was also found that new microorganisms with degrading activity could be explored.
  • Example 6 Example Of new microorganisms selected in 3 NGS Analysis, whole genome analysis and functional difference analysis with existing microorganisms
  • RAST is a tool that takes a continuation as an input value, estimates the ORF, and classifies / analyzes the function of the estimated ORF by a method called 'subsystem technique'. As of May 2015, it has 1,151 validated subsystems, which are divided into three levels with 27 categories. The function of the estimated ORF may belong to one or more subsystems. For strain # 46-2, subsystem classifications were defined in 2,941 ORFs, 52% of a total of 5,692 ORFs, with the remaining 48% not being subsystem classifications. Was not ORF. This ratio and the distribution of 2,941 subsystems are shown in FIG. The most common categories were amino acids and their derivatives, followed by carbohydrates, cofactors, vitamins, prosthetic groups and pigments.
  • strain # 46-2 shows the Genomic Coverage value obtained by dividing the number of identified genes by the total number of genes of each compared strain. It was confirmed that about 84% of the genes of P. fluorescence Pf0-1 were similar to strain # 46. Thus, the selected strain # 46-2 was found to be a novel microorganism with cellulase enzyme activity but different from the existing Pseudomonas species.
  • the novel strain # 46-2 which was selected as the E. coli WM335 strain containing MP-GESS, the sensor cell of the present invention, was found to be the most similar genus in P. koreensis sp. It was observed by electron microscopy to confirm whether or not.
  • # 46-2 strain was identified as the most similar genus (genus) in 16srRNA Analysis P. koreensis sp .
  • the phenotype with more flagella compared to that shown (Fig. 13). This is similar to that of P. koreensis Ps9-14 (T) with multiple flagella.
  • the microbial resources were rod-shaped and bulging, which is believed to produce polymer material due to the slime colony form.
  • Example 8 Microbial Screening Based on Two-Step Protocol: Screening of Microbes with Phosphatase Activity in Soil Samples (Example 1 after culturing microorganisms to detect enzyme activity, forming colonies Spraying sensor cells of -2)
  • phosphatase Since phosphatase has an activity of decomposing phenylphosphate into phenol and phosphate (FIG. 14A), microorganisms having phosphatase activity were searched using sensor cells.
  • the cultured sensor cells were centrifuged at 3000 rpm for 15 minutes and then washed by addition of 5 mL of dLB5. After one more wash step, the sensor cell had an OD 600 of about 1 before spraying. Thereafter, the sensor cells were sprayed onto a solid plate in which soil microorganisms formed colonies by using an atomizer. After 12 hours of incubation at 37 ° C., the sample was AZ100M fluorescence multi-zoom microscope (Nikon) equipped with a GFP filter. It was observed using. As expected from the TPL results, cyclic colonies that emit green fluorescence were formed around the edges of candidate colonies with phosphatase activity (FIG. 14B).
  • any soil microorganisms C8, C9 and C10 emit autofluorescence rather than contain sensor cells since the genes for the vectors contained in the sensor cells have not been amplified.
  • the two-step protocol is characterized by the size of colonies formed by sensor cells and metagenome microorganisms, and between the sensor cells and metagenome microorganisms in colony formation. The difference between can be clearly indicated, and thus, more effective guidelines can be suggested in selecting candidate microorganisms having target enzyme activity.
  • the seven selected colonies were further examined by 16s rRNA analysis. Seven colonies were floated on sterile toothpicks and streaked in dLB medium without substrate, phenol or D-glutamic acid. At this stage, the sensor cells naturally die off and single colonies were isolated for further 16s rRNA analysis. Table 3 shows the results of 16s rRNA analysis of each colony.
  • Aeromonas As a result, four types of genera, Aeromonas, Pseudomonas, Shewanella, and Escherichia, were identified from seven selected microorganisms. In particular, the genus Shewanella and Aeromonas have been identified in aquatic environments.
  • phosphatase Since phosphatase has an activity of decomposing phenylphosphate into phenol and phosphate, the cells selected by the sensor cells were recovered to confirm whether the selected cells have phosphatase activity.
  • the selected cells were recovered and suspended in 50 mM HEPES buffer (pH 7.5), and 0.1 mM phenylmethylsulfonyl fluoride (PMSF) was added as a protease inhibitor. Suspended cells were disrupted by sonication on ice (Fisher Scientific, Pittsburgh, Pa.). Cell debris was removed by centrifugation at 15,000 ⁇ g for 20 minutes at 4 ° C., and the supernatant was filtered through a 0.45- ⁇ m filter. Protein concentrations were quantified according to the methods described in Analytical Biochemistry 72, 248-254, Bradford.
  • PMSF phenylmethylsulfonyl fluoride
  • the catalytic activity of the crude extract was confirmed based on the amount of pNP released from 0.2 mL HEPES buffer (pH 7.5) containing 1 mM pNP-phosphate in a round bottomed 1.5-ml tube.
  • the crude extract enzyme reaction was carried out at 25 ° C. for 10 minutes and terminated by addition of 1 M Na 2 CO 3 .
  • the reaction solution was clarified by centrifugation at 16,300 ⁇ g for 15 minutes and the absorbance change was measured at 420 nm using Victor V Multilabel Plate Reader (PerkinElmer Life Sciences, Waltham, Massachusetts, USA).
  • One unit of enzyme was defined as the activity required to produce 1 nmol of pNP as product per minute under specific assay conditions.
  • FIG. 15A shows the phosphatase activity of crude extracts of 36 colonies selected.
  • 15B shows the phosphatase activity (U / mg) of the selected colonies with 16s rRNA analysis of the selected colonies.
  • Five major strains Shigella sonnei , Shigella flexneri , Rheinheimera tangshanensis , Rheinheimera soli , Escherichia fergusonii ) has been shown to exhibit a clear phosphatase activity in the range of 10-30 U / mg.
  • Shigella flexneri is one of the well-known sources of nonspecific acidic phosphatase of bacteria, which is used for the production of various phosphorylation products.
  • Rheinheimera soli is known to have weak enzymatic activity against acid phosphatase
  • Escherichia fergusonii has also been reported to have acidic phosphatase activity.
  • Shigella sonnei and Rheinheimera Since no information on phosphatase activity of tangshanensis has been published, Shigella sonnei and Rheinheimera Further studies of tangshanensis may reveal new phosphatase.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biomedical Technology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Plant Pathology (AREA)
  • Mycology (AREA)
  • Analytical Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Immunology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Physics & Mathematics (AREA)
  • Pathology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

본 발명은 페놀을 감지하여 발현되는 전사조절인자를 암호화하는 유전자 및 상기 전사조절인자에 의해 작동되는 하위 리포터 유전자를 포함하는 유전자 회로, 상기 유전자 회로를 포함하는 센서 세포, 및 상기 센서 세포와 페놀-태그 기질을 이용하여 자연계 시료에서 직접 목적 효소의 활성을 보유하고 있는 신규 미생물 균주 또는 유전자원을 감지 및 탐색하는 방법에 관한 것이다. 본 발명의 유전자 회로 및 이를 포함하는 센서 세포는 리포터 유전자로 형광 단백질과 함께 센서 세포의 생존을 제어하는 영양요구성에 관련 효소를 함께 포함하고 있으므로, 상기 센서 세포와 원하는 목적 효소의 활성을 갖고 있는 미지의 미생물 균주를 함께 배양하여 형광을 측정하는 간단한 방법으로 해당 목적 효소의 활성을 갖고 있는 신규한 미생물 균주 또는 유전자원을 용이하게 동정할 수 있고, 또한 이와 같은 이중 리포터 시스템을 도입함으로써 목적 효소의 활성 유무를 가시적으로 더욱 명확하게 확인할 수 있다. 또한, 자연계에서 직접 유용 자원을 탐색할 때 DNA 분리 및 라이브러리 구축 과정을 거치지 않고 항생제의 사용을 제한함으로써 목표 효소 유전자의 발현 가능성 및 실험의 용이성을 최대화하고 자연계 고활성 미생물을 직접 사용하므로써 재조합미생물에 의한 GMO/LMO 문제를 최소화할 수 있다.

Description

미생물 프로토타이핑 유전자 회로 기반 신규 미생물자원 탐색 시스템
본 발명은 세포내 효소활성 감지에 사용될 수 있는 "페놀계 화합물"이 포함된 기질, 페놀계 화합물을 감지하여 발현되는 전사조절인자를 암호화하는 유전자 및 상기 전사조절인자에 의해 작동되는 하위 리포터 유전자를 포함하는 유전자 회로, 상기 유전자 회로를 포함하는 센서 세포(sensor cell), 및 상기 센서 세포를 이용하여 목적 효소의 활성을 보유하고 있는 신규 미생물 균주를 센서 세포와 공배양하여 해당 활성을 직접 감지 및 탐색하는 방법에 관한 것이다.
최근 미생물 유전체 혹은 메타게놈(metagenome)으로부터 새로운 유전자원을 확보하거나, 기존 유전자의 활성을 개량하여 유용성이 높은 바이오촉매로 발전시키기 위하여 방향성 분자진화기술(directed evolution)을 적용하는 연구가 바이오산업기술의 중요 전략으로 부각되고 있으며, 이에 따라 극미량의 효소 활성을 고속으로 감지하는 새로운 고감도 탐지기술의 개발이 필요해지고 있다.
미생물유전체, 환경 DNA(메타게놈) 등 다양한 유전자원에서 새로운 효소 유전자를 획득하는 방법으로는 먼저 DNA 염기서열을 파악하여 PCR 반응을 수행하고, 증폭된 유전자를 획득하는 시퀀스기반 탐색기술(sequence-based screening)이 있다. 이 방법은 유전체 정보가 급증함에 따라서 활용성이 나날이 높아지고 있고, 원하는 유전자만 특이적으로 선별해 낼 수 있는 장점이 있지만, 목적 유전자의 염기서열에 대한 정확한 정보를 알고 있는 경우에만 사용이 가능하므로, 적용할 수 있는 대상이 유전자원의 일부로 국한되는 단점이 있다.
이에 반하여 유전자 기능, 즉 효소활성에 기초하여 유전자를 선별하는 활성기반 감지기술(function-based screening)도 널리 이용된다. 이 방법에 의한 효소활성의 탐색에는 토양, 하천, 공장폐수, 해수, 산림 등지의 환경시료에서 직접 미생물을 분리하는 방법이 주로 이용되어 왔으나, 실제 실험실에서 배양 가능한 미생물종은 자연계에 존재하는 미생물의 1% 미만으로 매우 적은 양에 불과하다. 최근에는 미생물을 배양하지 않고 환경시료에서 직접 DNA를 분리하여 메타게놈 라이브러리의 형태로 유전자원을 구축하는 전략이 활발히 시도되고 있다. 이에 따라 메타게놈 라이브러리에서 산업적으로 유용한 효소 활성을 직접적으로 감지하려는 탐색기술의 개발에 대한 관심도 매우 높아지고 있다.
효소활성의 고속 분석 기술에는 (1) 웰-플레이트(well-plate)를 이용하는 자동화 다중분석기술, (2) 고체 배지에서 발색 혹은 투명환(halo)을 관찰하는 방법, (3) 영양결핍 미생물을 이용하는 선택분리법 등이 주로 이용된다. 이들 방법은 효소의 실제적 활성에 근거하기 때문에 목적기능의 유전자를 명확하게 선별해 내는 장점이 있으나, 개별 효소활성에 부합하는 하나하나의 감지기술이 필요하므로 기술의 범용성에서 제약이 따르게 된다. 더구나 숙주세포에서 외래 유전자의 전사나 해독, 발현이 낮거나 단백질 접힘, 분비 등의 문제가 있는 경우에는 효과가 더욱 감소하게 된다. 실제로 신규 미생물유전체, 메타게놈 등 유전적 다양성이 높고, 유전자 특성이 알려지지 않은 유전자원으로부터 유래하는 신규 효소의 경우, 재조합 미생물에서의 발현 수준이 매우 낮으므로 이러한 고속분석법을 적용하기가 매우 어려워진다. 이에 따라 극미량 발현되는 효소의 활성조차도 고감도로 감지할 수 있는 새로운 고속탐색 기술의 개발이 지속적으로 요구되어 왔다.
한편, 페놀계 화합물을 검출하는 기술에 관한 연구가 알려져 있고(대한민국 등록특허공보 제10-0464068호), 또한 이를 이용하여 다양한 효소 활성의 탐색에 적용하는 연구에 대해서도 일부 진행되고 있으나(대한민국 공개특허공보 제10-2010-0131955호), 항생제 사용 및 DNA 분리, 라이브러리 구축 등의 문제로 인한 외래 세포 배양 및 유전자의 발현에 제약이 따르고 따라서 목적 효소의 활성을 보유하고 있는 신규한 미생물 균주를 간편하게 감지 및 탐색할 수 있는 방법에 대해서는 알려져 있지 않았다.
이에, 본 발명자들은 페놀에 의하여 그 발현이 유도되는 전사조절인자와 이 전사조절인자에 의하여 작동되는 하위 리포터 유전자로 구성된 유전자회로 및 이를 포함하는 센서 세포를 개발하였고, 자연계의 다양한 미생물에 존재하는 특정 목적 효소를 탐색하기 위해 해당 미생물의 DNA를 분리하여 라이브러리를 구축하는 대신에, 단순히 상기 센서 세포와 해당 미생물 혹은 자연계의 환경시료 자체를 항생제 없이 함께 배양하여 효소를 보유한 미생물 자원을 용이하게 확인 및 분리해 낼 수 있음을 밝힘으로써 본 발명을 완성하였다.
본 발명은 세포내 효소활성 감지에 사용될 수 있는 "페놀계 화합물"을 포함하는 기질, 페놀계 화합물을 감지하여 발현되는 전사조절인자를 암호화하는 유전자 및 상기 전사조절인자에 의해 작동되는 하위 리포터 유전자를 포함하는 유전자 회로, 상기 유전자 회로를 포함하는 센서 세포, 및 상기 센서 세포와 상기 페놀계 화합물을 포함하는 기질을 이용하여 목적 효소의 활성을 보유하고 있는 신규한 미생물 균주의 활성을 감지 및 탐색하는 방법을 제공하는 것을 목적으로 한다.
상기의 목적을 달성하기 위하여, 본 발명은 (1) 유전자 발현 조절 부위, 상기 유전자 발현 조절 부위에 의해 활성이 조절되는 제1 프로모터, 및 상기 제1 프로모터의 활성화에 의해 발현이 조절되고, 형광 단백질을 암호화하는 유전자 및 영양요구성(nutritional requirement, auxotrophic)에 관여하는 효소를 암호화하는 유전자를 포함하는 리포터 유전자;를 포함하는 제1 유전자 컨스트럭트; 및 (2) 제2 프로모터, 및 상기 제2 프로모터에 의해 발현이 조절되고, 페놀계 화합물이 존재하는 환경에서만 상기 유전자 발현 조절 부위에 결합하여 상기 제2 프로모터를 활성화시키는 전사조절인자의 유전자를 포함하는 제2 유전자 컨스트럭트;를 포함하는, 페놀계 화합물의 존재를 감지하기 위한 유전자 회로를 제공한다.
또한, 본 발명은 상기 유전자 회로를 포함하는 센서 세포를 제공한다.
또한, 본 발명은 상기 센서 세포와 세포내 효소활성 감지에 사용될 수 있는 "페놀계 화합물"을 포함하는 기질을 이용하여 목적 효소의 활성을 보유하고 있는 신규한 미생물 균주를 감지 및 탐색하는 방법을 제공한다.
이하, 본 발명을 상세히 설명한다.
본 발명은
(1) 유전자 발현 조절 부위, 상기 유전자 발현 조절 부위에 의해 활성이 조절되는 제1 프로모터, 및 상기 제1 프로모터의 활성화에 의해 발현이 조절되고, 형광 단백질을 암호화하는 유전자 및 영양요구성에 관여하는 효소를 암호화하는 유전자를 포함하는 리포터 유전자;를 포함하는 제1 유전자 컨스트럭트; 및
(2) 제2 프로모터, 및 상기 제2 프로모터에 의해 발현이 조절되고, 페놀계 화합물이 존재하는 환경에서만 상기 유전자 발현 조절 부위에 결합하여 상기 제2 프로모터를 활성화시키는 전사조절인자의 유전자를 포함하는 제2 유전자 컨스트럭트;를 포함하는,
페놀계 화합물의 존재를 감지하기 위한 유전자 회로를 제공한다.
본 명세서에 있어서, 달리 정의되지 않는 한, 본 명세서에서 사용된 모든 기술적 및 과학적 용어들은 본 발명이 속하는 기술분야의 통상의 기술자에 의해 통상적으로 이해되는 것과 동일한 의미를 갖는다. 일반적으로, 본 명세서에서 사용된 명명법 및 이하에 기술하는 실험 방법은 본 기술분야에서 잘 알려져 있고 통상적으로 사용되는 것이다.
본 발명은 유전자 회로를 이용하여 목적 효소 활성을 보유하고 있는 신규 미생물 자원을 자연계에서 직접 용이하게 확인 및 분리하는 기술(MP-GESS: Microbe prototyping based genetic enzyme screening system)에 관한 것이다.
본 발명에 있어서, "페놀계 화합물"은 세포내 효소활성 감지에 사용될 수 있는 기질로서, 페놀, 2-클로로페놀, 2-요오드페놀, 2-플로로페놀, o-크레졸, 2-에틸페놀, m-크레졸, 2-니트로페놀, 카테콜, 2-메톡시페놀, 2-아미노페놀, 2,3-디클로로페놀, 3-클로로페놀, 2,3-디메틸페놀, 3-니트로페놀, 4-클로로페놀, p-크레졸, 2,5-디클로로페놀, 2,5-디메틸페놀 등을 나타낸다. 이러한 "페놀계 화합물"을 포함하는 기질을 "페놀-태그 기질(phenol-tag substrate)"이라고도 한다.
본 발명에 있어서, 상기 리포터 유전자와 상기 리포터 유전자의 발현을 조절하는 제1 프로모터는 상호작동가능하게 연결되어 있는 것을 특징으로 한다.
본 발명에 있어서, 상기 전사조절인자가 결합하여 하류의 리포터 유전자의 발현을 유도하는 부위는 상기 전사조절인자가 결합하여 하류의 리포터 유전자가 발현될 수 있도록 리포터 유전자의 제1 프로모터를 활성화하는 것을 특징으로 한다.
본 발명에 있어서, 상기 페놀계 화합물을 인지하여 하류의 리포터 단백질의 발현을 유도하는 전사조절인자를 코딩하는 유전자와 상기 전사조절인자의 발현을 조절하는 제2 프로모터는 상호작동가능하게 연결되어 있는 것을 특징으로 한다.
본 발명에 있어서, "전사조절인자"는 바람직하게는 페놀계 화합물을 포함하는 기질의 분해효소의 발현을 조절하는 단백질로서, 페놀을 감지함으로써 페놀계 화합물 분해효소의 발현을 조절하는 프로모터를 작동시키고, 이러한 프로모터와 연결되어 있는 리포터의 발현을 유도하는 단백질을 나타낸다. 상기 "전사조절인자"에 관련하여, 페놀, 자일렌, 톨루엔, 벤젠 등 방향족 유기 화합물의 분해활성을 나타내는 유전자는 Pseudomonas 속과 Acinetobacter 속에서 주로 발견되고 있으며, 이들 유전자는 다유전자가 함께 발현되는 다기능 오페론으로 구성되어 있고, σ54 의존성 전사조절에 의하여 발현된다. 대표적인 전사조절인자로는 DmpR, DmpR 변이체, XylR, MopR, PhhR, PhlR, TbuT 등이 알려져 있고, 이 중 Pseudomonas putida에서 페놀 분해대사에 관여하는 DmpR과 톨루엔과 자일렌 분해 대사에 관여하는 XylR이 가장 잘 알려져 있다. 특히 자연환경에 오염된 톨루엔이나 자일렌, 혹은 페놀을 검출하기 위하여 DmpR이나 XylR을 이용하는 연구는 미생물 바이오센서라는 개념으로 많이 연구되고 왔다. 이러한 NtrC family 발현조절인자는 페놀, 자일렌 같은 활성화인자를 인식하는 도메인(A 도메인)과 ATPase 활성을 가지고 있는 도메인(C 도메인), 그리고 DNA에 결합하는 기능을 하는 도메인(D 도메인)들의 조합으로 구성된다. 따라서 페놀 분자가 없을 때에는 A 도메인이 전사를 저해하지만, 페놀 분자가 결합하여 A 도메인을 억제하면 C와 D 도메인에 의한 전사활성화 기능이 나타나게 된다. 최근에는 A 도메인의 특이성을 이용하여 새로운 물질의 감지에 이용하는 연구 및 유전공학적 방법을 통하여 특이성을 개량 연구도 알려지고 있다.
따라서, 본 발명에서 바람직하게 사용되는 전사조절인자는 P. putida 유래 페놀 분해 오페론의 조절 단백질인 dmpR, 또는 이의 변이체일 수 있다. dmpR은 페놀, 자일렌, 톨루엔, 벤젠 등 방향족 유기 화합물의 분해활성을 나타내는 dmp 오페론 유전자의 σ54 의존성 전사활성조절 부분이다. P. putida 유래 dmp 오페론은 15개의 유전자로 구성되어 있으며, 이 중에서 dmpKLMNOP는 phenol hydroxylation에 필요한 효소들을 코드하고, dmpQBCDEFGHI는 catechol 중간물질을 분해하는 meta 분해경로의 효소들을 코드한다. dmpKLMNOP 오페론의 발현은 σ54 의존성 전사조절인자인 dmpR이 dmpK 상위의 dmp 오퍼레이터에 결합하여 활성화되며, dmpR 자체에 대한 전사조절인자는 σ70 의존성으로 알려져 있다. 또한, 상기 dmpR의 변이체는, 예컨대, dmpR 아미노산 서열의 135번째 E가 K로 변이된 E135K, 이 외에도, E172K, D135N, D135N 및 E172K, F65L, L184I, F42Y, R109C, L113V, D116N, F122L, K6E 및 F42S, Q10R 및 K117M, Q10R, D116G 및 K117R, D116V의 하나 이상이 아미노산 잔기가 돌연변이된 변이체일 수 있으나 이에 한정되는 것은 아니며, 상기 변이체는 페놀계 화합물에 대한 친화도가 크므로, 이들 위치 또는 주변부에서의 단일, 또는 다중 변이를 포함한 다양한 변이체들, 이 외에도 다양한 dmpR의 변이체들도 본 발명의 범위에 포함될 수 있다.
본 발명에서, "유전자 발현 조절 부위"란, 유전자 회로 전체를 조절하는 부위이다. 상기 전사조절인자는 페놀 분자가 없을 때에는 A 도메인이 전사를 저해하지만, 페놀 분자가 결합하여 A 도메인을 억제하면, C와 D 도메인에 의한 전사활성화 기능이 나타나게 되어 OpR(Operator for Reporter) 부위에 결합하며, 이것은 σ54 의존성으로 그 활성이 조절된다.
본 발명에 있어서, "프로모터"는 전사조절인자의 발현을 조절하는 프로모터 또는, 리포터 단백질의 발현을 조절하는 프로모터를 의미하며, 예를 들어 Pseudomonas의 dmpR 또는 dmp 오페론의 프로모터나 일반 단백질 발현용 프로모터가 사용될 수 있고, 외래 단백질의 고발현용으로는 trc, T7, lac, ara 프로모터를 비롯한 고발현 프로모터가 사용될 수 있으며, 특히 inducer가 필요없는 항시 고발현 벡터인 Phce가 사용될 수 있다. 예를 들면, 상기 리포터 단백질의 발현을 조절하는 프로모터로는 E. coli의 σ54-의존성 프로모터(PECO) 등이 사용될 수 있다. 이것 외에도, MP-GESS의 숙주에 따라 Pseudomonas putida(PPPU), yeast(PYST) 등에도 적용하는 것은 당업자에 자명할 것이다.
본 발명에 있어서, 상기 유전자 회로는, 상기 프로모터뿐만 아니라, 바람직하게는, 리포터 단백질의 발현을 용이하게 해주는 RBS(Ribosome Binding Site) 및/또는 전사종결인자를 포함할 수 있다. 즉, 상기 조절 단백질의 발현을 조절하는 부위로써, 상기 프로모터 이외에도 RBS 및/또는 전사종결인자를 포함할 수 있다.
일반적으로 단백질의 발현은 mRNA에서 개시코돈인 AUG(메티오닌) 혹은 GUG(발린)에서 시작하는데, 리보좀이 단백질 내부의 잔기에 위치한 AUG 혹은 GUG와 단백질 개시코돈으로서의 AUG와 GUG의 구분은 DNA의 퓨린 염기가 풍부한 RBS (또는 샤인-달가노 연속부분; Shine-Dalgarno (SD) sequence)에 의하여 결정되며 이 RBS는 종마다 서열이 차이가 나는 것으로 알려져 있다. 본 발명의 바람직한 구현예에 따르면, 본 발명에서 구축한 유전자 회로는 Pseudomonas의 전사조절인자를 사용하고 있는데, 유전자 회로의 숙주인 대장균과는 생존 형태가 많이 다를 뿐만 아니라 σ54 의존성 유전자 발현의 경우에는 σ54 결합부위나 σ54 인자 자체가 대장균과 많이 다르기 때문에 Pseudomonas의 RBS(RBSPPU), 또는 숙주인 대장균에서 리포터 단백질의 발현을 용이하게 하기 위하여 대장균용 RBS(RBSε), 또는 모든 균주에 통합적으로 사용가능한 RBS(RBSx)를 사용할 수 있다.
본 발명에 있어서, 상기 전사종결인자는, 바람직하게는, rrnBT1T2 또는 tL3일 수 있고, 이것 이외에도 본 기술분야에서 통상적으로 사용되는 임의의 전사종결인자를 사용하여 본 발명을 구성할 수 있다.
본 발명에 있어서, 리포터 단백질은 형광 단백질 및 영양요구성에 관여하는 효소로 이루어진다. 형광 단백질로는 바람직하게 GFP, GFPUV, 또는 RFP를 사용할 수 있으나, 본 발명의 목적을 달성할 수 있는 한 본 발명에 사용할 수 있는 형광 단백질은 이러한 예에 한정되는 것은 아니다. 또한, 상기 영양요구성에 관여하는 효소는 돌연변이에 의해 미생물이 어떤 특정한 아미노산·핵산염기·비타민류 등의 합성 능력을 잃게 되어 배지에서는 생육하지 못하고 이에 따라 자기가 합성하지 못하는 성분을 생육에 필요한 양분으로 요구하게 되는 영양요구주(auxotroph)가 해당 결핍된 물질을 합성할 수 있도록 하는 효소를 나타낸다. 이러한 영양요구성의 돌연변이로서는 아르기닌 요구성·메티오닌 요구성·티민 요구성 등을 포함하는 다수의 종류가 있으나 이에 한정되는 것은 아니다. 또한, 동일한 아르기닌 요구성이라 하더라도 아르기닌 생합성 경로의 저지 단계에 따라 ① 아르기닌만으로 생육되는 것, ② 아르기닌 대신에 시트룰린으로도 생육되는 것, ③ 아르기닌·시트룰린·오르니틴으로 생육되는 것 등 여러 종류가 생길 수 있다. 본 발명의 바람직한 구현예에 따르면, 상기 영양요구성에 관여하는 효소로는 글루탐산 영양요구성 미생물을 글루탐산이 결핍된 환경에서도 생존할 수 있도록 하는 DAAT(D-amino acid aminotransferase) 효소를 들 수 있으나 이에 한정되는 것은 아니다.
본 발명의 바람직한 구현예에 따르면, 리포터는 형광 단백질과 영양요구성에 관여하는 효소 모두로 구성된 이중 리포터(dual reporter), 둘 이상의 리포터로 구성된 다중 리포터일 수 있다. 본 발명에 따르면, 메타게놈 라이브러리와 페놀 감지 재설계 유전자 회로를 적합한 미생물 숙주내로 순차적 형질전환시키는데 있어서 공지된 임의의 방법을 이용할 수 있다. 형질전환의 효율을 높이기 위해서, 바람직하게 전기천공법을 사용할 수 있다.
또한, 본 발명은 상기 유전자 회로를 포함하는 센서 세포를 제공한다.
본 발명에 있어서, 상기 유전자 회로는 벡터 또는 상기 벡터를 포함하는 미생물의 형태로 제공될 수 있다.
본 발명에 있어서, 상기 세포는 바람직하게는 임의의 세균, 예컨대 대장균, 진균, 예컨대 효모, 식물세포, 동물세포 등일 수 있으나 이에 한정되는 것은 아니다.
상기 대장균은 영양요구성 숙주세포일 수 있고, 바람직하게는 글루탐산 영양요구성 숙주세포일 수 있으나, 이에 한정되는 것은 아니다.
또한, 본 발명은 상기 센서 세포를 이용하여 목적 효소의 활성을 보유하고 있는 신규한 미생물 균주를 감지 및 탐색하는 방법을 제공한다.
상기 방법은
(1) 목적 효소의 활성에 의해 페놀계 화합물이 생성될 수 있는 페놀-태그 기질을 설계하는 단계;
(2) 목적 효소를 보유하고 있는 것으로 예상되는 자연계 미생물 균주 또는 이를 포함하는 환경 시료에 상기 페놀-태그 기질을 처리하여 특정 영양물질이 결핍된 환경 하에서 센서 세포와 함께 배양하는 단계;
(3) 상기 배양된 센서 세포들 중에서 리포터 단백질이 발현되는 것들을 확인 및 선별하는 단계; 및
(4) 상기 선별된 센서 세포에 인접한 미생물 균주를 분리하는 단계;를 포함한다.
상기 단계 (2)는, 상기 목적 효소를 보유하고 있는 것으로 예상되는 자연계 미생물 균주 또는 이를 포함하는 환경 시료를 상기 페놀-태그 기질 및 상기 센서 세포와 혼합하여 함께 공배양할 수 있다.
또는 상기 단계 (2)는, 상기 목적 효소를 보유하고 있는 것으로 예상되는 자연계 미생물 또는 이를 포함하는 환경 시료에 상기 페놀-태그 기질이 처리된 환경에서 배양하여 콜로니를 형성하는 단계; 및 상기 형성된 콜로니와 상기 센서 세포를 함께 공배양하는 단계;를 포함할 수 있다. 상기 센서 세포는 센서 세포 배양액을 자연계 미생물 또는 이를 포함하는 환경 시료로부터 형성된 콜로니에 스프레이하여 공배양될 수 있다.
상기 센서 세포는 저온에서 보관한 후에 배양 과정 없이 해동시켜서 바로 사용할 수 있다.
본 발명의 한 구현예에 있어서, 시트로박터 프레운디 세포 또는 TPL 생산 대장균을 기질인 티로신 및 상기 센서 세포와 함께 배양하면, 상기 시트로박터 프레운디 또는 TPL 발현 대장균에 존재하는 효소들의 활성에 의해 티로신으로부터 생성된 페놀계 화합물에 의해 상기 시트로박터 프레운디 또는 TPL 발현 대장균 주위의 센서 세포들에서 형광이 나타나는 것으로 확인되었다(도 6c).
마찬가지로, 본 발명의 다른 구현예에서, 시트로박터 프레운디 또는 TPL 생산 대장균을 기질인 티로신이 함유된 배지에 도말 배양하여 콜로니를 형성시킨 후, 상기 콜로니에 센서 세포를 분무하여 배양하면, 상기 시트로박터 프레운디 또는 TPL 생산 대장균의 주위에서 센서 세포들에 의해 발현된 형광이 확인되었다(도 6d).
본 발명에 있어서, 상기 영양물질은 글루탐산일 수 있으나 이에 한정되는 것은 아니다.
본 발명의 한 구현예에 따르면, 상기 단계 (1)에서 목적 효소의 활성에 따라 페놀-태그 기질을 설계한다. 예를 들면, 페놀-태그 기질은 목적 효소의 활성에 의해 분해될 수 있는 결합 부위와 상기 결합 부위를 통해 결합된 페놀을 포함한다. 상기와 같이, 페놀-태그 기질을 목적 효소의 활성에 적합하도록 특정하게 설계함으로써, 즉 탐색하고자 하는 효소의 활성에 맞추어 상기 결합 부위나 관능기의 종류 등을 설계하여, 단순히 페놀계 화합물을 생산하는 미생물뿐만 아니라, 다양한 활성을 가지는 목적 효소를 보유하고 있는 미생물의 탐색이 가능하다.
또한, 상기 단계 (2)에서 목적 효소를 보유하고 있는 것으로 예상되는 자연계 미생물 균주 또는 이를 포함하는 환경 시료에 상기 페놀-태그 기질을 처리하여 특정 영양물질이 결핍된 환경 하에서 상기 유전자 회로를 포함하는 센서 세포와 함께 배양한다. 상기 센서 세포에 도입되는 상기 유전자 회로에는 DAAT 유전자가 포함되어 있기 때문에, 상기 센서 세포가 영양요구성 균주이고 또한 영양 물질이 결핍된 환경에 놓여진다고 하더라도, 도입된 상기 유전자 회로에서 DAAT 유전자가 발현될 수만 있다면 생존할 수 있게 된다.
아울러, 상기 단계 (3)에서는 상기 목적 효소의 활성에 의해 생성된 페놀계 화합물에 의하여 리포터 단백질의 발현이 유도된 센서 세포를 확인 및 선별한다. 만약 자연계 미생물 균주 또는 이를 포함하는 환경 시료에 목적 효소가 존재하는 경우, 상기와 같이 설계된 페놀-태그 기질이 처리되었을 때 상기 목적 효소의 활성에 의해 페놀계 화합물이 생산될 것이고, 이렇게 생성된 페놀계 화합물은 상기 자연계 미생물 균주 또는 이를 포함하는 환경 시료의 주변에 있는 센서 세포에서 리포터 단백질의 발현을 유도할 것이므로, 상기와 같은 리포터 단백질의 발현을 확인함으로써 목적 효소를 가지는 신규한 균주의 탐색이 가능하다.
또한, 상기 단계 (4)에서는 상기와 같이 선별된 리포터 단백질의 발현이 유도되는 센서 세포에 인접한 미생물 균주를 분리한다. 상기와 같이 분리된 미생물 균주는 목적 효소를 보유하고 있는 것이다. 추가적으로, 상기 분리된 미생물 균주는 실제로 목적 효소의 활성이 있는지 다시 한번 검증할 수 있으며, 16s rRNA 분석을 하여 분리된 미생물 균주가 어떤 균에 해당하는지 확인할 수 있다.
또한, 효소반응을 최적화하기 위하여 세포 생장-재설계 유전자 회로의 활성화 단계가 분리되도록 기질 첨가 시기를 조절할 수 있다. 효소 반응에 의해 페놀계 화합물이 생성될 수 있는 화합물, 즉 페놀-태그 기질은 페놀 히드록실기(hydroxy, -OH)가 수식된 에스테르(ester, -OOC-), 에테르(ether, -OC-), 글리코사이드(glycoside, -O-Glc), 인산에스테르(phospho-ester, -O-PO3), 오르토-, 메타-, 파라- 위치에 알킬(-CH3), 히드록실(-OH), 카르복실(-COOH), 아미노(-NH2), 티올(-SH), 아마이드(amide, -NH-CO- 또는 -CO-NH-), 설파이드(sulfide, -S-SH), 할로겐기(-Cl, -Br, -F)가 도입된 페놀 유도체 또는 벤젠고리 화합물 등을 들 수 있으나 이에 한정되는 것은 아니다.
예를 들면, 본 발명에 따른 페놀-태그 기질로는 페놀기와 공유결합으로 연결된 다양한 페놀 유도체가 사용될 수 있다. 예를 들어 페놀의 히드록실기(hydroxy, -OH)를 수식하여 제조한 에스테르 결합물(ester, -OOC-), 에테르 결합물(ether, -OC-), 글리코사이드 결합물(glycoside, -O-Glc), 인산에스테르 결합물(phospho-ester, -O-PO3)을 기질로 이용하는 경우, 에스터라제(esterase), 리파제(lipase), 글리코시다제(glycosidase), 포스파타제(phosphatase), 피타제(phytase) 활성을 감지하는 목적으로 이용할 수 있다.
또한, 페놀-태그 기질은 오르토-, 메타-, 파라-의 한 위치에 새로운 메틸기(-CH3), 히드록실기(-OH), 카르복시길(-COOH), 아미노기(-NH2), 황화수소(-SH)를 도입하여 제조된 물질일 수 있다. 이 위치에 아마이드 결합(-NH-CO- 또는 -CO-NH-), 설파이드 결합(-S-SH)을 갖는 물질을 기질로 사용하면 아마이드기를 통하여 연결된 페놀 화합물은 아마이다제(amidase), 펩티다제(peptidase) 활성을 감지할 목적에 이용할 수 있으며, 설파이드기를 통하여 연결된 페놀 화합물을 이용하면 세포내 산화환원수준을 감지할 목적으로 이용할 수 있다. 또한, 페놀-태그 기질로 새로운 탄소결합이 연결된 페놀 화합물 즉, Ph-C-(R)이 이용되는 경우, 탄소 결합을 분해하여 페놀을 생성하는 페놀 리아제(phenol-lyase) 활성을 감지할 수도 있다. 페놀-태그 기질로는 벤젠고리 물질이 이용될 수도 있으며, 이 경우 방향족 화합물의 산화에 관여하는 모노옥시게나제(monooxygenase), 디옥시게나제(dioxygenase) 등의 산화효소 활성을 감지할 수 있다. 염소(Cl), 브롬(Br), 플루오르(F) 등 할로겐에 결합한 페놀 화합물도 기질로 이용될 수 있다. 이 경우 위 할로겐화 페놀 화합물에 작용하여 탈할로겐화(dehalogenation)하거나 할로겐의 위치를 바꾸는 이성질화(isomerization)하는 효소 활성이 본 발명에 따라 감지될 수 있다.
앞서 언급한 다양한 페놀계 화합물에서 공유결합을 다른 유기분자로 옮기는 전이효소(transferase)나, 새로운 공유결합을 생성하는 합성효소(ligase)의 활성도 동일한 원리에 의하여 본 발명에 의해 감지될 수 있다. 따라서, 본 발명에서 제시한 다양한 페놀-태그 기질을 이용하면, 세포내에 존재하는 특정 가수분해효소(hydrolase), 산화환원효소(oxido-reductase), 이성화효소(isomerase), 분해효소(lyase), 전이효소(transferase) 등을 감지할 수 있다. 본 발명에 있어서 세포내 효소활성 감지에 이용되는 기질은 페놀-태그 기질로서, 페놀, o/p-nitrophenol, o/p-chlorophenol 등을 포함하는 다양한 합성 기질을 나타낸다. 이러한 페놀-태그 기질에 적절한 효소가 작용하면 상기 페놀 물질이 원래의 페놀-태그 기질로부터 생성된다. 예를 들면, 페닐-β-글루코사이드에 대장균의 β-갈락토시다제(lacZ)가 작용하면 페놀 성분이 효소활성에 따라 생성된다.
본 발명의 한 구현예에 따르면, 페놀계 화합물을 감지하는 유전자 회로를 함유하는 센서 세포에 임의의 효소 유전자를 도입하고, 목적 효소의 활성을 보유하고 있는 미생물 균주에 페놀-태그 기질을 처리하면, 세포내 효소 유전자의 기능 및 활성도에 따라서 페놀 화합물의 농도가 변화하게 된다. 따라서, 페놀계 화합물의 발현유도 기능에 의한 형광, 영양요구성에 반응하는 정도를 통해 용이하게 원하는 목적 효소의 활성을 보유하고 있는 미생물 균주를 동정할 수 있게 된다.
또한, 본 발명에 있어서 리포터로 사용되는 형광 단백질 및 영양요구성에 관여하는 효소는 고도의 민감성 측정 방법을 적용할 수 있을 뿐만 아니라, 세포막을 통과하지 않고 특정세포 내부에 한정되므로 그 세포 내에서 발현되는 외래 유전자의 특성을 개별적으로 발휘하게 된다. 따라서, 개별적인 단일 세포(single cell)가 독립적인 반응조 및 분석기의 역할을 수행하게 되므로 효소반응에 의해 생성된 페놀계 화합물을 감지하여 발현이 유도된 리포터의 활성을 측정하는 수단으로 수백-수천만 개의 대량시료를 형광유세포분석기 (FACS), 미세콜로니 형광이미지분석, 형광스펙트럼분석, 영양요구성 선택배지를 이용한 대량탐색 등을 이용하여 측정할 수도 있다.
본 발명의 유전자 회로 및 이를 포함하는 센서 세포는 리포터 유전자로 형광 단백질과 함께 센서 세포의 생존을 제어하는 영양요구성에 관련 효소를 함께 포함하고 있으므로, 상기 센서 세포와 원하는 목적 효소의 활성을 갖고 있는 신규 미생물 자원 혹은 자연계의 환경 시료를 함께 배양하여 형성된 콜로니의 형광을 측정하는 간단한 방법으로 해당 목적 효소의 활성을 갖고 있는 신규한 미생물 균주를 용이하게 동정할 수 있고, 또한 이와 같은 이중 리포터 시스템을 도입함으로써 목적 효소의 활성 유무를 가시적으로 더욱 명확하게 확인할 수 있다. 뿐만 아니라, 자연계에서 직접 유용 자원을 탐색할 때 DNA의 분리, 라이브러리 구축 및 항생제 사용 등의 과정 없이 센서 세포와 공배양하여 탐색하는 것은 목표 효소의 발현 가능성을 최대화하고, 실험이 용이하며, 또한 자연계 고활성 미생물을 직접 사용하므로써 재조합미생물에 의한 GMO/LMO 문제를 피해갈 수 있는 유용한 기술이다.
도 1은 본 발명의 미생물 프로토타이핑 기반 효소 유전자 스크리닝 시스템(MP-GESS)의 주요 구성을 나타내는 개략도이다.
도 2는 본 발명의 MP-GESS 컨스트럭트의 작동 양상을 보여주는 개략도이다.
도 3은 본 발명의 MP-GESS 컨스트럭트를 포함하는 영양요구성 숙주의 페놀에 의한 성장 및 형광 정도를 보여주는 그래프이다.
도 4a의 (A)는 dmpR 활성화를 유도하는 페놀 화합물이 GFP-암호화 유전자 또는 항생제 내성 유전자를 작동시키는 시스템을 나타내고, 도 4a의 (B)는 세포 내의 표적 효소가 기질 분자로부터 페놀을 생산하고, 페놀에 의해 DmpR이 활성화되며 하류의 GFP 암호화 유전자를 발현시키는 것을 나타낸다. 도 4b의 (A)는 EGFP의 N-말단에 D-AAT 암호화 유전자를 도입하고, 이 시스템을 D-글루타메이트 영양요구성 숙주인 WM335로 형질전환시킨 것을 도식화한 것이고, 도 4b의 (B)는 세포-세포간 소통 기반의 스크리닝 시스템을 나타낸다. 페놀 분자는 효소 활성 표지로 이용되는 것뿐만 아니라 신호 송신기로서도 이용되며, 페놀이 전사인자(dmpR)을 활성하여 D-AAT 및 GFP-암호화 유전자의 발현을 유도하게 한다.
도 5는 표현형 리포터로 항생제 저항성 유전자 또는 영양요구성 유전자를 도입하였을 때, 형질전환체의 증식 정도를 나타내는 그래프이다.
도 6a는 TPL(tyrosine-phenol lyase) 효소에 의한 L-티로신의 분해에 의해 페놀, 피루베이트 및 암모니아가 생성되는 것을 보여주는 화학반응식을 나타낸 것이다.
도 6b는 본 발명의 센서 세포를 이용한 표적 효소 활성이 있는 미생물을 검출하는 두 가지 방법을 도시한 것이다.
도 6c는 1 단계(one-step) 프로토콜 기반으로 확인한 센서 세포의 활성 검증 결과이다.
도 6d는 2 단계(two-step) 프로토콜 기반으로 확인한 센서 세포의 활성 검증 결과이다.
도 7a는 섬유소 분해 효소에 의한 pNPG2의 분해에 의해 p-니트로페놀 및 셀로비오스가 생성되는 것을 보여주는 화학반응식을 나타낸 것이고, 도 7b는 토양 샘플에서 섬유소 분해효소 활성을 갖는 미생물을 탐색하는 과정을 나타낸다.
도 8은 메타게놈 샘플로부터 토양에서 분리한 4개의 콜로니의 형광 이미지를 보여주는 사진이다.
도 9은 선별된 7종의 후보 미생물들의 다양한 기질에 대한 섬유소 분해 활성을 보여주는 그래프이다.
도 10은 RAST 사이트 분석을 통한 신균주 서열 기반 ORF(open reading frame) 기능 분포를 나타낸다.
도 11은 신균주 전체 ORF 서열의 비교를 통한 다른 균주와의 서열 유사성 분석 결과를 나타낸 것이다.
도 12는 신균주와 서열 비교 분석을 통해 가장 유사한 균주로 밝혀진 슈도모나스 플루오르센스(Pseudomonas fluorescence) Pf0-1 균주와의 기능을 비교한 것으로서, 균주간 차이가 나는 유전자 기능을 탐색하기 위하여 #46-2 균주에만 존재하는 기능(왼쪽)과, 슈도모나스 플루오르센스 Pf0-1 균주에만 존재하는 기능(오른쪽)의 상위 10개 기능을 각각 나타낸 그래프이다.
도 13의 (A) 및 도 13의 (B)는 각각 주사형 전자현미경 및 투과형 전자현미경을 이용한 슈도모나스 속 #46-2 균주의 이미지를 보여주는 사진이다.
도 14a는 인산가수분해효소(phosphatase)에 의해 페닐포스페이트가 페놀 및 포스페이트로 분해되는 반응을 도시한 것이며, 도 14b는 센서 세포로 선별된 7개의 후보 미생물들을 나타내고, 도 14c는 음성 대조군으로서 센서 세포를 포함하지 않은 dLB 플레이트로부터 수집된 형광을 나타내는 3개의 콜로니를 나타낸다. 도 14d는 도 14b 및 도 14c의 선택된 10개의 콜로니를 PCR하여 센서 세포 존재 여부를 확인한 결과이다.
도 15a는 실시예 8의 2 단계 프로토콜을 이용하여 토양 시료와 센서 세포를 배양한 후, GFP 필터를 구비한 현미경 분석을 이용하여 선택된 36개의 콜로니의 녹색 형광 및 명시야 이미지를 나타내고, 15b는 36개의 후보 콜로니의 특이적 효소 활성을 그들의 조추출물을 이용하여 측정한 결과이다.
이하, 본 발명을 실시예 및 실험예에 의해 상세히 설명한다.
단, 하기 실시예 및 실험예는 본 발명을 예시하기 위한 것일 뿐, 본 발명의 내용이 하기 실시예 및 실험예에 의해 한정되는 것은 아니다.
< 실시예 1> 미생물 프로토타이핑 기반 효소 유전자 스크리닝 시스템( MP -GESS)
항생제 비의존적 신규 바이오부품 탐색 기술을 개발하기 위하여, 슈도모나스 푸티다(Pseudomonas putida) 유래 페놀 분해 오페론의 전사조절인자인 dmpR 또는 dmpR 변이체를 이용한 GESS 유전자 컨스트럭트에 D-아미노산 아미노트랜스퍼라제(D-amino-acid aminotransferase, DAAT) 유전자를 추가로 채용한 듀얼 리포터 형태의 GESS 컨스트럭트를 구축하였다. 상기 DAAT 유전자는 페놀의 존재시 발현하게 된다. 또한, 상기 MP-GESS 컨스트럭트의 숙주세포로서 글루탐산 영양요구성 대장균(Escherichia coli, WM335)을 이용하였다. MP-GESS 구성의 모식도는 도 1에 나타나 있으며, 하기 표 1에 MP-GESS의 구성 요소 및 각 구성이 가지는 특성을 나타내었다.
구성요소 명칭 특성
전사조절인자 dmpR 또는 dmpR 변이체 Pseudomonas 유래 / 페놀류 화합물 감지
리포터 단백질 DAAT, EGFP MP-GESS를 포함하는 숙주세포 생존, 형광 발현
조절부위 전자조절인자 결합부위 전사조절인자 결합 / 리포터 발현 활성화
프로모터 1 전사조절인자 발현용 프로모터 (PX) 전사조절인자 발현
프로모터 2 리포터단백질 발현 프로모터 (PR) 리포터단백질 발현
리보솜 결합 부위 RBS 리포터 단백질 발현 촉진
전사종결인자 rrnBT1T2, tL3 (t) 전사 종결
분해 태그(tag) ssrA DAAT의 반감기 조절
MP-GESS 컨스트럭트의 작동 양상은 도 2에 나타내었다. 구체적으로, 글루탐산 영양요구성 대장균에 상기 MP-GESS 컨스트럭트를 도입하여 센서 세포를 만들었다. 만들어진 센서 세포를 글루탐산이 없는 배지에서 배양시키면 사멸하게 되고, 만약 페놀을 만들 수 있는 균주와 배양하면서 페놀로 분해 가능한 기질을 첨가하면, 페놀 생산 균주에 의해 만들어진 페놀에 의해 센서 세포의 MP-GESS 컨스트럭트의 DAAT 유전자가 발현하여 센서 세포가 생존하고, 또 EGFP가 발현하여 형광을 나타내므로, 센서 세포의 생존 여부에 따라 페놀을 생산하는 균주의 탐색이 가능하게 된다.
<1-1> MP-GESS 컨스트럭트의 제작
MP-GESS 컨스트럭트는 pGESSv4(ACS Synthetic Biology (2014) 3(3): 163-167) 또는 pGESS(E135K)(ACS Synthetic Biology (2014) 3(3): 163-167)의 N-말단의 상부에 DAAT 유전자를 삽입하여 제작할 수 있다. 본 발명에서는 pGESSv4를 주형으로 하고, 하기 서열번호 1 및 서열번호 2의 서열을 이용하여 PCR함으로써 6,185bp의 절편을 증폭하였다.
상기 DAAT 유전자는 하기의 과정으로 얻었다. 바실러스 서브틸리스168(Bacillus subtilis 168)(미생물 자원센터, Korean Collection for Type Cultures)의 DNA를 주형으로 하고, 하기 서열번호 3 및 서열번호 4의 서열을 이용하여 약 800bp의 PCR 산물을 증폭한 후, 이 800bp PCR 산물을 주형으로 하고 상기 벡터 pGESSv4와 상동 서열을 가지는 서열번호 5 및 서열번호 6의 서열을 이용하여 PCR을 한 번 더 수행함으로써 최종 852bp 길이의 PCR 산물을 확보하였다. 특히, 서열번호 6의 서열은 DAAT의 수명을 조절해주는 ssrA tag(밑줄로 표시된 부분)을 포함하고 있다. ssrA tag은 분해 태그(destruction tag)의 일종으로 단백질의 C-말단에 삽입시 단백질의 반감기를 조절할 수 있고, 대장균이나 슈도모나스에서 형광 단백질의 반감기를 조절할 수 있다. 본 발명에서는 AANDENYALAA 아미노산 서열(서열번호 7)(ssrA tag; 서열번호 6의 서열의 밑줄에 해당하는 아미노산 서열)을 사용함으로써 DAAT의 반감기를 조절하여 MP-GESS의 비특이적 반응을 줄였다.
서열번호 1: 5'-atgtatatctccttctccaggttggcggat
서열번호 2: 5'-aaggagatatacatatggtgagcaagggcg
서열번호 3: 5'-atgttggaacaaccaataggagtcattgattc
서열번호 4: 5'-tcttttaatcggttcttgcagtgagatacatt
서열번호 5: 5'-atccgccaacctggagaaggagatatacatatgttggaacaaccaataggag
서열번호 6: 5'-cgcccttgctcaccatatgtatatctccttctaagctgctaaagcgtagttttcg tcgtttgctgctcttttaatcggtt
상기에서 증폭 및 확보한 pGESSv4 벡터와 DAAT 유전자를 Gibson assembly 방법(Gibson Assembly Master Mix, NEB, 영국)으로 클로닝하여 MP-GESS 컨스트럭트의 제작을 완성하였다.
<1-2> MP-GESS의 활성 검증
상기 실시예 <1-1>에서 제작한 MP-GESS 컨스트럭트의 활성을 검증하기 위하여 MP-GESS 플라스미드를 대장균 WM335 균주에 형질전환시켰다. 대장균 WM335 균주는 글루탐산 영양요구성 균주로서, 성장 배지에 글루탐산을 추가로 첨가하지 않으면 자라지 않는다(Biosci Biotechnol Biochem. 1998 Jan;62(1):193-5). MP-GESS 컨스트럭트를 포함하는 대장균 WM335 균주의 단일 콜로니를 LB 액체배지에 0.1㎎/㎖의 D-글루탐산을 첨가하여 37℃에서 24시간 진탕 배양한 후 종균으로 사용하였다. 상기 종균을 M9 액체 배지로 한 번 세척한 후, 다시 M9 액체 배지((1ℓ 속에 Na2HPO4·7H2O 6.78g, KH2PO4 3g, NaCl 0.5g, NH4Cl 1g, 2mM MgSO4, 0.1mM CaCl2, 0.4% (w/v) Glucose, 0.01% (w/v) thiamine이 첨가됨)에 현탁하여 페놀에 반응하는지를 확인하였다.
그 결과, MP-GESS 컨스트럭트가 도입된 글루탐산 영양요구성 숙주세포는 글루탐산이 없을 때에는 자라지 않지만, 페놀에 의하여 DAAT 유전자가 발현된 경우에만 성장하면서 형광이 발현됨을 확인하였다(도 3). 상기와 같은 결과로부터 본 발명의 MP-GESS 컨스트럭트가 도입된 글루탐산 영양요구성 숙주세포, 즉 센서 세포가 페놀에 의해 생존가능함을 알 수 있었다.
<1-3> pGESS-Cm/Tc/Km 컨스트럭트 제작 및 적합성 확인
GESS의 실용성을 촉진하기 위하여, 추가적인 생물 성분의 적합성이 조사되었으며, 표현형 리포터로서 항생제 내성 유전자 및 영양요구성 유전자를 이용하였다. 항생제 내성 유전자에 대해서는 DmpR-기반 GESS 플라스미드(ACS Synthetic Biology (2014) 3(3): 163-167)의 리포터 영역을 클로람페니콜(pGESS-Cm)-, 테트라시클린(pGESS-Tc)-, 및 카나마이신(pGESS-Km)-내성 유전자로 교체하였다(도 4의 (A)). 영양요구성 유전자에 대해서는 실시예 1-2의 MP-GESS 컨스트럭트를 이용하였다(도 4의 (D)).
Cm-(chloramphenicol) 내성 유전자 및 Tc-(tetracycline) 내성 유전자를 pACYC184 (New England Biolabs, Ipswitch, MA, USA)로부터 PCR로 증폭하였고, Km-(kanamycin) 내성 유전자를 pET27b (EMD Millipore, Darmstadt, Germany)로부터 PCR로 증폭하였다. DmpR-기반 GESS 플라스미드(ACS Synthetic Biology (2014) 3(3): 163-167)인 pGESSv4를 주형으로 하고, 서열번호 10( Vector-F1: aaggagatatacatatggtgagcaagggcg) 및 서열번호 11(Vector-R1: atgtatatctccttctccaggttggcggat)의 프라이머를 이용하여 PCR하여 6,185bp의 절편을 증폭하였다. 상기 항생제 내성 유전자를 증폭한 pGESSv4 벡터 내의 EGFP의 N-말단에 상기 실시예 <1-1>의 pGESS-DAAT에서와 동일한 클로닝 방법을 이용하여 도입하여 pGESS-Cm, pGESS-Tc, 및 pGESS-Km 컨스트럭트를 제작하였다. 다음으로, 각 플라스미드를 포함하는 DH5α 대장균 세포를 37℃에서 하룻밤 동안 배양하였고, 상기 전배양(preculture)을 106배로 희석하였으며, 상이한 조합의 페놀(1-1000μM) 및 항생제(0, 10, 20, 및 30 μg/mL)를 포함하는 LB-플레이트 선택 배지에 확산 도말(spread)하였다. pGESS-Tc는 티로신 페놀 분해효소의 탐지를 위해 조사하였다. pHCEIIB-TPL로 형질전환된 pGESS-Tc를 포함하는 DH5α 대장균 세포를 1mM 티로신, 10μM PLP, 30 μg/mL 테트라시클린을 포함하는 LB 고체 배지 위에 두었고, 30℃에서 48시간 동안 배양하였다.
그 결과, pGESS-Cm 및 pGESS-Tc을 가지는 각 세포가 배지의 페놀 농도에 비례하여 생존도가 증가하였으며, 페놀이 없을 때 아주 적은 생존도를 나타냈다(도 5의 (A), (B)). pGESS-Cm을 가지는 세포는 pGESS-Tc를 가지는 세포와 유사한 프로파일을 나타낸 반면에 pGESS-Km이 형질전환된 세포는 3가지 시험된 균주 중에서 가장 낮은 생존도를 나타내었다(도 5). pGESS-Tc의 경우에는 증가된 페놀 농도에서 콜로니의 형광 강도가 더 높게 관찰되었다. pGESS-DAAT를 가지는 세포는 페놀 농도의 증가에 따라 콜로니 수가 증가하였다.
이와 같이, 항생제 내성 유전자를 특정 효소 활성이 있는 미생물을 선별하는데 이용할 수 있지만, 녹색 형광 단백질과 함께 추가적인 리포터로 항생제 내성 유전자를 부가함으로써, 항생제 내성 활성이 있는 임의의 메타게놈 유전자가 센서 세포 콜로니의 형성을 유도할 수 있고, 이는 위양성율을 초래할 수 있다. 또한 대장균 숙주 기반 메타게놈 스크리닝과는 달리 항생제를 포함하는 플레이트에서 자연의 미생물을 성장시키는 것은 가능하지 않다. 따라서, 메타게놈 미생물들에서 특정 효소 활성이 있는 미생물을 선별하기 위해서는 항생제 저항성 유전자의 사용보다는 상기 실시예 <1-2>에서와 같이 영양요구성 유전자를 도입하여 하는 것이 효율적이므로, 본 발명자들은 D-AAT를 암호화하는 유전자와 형광 리포터를 가지는 MP-GESS를 이용하여 추가적인 실험을 진행하였다.
< 실시예 2> MP - GESS의 이종 간 효소 활성 검증
<2-1> 1 단계(one-step) 프로토콜 기반으로 효소 활성 검증
실시예 <1-1>에서 제조된 MP-GESS 컨스트럭트를 이용하여 종이 다른 미생물 사이에서도 효소 활성을 감지할 수 있는지 여부를 검증하기 위하여 TPL(tyrosin-phenol lyase) 효소를 이용하였다. TPL은 티로신을 분해하여 피루베이트, 암모니아 및 페놀을 생산하는 효소로서, TPL에 의하여 생성된 페놀이 본 발명의 MP-GESS를 활성화하여 형광 단백질이 발현되는지를 확인하였다(도 6a). 구체적으로, 기질인 티로신을 포함하고 있는 LB 고체 배지에 TPL를 생산하는 시트로박터 프레운디 세포 또는 TPL 생산 대장균을 도말하여 배양한 후, 실시예 <1-2>에서와 같이 MP-GESS 벡터가 도입된 글루탐산 영양요구성 대장균 세포, 즉 센서 세포를 제작하고 배양한 배양액을 0.75%(w/v) 아가(agar) 용액과 섞어 TPL 생산 세포가 자라고 있는 고체 배지에 넣은 후 37℃에서 배양하였다. 12시간 배양한 후 형광현미경으로 MP-GESS 컨스트럭트가 도입된 센서 세포의 생존과 형광 발현을 관찰하였다(도 6b의 one-step protocol).
그 결과, 음성 대조군인 TPL이 없는 대장균 세포(콜로니)의 주위에는 아무런 센서 세포가 존재하지 않았지만 시트로박터 프레운디 또는 TPL을 발현시킨 대장균의 주위에는 형광을 내는 센서 세포 콜로니들이 존재하는 것이 관찰되었다(도 6c). 상기 결과로부터 MP-GESS 컨스트럭트가 도입된 글루탐산 영양요구성 대장균이 동종인 대장균에서 발현하는 TPL에 의해서 뿐만 아니라 시트로박터 프레운디의 TPL 활성에 의해서도 생존가능하고 형광을 나타내는 것을 알 수 있었다.
<2-2> 2 단계(two-step) 프로토콜 기반으로 효소 활성 검증
센서 세포 처리 시기를 TPL을 생산하는 시트로박터 프레운디 세포 또는 TPL 생산 대장균을 도말하여 12시간 배양한 후 콜로니가 형성된 이후로 한 것 이외에는 실시예 <2-1>의 방법과 동일하게 하였다(도 6b의 two-step protocol).
그 결과, TPL 활성이 있는 대장균은 TPL 세포의 가장자리 주변에서 형광으로 분명하게 나타났고, 시트로박터 프레운디는 세포의 빠른 생장과 강한 TPL 활성으로 인해 센서 세포가 플레이트에 넓게 분포하고 있었으나, 시트로박터 프레운디가 없는 플레이트의 가장자리에서는 센서 세포가 생장하지 않고 형광을 나타내지 않았다(도 6d).
< 실시예 3> 1 단계(one-step) 프로토콜 기반의 미생물 탐색: 토양 샘플에서 섬유소 분해효소 활성을 갖는 미생물 탐색( 실시예 <1- 2>의 센서 세포와 탐색하고자 하는 미생물을 공배양)
섬유소 분해효소는 파라-니트로페닐 셀로비오사이드(para-nitrophenyl cellobioside, pNPG2)를 니트로페놀과 셀로비오스로 분해한다(도 7a). 실시예 <1-2>에서 제작된 MP-GESS 컨스트럭트가 도입된 대장균은 페놀 존재시 생존하여 형광을 나타내므로, 상기 MP-GESS가 도입된 대장균과 토양에서 유래하는 미생물을 공배양하여, MP-GESS가 도입된 대장균의 형광 발현 정도에 따라 토양에 존재하는 미생물 중 섬유소 분해효소 활성이 있는 미생물을 탐색할 수 있는지 여부를 확인하였다. 구체적으로, 대전 연구단지 인근 야산의 토양 샘플 1g을 100㎖ 1X PBS 버퍼에 0.1% 카르복실 메틸 셀룰로오스(Carboxyl methyl cellulose, CMC)를 첨가한 용액에 넣은 후, 25℃에서 2시간 동안 진탕 배양하여 토양 내 미생물의 양을 늘렸다(이하, '강화된 토양 샘플'로 기재함). 기질인 pNPG2가 100μM 포함된 1/10 희석된 LB 고체 배지에 실시예 <1-2>에서 제조한 MP-GESS 함유 대장균 WM335 5×104 세포와 함께 상기 강화된 토양 샘플 1㎖을 도말하였다. 30℃에서 12시간 정도 배양 한 후 형광현미경(Nikon)으로 관찰하여 MP-GESS 컨스트럭트가 활성화되어 형광을 내는 대장균 주변의 콜로니를 섬유소 분해 효소를 생산하는 후보 미생물로 판단하였다. 이 섬유소 분해 효소를 생산하는 후보 미생물을 분리하기 위하여 화염 살균한 칼로 해당 콜로니를 잘라내어 1/10로 희석된 LB 액체 배지에 현탁하여 기질이 포함되지 않은 고체 배지에 도말하거나, 기질이 없는 고체 배지에 선별 콜로니를 스트리킹하였다. MP-GESS 컨스트럭트를 함유하는 대장균은 기질이 없는 배지에서는 페놀을 생산하지 못하여 DAAT 유전자를 발현할 수 없어 성장할 수 없기 때문에, 이 과정에서 섬유소 분해 효소를 생산하는 후보 미생물을 분리해 낼 수 있었다(도 7b).
상기와 같은 과정으로, 토양 샘플에서 분리한 약 2,500개의 콜로니 중에서, 콜로니 주변에 형광이 관찰되는 #25, #34, #43, #46의 4종의 콜로니를 얻었으며(도 8), 이 4종의 미생물을 추가 분리 과정 중 표현형이 다른 3종이 추가로 발견되어 #25-1, #25-2, #34-1, #34-2, #43, #46-1 및 #46-2의 총 7종의 섬유소 분해 효소를 생산하는 후보 미생물 균주를 확보하였다.
< 실시예 4> 실시예 3에서 선별된 후보 미생물들의 섬유소 분해 활성 확인
실시예 3에서 선별된 7종의 후보 미생물들이 섬유소 분해 활성을 가지고 있는지 여부를 다양한 기질들을 이용하여 확인하였다. 선별한 후보 미생물들을 30℃에서 배양한 후, celLyticB와 lysozyme, DNase을 각각 처리하여 용해물을 조효소액으로 사용하였다. pNPG2와 pNPG3(para-nitrophenyl cellotrioside)를 기질로 하여 45℃에서 2시간 반응시킨 후, 분해된 pNP(para-nitrophenol)를 405nm에서 OD(optical density; Victor)를 측정하였다. 음성대조군으로는 조효소액 없이 버퍼에 기질을 넣은 것, 각 후보 미생물 샘플들에 기질을 넣지 않은 것(None), 및 아무것도 넣지 않은 것(N.C)을 사용하였고, 양성 대조군으로는 0.02% c-tech(창해에탄올, P.C)와 celEdx16(K.C Ko, et al. (20111) Appl. Microbiol. Biotechnol. 89, 1453-1462)을 사용하였다. 또한, 여과지(1×3㎝), 1%(w/v) 아비셀 및 2%(w/v) CMC도 기질로 이용하였다. 각 반응은 45℃에서 이루어지며, 효소 반응 후 샘플은 DNS 환원당 정량법으로 활성을 측정하였다. 상기 다양한 기질들 중에서 pNPG2, 아비셀, 여과지는 엑소(exo)형 섬유소 분해효소의 기질이고, pNPG3는 엔도(endo)형 섬유소 분해효소의 기질들이다.
반응 결과, 아비셀에 대하여는 #25-1과 #46-2 균주가 반응하였고, pNPG2와 pNPG3에 대한 활성은 #34-1, #46-1 균주를 제외한 시료에서 확인할 수 있었다. 특히, #46-2 균주는 여과지에 대한 활성이 높았으며, 이러한 특성이 있으므로 결정형 섬유소 분해에 유용하게 사용될 것 수 있다(도 9). 상기 결과로부터, 본 발명의 센서 세포인 MP-GESS 함유 대장균 WM335 균주로 섬유소 분해효소 활성이 있는 균주 탐색이 가능함을 확인하였다.
< 실시예 5> 실시예 3에서 선별된 후보 미생물의 종 확인
실시예 4에서 선별된 콜로니들의 미생물 종을 확인하기 위해 16s rRNA 분석을 수행하였다. 변이 영역(variable region)을 9개 포함하고 있는 세균의 16s rRNA의 염기서열을 분석하기 위하여 대장균의 16s rRNA 서열을 PCR 증폭할 수 있는 9F(서열번호 8)와 1512R(서열번호 9) 프라이머를 사용하였다. 분리한 7종의 미생물 자원들 중에서, 배양되지 않는 #34-1을 제외한 6종의 미생물 자원들에 대하여 16s rRNA 염기서열 분석을 수행하였다.
서열 8: 5'-agagtttgatcatggctcag
서열 9: 5'-tacggttaccttgttacgactt
표 2에 각 후보 미생물과 기존에 밝혀진 미생물들의 유사성 결과를 나타내었다.
후보 미생물 근접한 매치 유사성 (%)
#25-1 Bacillus cereus ATCC14579(T) 97.34
#25-2 Pseudomonas koreensis Ps 9-14(T) 99.13
#34-2 Bacillus cereus ATCC14579(T) 99.92
#43 Pseudomonas koreensis Ps 9-14(T) 98.87
#46-1 Bacillus cereus ATCC14579(T) 99.92
#46-2 Pseudomonas koreensis Ps 9-14(T) 92.77
그 결과, #25-1은 바실러스 세레우스(Bacillus cereus) ATCC14579(T)와 유사성이 97% 이상 나왔고, #34-2과 #46-1은 슈도모나스 트리지엔시스(Pseudomonas thringiensis) ATCC10792와 99% 이상 유사한 것으로 분석되었다. 여과지에 대한 활성이 비교적 높은 #46-2의 경우에는 슈도모나스 코리엔시스(Pseudomonas koreensis) Ps 9-14(T)과 93% 정도 유사한 것으로 분석되어, #46-2 균주가 신규 미생물인 것으로 확인되었으며, 기탁번호 KCTC32541로 미생물자원센터에 기탁하였다. #25-2와 #43 미생물들도 슈도모나스 코리엔시스(Pseudomonas koreensis) Ps 9-14과 98% 이상 유사한 것으로 분석되었다.
상기 결과로부터, 본 발명의 센서 세포인 MP-GESS 함유 대장균 WM335으로 섬유소 분해효소 활성이 있는 균주 탐색이 가능하고, 탐색된 균주는 바실러스 세레우스, 슈도모나스 트리지엔시스, 슈도모나스 코리엔시스와 유사성이 있으며, 섬유소 분해 활성이 있는 신규한 미생물도 탐색 가능함을 알 수 있었다.
< 실시예 6> 실시예 3에서 선별된 신규 미생물의 NGS 분석, 전체 유전체 분석 및 기존 미생물과의 기능 차이 분석
<6-1> 신규 미생물의 NGS 분석, 전체 유전체 분석
슈도모나스의 서열 비교 분석을 통한 새로운 균주 검증을 위해 #46-2 균주의 DNA를 추출해 두 번의 차세대 유전체 분석기술(Next Generation DNA sequencer, NGS)(Roche454)을 수행하였다. 총 리드(Read)의 개수는 1,192,651개이고, GS FLX 어셈블러로 찾아진 컨티그(Contig)는 총 625개였다. 평균 컨티그 사이즈는 10,059bp로 전체 약 6M의 길이를 가진 미생물임을 알 수 있었다. 이와 같이 확인된 컨티그를 기반으로 #46-2 지놈의 어노테이션(annotation) 분석을 위해서 온라인 툴 중 하나인 RAST(http://rast.nmpdr.org/rast.cgi)를 사용하였다. RAST는 컨티그를 입력 값으로 받아 ORF를 추정하고 '서브시스템 기술(subsystem technique)'라는 방법으로 추정된 ORF의 기능을 분류/분석하는 툴이다. 2015년 5월에 확인된 바로는 1,151개의 검증된 서브시스템을 가지고 있으며, 이들은 27개의 카테고리를 포함한 3단계 수준으로 구분되어 있다. 추정된 ORF의 기능은 하나 이상의 서브시스템에 속할 수 있는데 #46-2 균주의 경우 총 5,692개의 ORF 중 52%인 2,941개의 ORF에 서브시스템 분류가 정의되어 있었고, 나머지 48%는 서브시스템 분류가 되지 않은 ORF였다. 이러한 비율과 2,941개의 서브시스템 분포를 도 10에 나타내었다. 가장 많은 비율을 차지하는 카테고리는 아미노산과 이의 유도체였고, 그 뒤로 탄수화물, 보조인자(Cofactor), 비타민, 보결 원자단(Prosthetic Group) 및 색소가 많았다.
상기 과정을 통해 #46-2 균주의 다른 균주들과의 비교 분석을 위해서 예측된 ORF 서열 정보를 이용하여 NCBI의 Blast 분석을 수행하였다. Blastn 소프트웨어를 이용하여 총 5,754개의 ORF를 NCBI nt 데이터베이스에 얼라인(align)하였으며 evalue 10 이하의 히트(hit)들을 고른 결과 각 orf마다 평균 약 45개의 히트들을 찾아내었다. 이와 같이 확인된 히트 서열들의 유래 균주를 분석한 결과 가장 많은 빈도로 찾아낸 균주는 슈도모나스 플루오르센스 Pf0-1로 총 ORF 개수 5,754 중 4,829개의 유전자가 P. fluorescence Pf0-1 에 존재하는 유전자와 유사함을 확인하였다. 도 11은 확인된 유전자들의 개수를 각 비교된 균주의 총 유전자 수로 나눈 Genomic Coverage 값을 보여주는 것으로 P. fluorescence Pf0-1의 경우 약 84%의 유전자가 #46균주와 유사함을 확인하였다. 따라서, 선별된 #46-2 균주의 경우 셀룰라제 효소의 활성이 있으면서도 기존 슈도모나스 종과는 다른 신규 미생물임을 알 수 있었다.
<6-2> 기존 미생물과의 기능 차이 분석
#46-2 균주의 유전자 구성과 그 기능에 대한 분석을 위하여 앞서 가장 유사한 균주로 분석된 P. fluorescence Pf0-1 종과의 유전자 기능 및 서열 기반의 비교 분석을 수행하였다. RAST에서 제공하는 기능인 기능 기반 비교 툴을 이용하여 #46-2과 P. fluorescence Pf0-1의 구성 유전자들의 기능과 존재 유무를 서로 비교하고 그 결과를 파일 다운로드 받아 2차로 비교 분석을 수행하였다.
그 결과, 서브시스템 기반 분석된 전체 3480개의 유전자 중 두 균주가 기능을 공유하는 유전자는 3,142개이고 #46-2 균주에만 있는 유전자 기능은 168개, P. fluorescence Pf0-1에만 있는 유전자 기능은 170개로 확인되었다. 두 미생물 사이의 기능 차이는 도 12에 나타내었다. 상기 결과로부터 #46-2 균주와 서열상 가장 가까운 것으로 밝혀진 P. fluorescence Pf0-1 균주가 ORF 서열의 차이뿐만 아니라 그 기능에 있어서도 차이를 나타낼 수 있음을 확인하였다.
< 실시예 7> 실시예 3에서 선별된 신규 미생물의 전자 현미경 이미지 분석을 통한 형태 평가
본 발명의 센서 세포인 MP-GESS 함유 대장균 WM335 균주로 선별된 신규한 #46-2 균주가 세포 형태면에서도 가장 유사한 속(genus)으로 밝혀진 P. koreensis sp.와 유사한지 여부를 확인하기 위해서 전자 현미경으로 관찰하였다.
그 결과, #46-2 균주는 16srRNA 분석에서 가장 유사한 속(genus)으로 밝혀진 P. koreensis sp .에 비해서 더 많은 편모를 가진 표현형을 보였다(도 13). 이는 P. koreensis Ps9-14(T)가 다수의 편모를 갖는 특징과 유사하였다. 또한, 이 미생물 자원은 막대형이고 표면이 부푼듯한 모양이었는데 이러한 형태는 점액질의 콜로니 형태 때문으로 고분자 물질을 생산하는 것으로 생각된다.
< 실시예 8> 2 단계(two-step) 프로토콜 기반의 미생물 탐색: 토양 샘플에서 인산가수분해효소(phosphatase) 활성을 갖는 미생물 탐색(효소 활성을 탐색하고자 하는 미생물을 배양하여 콜로니를 형성시킨 후, 실시예 1-2의 센서 세포를 분무하는 방식)
인산가수분해효소는 페닐포스페이트를 페놀 및 포스페이트로 분해하는 활성이 있으므로(도 14a), 센서 세포를 이용하여 인산가수분해효소 활성이 있는 미생물을 탐색하였다.
대전 신탄진동의 강에서 1g의 토양을 채집하였고, 채집된 토양에 1× PBS 50mL을 첨가하였다. 24시간 후에 1000rpm에서 5분 동안 원심분리하여 상층액 10mL을 수득하였다. 수득한 1 mL의 토양 시료를 100 μM 페닐포스페이트를 함유하는 1/10 희석된 LB 배지에 평판 도말(spreading)하여 20℃에서 12시간 동안 배양하였다. 실시예 1-2에서 제조된 pGESS-DAAT를 가지는 WM335 세포인 센서 세포는 10 μM 페놀이 함유된 10 mL dLB 브로스에서 37℃에서 24시간 동안 별도로 배양하였다. 배양된 센서 세포를 3000 rpm에서 15분 동안 원심분리한 후, dLB5 mL를 첨가하여 세척하였다. 상기 세척 단계를 1회 더 실시한 후, 분무하기 전에 상기 센서 세포의 OD600을 약 1로 하였다. 그 후 상기 센서 세포를 토양 미생물이 콜로니를 형성한 고체 플레이트 위에 분무기를 이용하여 분무하였고, 37℃에서 배양기에서 12시간 배양 후, 상기 시료를 GFP 필터가 구비된 AZ100M fluorescence multi-zoom microscope (Nikon)를 이용하여 관찰하였다. TPL 결과에서 예측되는 바와 같이, 인산가수분해효소 활성이 있는 후보 콜로니의 가장자리 주변에서 녹색 형광을 방출하는 환형의 콜로니를 형성하였다(도 14b). 인산가수분해효소를 생산하는 7개의 후보 미생물 콜로니(배양하여 콜로니를 생성한 토양 미생물에 센서 세포를 분무한 경우, 도 14b)과 3개의 임의의 형광 콜로니(센서 세포 없이 토양 미생물만 배양한 경우, 도 14c)를 선택하여, 서열번호 12(MP-F1: tgaaacctgcagcaacagcatgcgttgttc) 및 서열번호 13(MP-R1: ggtgaacagctcctcgcccttgctcaccat)의 프라이머를 이용하여 PCR을 수행하였다. 그 결과, C7을 제외한 모든 콜로니가 센서 세포(MP-GESS를 가지는 세포)가 혼합되어 있는 것으로 확인되었다(도 14d). PCR 결과를 보았을 때, 임의의 토양 미생물들인 C8, C9 및 C10은 센서 세포에 포함되는 벡터에 대한 유전자가 증폭되지 않았으므로, 센서 세포를 함유한다기 보다는 자가 형광을 방출하는 것으로 추정된다. 상기 실시예 3의 1 단계(one-step) 프로토콜과 비교하여, 상기 2 단계(two-step) 프로토콜은 센서 세포와 메타게놈 미생물이 형성하는 콜로니 크기 및 콜로니 형성에 있어서 센서 세포와 메타게놈 미생물 사이의 차이점을 분명하게 나타낼 수 있으므로, 표적 효소 활성이 있는 후보 미생물을 선택함에 있어서, 더 효과적인 가이드라인을 제시할 수 있다.
상기 7개의 선택된 콜로니를 확인하기 위해 16s rRNA 분석으로 추가적으로 조사하였다. 7개의 콜로니를 멸균한 이쑤시개로 떠서 기질, 페놀 또는 D-글루탐산이 없는 dLB 배지에 획선 도말(streaking)하였다. 이 단계에서, 센서 세포는 자연적으로 소멸되며, 단일 콜로니는 추가적인 16s rRNA 분석을 위해 분리하였다. 표 3에 각 콜로니의 16s rRNA 분석 결과를 나타낸다.
No. Reference Strain Length Score Identification (%)
C1 NR _036911.2 Aeromonas media strain RM 16S ribosomal RNA gene, partial sequence 1503 2894 1469/1472 (99%)
C2 NR _024927.1 Pseudomonas migulae strain CIP 105470 16S ribosomal RNA gene, partial 1516 2866 1467/1474 (99%)
C3 NR _113578.1 Pseudomonas fragi strain NBRC 3458 16S ribosomal RNA gene, partial 1462 2876 1458/1461 (99%)
C4 NR _044863.1 Shewanella putrefaciens strain Hammer 95 16S ribosomal RNA gene 1504 2831 1461/1472 (99%)
C5 NR _044863.1 Shewanella putrefaciens strain Hammer 95 16S ribosomal RNA gene, 1504 2734 1406/1415 (99%)
C6 NR _074891.1 Escherichia coli O157:H7 str. Sakai strain Sakai 16S ribosomal RNA, 1542 2208 1318/1386 (95%)
C7 NR _108852.1 Shewanella seohaensis strain S7-3 16S ribosomal RNA gene, partial 1465 2036 1307/1399 (93%)
그 결과, 7개의 선택된 미생물로부터 4가지 유형의 속, 즉 Aeromonas, Pseudomonas, Shewanella, 및 Escherichia가 확인되었다. 특히 Shewanella 및 Aeromonas속은 수생 환경에서 확인되었다.
< 실시예 9> 후보 미생물의 인산가수분해효소 활성 확인
인산가수분해효소는 페닐포스페이트를 페놀 및 포스페이트로 분해하는 활성이 있으므로, 센서 세포에 의해 선별된 세포를 회수하여 선별된 세포가 인산가수분해효소 활성이 있는지 확인하였다.
선별된 세포를 회수한 후 50mM HEPES 버퍼(pH 7.5)에 현탁하였으며, 단백질 분해 효소저해제로서 0.1 mM 페닐메틸설포닐플루오라이드(phenylmethylsulfonyl fluoride, PMSF)를 첨가하였다. 현탁된 세포를 얼음에서 초음파 처리(Fisher Scientific, Pittsburgh, PA)로 붕괴하였다. 세포 잔해를 15,000 × g에서 20분 동안 4℃에서 원심분리하여 제거하였고, 상층액을 0.45-μm 필터로 여과하였다. 단백질 농도는 Bradford의 Analytical biochemistry 72, 248-254에 개시된 방법에 따라 정량하였다. 조추출물의 촉매 활성은 둥근 바닥 형태인 1.5-ml 튜브에서 1 mM pNP-포스페이트를 함유하는 0.2 mL HEPES 버퍼(pH 7.5)로부터 방출되는 pNP 의 양에 기초하여 확인하였다. 조추출물 효소 반응을 10분 동안 25℃에서 실시하였고, 1 M Na2CO3를 첨가하여 종료하였다. 반응 용액을 16,300 × g에서 15분 동안 원심분리하여 맑게 하였으며, Victor V Multilabel Plate Reader (PerkinElmer Life Sciences, Waltham, Massachusetts, USA)를 이용하여 420nm에서 흡광도 변화를 측정하였다. 효소의 한 단위는 특정한 분석 조건 하에서 분당 생산물로서 1 nmol의 pNP를 생산하는데 요구되는 활성으로 정하였다.
인산가수분해효소 양성 콜로니가 실제로 인산가수분해효소 활성을 가지는지 확인하기 위하여 4000개의 콜로니 중에서 36개의 콜로니를 선별하였다(도 15a). 선별된 36개 콜로니의 조추출물의 인산가수분해효소 활성을 확인하였다. 도 15b에 선별된 콜로니의 16s rRNA 분석 결과와 함께 선별된 콜로니의 인산가수분해효소의 활성(U/mg)을 나타내었다. 주요 5개 균주(Shigella sonnei , Shigella flexneri , Rheinheimera tangshanensis , Rheinheimera soli , Escherichia fergusonii) 는 10 내지 30 U/mg 범위의 분명한 인산가수분해효소 활성을 나타내는 것으로 확인되었다. Shigella flexneri는 잘 알려진 박테리아의 비특이적 산성 인산가수분해효소 공급원 중의 하나이고, 이 효소는 다양한 인산화 생산물의 제조에 사용되고 있다. Rheinheimera soli는 산성 인산가수분해효소에 대한 약한 효소 활성을 가지는 것으로 알려져 있고, Escherichia fergusonii는 또한 산성 인산가수분해효소 활성을 가지는 것으로 보고되었다. 하지만, Shigella sonneiRheinheimera tangshanensis의 인산가수분해효소 활성에 대한 정보는 발표된 바 없으므로, 이와 같은 결과로부터 상기 Shigella sonneiRheinheimera tangshanensis들에 대해서 추가적으로 연구할 경우에 새로운 인산가수분해효소를 찾을 수 있는 것을 알 수 있었다.
상기에서는 본 발명의 바람직한 실시예를 예시적으로 설명하였으나, 본 발명의 범위는 상기와 같은 특정 실시예에만 한정되지 아니하며, 해당 분야에서 통상의 지식을 가진 자라면 본 발명의 특허청구범위에 기재된 범주 내에서 적절하게 변경이 가능할 것이다.

Claims (18)

  1. (1) 유전자 발현 조절 부위, 상기 유전자 발현 조절 부위에 의해 활성이 조절되는 제1 프로모터, 및 상기 제1 프로모터의 활성화에 의해 발현이 조절되고, 형광 단백질을 암호화하는 유전자 및 영양요구성에 관여하는 효소를 암호화하는 유전자를 포함하는 리포터 유전자;를 포함하는 제1 유전자 컨스트럭트; 및
    (2) 제2 프로모터, 및 상기 제2 프로모터에 의해 발현이 조절되고, 페놀계 화합물이 존재하는 환경에서만 상기 유전자 발현 조절 부위에 결합하여 상기 제2 프로모터를 활성화시키는 전사조절인자의 유전자를 포함하는 제2 유전자 컨스트럭트;를 포함하는,
    페놀계 화합물의 존재를 감지하기 위한 유전자 회로.
  2. 청구항 1에 있어서,
    상기 페놀계 화합물은 페놀, 2-클로로페놀, 2-요오드페놀, 2-플로로페놀, o-크레졸, 2-에틸페놀, m-크레졸, 2-니트로페놀, 카테콜, 2-메톡시페놀, 2-아미노페놀, 2,3-디클로로페놀, 3-클로로페놀, 2,3-디메틸페놀, 3-니트로페놀, 4-클로로페놀, p-크레졸, 2,5-디클로로페놀 및 2,5-디메틸페놀로 이루어진 군으로부터 선택되는 유전자 회로.
  3. 청구항 1에 있어서,
    상기 전사조절인자는 DmpR, DmpR 변이체, XylR, MopR, PhhR, PhlR 및 TbuT로 이루어진 군으로부터 선택되는 유전자 회로.
  4. 청구항 3에 있어서,
    상기 DmpR 변이체는 DmpR 아미노산 서열에서 E172K, D135N, D135N 및 E172K, F65L, L184I, F42Y, R109C, L113V, D116N, F122L, K6E 및 F42S, Q10R 및 K117M, Q10R, D116G 및 K117R 및 D116V로 이루어진 군으로부터 선택되는 하나 이상이 아미노산 잔기가 돌연변이된 변이체인 유전자 회로.
  5. 청구항 1에 있어서,
    상기 영양요구성에 관여하는 효소는 DAAT(D-amino acid aminotransferase) 효소인 유전자 회로.
  6. 청구항 1에 있어서,
    상기 제1 및 제2 프로모터는 슈도모나스의 dmpR 또는 dmp 오페론의 프로모터, 일반 단백질 발현용 프로모터, trc 프로모터, T7 프로모터, lac 프로모터, ara 프로모터 및 σ54-의존성 프로모터(PECO)로 이루어진 군으로부터 선택되는 유전자 회로.
  7. 청구항 1에 있어서,
    상기 유전자 발현 조절 부위는 리포터 단백질의 발현을 용이하게 해주는 RBS(Ribosome Binding Site) 및 전사종결인자로 이루어진 군으로부터 선택되는 하나 이상의 인자를 추가로 포함하는 유전자 회로.
  8. 청구항 7에 있어서,
    상기 전사종결인자는 rrnBT1T2 또는 tL3인 유전자 회로.
  9. 청구항 1 내지 청구항 8 중 어느 한 항에 따른 유전자 회로를 포함하는 목적 효소를 보유하고 있는 신규한 미생물 균주의 감지 및 탐색용 센서 세포.
  10. 청구항 9에 있어서,
    상기 세포는 세균, 진균, 식물세포 및 동물세포로 이루어진 군으로부터 선택되는 목적 효소를 보유하고 있는 신규한 미생물 균주의 감지 및 탐색용 센서 세포.
  11. 청구항 10에 있어서,
    상기 세균은 대장균인 목적 효소를 보유하고 있는 신규한 미생물 균주의 감지 및 탐색용 센서 세포.
  12. 청구항 10에 있어서,
    상기 진균은 효모인 목적 효소를 보유하고 있는 신규한 미생물 균주의 감지 및 탐색용 센서 세포.
  13. (1) 목적 효소의 활성에 의해 페놀계 화합물이 생성될 수 있는 페놀-태그 기질을 설계하는 단계;
    (2) 목적 효소를 보유하고 있는 것으로 예상되는 자연계 미생물 균주 또는 이를 포함하는 환경 시료에 상기 페놀-태그 기질을 처리하여 특정 영양물질이 결핍된 환경 하에서 청구항 9의 센서 세포와 함께 배양하는 단계;
    (3) 상기 배양된 센서 세포들 중에서 리포터 단백질이 발현되는 것들을 확인 및 선별하는 단계; 및
    (4) 상기 선별된 센서 세포에 인접한 미생물 균주를 분리하는 단계;를 포함하는, 센서 세포를 이용하여 목적 효소를 보유하고 있는 신규한 미생물 균주를 감지 및 탐색하는 방법.
  14. 청구항 13에 있어서,
    상기 단계 (2)는, 상기 목적 효소를 보유하고 있는 것으로 예상되는 자연계 미생물 균주 또는 이를 포함하는 환경 시료를 상기 페놀-태그 기질 및 상기 청구항 9의 센서 세포와 혼합하여 함께 공배양하는 방법.
  15. 청구항 13에 있어서,
    상기 단계 (2)는, 상기 목적 효소를 보유하고 있는 것으로 예상되는 자연계 미생물 또는 이를 포함하는 환경 시료에 상기 페놀-태그 기질이 처리된 환경에서 배양하여 콜로니를 형성하는 단계; 및
    상기 형성된 콜로니와 상기 청구항 9의 센서 세포를 함께공배양하는 단계;
    를 포함하는 방법.
  16. 청구항 13 내지 청구항 15 중 어느 한 항에 있어서,
    상기 영양물질은 글루탐산인 방법.
  17. 청구항 13 내지 청구항 15 중 어느 한 항에 있어서,
    상기 페놀계 화합물은 페놀, 2-클로로페놀, 2-요오드페놀, 2-플로로페놀, o-크레졸, 2-에틸페놀, m-크레졸, 2-니트로페놀, 카테콜, 2-메톡시페놀, 2-아미노페놀, 2,3-디클로로페놀, 3-클로로페놀, 2,3-디메틸페놀, 3-니트로페놀, 4-클로로페놀, p-크레졸, 2,5-디클로로페놀 및 2,5-디메틸페놀로 이루어진 군으로부터 선택되는 방법.
  18. 청구항 13 내지 청구항 15 중 어느 한 항에 있어서,
    상기 페놀-태그 기질은 페놀 히드록실기(hydroxy, -OH)가 수식된 에스테르(ester, -OOC-), 에테르(ether, -OC-), 글리코사이드(glycoside, -O-Glc), 인산에스테르(phospho-ester, -O-PO3), 오르토-, 메타-, 파라- 위치에 알킬(-CH3), 히드록실(-OH), 카르복실(-COOH), 아미노(-NH2), 티올(-SH), 아마이드(amide, -NH-CO- 또는 -CO-NH-), 설파이드(sulfide, -S-SH), 할로겐기(-Cl, -Br, -F)가 도입된 페놀 유도체 및 벤젠고리 화합물로 이루어진 군으로부터 선택되는 방법.
PCT/KR2016/007613 2015-07-13 2016-07-13 미생물 프로토타이핑 유전자 회로 기반 신규 미생물자원 탐색 시스템 Ceased WO2017010805A1 (ko)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
KR20150099372 2015-07-13
KR10-2015-0099372 2015-07-13
KR10-2016-0088411 2016-07-13
KR1020160088411A KR101937180B1 (ko) 2015-07-13 2016-07-13 미생물 프로토타이핑 유전자 회로 기반 신규 미생물자원 탐색 시스템

Publications (1)

Publication Number Publication Date
WO2017010805A1 true WO2017010805A1 (ko) 2017-01-19

Family

ID=57758026

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2016/007613 Ceased WO2017010805A1 (ko) 2015-07-13 2016-07-13 미생물 프로토타이핑 유전자 회로 기반 신규 미생물자원 탐색 시스템

Country Status (1)

Country Link
WO (1) WO2017010805A1 (ko)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN108424866A (zh) * 2018-04-11 2018-08-21 中国水产科学研究院长江水产研究所 一种鲟源中间气单胞菌AMth-1及PCR检测引物及应用

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20020061022A (ko) * 2001-01-12 2002-07-22 주식회사 바이오리더스 항생제 비의존성 항시적 고발현 벡터 및 이를 이용한유전자 발현방법
US20020168636A1 (en) * 1999-03-09 2002-11-14 Wise Arlene A. Detection of phenols using engineered bacteria
KR20040061588A (ko) * 2002-12-31 2004-07-07 주식회사유한양행 신약탐색용 단백질 칩 및 이를 이용한 신약탐색방법
KR20110073049A (ko) * 2009-12-23 2011-06-29 한국생명공학연구원 메타게놈 라이브러리 유래 효소활성의 탐색 방법
KR20130039034A (ko) * 2011-10-11 2013-04-19 한국생명공학연구원 강제전사를 통한 메타게놈 유래 유용효소의 고효율 탐색방법

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20020168636A1 (en) * 1999-03-09 2002-11-14 Wise Arlene A. Detection of phenols using engineered bacteria
KR20020061022A (ko) * 2001-01-12 2002-07-22 주식회사 바이오리더스 항생제 비의존성 항시적 고발현 벡터 및 이를 이용한유전자 발현방법
KR20040061588A (ko) * 2002-12-31 2004-07-07 주식회사유한양행 신약탐색용 단백질 칩 및 이를 이용한 신약탐색방법
KR20110073049A (ko) * 2009-12-23 2011-06-29 한국생명공학연구원 메타게놈 라이브러리 유래 효소활성의 탐색 방법
KR20130039034A (ko) * 2011-10-11 2013-04-19 한국생명공학연구원 강제전사를 통한 메타게놈 유래 유용효소의 고효율 탐색방법

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
KIM, HASEONG ET AL.: "Designed Sensor Cells for Direct Detection of Microbial Colonies with Target Enzyme Activities on Solid Plates", 16TH EUROPEAN CONGRESS ON BIOTECHNOLOGY, EDITED BY MIKE TAUSSIG, EDINBURGH-SCOTLAND: NEW BTOTECHNOLOGY, vol. 31, 2014, pages S70, XP055346575 *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN108424866A (zh) * 2018-04-11 2018-08-21 中国水产科学研究院长江水产研究所 一种鲟源中间气单胞菌AMth-1及PCR检测引物及应用
CN108424866B (zh) * 2018-04-11 2021-05-28 中国水产科学研究院长江水产研究所 一种鲟源中间气单胞菌AMth-1及PCR检测引物及应用

Similar Documents

Publication Publication Date Title
Watanabe et al. Molecular detection, isolation, and physiological characterization of functionally dominant phenol-degrading bacteria in activated sludge
KR101128080B1 (ko) 메타게놈 라이브러리 유래 효소활성의 탐색 방법
Taupp et al. The art and design of functional metagenomic screens
EP2465946B1 (en) Method for screening and quantifying various enzyme activities using a genetic enzyme screening system
KR101222056B1 (ko) 재설계 유전자회로를 이용한 목적 효소 활성의 신규 탐색 및 정량 방법
Salerno et al. One of the two genes encoding nucleoid-associated HU proteins in Streptomyces coelicolor is developmentally regulated and specifically involved in spore maturation
Li et al. Rhodococcus soli sp. nov., an actinobacterium isolated from soil using a resuscitative technique
Sisinthy et al. Mitsuaria chitinivorans sp. nov. a potential candidate for bioremediation: emended description of the genera Mitsuaria, Roseateles and Pelomonas
Ninawe et al. Isolation of Three Xylanase-Producing Strains of Actinomycetes and Their Identification Using Molecular Methods: S. Ninawe et al.
Estrela et al. Genetic and biochemical characterization of Bacillus subtilis 168 mutants specifically blocked in the synthesis of the teichoic acid poly (3-O-β-d-glucopyranosyl-N-acetylgalactosamine 1-phosphate): gneA, a new locus, is associated with UDP-N-acetylglucosamine 4-epimerase activity
Sanyal et al. Activation of RelA by pppGpp as the basis for its differential toxicity over ppGpp in Escherichia coli: Rajeshree Sanyal and Rajendran Harinarayanan
Kämpfer et al. Novosphingobium hassiacum sp. nov., a new species isolated from an aerated sewage pond
Kamanavalli et al. Biodegradation of propoxur by Pseudomonas species
Ramesh et al. Genome and compound analysis of sioxanthin-producing marine actinobacterium Micromonospora sp. nov. Strain SH-82 isolated from sponge Scopalina hapalia
WO2017010805A1 (ko) 미생물 프로토타이핑 유전자 회로 기반 신규 미생물자원 탐색 시스템
Zhou et al. Physiological and genomic properties of Thermus tenuipuniceus sp. nov., a novel slight reddish color member isolated from a terrestrial geothermal spring
KR101937180B1 (ko) 미생물 프로토타이핑 유전자 회로 기반 신규 미생물자원 탐색 시스템
Uddin et al. Production of extracellular lipase from psychrotrophic bacterium Oceanisphaera sp. RSAP17 isolated from arctic soil
Huang et al. H alomonas flagellata sp. nov., a halophilic bacterium isolated from saline soil in Xinjiang
Hariharan et al. Streptomyces apricus sp. nov., isolated from soil
Zakharova et al. Isolation and characterization of a violacein pigment-producing psychrotolerant bacterium iodobacter sp. strain S-LB17
Octaviana et al. Four new members of the family Cytophagaceae: Chryseosolibacter histidini gen. nov., sp. nov., Chryseosolibacter indicus gen. nov., sp. nov., Dawidia cretensis, gen. nov., sp. nov., and Dawidia soli, gen. nov., sp. nov. isolated from diverse habitat
Puri et al. Molecular identification of Staphylococcus xylosus MAK2, a new α-L-rhamnosidase producer
Wang et al. Aidingibacillus halophilus gen. nov., sp. nov., a novel member of the family Bacillaceae
Meddeb-Mouelhi et al. Characterization of bacteria community isolated from wood decay

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 16824722

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 16824722

Country of ref document: EP

Kind code of ref document: A1