WO2016175351A1 - Rice-derived osiaa6 gene for increasing drought stress resistance of plant and use thereof - Google Patents
Rice-derived osiaa6 gene for increasing drought stress resistance of plant and use thereof Download PDFInfo
- Publication number
- WO2016175351A1 WO2016175351A1 PCT/KR2015/004311 KR2015004311W WO2016175351A1 WO 2016175351 A1 WO2016175351 A1 WO 2016175351A1 KR 2015004311 W KR2015004311 W KR 2015004311W WO 2016175351 A1 WO2016175351 A1 WO 2016175351A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- plant
- osiaa6
- stress
- rice
- gene
- Prior art date
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
- C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
- C12N15/8273—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for drought, cold, salt resistance
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
Landscapes
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Molecular Biology (AREA)
- Biomedical Technology (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Microbiology (AREA)
- Physics & Mathematics (AREA)
- Plant Pathology (AREA)
- Cell Biology (AREA)
- Botany (AREA)
- Gastroenterology & Hepatology (AREA)
- Medicinal Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
Disclosed are: a method for controlling the resistance of a plant to environmental stress, comprising a step of transforming plant cells with a recombinant vector including a gene coding for a rice-derived Oryza sativa Aux/IAA 6 (OsIAA6) protein; a method for producing a transgenic plant body of which the resistance of a plant to environmental stress is controlled, comprising a step of transforming plant cells with the recombinant vector including a gene coding for the OsIAA6 protein; a transgenic plant body produced by the method and of which the resistance to environmental stress is controlled; and seeds thereof.
Description
본 발명은 식물의 가뭄 스트레스 내성을 증가시키는 벼 유래의 OsIAA6 유전자 및 이의 용도에 관한 것으로, 더욱 상세하게는 벼 유래 OsIAA6(Oryza sativa Aux/IAA 6) 단백질을 코딩하는 유전자를 포함하는 재조합 벡터를 식물세포에 형질전환시키는 단계를 포함하는 식물의 환경 스트레스에 대한 내성을 조절하는 방법, 상기 벼 유래 OsIAA6(Oryza sativa Aux/IAA 6) 단백질을 코딩하는 유전자를 포함하는 재조합 벡터로 식물세포를 형질전환하는 단계를 포함하는 식물의 환경 스트레스에 대한 내성이 조절된 형질전환 식물체의 제조 방법, 상기 방법에 의해 제조된 환경 스트레스에 대한 내성이 조절된 형질전환 식물체 및 이의 종자에 관한 것이다.The present invention relates to a rice-derived OsIAA6 gene and its use for increasing drought stress resistance of plants, and more particularly, to a recombinant vector comprising a gene encoding a rice-derived OsIAA6 (Oryza sativa Aux / IAA 6) protein. A method of controlling resistance to environmental stress of a plant, comprising the step of transforming a cell, transforming plant cells with a recombinant vector comprising a gene encoding the rice-derived OsIAA6 (Oryza sativa Aux / IAA 6) protein The present invention relates to a method for producing a transgenic plant having a controlled resistance to environmental stress of a plant, a transgenic plant having a controlled resistance to environmental stress produced by the method, and a seed thereof.
가뭄 스트레스는 전세계적으로 작물 생산에 가장 심각한 영향을 미치는 요인 중 하나이다. 가뭄 조건에 식물을 노출시키면, 많은 스트레스 관련 유전자가 유도되며, 이의 산물은 스트레스에 유도된 손상에 대한 세포 보호물질로서 기능하는 것으로 생각된다. 스트레스 관련 유전자의 발현은 특이적 전사인자에 의해 대개 조절되며, 이는 벼 및 애기장대의 경우 게놈 전체 유전자 수의 약 6%를 차지한다.Drought stress is one of the most serious factors affecting crop production worldwide. Exposure of plants to drought conditions leads to the induction of many stress-related genes, the products of which are thought to function as cellular protective agents against stress-induced damage. The expression of stress-related genes is usually regulated by specific transcription factors, which account for about 6% of the genome total gene number in rice and Arabidopsis.
AUX/IAA(옥신(auxin)/인돌아세트산(indoleacetic acid)) 유전자는 단백질의 발현이 식물 호르몬 옥신에 의해서 엄격하게 조절되는 단백질 패밀리를 코딩한다. 식물 호르몬 옥신은 세포 분열, 세포 팽창 및 분화, 배의 패터닝 (patterning), 맥관구조 또는 다른 조직, 원뿌리 및 곁뿌리 또는 줄기 분열 조직의 성장 조절과 같은 다양한 과정에 관련한다. 일반적으로 AUX/IAA 단백질은 4개의 보존된 아미노산 서열 모티프 (도메인 Ⅰ, Ⅱ, Ⅲ 및 Ⅳ) 및 핵 위치 신호 서열을 갖는다. 도메인 Ⅰ 및 Ⅱ는 degradation 도메인으로 옥신신호를 인지하여 AUX/IAA 단백질을 분해하는데 역할을 한다. 도메인 Ⅲ 및 Ⅳ는 단백질-단백질 상호작용을 하는 dimerization 도메인으로 AUX/IAA 단백질과 homodimer 혹은 ARF 단백질과 heterodimer를 형성한다고 알려져 있다. AUX/IAA 단백질은 옥신-반응 유전자의 발현을 조절하는 옥신 반응 인자 (ARFs)의 음성 조절자 (negative regulator)로서 ARF 활성을 억제한다. 옥신이 활성화된 상태에서, AUX/IAA 단백질은 옥신-SCFTIR1 복합체와 함께 상호작용을 통해 유비퀴틴화 되고, 그 후에 프로테아좀 작용에 의해서 분해된다. AUX/IAA 단백질의 역할의 개요 및 활성은 Reed에 의해서 보고되었다 (Trends in Plant Science 6, 420-425, 2001). 벼 (Oryza sativa Aux/IAA 6)에서 초기 옥신-반응 AUX/IAA 유전자 패밀리의 구조 및 발현 분석은 최근에 Jain 등에 의해서 보고되었다(Funct Integr Genomics. 2006 Jan;6(1):47-59). 벼는 총 25개의 ARF 유전자와 31개의 Aux/IAA 유전자가 존재하며 이들의 다양한 결합에 의하여 식물 전반의 발달과정이 옥신에 의하여 조절된다. 가뭄, 염, 저온의 비생물성 스트레스 처리시 발현이 증가하는 OsIAA6 유전자를 분리하고, 상기 유전자의 가뭄 저항성에 대한 기능을 분석하고자 한다.The AUX / IAA (auxin / indoleacetic acid) gene encodes a family of proteins whose expression is tightly regulated by the plant hormone auxin. The plant hormone auxin is involved in a variety of processes such as cell division, cell expansion and differentiation, embryonic patterning, growth control of vasculature or other tissues, root and side roots or stem meristem. AUX / IAA proteins generally have four conserved amino acid sequence motifs (domains I, II, III and IV) and nuclear position signal sequences. Domains I and II play a role in degrading AUX / IAA proteins by recognizing auxin signals as degradation domains. Domains III and IV are protein-protein interaction dimerization domains known to form homodimers with AUX / IAA proteins or heterodimers with ARF proteins. AUX / IAA proteins inhibit ARF activity as negative regulators of auxin response factors (ARFs) that regulate expression of auxin-responsive genes. In the auxin activated state, the AUX / IAA protein is ubiquitized through interaction with the auxin-SCFTIR1 complex and then degraded by proteasome action. An overview of the role and activity of AUX / IAA proteins has been reported by Reed (Trends in Plant Science 6, 420-425, 2001). Structure and expression analysis of early auxin-responsive AUX / IAA gene families in rice (Oryza sativa Aux / IAA 6) was recently reported by Jain et al. (Funct Integr Genomics. 2006 Jan; 6 (1): 47-59). A total of 25 ARF genes and 31 Aux / IAA genes are present in rice, and the various processes of planting control the development of the whole plant by auxin. The purpose of this study is to isolate OsIAA6 genes that increase expression in drought, salt, and low temperature abiotic stress treatment, and analyze the function of drought resistance of the genes.
한편, 한국등록특허 제0742194호에서는 '환경 스트레스 저항성 조절 유전자를 이용하여 식물체의 환경 스트레스 저항성을 증가시키는 방법'이 개시되어 있고, 한국등록특허 제1427180호에서는 '식물의 가뭄 스트레스 내성을 증가시키는 벼 유래의 OsCTR1 유전자 및 이의 용도'가 개시되어 있으나, 본 발명에서와 같이 식물의 가뭄 스트레스 내성을 증가시키는 벼 유래의 OsIAA6 유전자 및 이의 용도에 대해서는 밝혀진 바가 없다.Meanwhile, Korean Patent No. 0742194 discloses a method of increasing environmental stress resistance of a plant using environmental stress resistance control genes, and Korean Patent No. 1427180 discloses rice which increases drought stress resistance of plants. Derived OsCTR1 gene and its use 'is disclosed, but there is no known about the OsIAA6 gene derived from rice and its use to increase drought stress resistance of plants as in the present invention.
본 발명은 상기와 같은 요구에 의해 도출된 것으로서, 본 발명자들은 벼 유래 OsIAA6 단백질 코딩 유전자를 포함하는 재조합 벡터 및 상기 재조합 벡터로 식물체를 형질전환하여 OsIAA6 유전자가 과발현되는 벼 형질전환 식물체를 제작하였고, 상기 OsIAA6 과발현 형질전환 벼 식물체가 가뭄 스트레스 처리 시 야생형 식물체에 비해 가뭄 스트레스에 대한 내성이 증가된 것을 확인함으로써, 본 발명을 완성하였다.The present invention has been derived by the above-described requirements, the present inventors transformed the plant with a recombinant vector comprising a rice-derived OsIAA6 protein coding gene and the recombinant vector to produce a rice transgenic plant overexpressing the OsIAA6 gene, By confirming that the OsIAA6 overexpressed transgenic rice plants increased drought stress resistance compared to wild type plants, the present invention was completed.
상기 과제를 해결하기 위해, 본 발명은 벼 유래 OsIAA6(Oryza sativa Aux/IAA 6) 단백질을 코딩하는 유전자를 포함하는 재조합 벡터를 식물세포에 형질전환시키는 단계를 포함하는 식물의 환경 스트레스에 대한 내성을 조절하는 방법을 제공한다.In order to solve the above problems, the present invention provides a plant-resistant resistance to environmental stress, comprising the step of transforming plant cells with a recombinant vector comprising a gene encoding a rice-derived OsIAA6 (Oryza sativa Aux / IAA 6) protein It provides a way to adjust.
또한, 본 발명은 벼 유래 OsIAA6(Oryza sativa Aux/IAA 6) 단백질을 코딩하는 유전자를 포함하는 재조합 벡터로 식물세포를 형질전환하는 단계; 및In addition, the present invention comprises the steps of transforming plant cells with a recombinant vector comprising a gene encoding a rice-derived OsIAA6 (Oryza sativa Aux / IAA 6) protein; And
상기 형질전환된 식물세포로부터 식물을 재분화하는 단계를 포함하는 환경 스트레스에 대한 내성이 조절된 형질전환 식물체의 제조 방법을 제공한다.It provides a method for producing a transformed plant is controlled resistance to environmental stress comprising the step of regenerating the plant from the transformed plant cells.
또한, 본 발명은 상기 방법에 의해 제조된 환경 스트레스에 대한 내성이 조절된 형질전환 식물체 및 이의 종자를 제공한다.In addition, the present invention provides a transgenic plant and its seed having a controlled resistance to environmental stress produced by the method.
본 발명에 따르면, 벼 유래 OsIAA6(Oryza sativa Aux/IAA 6) 단백질을 코딩하는 유전자가 과발현되는 식물체는 가뭄 스트레스 조건에서 야생형에 비해 스트레스 내성이 증가된다. 따라서, 본 발명의 벼 유래 OsIAA6(Oryza sativa Aux/IAA 6) 단백질을 코딩하는 유전자는 가뭄 스트레스에 대한 저항성이 증가된 형질전환 식물체의 개발에 유용하게 이용될 수 있으므로, 산업적으로 매우 유용하게 이용될 수 있을 것이다.According to the present invention, plants overexpressing the genes encoding the rice-derived OsIAA6 (Oryza sativa Aux / IAA 6) protein have increased stress resistance compared to wild type under drought stress conditions. Therefore, the gene encoding the rice-derived OsIAA6 (Oryza sativa Aux / IAA 6) protein of the present invention can be usefully used in the development of transgenic plants with increased resistance to drought stress. Could be.
도 1은 벼 식물체에 가뭄, 염 또는 저온의 스트레스 처리 시 OsIAA6 유전자의 발현 수준 변화를 확인한 결과이다.1 is a result of confirming the change in the expression level of OsIAA6 gene during treatment of drought, salt or low temperature in rice plants.
도 2는 벼의 생장호르몬인 옥신의 아날로그인 NAA(naphthalene-1-acetic acid)을 식물체에 처리하였을 때, OsIAA6 유전자의 발현 수준 변화를 확인한 결과이다.Figure 2 is a result of confirming the change in the expression level of OsIAA6 gene when the plant was treated with NAA (naphthalene-1-acetic acid), an analogue of Auxin, a growth hormone of rice.
도 3은 OsIAA6 과발현 형질전환 식물체(PGD1:OsIAA6)에서의 OsIAA6 유전자의 발현 수준 변화를 확인한 결과이다.3 is OsIAA6 transgenic plants: The results confirm the expression level change of the gene in OsIAA6 (PGD1 OsIAA6).
도 4는 OsIAA6 과발현 형질전환 식물체(PGD1:OsIAA6)와 야생형 식물체의 가뭄 스트레스 저항성을 비교한 결과로, (A) 가뭄 스트레스 처리와 물 재공급(rewatering) 후의 식물체의 모습을 보여주는 사진이며, (B) 가뭄 스트레스 처리에 따른 Fv/Fm 값 변화를 분석한 그래프이다.4 is OsIAA6 transgenic plants: a result of comparing the drought stress tolerance of (PGD1 OsIAA6) and wild type plants, (A) is a photograph of the drought stress treatment and the plant state of after the water resupply (rewatering), (B ) This is a graph analyzing the change of Fv / Fm value according to drought stress treatment.
본 발명의 목적을 달성하기 위하여, 본 발명은 벼 유래 OsIAA6(Oryza sativa Aux/IAA 6) 단백질을 코딩하는 유전자를 포함하는 재조합 벡터를 식물세포에 형질전환시키는 단계를 포함하는 식물의 환경 스트레스에 대한 내성을 조절하는 방법을 제공한다. In order to achieve the object of the present invention, the present invention is directed to the environmental stress of plants comprising the step of transforming a plant cell with a recombinant vector comprising a gene encoding a rice-derived OsIAA6 (Oryza sativa Aux / IAA 6) protein Provides a way to control tolerance.
본 발명의 일 구현 예에 따른 방법은 벼 유래 OsIAA6(Oryza sativa Aux/IAA 6) 단백질을 코딩하는 유전자를 포함하는 재조합 벡터를 식물세포에 과발현시켜 식물의 환경 스트레스에 대한 내성을 증가시키는 것을 특징으로 하나, 이에 제한되지 않는다.Method according to an embodiment of the present invention is characterized by increasing the plant's resistance to environmental stress by overexpressing a recombinant vector comprising a gene encoding a rice-derived OsIAA6 (Oryza sativa Aux / IAA 6) protein in plant cells However, it is not limited thereto.
본 발명에서 "환경 스트레스"란 식물체의 성장 또는 생산성을 저하시키는 외부적인 요인을 말하며 크게 생물학적 스트레스(biotic stress)와 비생물학적 스트레스(abiotic stress)로 대별된다. 생물학적 스트레스로는 대표적으로 병원균을 들 수 있으며 비생물학적 스트레스로는 고농도의 염, 가뭄(건조), 저온, 고온 및 산화 스트레스 등이 포함된다. "환경 스트레스 내성"이란 상기와 같은 환경 스트레스에 의한 식물체의 성장 저하 또는 생산성의 저하가 억제되거나 지연되는 형질을 말한다.In the present invention, "environmental stress" refers to an external factor that lowers the growth or productivity of a plant and is largely classified into a biological stress and an abiotic stress. Biological stresses typically include pathogens, and abiotic stresses include high concentrations of salt, drought (dry), low temperature, high temperature and oxidative stress. "Environmental stress tolerance" refers to a trait in which a decrease in growth or a decrease in productivity of a plant caused by environmental stress is suppressed or delayed.
본 발명의 일 구현 예에 따른 방법에서, 상기 환경 스트레스는 가뭄 스트레스일 수 있으나, 이에 제한되지 않는다.In the method according to an embodiment of the present invention, the environmental stress may be a drought stress, but is not limited thereto.
본 발명에 따른 OsIAA6 단백질의 범위는 서열번호 2로 표시되는 아미노산 서열을 갖는 단백질 및 상기 단백질의 기능적 동등물을 포함한다. "기능적 동등물"이란 아미노산의 부가, 치환 또는 결실의 결과, 상기 서열번호 2로 표시되는 아미노산 서열과 적어도 70% 이상, 바람직하게는 80% 이상, 더욱 바람직하게는 90% 이상, 더 더욱 바람직하게는 95% 이상의 서열 상동성을 갖는 것으로, 서열번호 2로 표시되는 단백질과 실질적으로 동질의 생리활성을 나타내는 단백질을 말한다. "실질적으로 동질의 생리활성"이란 식물체의 환경 스트레스 내성을 조절하는 활성을 의미한다.OsIAA6 according to the invention The range of proteins includes proteins having the amino acid sequence represented by SEQ ID NO: 2 and functional equivalents of such proteins. "Functional equivalent" means at least 70%, preferably at least 80%, more preferably at least 90%, even more preferably at least 70% of the amino acid sequence represented by SEQ ID NO: 2 as a result of the addition, substitution, or deletion of the amino acid Is 95% or more of sequence homology, and refers to a protein that exhibits substantially homogeneous physiological activity with the protein represented by SEQ ID NO: 2. "Substantially homogeneous physiological activity" means activity that modulates the environmental stress tolerance of a plant.
용어 "재조합"은 세포가 이종의 핵산을 복제하거나, 상기 핵산을 발현하거나 또는 펩티드, 이종의 펩티드 또는 이종의 핵산에 의해 암호된 단백질을 발현하는 세포를 지칭하는 것이다. 재조합 세포는 상기 세포의 천연 형태에서는 발견되지 않는 유전자 또는 유전자 절편을, 센스 또는 안티센스 형태 중 하나로 발현할 수 있다. 또한 재조합 세포는 천연 상태의 세포에서 발견되는 유전자를 발현할 수 있으며, 그러나 상기 유전자는 변형된 것으로서 인위적인 수단에 의해 세포내 재도입된 것이다.The term “recombinant” refers to a cell in which a cell replicates a heterologous nucleic acid, expresses the nucleic acid, or expresses a protein encoded by a peptide, a heterologous peptide, or a heterologous nucleic acid. Recombinant cells can express genes or gene fragments that are not found in their natural form in either the sense or antisense form. Recombinant cells can also express genes found in natural cells, but the genes are modified and intracellularly reintroduced by artificial means.
본 발명에서, 상기 OsIAA6 유전자 서열은 재조합 발현 벡터 내로 삽입될 수 있다. 용어 "재조합 발현 벡터"는 세균 플라스미드, 파아지, 효모 플라스미드, 식물 세포 바이러스, 포유동물 세포 바이러스, 또는 다른 벡터를 의미한다. 대체로, 임의의 플라스미드 및 벡터는 숙주 내에서 복제 및 안정화할 수 있다면 사용될 수 있다.In the present invention, the OsIAA6 gene sequence may be inserted into a recombinant expression vector. The term "recombinant expression vector" means a bacterial plasmid, phage, yeast plasmid, plant cell virus, mammalian cell virus, or other vector. In principle, any plasmid and vector can be used as long as it can replicate and stabilize in the host.
본 발명의 OsIAA6 유전자 서열 및 적당한 전사/번역 조절 신호를 포함하는 발현 벡터는 당업자에 주지된 방법에 의해 구축될 수 있다. 상기 방법은 시험관내 재조합 DNA 기술, DNA 합성 기술 및 생체 내 재조합 기술 등을 포함한다. 상기 DNA 서열은 mRNA 합성을 이끌기 위해 발현 벡터 내의 적당한 프로모터에 효과적으로 연결될 수 있다. 또한 발현 벡터는 번역 개시 부위로서 리보좀 결합 부위 및 전사 터미네이터를 포함할 수 있다.Expression vectors comprising the OsIAA6 gene sequence of the present invention and appropriate transcriptional / translational control signals can be constructed by methods well known to those skilled in the art. Such methods include in vitro recombinant DNA techniques, DNA synthesis techniques, in vivo recombinant techniques, and the like. The DNA sequence can be effectively linked to a suitable promoter in the expression vector to drive mRNA synthesis. Expression vectors may also include ribosomal binding sites and transcription terminators as translation initiation sites.
본 발명의 재조합 벡터의 바람직한 예는 아그로박테리움 투머파시엔스와 같은 적당한 숙주에 존재할 때 그 자체의 일부, 소위 T-영역을 식물 세포로 전이시킬 수 있는 Ti-플라스미드 벡터이다. 다른 유형의 Ti-플라스미드 벡터(EP 0 116 718 B1호 참조)는 현재 식물 세포, 또는 잡종 DNA를 식물의 게놈 내에 적당하게 삽입시키는 새로운 식물이 생산될 수 있는 원형질체로 잡종 DNA 서열을 전이시키는데 이용되고 있다. Ti-플라스미드 벡터의 특히 바람직한 형태는 EP 0 120 516 B1호 및 미국 특허 제4,940,838호에 청구된 바와 같은 소위 바이너리(binary) 벡터이다. 본 발명에 따른 DNA를 식물 숙주에 도입시키는데 이용될 수 있는 다른 적합한 벡터는 이중 가닥 식물 바이러스(예를 들면, CaMV) 및 단일 가닥 바이러스, 게미니 바이러스 등으로부터 유래될 수 있는 것과 같은 바이러스 벡터, 예를 들면 비완전성 식물 바이러스 벡터로부터 선택될 수 있다. 그러한 벡터의 사용은 특히 식물 숙주를 적당하게 형질전환하는 것이 어려울 때 유리할 수 있다.Preferred examples of recombinant vectors of the invention are Ti-plasmid vectors capable of transferring part of themselves, the so-called T-region, to plant cells when present in a suitable host such as Agrobacterium tumerfaciens. Another type of Ti-plasmid vector (see EP 0 116 718 B1) is used to transfer hybrid DNA sequences to protoplasts from which current plant cells or new plants can be produced that properly insert hybrid DNA into the plant's genome. have. A particularly preferred form of the Ti-plasmid vector is the so-called binary vector as claimed in EP 0 120 516 B1 and US Pat. No. 4,940,838. Other suitable vectors that can be used to introduce the DNA according to the invention into a plant host are viral vectors, such as those which can be derived from double stranded plant viruses (eg CaMV) and single stranded viruses, gemini viruses, etc. For example, it may be selected from an incomplete plant viral vector. The use of such vectors can be advantageous especially when it is difficult to properly transform a plant host.
발현 벡터는 바람직하게는 하나 이상의 선택성 마커를 포함할 것이다. 상기 마커는 통상적으로 화학적인 방법으로 선택될 수 있는 특성을 갖는 핵산 서열로, 형질전환된 세포를 비형질전환 세포로부터 구별할 수 있는 모든 유전자가 이에 해당된다. 그 예로는 글리포세이트(glyphosate) 또는 포스피노트리신(phosphinothricin)과 같은 제초제 저항성 유전자, 카나마이신(kanamycin), G418, 블레오마이신(Bleomycin), 하이그로마이신(hygromycin), 클로람페니콜(chloramphenicol)과 같은 항생제 내성 유전자, aadA 유전자 등이 있으나, 이에 한정되는 것은 아니다.The expression vector will preferably comprise one or more selectable markers. The marker is typically a nucleic acid sequence having properties that can be selected by chemical methods, and all genes that can distinguish transformed cells from non-transformed cells. Examples include herbicide resistance genes such as glyphosate or phosphinothricin, kanamycin, G418, bleomycin, hygromycin, and chloramphenicol. Resistance gene, aadA gene, and the like, but are not limited thereto.
본 발명의 재조합 벡터에서, 프로모터는 CaMV 35S, 액틴, 유비퀴틴, pEMU, MAS, 히스톤 프로모터, Clp 프로모터일 수 있으나, 이에 제한되지 않는다. "프로모터"란 용어는 구조 유전자로부터의 DNA 업스트림의 영역을 의미하며 전사를 개시하기 위하여 RNA 폴리머라아제가 결합하는 DNA 분자를 말한다. "식물 프로모터"는 식물 세포에서 전사를 개시할 수 있는 프로모터이다. "구성적(constitutive) 프로모터"는 대부분의 환경 조건 및 발달 상태 또는 세포 분화하에서 활성이 있는 프로모터이다. 형질전환체의 선택이 각종 단계에서 각종 조직에 의해서 이루어질 수 있기 때문에 구성적 프로모터가 본 발명에서 바람직할 수 있다. 따라서, 구성적 프로모터는 선택 가능성을 제한하지 않는다.In the recombinant vector of the present invention, the promoter may be, but is not limited to, CaMV 35S, actin, ubiquitin, pEMU, MAS, histone promoter, Clp promoter. The term "promoter" refers to a region of DNA upstream from a structural gene and refers to a DNA molecule to which an RNA polymerase binds to initiate transcription. A "plant promoter" is a promoter capable of initiating transcription in plant cells. A "constitutive promoter" is a promoter that is active under most environmental conditions and developmental conditions or cell differentiation. Constitutive promoters may be preferred in the present invention because selection of the transformants may be made by various tissues at various stages. Thus, the constitutive promoter does not limit the selection possibilities.
본 발명의 재조합 벡터에서, 통상의 터미네이터를 사용할 수 있으며, 그 예로는 노팔린 신타아제(NOS), 벼 α-아밀라아제 RAmy1 A 터미네이터, 파세올린(phaseoline) 터미네이터, 아그로박테리움 투메파시엔스(Agrobacterium tumefaciens)의 옥토파인(Octopine) 유전자의 터미네이터, 대장균의 rrnB1/B2 터미네이터 등이 있으나, 이에 한정되는 것은 아니다. 터미네이터의 필요성에 관하여, 그러한 영역이 식물 세포에서의 전사의 확실성 및 효율을 증가시키는 것으로 일반적으로 알려져 있다. 그러므로, 터미네이터의 사용은 본 발명의 내용에서 매우 바람직하다.In the recombinant vectors of the present invention, conventional terminators can be used, for example nopalin synthase (NOS), rice α-amylase RAmy1 A terminator, phaseoline terminator, Agrobacterium tumefaciens ( Agrobacterium tumefaciens) Terminator of the octopine gene, and the rrnB1 / B2 terminator of Escherichia coli, but are not limited thereto. With regard to the need for terminators, such regions are generally known to increase the certainty and efficiency of transcription in plant cells. Therefore, the use of terminators is highly desirable in the context of the present invention.
본 발명의 벡터를 진핵 세포에 형질전환시키는 경우에는 숙주세포로서, 효모(Saccharomyce cerevisiae), 곤충세포, 사람세포(예컨대, CHO 세포주(Chinese hamster ovary), W138, BHK, COS-7, 293, HepG2, 3T3, RIN 및 MDCK 세포주) 및 식물세포 등이 이용될 수 있다. 숙주세포는 바람직하게는 식물세포이다.When transforming the vector of the present invention into eukaryotic cells, yeast ( Saccharomyce cerevisiae ), insect cells, human cells (e.g., CHO cell line (Chinese hamster ovary), W138, BHK, COS-7, 293, HepG2) , 3T3, RIN and MDCK cell lines) and plant cells and the like can be used. The host cell is preferably a plant cell.
본 발명의 벡터를 숙주세포 내로 운반하는 방법은 미세주입법, 칼슘포스페이트 침전법, 전기천공법, 리포좀-매개 형질감염법, DEAE-덱스트란 처리법, 및 유전자 밤바드먼트 등에 의해 벡터를 숙주세포 내로 주입할 수 있다.The method of transporting the vector of the present invention into the host cell may be performed by injecting the vector into the host cell by microinjection, calcium phosphate precipitation, electroporation, liposome-mediated transfection, DEAE-dextran treatment, gene bombardment, or the like. can do.
또한, 본 발명은 벼 유래 OsIAA6(Oryza sativa Aux/IAA 6) 단백질을 코딩하는 유전자를 포함하는 재조합 벡터로 식물세포를 형질전환하는 단계; 및 상기 형질전환된 식물세포로부터 식물을 재분화하는 단계를 포함하는 환경 스트레스에 대한 내성이 조절된 형질전환 식물체의 제조 방법을 제공한다. In addition, the present invention comprises the steps of transforming plant cells with a recombinant vector comprising a gene encoding a rice-derived OsIAA6 (Oryza sativa Aux / IAA 6) protein; And it provides a method for producing a transformed plant is controlled resistance to environmental stress comprising the step of regenerating the plant from the transformed plant cells.
본 발명의 일 구현 예에 따른 방법은 벼 유래 OsIAA6 유전자를 포함하는 재조합 벡터를 식물세포에 과발현시켜 식물의 환경 스트레스에 대한 내성을 증가시키는 것을 특징으로 하나, 이에 제한되지 않는다.Method according to an embodiment of the present invention is characterized by increasing the resistance to environmental stress of the plant by overexpressing a recombinant vector comprising a rice-derived OsIAA6 gene in plant cells, but is not limited thereto.
바람직하게는, 상기 OsIAA6 단백질은 서열번호 2의 아미노산 서열로 이루어질 수 있다. Preferably, the OsIAA6 protein may be composed of the amino acid sequence of SEQ ID NO: 2.
본 발명의 일 구현 예에 따른 방법에서, 상기 환경 스트레스는 가뭄 스트레스일 수 있으나, 이에 제한되지 않는다.In the method according to an embodiment of the present invention, the environmental stress may be a drought stress, but is not limited thereto.
본 발명의 방법은 본 발명에 따른 재조합 벡터로 식물 세포를 형질전환하는 단계를 포함하는데, 상기 형질전환은 예를 들면, 아그로박테리움 튜머파시엔스(Agrobacterium tumefiaciens)에 의해 매개 될 수 있다. 또한, 본 발명의 방법은 상기 형질전환된 식물 세포로부터 형질전환 식물을 재분화하는 단계를 포함한다. 형질전환 식물 세포로부터 형질전환 식물을 재분화하는 방법은 당업계에 공지된 임의의 방법을 이용할 수 있다.The method of the present invention comprises the step of transforming a plant cell with a recombinant vector according to the present invention, the transformation may be mediated by, for example, Agrobacterium tumefiaciens ( Agrobacterium tumefiaciens ). The method also includes the step of regenerating the transgenic plant from said transformed plant cell. The method for regenerating the transformed plant from the transformed plant cell may use any method known in the art.
형질전환된 식물세포는 전식물로 재분화되어야 한다. 캘러스 또는 원형질체 배양으로부터 성숙한 식물의 재분화를 위한 기술은 수많은 여러 가지 종에 대해서 당업계에 주지되어 있다.Transformed plant cells should be re-differentiated into whole plants. Techniques for regeneration of mature plants from callus or protoplast cultures are well known in the art for many different species.
또한, 본 발명은 상기 방법에 의해 제조된 환경 스트레스에 대한 내성이 조절된 형질전환 식물체 및 이의 종자를 제공한다. In addition, the present invention provides a transgenic plant and its seed having a controlled resistance to environmental stress produced by the method.
바람직하게는, 상기 형질전환 식물체 및 이의 종자는 환경 스트레스에 대한 내성이 증가된 형질전환 식물체 및 이의 종자이다. Preferably, the transgenic plant and its seeds are transgenic plants and their seeds with increased resistance to environmental stress.
상기 식물체는 애기장대, 감자, 가지, 담배, 고추, 토마토, 우엉, 쑥갓, 상추, 도라지, 시금치, 근대, 고구마, 샐러리, 당근, 미나리, 파슬리, 배추, 양배추, 갓무, 수박, 참외, 오이, 호박, 박, 딸기, 대두, 녹두, 강낭콩, 완두 등의 쌍자엽 식물 또는 벼, 보리, 밀, 호밀, 옥수수, 사탕수수, 귀리, 양파 등의 단자엽 식물일 수 있으며, 바람직하게는 단자엽 식물이며, 더욱 바람직하게는 벼 식물체일 수 있으나, 이에 제한되지 않는다.The plant is Arabidopsis, potato, eggplant, tobacco, pepper, tomato, burdock, garland chrysanthemum, lettuce, bellflower, spinach, chard, sweet potato, celery, carrot, buttercup, parsley, cabbage, cabbage, gatchi, watermelon, melon, cucumber, Dicotyledonous plants such as pumpkins, gourds, strawberries, soybeans, green beans, kidney beans, peas, or monocotyledonous plants, such as rice, barley, wheat, rye, corn, sugarcane, oats, and onions, preferably monocotyledonous plants, and more. Preferably it may be a rice plant, but is not limited thereto.
또한, 본 발명은 서열번호 2의 아미노산 서열로 이루어진, 벼 유래 OsIAA6(Oryza sativa Aux/IAA 6) 단백질을 코딩하는 유전자를 유효성분으로 함유하는, 식물체의 환경 스트레스 내성 조절용 조성물을 제공한다. 상기 조성물은 유효성분으로 서열번호 2의 아미노산 서열로 이루어진 OsIAA6 단백질을 코딩하는 유전자를 함유하며, 상기 유전자 또는 상기 유전자를 포함하는 재조합 벡터를 식물체에 형질전환시킴으로써 식물체의 환경 스트레스 내성, 바람직하게는 가뭄 스트레스 내성을 증가시킬 수 있는 것이다.The present invention also provides a composition for regulating environmental stress resistance of plants, comprising a gene encoding the rice-derived OsIAA6 (Oryza sativa Aux / IAA 6) protein consisting of the amino acid sequence of SEQ ID NO: 2 as an active ingredient. The composition contains a gene encoding an OsIAA6 protein consisting of the amino acid sequence of SEQ ID NO: 2 as an active ingredient, the plant is transformed into a plant by transforming the gene or a recombinant vector containing the gene into an environmental stress tolerance, preferably drought. It can increase stress tolerance.
또한, 본 발명은 식물체의 환경 스트레스 내성을 조절하기 위한, 서열번호 2의 아미노산 서열로 이루어진 벼 유래 OsIAA6(Oryza sativa Aux/IAA 6) 단백질을 코딩하는 유전자의 용도를 제공한다. 상기 OsIAA6 단백질을 코딩하는 유전자는 바람직하게는 식물체의 가뭄 스트레스 내성을 증가시키는데 이용될 수 있다.The present invention also provides the use of a gene encoding a rice-derived OsIAA6 (Oryza sativa Aux / IAA 6) protein consisting of the amino acid sequence of SEQ ID NO: 2 to regulate the environmental stress resistance of plants. The gene encoding the OsIAA6 protein can preferably be used to increase the drought stress resistance of the plant.
이하, 본 발명을 실시예에 의해 상세히 설명한다. 단, 하기 실시예는 본 발명을 예시하는 것일 뿐, 본 발명의 내용이 하기 실시예에 한정되는 것은 아니다.Hereinafter, the present invention will be described in detail by way of examples. However, the following examples are merely to illustrate the invention, but the content of the present invention is not limited to the following examples.
재료 및 방법Materials and methods
플라스미드 구축 및 벼의 형질전환Plasmid Construction and Transformation of Rice
OsIAA6 (AK068600)와 전장 cDNA는 벼('일미' 품종)에서 추출한 총 RNA를 주형으로 하고, OsIAA6 정방향(5'- caccatggaagaagggtccaacaaaa -3'; 서열번호 3) 및 OsIAA6 역방향(5'- ttagaccctagcagtagctcca -3'; 서열번호 4) 프라이머를 이용하여 증폭하였다. 증폭된 각각의 전장 cDNA는 게이트웨이 시스템(Invitrogen, 미국)을 이용하여 PGD1 프로모터를 가지고 있는 p700 벡터로 삽입하였다. PGD1:OsIAA6 벡터는 아그로박테리움 매개 공동 배양 방법(Jang et al., 1999, Mol. Breeding 5:453-461)을 통해 식물체 내로 도입하였다. OsIAA6 (AK068600) and full-length cDNA are the template of total RNA extracted from rice ('ilmi' cultivar), and the OsIAA6 forward (5'-caccatggaagaagggtccaacaaaa-3 '; SEQ ID NO: 3) and the OsIAA6 reverse (5'-ttagaccctagcagtagctcca -3') SEQ ID NO: 4) using a primer. Amplified respective full-length cDNA by using the Gateway system (Invitrogen, USA) was inserted into the vector p700 with a PGD1 promoter. PGD1: OsIAA6 vectors were introduced into plants via the Agrobacterium mediated co-culture method (Jang et al., 1999, Mol. Breeding 5: 453-461).
스트레스 및 옥신 아날로그 (NAA; naphthalene-1-acetic acid) 처리Stress and auxin analog (NAA; naphthalene-1-acetic acid) treatment
비생물적 스트레스에 대한 반응에 있어서 OsIAA6 유전자의 발현 경향을 분석하기 위해서, 비형질전환(NT, '일미' 품종) 벼 식물체를 비닐 하우스 내의 토양에서 4주간 키웠다. 4주령 비형질전환 식물체를 가뭄 스트레스 처리를 위해 식물체 전체를 3시간 동안 공기 건조시켰다. 또한, 염 스트레스를 위해서 식물체 전체를 200mM 염화나트륨 용액으로 옮겨 24시간 두었고, 저온 스트레스의 처리를 위해서는 식물체 전체를 4℃ 저온 챔버에 넣고 24시간 두었다.To analyze the trend of expression of the OsIAA6 gene in response to abiotic stress, nontransformed (NT, 'Ilmi' cultivar) rice plants were grown for 4 weeks in soil in a plastic house. Four-week-old transgenic plants were air dried for three hours for drought stress treatment. In addition, the whole plant was transferred to 200 mM sodium chloride solution for salt stress for 24 hours, and the whole plant was placed in a 4 ° C. low temperature chamber for 24 hours for low temperature stress treatment.
식물체에 옥신 아날로그 처리를 위하여 비형질전환(NT, '일미' 품종) 벼 식물체를 챔버에서 6일 동안 키운 후 식물체를 100uM 농도의 NAA가 들어있는 MS 배지로 옮겨 24시간 처리하였다.For transgenic analogues to plants, non-transformed (NT, 'Ilmi' varieties) rice plants were grown in a chamber for 6 days, and the plants were transferred to MS medium containing 100 uM NAA for 24 hours.
실시간 정량적 역전사 중합효소연쇄반응(Real-Time Quantitative RT-PCR)Real-Time Quantitative RT-PCR
비생물적 스트레스 및 옥신 아날로그(NAA; naphthalene-1-acetic acid) 처리 식물체의 잎 조직을 떼어내어 얼린 후, 얼린 잎 및 뿌리 조직을 액체 질소를 이용하여 분쇄하고 Qiagen RNeasy plant mini kit(Qiagen, 미국)를 사용하여 총 RNA를 추출하였다. 총 RNA의 1㎍을 Superscript Ⅱ cDNA 합성 키트(Invitrogen, 미국)를 사용한 첫 번째 가닥 cDNA 합성에 사용하였다. 유전자 발현 수준을 분석하기 위해서, Mx3000p 실시간 PCR 장비 및 Platinum SYBR Green qPCR SuperMix-UDG system(Invitrogen, 미국)을 사용하여 정량적 PCR을 수행하였다. 벼의 유비퀴틴 전사체를 표준화 지표로 사용하였고, OsIAA6 유전자 특이 프라이머는 3' UTR과 3' 엑손 부위에서 제작하였다. 정량적 RT-PCR 수행을 위해 사용한 프라이머는 하기 표 1과 같다.After removing and freezing the leaf tissue of abiotic stress and auxin analog (NAA; naphthalene-1-acetic acid) treated plants, the frozen leaf and root tissues are pulverized with liquid nitrogen and Qiagen RNeasy plant mini kit (Qiagen, USA) ) Was used to extract total RNA. 1 μg of total RNA was used for first strand cDNA synthesis using the Superscript II cDNA synthesis kit (Invitrogen, USA). To analyze gene expression levels, Mx3000p real-time PCR instrument and Platinum SYBR Quantitative PCR was performed using the Green qPCR SuperMix-UDG system (Invitrogen, USA). Rice ubiquitin transcript was used as a standardization index, and OsIAA6 gene specific primers were prepared at 3 'UTR and 3' exon sites. Primers used for quantitative RT-PCR are shown in Table 1 below.
표 1
Table 1
유전자명 | 염기서열 정보 (5'→3') | |
OsIAA6 | 정방향 | AGC ACC AGT GGT TGG TTG GCC (서열번호 5) |
역방향 | CCC AAC CAG CAT CCT GTC TCC T (서열번호 6) | |
OsUbi1 | 정방향 | ATG GAG CTG CTG CTG TTC TA (서열번호 7) |
역방향 | TTC TTC CAT GCT GCT CTA CC (서열번호 8) |
Gene name | Sequence information (5 '→ 3') | |
OsIAA6 | Forward direction | AGC ACC AGT GGT TGG TTG GCC (SEQ ID NO: 5) |
Reverse | CCC AAC CAG CAT CCT GTC TCC T (SEQ ID NO: 6) | |
| Forward direction | ATG GAG CTG CTG CTG TTC TA (SEQ ID NO: 7) |
Reverse | TTC TTC CAT GCT GCT CTA CC (SEQ ID NO: 8) |
가뭄 스트레스에 대한 표현형 분석Phenotypic Analysis of Drought Stress
PGD1:OsIAA6 형질전환 식물체를 비형질전환 식물체와 함께 토양에서 4주 동안 키운 후, 토양으로부터 물을 제거하여 가뭄 스트레스를 처리하였다. 가뭄 스트레스 처리 5일 후에, 물을 재공급하고 PGD1:OsIAA6 형질전환 식물체 및 비형질전환 식물체의 가뭄 스트레스에 의한 시각적인 증상을 이미지를 촬영하여 관찰하였다. PGD1: OsIAA6 transgenic plants were grown with soil for 4 weeks in the soil and then treated with drought stress by removing water from the soil. After 5 days of drought stress treatment, water was replenished and visual symptoms of drought stress in PGD1: OsIAA6 transgenic plants and non-transformed plants were photographed and observed.
펄스 진폭 변조(PAM, Pulse-Amplitude Modulation) 실험Pulse-Amplitude Modulation (PAM) Experiment
PGD1:OsIAA6 형질전환 식물체 3 라인을 비형질전환 식물체와 함께 2주 동안 토양에서 키운 후, 각 식물체로부터 잎을 수집하여 10분 동안 암 순응시켰다. PAM 분석을 위해서, 성장 챔버 내에서 시간 경과 방식으로 가뭄 조건을 처리하고, 각 지시된 시간에 펄스 변조 형광광도계(mini-PAM, Walz, 독일)를 사용하여 잎의 위쪽 표면으로부터 배출되는 엽록소 형광을 감지하여 Fv/Fm 값을 측정하였다. Fv/Fm 값은 광계Ⅱ의 활성을 나타낸다.Three lines of PGD1: OsIAA6 transgenic plants were grown in the soil for two weeks with non-transgenic plants, and then leaves were collected from each plant and allowed to acclimate for 10 minutes. For PAM analysis, drought conditions were treated in a growth chamber in a time-lapse fashion, and at each indicated time, chlorophyll fluorescence emitted from the upper surface of the leaves was extracted using a pulse modulated fluorophotometer (mini-PAM, Walz, Germany). The Fv / Fm value was measured by sensing. Fv / Fm values indicate activity of light system II.
실시예 1. 비생물적 스트레스 조건에서 Example 1 Under Abiotic Stress Conditions
OsIAA6 OsIAA6
유전자의 발현 경향 분석Analysis of Gene Expression Trend
가뭄 스트레스를 포함한 비생물적 스트레스에 대한 반응으로 OsIAA6 유전자의 발현 경향이 어떻게 변화하는지 확인하기 위해서 가뭄, 고염 및 저온 스트레스를 비형질전환 벼에 처리하였다. 그 결과, OsIAA6 유전자의 발현은 스트레스 무처리 대조구에 비해 가뭄 스트레스 시 6배, 고염 스트레스 시 4배 및 저온 스트레스 시 2.3배 발현양이 증가된 것을 확인하였다(도 1).To determine how the expression trend of OsIAA6 gene changes in response to abiotic stress, including drought stress, drought, high salt, and low temperature stress were treated in non-transformed rice. As a result, it was confirmed that the expression of OsIAA6 gene was increased 6 times in drought stress, 4 times in high salt stress, and 2.3 times in low temperature stress compared to the control group (FIG. 1).
실시예 2. 옥신 처리에 의한 Example 2. By Auxin Treatment
OsIAA6 OsIAA6
유전자의 발현 분석Gene expression analysis
옥신은 식물의 생장 및 발달을 조절하는 식물의 주요 호르몬 중 하나이다. 옥신반응은 식물체 내 옥신의 양을 정확하게 인지하여 신호전달체계를 통하여 ARF유전자의 발현을 조절하는데, Aux/IAA 단백질이 ARF 단백질의 음성적 조절자(negative regulator)로 식물체 내 옥신양에 따른 신호전달체계를 세밀하게 조절한다. 벼에 존재하는 31개의 Aux/IAA 유전자 중 비생물적 스트레스 조건에서 현저하게 증가하는 OsIAA6 유전자가 옥신 반응을 하는지 확인하기 위하여 6일 생장시킨 야생형 벼에 옥신 아날로그인 NAA를 100uM로 24시간 동안 처리하였다. 그 결과, OsIAA6 유전자는 무처리 대조구에 비해 약 2.7배 발현 증가를 보였다(도 2). 이상의 결과로 벼의 비생물적 스트레스 조건에서 현저히 증가하는 OsIAA6 유전자가 옥신반응을 한다는 것을 확인하였다.Auxins are one of the major hormones in plants that regulate their growth and development. The auxin reaction regulates the expression of ARF genes through the signaling system by accurately recognizing the amount of auxin in the plant. The Aux / IAA protein is a negative regulator of the ARF protein. Fine tune the In order to check whether OsIAA6 gene, which is significantly increased in abiotic stress conditions among 31 Aux / IAA genes in rice, reacted with auxin, NAA, an auxin analogue, was treated with 100 uM for 24 hours in wild type rice grown 6 days. . As a result, the OsIAA6 gene showed about 2.7-fold increase in expression compared to the untreated control (FIG. 2). As a result, it was confirmed that OsIAA6 gene, which is significantly increased under abiotic stress conditions of rice, reacts auxin.
실시예 3. Example 3.
OsIAA6 OsIAA6
유전자 과발현에 의한 가뭄 저항성 검증Drought Resistance Verification by Gene Overexpression
전술한 실시예 1을 통해 가뭄 스트레스 조건에서 OsIAA6 유전자가 강하게 발현 유도되는 것을 확인하였다. 이에 OsIAA6 유전자의 가뭄 저항성에 대한 잠재적인 기능을 확인하기 위해, OsIAA6 과발현 형질전환 벼 식물체를 제작하고, 과발현체에서 OsIAA6 유전자의 발현 양상을 확인하였다(도 3). 또한 5 라인의 과발현체를 대상으로 가뭄저항성을 확인하기 위하여 가뭄 스트레스를 처리하였다. 가뭄 스트레스 처리 3일 후, 야생형 비형질전환 식물체는 잎의 말림 및 시들음과 같은 가뭄 유도 손상의 약한 증상들을 보여주었다. 가뭄 스트레스 처리 시간의 증가와 함께, 야생형 비형질전환 식물체의 증상은 심각해졌으며, 가뭄 처리 5일째에 가뭄 유도에 의한 강한 손상 증상을 나타내었다. 비형질전환 식물체의 잎은 모두 말라버렸으며, 물을 재공급하여도 가뭄 스트레스 유도 손상으로부터 식물체는 회복되지 않았다(도 4 A). 하지만, OsIAA6 과발현 형질전환 식물체는 가뭄 스트레스에 대한 강한 저항성을 보여주었다. OsIAA6 과발현 형질전환 식물체는 가뭄 스트레스 처리 3일 후에도 잎의 손상이 야생형 비형질전환 식물체보다 적었다. 가뭄처리 5일째에는 비형질전환체와 OsIAA6 과발현 형질전환 식물체 모두 가뭄에 의하여 잎의 마름증상이 심하였지만 비형질전환 식물체에 비하여 식물체의 줄기부분이 단단하게 유지가 되고 있으며 더욱이 물 공급을 재개하자 가뭄 스트레스 유도 손상으로부터 회복되었다. 상기의 결과들을 통해 OsIAA6 유전자가 가뭄 스트레스에 대한 저항성을 증진시킬 수 있음을 알 수 있었다.In Example 1 described above, it was confirmed that OsIAA6 gene was strongly expressed under drought stress conditions. In order to confirm the potential function on the drought resistance of OsIAA6 gene, OsIAA6 overexpressed transgenic rice plants were prepared, and the expression pattern of OsIAA6 gene was confirmed in the overexpression (FIG. 3). In addition, drought stress was treated to identify drought resistance in overexpression of 5 lines. After 3 days of drought stress treatment, the wild type transgenic plants showed mild symptoms of drought induced damage such as leaf curling and wilting. With the increase of drought stress treatment time, the symptoms of wild type transgenic plants became severe, and on the 5th day of drought treatment, there was a strong symptom of drought induction. The leaves of the non-transformed plants were all dried, and the plants did not recover from the drought stress-induced damage even when water was resupplied (FIG. 4A). However, OsIAA6 overexpressing transgenic plants showed strong resistance to drought stress. OsIAA6 overexpressed transgenic plants showed less leaf damage than wild-type nontransgenic plants even after 3 days of drought stress treatment. On the 5th day of drought treatment, both non-transformers and OsIAA6 overexpressed transgenic plants suffered from drought severe leaves. However, the stems of the plants were firmly maintained compared to the non-transformed plants. Recovery from stress-induced injury. The above results show that OsIAA6 gene can enhance the resistance to drought stress.
가뭄 저항성에 있어서 OsIAA6의 기능을 확인하기 위해서, OsIAA6 과발현 형질전환 식물체의 독립적인 3개 라인을 사용하여 펄스 증폭 변조(PAM, Pulse-Amplitude Modulation) 시험을 수행하였다. PAM 분석의 Fv/Fm 값은 식물에 있어서 비생물적 스트레스의 영향을 관찰하는데 사용되는데, 가뭄 스트레스 처리에 의해 비형질전환 식물체는 Fv/Fm 값의 강한 감소를 나타내었다. 야생형 비형질전환 식물체에서 스트레스 무처리 시 Fv/Fm 값은 0.8이었으나, 가뭄 스트레스 처리 1시간 이후부터 Fv/Fm 값의 감소를 보이기 시작하였고, 스트레스 처리 시간의 증가와 함께 감소세가 가속화되는 결과를 보여주었다(도 4B, 야생형). 반면에, 비형질전환 식물체와는 달리 OsIAA6 과발현 형질전환 식물체들은 가뭄 스트레스에 의한 Fv/Fm 값의 감소가 지연되는 결과를 나타내었다. 3개의 OsIAA6 과발현 형질전환 식물체들은 가뭄 스트레스 처리 2시간까지 야생형 비형질전환 식물체보다 높은 값을 유지하였다. 이상의 결과는 OsIAA6의 과발현이 가뭄에 대한 식물체의 저항성을 증진시킴을 뒷받침하였다.To confirm the function of OsIAA6 in drought resistance, pulse-amplitude modulation (PAM) tests were performed using three independent lines of OsIAA6 overexpressing transgenic plants. The Fv / Fm values of the PAM assay were used to observe the effects of abiotic stress in plants, and the nontransformed plants showed a strong decrease in Fv / Fm values by drought stress treatment. The Fv / Fm value was 0.8 when no stress was treated in wild type transgenic plants, but the Fv / Fm value began to decrease after 1 hour of drought stress treatment, and the decrease accelerated with increasing stress treatment time. (FIG. 4B, wild type). On the other hand, unlike non-transformed plants, OsIAA6 overexpressed transgenic plants showed delayed decrease in Fv / Fm values due to drought stress. Three OsIAA6 overexpressing transgenic plants maintained higher values than wild type transgenic plants until 2 hours of drought stress treatment. These results supported that overexpression of OsIAA6 enhanced plant resistance to drought.
Claims (12)
- 벼 유래 OsIAA6(Oryza sativa Aux/IAA 6) 단백질을 코딩하는 유전자를 포함하는 재조합 벡터를 식물세포에 형질전환시키는 단계를 포함하는 식물의 환경 스트레스에 대한 내성을 조절하는 방법.A method of controlling plant resistance to environmental stress, comprising the step of transforming a plant cell with a recombinant vector comprising a gene encoding a rice-derived OsIAA6 (Oryza sativa Aux / IAA 6) protein.
- 제1항에 있어서, 상기 OsIAA6(Oryza sativa Aux/IAA 6) 단백질을 코딩하는 유전자를 식물세포에서 과발현시켜 식물의 환경 스트레스에 대한 내성을 증가시키는 것을 특징으로 하는 방법.The method of claim 1, wherein the gene encoding the OsIAA6 (Oryza sativa Aux / IAA 6) protein is overexpressed in plant cells, thereby increasing the plant's resistance to environmental stress.
- 제1항에 있어서, 상기 OsIAA6 단백질은 서열번호 2의 아미노산 서열로 이루어진 것을 특징으로 하는 방법.According to claim 1, wherein the OsIAA6 protein is characterized in that consisting of the amino acid sequence of SEQ ID NO: 2.
- 제1항에 있어서, 상기 환경 스트레스는 가뭄 스트레스인 것을 특징으로 하는 방법.The method of claim 1, wherein the environmental stress is a drought stress.
- 벼 유래 OsIAA6(Oryza sativa Aux/IAA 6) 단백질을 코딩하는 유전자를 포함하는 재조합 벡터로 식물세포를 형질전환하는 단계; 및Transforming plant cells with a recombinant vector comprising a gene encoding a rice-derived OsIAA6 (Oryza sativa Aux / IAA 6) protein; And상기 형질전환된 식물세포로부터 식물을 재분화하는 단계를 포함하는 환경 스트레스에 대한 내성이 조절된 형질전환 식물체의 제조 방법.Method for producing a transformed plant is controlled resistance to environmental stress comprising the step of regenerating the plant from the transformed plant cells.
- 제5항에 있어서, 상기 OsIAA6(Oryza sativa Aux/IAA 6) 단백질을 코딩하는 유전자를 식물세포에서 과발현시켜 환경 스트레스에 대한 내성이 증가된 형질전환 식물체를 제조하는 것을 특징으로 하는 방법.The method according to claim 5, wherein the gene encoding the OsIAA6 (Oryza sativa Aux / IAA 6) protein is overexpressed in plant cells to prepare a transgenic plant having increased resistance to environmental stress.
- 제5항에 있어서, 상기 OsIAA6 단백질은 서열번호 2의 아미노산 서열로 이루어진 것을 특징으로 하는 방법.The method of claim 5, wherein the OsIAA6 protein consists of the amino acid sequence of SEQ ID NO: 2. 7.
- 제5항에 있어서, 상기 환경 스트레스는 가뭄 스트레스인 것을 특징으로 하는 방법.6. The method of claim 5, wherein said environmental stress is a drought stress.
- 제5항의 방법에 의해 제조된 환경 스트레스에 대한 내성이 조절된 형질전환 식물체.A transgenic plant with controlled resistance to environmental stress produced by the method of claim 5.
- 제9항에 있어서, 상기 식물체는 환경 스트레스에 대한 내성이 증가된 것을 특징으로 하는 식물체.The plant of claim 9, wherein the plant has increased resistance to environmental stress.
- 제9항에 있어서, 상기 식물체는 단자엽 또는 쌍자엽 식물인 것을 특징으로 하는 형질전환 식물체.10. The transgenic plant of claim 9, wherein the plant is a monocotyledonous or dicotyledonous plant.
- 제9항에 따른 형질전환 식물체의 형질전환된 종자.Transformed seeds of the transgenic plant according to claim 9.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
PCT/KR2015/004311 WO2016175351A1 (en) | 2015-04-29 | 2015-04-29 | Rice-derived osiaa6 gene for increasing drought stress resistance of plant and use thereof |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
PCT/KR2015/004311 WO2016175351A1 (en) | 2015-04-29 | 2015-04-29 | Rice-derived osiaa6 gene for increasing drought stress resistance of plant and use thereof |
Publications (1)
Publication Number | Publication Date |
---|---|
WO2016175351A1 true WO2016175351A1 (en) | 2016-11-03 |
Family
ID=57198495
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/KR2015/004311 WO2016175351A1 (en) | 2015-04-29 | 2015-04-29 | Rice-derived osiaa6 gene for increasing drought stress resistance of plant and use thereof |
Country Status (1)
Country | Link |
---|---|
WO (1) | WO2016175351A1 (en) |
Citations (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
KR20120034588A (en) * | 2009-04-29 | 2012-04-12 | 바스프 플랜트 사이언스 게엠베하 | Plants having enhanced yield-related traits and a method for making the same |
US20120115232A1 (en) * | 2009-04-30 | 2012-05-10 | Osaka University | Method for inducing degradation of protein in mammalian cell |
US20120151629A1 (en) * | 2009-08-25 | 2012-06-14 | Basf Plant Science Company Gmbh | Nematode-Resistant Transgenic Plants |
-
2015
- 2015-04-29 WO PCT/KR2015/004311 patent/WO2016175351A1/en active Application Filing
Patent Citations (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
KR20120034588A (en) * | 2009-04-29 | 2012-04-12 | 바스프 플랜트 사이언스 게엠베하 | Plants having enhanced yield-related traits and a method for making the same |
US20120115232A1 (en) * | 2009-04-30 | 2012-05-10 | Osaka University | Method for inducing degradation of protein in mammalian cell |
US20120151629A1 (en) * | 2009-08-25 | 2012-06-14 | Basf Plant Science Company Gmbh | Nematode-Resistant Transgenic Plants |
Non-Patent Citations (2)
Title |
---|
SONG, YALING ET AL.: "Comprehensive Expression Profiling Analysis of OsIAA Gene Family in Developmental Processes and in Response to Phytohormone and Stress Treatments", PLANTA, vol. 229, 26 November 2008 (2008-11-26), pages 577 - 591, XP019715457 * |
SONG, YALING ET AL.: "Ectopic Overexpression of an AUXIN/INDOLE-3-ACETIC ACID (Aux/IAA) Gene OsIAA4 in Rice Induces Morphological Changes and Reduces Responsiveness to Auxin", INTERNATIONAL JOURNAL OF MOLECULAR SCIENCES, vol. 14, 28 June 2013 (2013-06-28), pages 13645 - 13656, XP055325996 * |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
AU2016202110B2 (en) | Methods of controlling plant seed and organ size | |
CA2516645C (en) | Abiotic stress responsive plant transcription factor polynucleotides and polypeptides and use thereof for generating transgenic plants | |
WO2018084522A1 (en) | Oryza sativa-derived gene for enhancing resistance to pre-harvest sprouting, and use thereof | |
WO2015125985A1 (en) | Osnf-ya7 gene for increasing drought stress resistance of plant and use thereof | |
KR101852530B1 (en) | OsiEZ1 gene from Oryza sativa controlling ligule and seed development of plant and uses thereof | |
KR101346586B1 (en) | Method for producing transgenic plant with increased ability of immune response against pathogen using reca1 gene from arabidopsis thaliana and the plant thereof | |
WO2016175351A1 (en) | Rice-derived osiaa6 gene for increasing drought stress resistance of plant and use thereof | |
KR101376522B1 (en) | OsMLD gene increasing tolerance to salt stress from rice and uses thereof | |
KR101664206B1 (en) | OsWOX13 gene from rice for increasing environmental stress resistance of plant and uses thereof | |
WO2018164293A1 (en) | Rice-derived roc10 gene for increasing plant resistance to drought stress, and use thereof | |
KR101402602B1 (en) | Method for producing transgenic plant with increased resistance to environmental stresses using oscyp18-2 gene | |
KR101412555B1 (en) | Method for producing transgenic plant with increased resistance to environmental stresses using OsCYP19-4 gene | |
WO2016159560A1 (en) | Sweet potato-derived ibhppd gene for regulating plant tolerance to environmental stress, and use thereof | |
Popescu | Contribution of boundary genes to fruit patterning and dehiscence in Arabidopsis thaliana | |
KR102431656B1 (en) | CaAPIK1 gene and Method for improving the resistance to the drought stress using CaAPIK1 in plants | |
KR102035645B1 (en) | Gene increasing tolerance to drought stress derived from Brassica rapa and uses thereof | |
KR101592863B1 (en) | D-h gene showing dwarf phenotype and uses thereof | |
KR20150106528A (en) | MSRB2 gene from pepper for increasing abiotic stress resistance of plant and uses thereof | |
KR101512979B1 (en) | Method for controlling polyploidy of plant using AtTIO TFFR mutant and the plant thereof | |
WO2018080031A1 (en) | Chara coralina-derived chexp gene and use therefor | |
KR101512978B1 (en) | Method for controlling polyploidy of plant using AtTIO TFFT mutant and the plant thereof | |
KR101499062B1 (en) | Method for controlling resistance to environmental stresses of plant using ARR22 gene and the plant thereof | |
KR101512974B1 (en) | Method for controlling polyploidy of plant using AtTIO TFARM1 mutant and the plant thereof | |
KR101512972B1 (en) | Method for controlling polyploidy of plant using AtTIO TFARM3 mutant and the plant thereof | |
KR101512969B1 (en) | Method for controlling polyploidy of plant using AtTIO TFNR mutant and the plant thereof |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 15890792 Country of ref document: EP Kind code of ref document: A1 |
|
NENP | Non-entry into the national phase |
Ref country code: DE |
|
122 | Ep: pct application non-entry in european phase |
Ref document number: 15890792 Country of ref document: EP Kind code of ref document: A1 |