WO2016175618A1 - Method for converting mesenchymal stem cells into endothelial cells by using specific transcription factors - Google Patents

Abstract

The present invention relates to a method for converting mesenchymal stem cells into endothelial cells by using specific transcription factors and, more specifically, a method for converting mesenchymal stem cells into endothelial cells by using Oct4, Nanog, Tal1, and LMO2, which are specific transcription factors. According to the present invention, the method for converting adult cells or mesenchymal stem cells, which are adult stem cells, into endothelial cells was developed by selecting two types of genes, which are less directly related to cancer induction, among cell reprogramming factors and two types of transcription factors, which are not expressed or expressed at a low level in mesenchymal stem cells, among transcription factors related to vascular development, and combining all four. The method can be applied in the production of endothelial cells for forming regenerative tissue in tissue engineering and ischemic disease therapy.

Description

How to convert mesenchymal stem cells to endothelial cells using specific transcription factors

The present invention relates to a method for converting mesenchymal stem cells into endothelial cells using specific transcription factors, and more particularly, to convert mesenchymal stem cells into endothelial cells using specific transcription factors Oct4, Nanog, Tal1 and LMO2. It is about how to let.

The production of endothelial cells from pluripotent stem cells, such as embryonic stem cells and induced pluripotent stem cells, is important in the treatment of ischemic diseases that require angiogenesis. Endothelial cells are also essential in regenerative tissue fields such as liver tissues because they can provide an important vascular network. Many studies have led to the differentiation of embryonic stem cells or induced pluripotent stem cells into endothelial cells, but cells made from these cells are concerned about the possibility of cancer and the incomplete differentiation. Alternative methods of transdifferentiation into endothelial cells by partial reprogramming of cells may be an alternative [Graf, T. et al., Nature., 2009].

In fact, MyoD gene has been successfully converted into muscle cells by treatment with MyoD gene and 5-azacytidine in mouse embryonic fibroblast [Davis, RL, et al Cell, 1987], and introduced Ngn3, Pdx1 and Mafa genes into pancreatic exocrine cells. Has been converted to beta cell-like cells that secrete insulin (Zhou, Q., et al., Nature, 2008).

In the case of endothelial cells, Ginsberg et al. Introduced the ETS transcription factors ETV2, FLI1, and ERG1 into human midgestation c-Kitase-committed amniotic cells for the first time in 2012, and induced culture in EGM2 medium in the presence of a TGF beta inhibitor. It has been reported that it can be converted to cells that characterize (Ginsberg, M., et al., Cell, 2012). These cells were observed to form stable blood vessels in the Matrigel plug and regenerated liver tissue. Subsequently, it has been reported that only one ETV2 gene may be introduced into human skin fibroblasts and converted into cells exhibiting endothelial cell characteristics (Morita, R., et al., Proc Natl Acad Sci U S A, 2015).

In addition, toll-like receptor 3 (TLR3) agonist is used to stimulate fibrous blasts into endothelial cells by stimulating innate immunity [Sayed, N., et al., Circulation, 2015], Oct4 and Klf4 genes. Was introduced to convert into endothelial cell characteristics (Li, J., et al., Arterioscler Thromb Vasc Biol, 2013).

In addition, an attempt was made to introduce four Yamanaka factors, Oct4, Sox2, Klf4, and c-Myc, but convert them to endothelial cells by partial reprogramming without inducing iPS production [Margariti, A., et al., Proc Natl Acad. Sci 2012]. Among the reprogramming factors, two genes that are directly related to cancer induction and two transcription factors that are not expressed in umbilical cord-derived mesenchymal stem cells or that are expressed at low levels are selected from the transcription factor factors related to vascular development. Combining these four, we tried to develop a method for converting adult somatic cells or adult stem cells (MSC) into endothelial cells.

It is an object of the present invention to provide a novel method for converting mesenchymal stem cells into endothelial cells.

Another object of the present invention is to provide a novel composition for converting mesenchymal stem cells into endothelial cells.

Another object of the present invention provides a composition for tissue regeneration comprising the endothelial cells obtained by the method of the present invention as an active ingredient.

Another object of the present invention provides a cell therapy composition for the treatment of ischemic diseases comprising the endothelial cells obtained by the method of the present invention as an active ingredient.

In order to achieve the above object, the present invention provides a method for converting mesenchymal stem cells into endothelial cells, comprising the step of introducing Oct4, Nanog, Tal1 and LMO2 genes or proteins encoded by the genes into mesenchymal stem cells. to provide.

In one embodiment of the present invention, the Oct4, Nanog, Tal1 and LMO2 genes may be transduced into mesenchymal stem cells using a lentiviral vector.

In one embodiment of the present invention, the Oct4 gene is represented by SEQ ID NO: 1, Nanog gene is represented by SEQ ID NO: 2, Tal1 gene is represented by SEQ ID NO: 3, LMO2 gene may be represented by SEQ ID NO: 4 have.

The present invention also provides a composition for inducing differentiation of mesenchymal stem cells into endothelial cells comprising Oct4, Nanog, Tal1 and LMO2 genes or proteins encoded by the genes.

In another aspect, the present invention provides a composition for tissue regeneration comprising the endothelial cells obtained by the method of the present invention as an active ingredient.

In another aspect, the present invention provides a cell therapeutic composition for the treatment of ischemic diseases comprising the endothelial cells obtained by the method of the present invention as an active ingredient.

According to the present invention, two genes that are directly related to cancer induction among the reprogramming factors of cells and transcription factors that are not expressed or low in mesenchymal stem cells (MSCs) among transcription factor factors related to blood vessel development By selecting two species and combining these four, we developed a method of converting adult cells or adult stem cells, mesenchymal stem cells, into endothelial cells, which are endothelial cells for constructing regenerative tissue in tissue engineering and treatment of ischemic diseases. There is an effect that can be applied to the generation of.

Figure 1 relates to the conversion of endothelial cells (EC) by Oct4, Nanog, Tal1, LMO2 gene introduction, (A) is a schematic diagram of the induction of MSCs into endothelial cells, (B) of the umbilical cord-derived MSCs Gene expression was confirmed by RT-PCR after Oct4, Nanog, Tal1, and LMO2 genes were transformed into lentiviral for induction into endothelial cells, and (C) is an endothelial cell marker after induction into endothelial cells. Cells positive for CD31 / CD144 (iEC) were analyzed by FACS, and (D) RT-PCR was used to analyze endothelial marker expression after passage of amplified iECs into endothelial cells. (E) shows the results of RT4-PCR analysis of Oct4, Nanog, Tal1, LMO2 gene expression after expansion of iEC. When cultured in SB431542), it is a result indicating that it is not converted to endothelial cells.

Figure 2 is a repeat experiment by changing the incubation time in the conversion of MSC to EC by Oct4, Nanog, Tal1, LMO2, confirming the production reproducibility and conversion rate of CD31 / CD144 positive cells.

3 shows the results of investigating the expression of VE-cadherin by immunofluorescence after conversion of expanded iEC, and the absorption and angiogenesis of ac-LDL.

Figure 4 confirms the optimal combination of gene combinations required for conversion from WJ-MSC to endothelial cells (4A), 4B shows the results of repeated experiments. In the figure, ONTL is a group using a gene combination of Oct4, Nanog, Tal1 4, LMO2, OTL is a gene combination of Oct4, Tal1 4, LMO2, NTL is a combination of Nanog, Tal1 4, LMO2, ONL is Oct4, Nanog, LMO2 gene combinations are shown.

Tal1 and LMO2 are known as major regulators of hematopoietic and endothelial cell transcription. Human umbilical cord-derived mesenchymal stem cells were transduced using recombinant lentiviruses capable of carrying cDNAs of Oct4, Nanog, Tal1 and LMO2 (FIG. 1A), blasticidine (350 ng / ml), puromycin ( Only transduced cells were selected by culturing for 10 days in a medium containing 350 ng / ml). RT-PCR was performed using total RNA to confirm that these four genes were expressed in selected cells (FIG. 1B). Thereafter, these cells were cultured in EGM2 containing TB inhibitor SB431542 (10 uM) for 35 days to induce conversion into endothelial cells. FACS analysis of these cells revealed an induced cell population comprising 4.96% of CD31 + VE-cadherin + cells (FIG. 1C). These CD31 + VE-cadherin + cells were sorted by FACS and cultured in the same medium. Endothelial gene analysis of VE-cadherin, VEGFR2, CD31, and eNOS of these cultured cells (iEC) was carried out by PCR analysis. As a result, VE-caderin, VEGFR2, CD31 and eNOS were expressed in cultured iEC cells as in HUVEC. Expressed (FIG. 1D). As a result of analyzing Oct 4, Nanog, Tal1 and LMO2 gene expression in cultured iEC, the expression of Nanog, Tal1 and LMO2 except for Oct 4 was observed (FIG. 1E). In contrast, culture of MSCs without transduction of these four transcription factors in the same induction medium did not induce conversion into EC cells (FIG. 1F). Direct conversion of MSCs to ECs by these four factors was confirmed by repeated experiments, with conversion to EC cells even induction on day 11 (FIG. 2), with CD31 and CD144 positive cells ranging from 1.4-7%. It was confirmed.

To characterize the iEC in more detail, we examined the immunofluorescence of these cells and found that VE-Cadherin is expressed around the cells as in HUVEC, and these cells were Dil-labeled in contrast to MSC. It was confirmed that it has the ability to absorb ac-LDL, indicating the characteristics of endothelial cells.

Finally, we looked at whether these induced cells could form a tube-like structure, as shown in Figure 3, these cells were tube-like structures on matrigel at 20 hours as in HUVEC as opposed to MSC. It was found to form.

Through the above results, the inventors confirmed that reprogramming of MSCs and adult cells into endothelial cells can be achieved by Oct4, nanog, Tal1 and LMO2.

In addition, the inventors confirmed that MSC and adult cells can be efficiently converted into endothelial cells only when all four genes Oct4, Nanog, Tal1, and LMO2 are used as described above. According to one embodiment of the present invention, Oct4 Introduces 6 genes, Tal1, LMO2, Nanog, Tal1, LMO2 (NTL), Oct4, Nanog, LMO2 (ONL), and 4 genes Oct4, Nanog, Tal1, LMO2 One group was analyzed for endothelial cell conversion according to gene combination.

As a result, as shown in FIG. 4, in the group in which the four genes of Oct4, Nanog, LMO2, and Tal1 were introduced, conversion to CD31 / CD144 positive cells occurred, but Oct4, Tal1, LMO2 (OTL), When introduced into a combination consisting of three genes, Nanog, Tal1, LMO2 (NTL) or Oct4, Nanog, LMO2 (ONL), it was confirmed that no conversion to CD31 / CD144 positive cells occurred.

Therefore, in the present invention, it was found that in order to completely convert MSCs and adult cells into endothelial cells, it is necessary to introduce all four special genes of Oct4, Nanog, LMO2, and Tal1.

The gene of Oct4, Nanog, LMO2, Tal1 4 introduced for endothelial cell conversion in the present invention is preferably Oct4 gene represented by SEQ ID NO: 1, Nanog gene represented by SEQ ID NO: 2, LMO2 gene represented by SEQ ID NO: 3, SEQ ID NO: You can use Tal1 4 as indicated by 4.

 In addition, the introduction of the genes into cells can be used as long as the gene introduction techniques known in the art, one embodiment of the present invention used a lentiviral vector.

Endothelial cells obtained by the above method was found to be applicable to the production of endothelial cells (EC) for constituting regenerative tissue in tissue engineering and treatment of ischemic diseases.

Therefore, the present invention can provide a composition for tissue regeneration comprising the endothelial cells obtained by the method of the present invention as an active ingredient, and the present invention includes the endothelial cells obtained by the method of the present invention as an active ingredient. It can provide a cell therapy composition for the treatment of ischemic disease.

Endothelial cells converted from stem cells according to the present invention can be used as a cell therapy for the treatment of tissue regeneration or ischemic disease. Can be used.

Hereinafter, the present invention will be described in more detail with reference to Examples. These examples are intended to illustrate the present invention more specifically, but the scope of the present invention is not limited to these examples.

< Example  1>

Oct4 , Nanog , Tal1 , LMO2  Conversion into endothelial cells by gene introduction

1-1. Cell Culture and Reagent Preparation

Human umbilical vein endothelial cells (HUVEC) cells were isolated from human blood vessels according to the method described in Jaffe, E.A. HUVEC cells were cultured in M199 medium containing 20% FBS (Invitrogen), 30 μg / ml endothelial cell growth aid (ECGS, BD Biosciences), 90 μg / ml heparin, 1% antibiotic. iEC was cultured in EGM2 medium (Lonza) to which 10 μM SB431542 (Sigma) was added, and umbilical cord-derived mesenchymal stem cells (MSCs) were cultured in DMEM (Invitrogen) medium containing 20% FBS and 1% antibiotics. Human umbilical cord samples were isolated according to an approved procedure of the Catholic University Clinical Trials Review Committee (Task No. MC13TISI0078, MC12TISI0094).

1-2. Lentivirus  Vector and Transduction

Lentiviral vectors carrying Nanog, Tal1 and LMO2 were purchased from GeneCopoeia (USA), and Oct4 vectors were obtained from Prof. Won-hee Seo from Ajou University. 293FT cells were dispensed into 10 cm tissue culture plates the day before transfection and allowed to be 90-95% density of the plates on the day of transduction. To produce lentiviral, the desired vector plasmids psi-EF1-Bls-hOct4, psi-EF1-Puro-hNanog, psi-EF1-Puro-hTaL1 and psi-EF1-Puro-hLMO2 (Genecopoeia; 3 for each plasmid ) Was mixed with 9 μg ViraPowerPackaging Mix and 12 μg Lipofectamine2000 complex and added to 293FT cells. After overnight incubation at 37 ° C., 5% CO ₂ conditions, the medium was replaced with 293FT medium without antibiotics. Culture supernatants were collected 48 hours after medium replacement. Virus supernatants were filtered by 0.45 μm PVDF filter to remove cells and virus stocks were stored at -80 ° C. MSCs (5 × 10 ⁴ / well) were plated for 24 hours and infected with 5 MOI in 10% FBS-DMEM medium containing 8 μg / ml polybrene (Sigma-Aldrich). After 24 hours, the virus-containing medium was replaced with fresh DMEM medium containing 20% FBS and penicillin / streptomycin and cultured for 2 days. Cells were then incubated for 10 days in medium containing blasticidine (350 ng / ml), puromycin (350 ng / ml) and transduced cells were selected (see FIG. 1A).

1-3. Lentivirus  Transduced MSc  Induction into Endothelial Cells

Lentivirus-transduced MSC cells were cultured in gelatin coated dishes containing endothelial cell growth medium EGM2 and 10 μM SB431542 to induce transformation into endothelial cells. The medium was changed every 2 days and split 1: 2 after 3-5 days when cells became 90% density. After culturing the cells for 11-35 days, iEC was isolated by FACS.

1-4. RNA  Extraction and RT- PCR

Total RNA was extracted from the cultured cells using Trizol reagent (Invitrogen). CDNA synthesis for RT-PCR was performed using a SuperScript synthesis system (Enzynomics) according to the manufacturer's instructions. Each gene was amplified by PCR using the primer sets described in Table 1. The PCR conditions reacted using the synthesized cDNA are as follows: 95 ° C. 7 min (initial denaturation), 95 ° C. 1 min (denature)-54 ° C. to 60 ° C. 1 min (annealing)-72 ° C. 1 minute extension process 30 cycles in total, 72 ° C. 10 minutes (last extension). PCR products were analyzed by 1.0% agarose-gel electrophoresis and DNA bands were visualized by SYBR safe DNA gel staining (Invitrogen).

Name	Forward	Reserve	Accession no.
Oct4	AGGAGATATGCAAAGCAGAA	AGAGTGGTGACGGAGACAG	NM_002701
Nanog	ATCCAGCTTGTCCCCAAAG	ATTTCATTCTCTGGTTCTGG	NM_024865.2
Tal1	TCACCACCAACAATCGAGTGAAGAGG	CTCCTCCTGGTCATTGAGCAGCTTGG	NM_003189.2
LMO2	TCCCCAATGTCCTCGGCCAT	ATCCGCTTGTCACAGGAT	NM_005574.3
CD31	ATGATGCCCAGTTTGAGGTC	GACGTCTTCAGTGGGGTTGT	NM_000442.4
VE-ead	CCCTACCAGCCCAAAGTGTG	CGACTTGGCATCCCATTGTC	NM_001795.3
VEGFR2	GCGATGGCCTCTTCTGTAAG	ACACGACTCCATGTTGGTCA	EU826563.1
eNOS	TGATGGCGAAGCGAGTGAA	ACTCATCCATACACAGGACCCG	NM_000603.4

By using the RT-PCR as described above, when transfected with a lentiviral, and then examined whether Oct4, Nanog, Tal1, LMO2 is expressed, it was confirmed that these genes are expressed (Fig. 1B). On the other hand, these cells were induced by differentiation into endothelial cells, and then separated by FACS sorting. Subsequent amplification of the isolated iEC was followed by amplification of endothelial cell marker expression by RT-PCR as described above. It was confirmed that the expression of cadherin, VEGFR2, CD31, eNOS (Fig. 1D), the expression of Nanog, Tal1, LMO2 was confirmed by RT-PCR (Fig. 1E).

1-5. FACS  analysis

After inducing differentiation into endothelial cells, we tried to identify CD31 / CD144 positive cells, which are endothelial markers, by FACS analysis.

To this end, cells were collected and stained for 30 min on ice with PE-conjugated VE-cadherin antibody (1: 400; BD Biosciences) or FITC-conjugated CD31 antibody (1: 400; BD Biosciences). Samples were analyzed with a FACSAria III cell analyzer (BD Biosciences). Data was analyzed with BD CellQuest Pro software (version 5.2.1). To identify CD31 + / CD144 + cells, the cells were harvested for 35 days in endothelial cell differentiation induction medium after viral transduction and cells were collected and analyzed by FACS Beckman coulter cell sorter (BD Biosciences). Data was analyzed by FACS summit software (version 6.1.3). CD31 + / CD144 + iECs were incubated in EGM2 containing 10 μM SB431542 using 1% gelatin coated plates after separation by FACS.

As a result, as shown in FIG. 1C, it was confirmed that 4.96% of cells (iEC) positive for endothelial cell marker CD31 / CD144 were present.

< Example  2>

Oct4 , Nanog , Tal1 , LMO2  by MSc To EC In conversion  Review reproducibility and conversion rate

In the same experimental method as in Example 1, four genes were introduced and differentiation of endothelial cells was induced, and repeated experiments with varying incubation time in endothelial cell-induced medium were used to reproduce CD31 / CD144 positive cells. I checked the conversion rate.

 To identify CD31 + / CD144 + cells, cells were harvested for 11-35 days in endothelial cell differentiation induction medium after viral transduction and cells were collected and analyzed by FACS Beckman coulter cell sorter (BD Biosciences). Data was analyzed by FACS summit software (version 6.1.3). CD31 + / CD144 + iECs were incubated in EGM2 containing 10 μM SB431542 using 1% gelatin coated plates after separation into FACS.

As a result, as shown in Figure 2, it was confirmed that the CD31 / CD144 positive cells were produced reproducibly, at a rate of about 1.4 ~ 7%.

< Example  3>

Passage  Amplification through culture expansion ) iEC  Characteristic investigation

After expansion of sorted CD31 / CD144 positive cells (iEC) via FACS, VE-cadherin expression was examined by immunofluorescence, and ac-LDL uptake and angiogenesis were examined.

3-1. Immunofluorescence staining  through VE - cadherin  Expression survey

Cells were fixed with 100% methanol for 5 minutes and permeabilized with 0.1% Triton X-100 for 3 minutes. Nonspecific protein binding sites were blocked for 1 hour with 5% BSA, cells were reacted with VE-cadherin (1: 100, cell signaling) primary antibody, washed three times with PBS, and Cy 3 (Millipore) conjugated. Was reacted with the secondary antibody for 2 hours. Finally, all slides were counterstained with 1 μg / ml DAPI (Sigma). Images were obtained by confocal microscopy (Zeiss LSM 510 Meta with LSM image examiner software, Germany).

3-2. In vitro ( In in vitro )  Endothelial Cell Function Analysis

The uptake of ac-LDL by adherent cells known as one of the main features of endothelial cell lineage was measured (Murohara et al., J. Clin. Invest., 2000). Cells incubated in gelatin-coated chamber slides for 24 hours were treated at 37 ° C., 4 in medium containing 15 μg / ml Dil-labeled acetyl-low density lipoprotein (Dil-ac-LDL, Molecular Probes, Eugene, OR). The reaction was carried out for a time. After washing, the samples were observed by fluorescence microscopy and reversed phase contrast microscopy, and three fields were taken at random.

3-3. Tube (Vacuum) Formation Analysis

Chilled Matrigel (150 μl, BD Bioscience) was placed in pre-cooled 48-well plates and incubated at 37 ° C. for 30 minutes. HUVECs, MSC and iEC were aliquoted onto solidified Matrigel (2 × 10 ⁴ cells / well) and tube formation was taken 20 hours after incubation in EGM.

As a result, as shown in FIG. 3, VE-cadherin was expressed at the cell interface, absorbed Dil-labeled ac-LDL, and vasculature, similar to HUVEC cells, although completely different from MSC in expanded iEC. It also confirmed that it has the ability.

< Example  4> Wharton's jelly mesenchymal stem from cells (WJ-MSC)  Optimal combination of genes required for endothelial cell conversion

The present inventors carried out the following experiment to identify the optimal gene required for the conversion of mesenchymal stem cells to endothelial cells confirmed as a result of the above example. A group into which four genes used in the above examples, Oct4, Nanog, Tal1, and LMO2, were introduced; The group which introduced three genes of Oct4, Tal1, LMO2 (OTL); Group which introduced three genes, Nanog, Tal1, LMO2 (NTL); And endothelial cell differentiation ability was investigated in the group which introduced three genes of Oct4, Nanog, LMO2 (ONL). Specifically, in the same experimental method as in Example 1, Oct4, Tal1, LMO2 (OTL), Nanog, Tal1, LMO2 (NTL) or Oct4, Nanog, LMO2 (ONL) in a combination consisting of three genes in a cell After 24 hours of introduction, the cells were transfected with fresh DMEM medium added with penicillin / streptomycin and cultured for 2 days, followed by cell selection for 10 days to select transduced cells. Then, cultured in a gelatin coated dish containing 10 uM SB431542 in the endothelial cell growth medium EGM2 and cultured for 21 days while replacing the medium every 2 days, and then subjected to FACS analysis.

As a result, as shown in Fig. 4, the introduction of four genes Oct4, Nanog, Tal1, and LMO2 resulted in conversion to CD31 / CD144 positive cells, but CD31 / CD144 positive when the combinations of three genes were introduced. Cells could not be obtained (see FIG. 4A). In the case of additional repeated experiments, CD31 / CD144 positive cells were obtained with high efficiency (~ 5%) when four genes were introduced at the same time, while a combination of three genes, Nanog, Tal1, and LMO2, was introduced. It was confirmed that little CD31 / CD144 positive cells appeared (see FIG. 4B).

These results confirm that the present inventors required four transcription factors Oct4, Nanog, Tal1, and LMO2 to efficiently convert MSCs into endothelial cells under differentiation and culture conditions. If there is no conversion to endothelial cells was found.

So far I looked at the center of the preferred embodiment for the present invention. Those skilled in the art will appreciate that the present invention can be implemented in a modified form without departing from the essential features of the present invention. Therefore, the disclosed embodiments should be considered in descriptive sense only and not for purposes of limitation. The scope of the present invention is shown in the claims rather than the foregoing description, and all differences within the scope will be construed as being included in the present invention.

Claims (7)

1. A method for converting mesenchymal stem cells into endothelial cells, comprising introducing Oct4, Nanog, Tal1 and LMO2 genes or proteins encoded by the genes into mesenchymal stem cells.
2. The method of claim 1,

   The Oct4, Nanog, Tal1 and LMO2 genes are characterized in that the mesenchymal stem cells are transduced using a lentiviral vector, mesenchymal stem cells are converted to endothelial cells.
3. The method of claim 2,

   The Oct4 gene is represented by SEQ ID NO: 1, Nanog gene is represented by SEQ ID NO: 2, Tal1 gene is represented by SEQ ID NO: 3, LMO2 gene is characterized in that the endothelial stem cells, characterized in that represented by SEQ ID NO: 4 How to convert to cells.
4. The method of claim 1,

   Oct4 protein is represented by SEQ ID NO: 5, Nanog protein is represented by SEQ ID NO: 6, Tal1 protein is represented by SEQ ID NO: 7, LMO2 protein is characterized by SEQ ID NO: 8 endothelial stem cells How to switch to
5. Composition for inducing differentiation of mesenchymal stem cells into endothelial cells comprising Oct4, Nanog, Tal1 and LMO2 genes or proteins encoded by the genes.
6. Composition for tissue regeneration comprising the endothelial cells obtained by the method of claim 1 as an active ingredient.
7. Cell therapy composition for the treatment of ischemic diseases comprising the endothelial cells obtained by the method of claim 1 as an active ingredient.

Images