WO2016174311A1 - Modification des protéines inductibles par des ions - Google Patents

Modification des protéines inductibles par des ions Download PDF

Info

Publication number
WO2016174311A1
WO2016174311A1 PCT/FI2016/050277 FI2016050277W WO2016174311A1 WO 2016174311 A1 WO2016174311 A1 WO 2016174311A1 FI 2016050277 W FI2016050277 W FI 2016050277W WO 2016174311 A1 WO2016174311 A1 WO 2016174311A1
Authority
WO
WIPO (PCT)
Prior art keywords
protein
ion
interest
inducible
splicing domain
Prior art date
Application number
PCT/FI2016/050277
Other languages
English (en)
Inventor
Hideo Iwai
A. Sesilja ARANKO
Original Assignee
University Of Helsinki
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by University Of Helsinki filed Critical University Of Helsinki
Publication of WO2016174311A1 publication Critical patent/WO2016174311A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/62—DNA sequences coding for fusion proteins
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/90—Fusion polypeptide containing a motif for post-translational modification
    • C07K2319/92—Fusion polypeptide containing a motif for post-translational modification containing an intein ("protein splicing")domain

Definitions

  • the present description relates to the field of recombinant protein production and protein engineering.
  • it provides novel fusion proteins and methods that can be used in production and modification of recombinant proteins and to conjugate peptide bonds.
  • Peptides can be produced by chemical synthesis and recombinant DNA technology. Chemical synthesis of peptides allows incorporation of any unnatural modifications, but has several drawbacks. Chemical synthesis can be more expensive than production by recombinant technology, mainly due to high raw material costs, and it requires specialist equipment. Due to these problems, large-scale production of peptides by chemical synthesis requires large initial investments in production facilities and may lead to dependency on the suppliers of raw materials and their pricing. This problem may be particularly significant in the pharmaceutical industry. In addition, the fidelity of chemical synthesis of peptides is low, which reduces the recovery yield and increases the requirement of purification steps and quality control to obtain a product of adequate quality. There are also limitations with the length of peptides that can be satisfactorily synthesized and is typically limited to ⁇ 30-40 amino acids in length. Finally, the large amounts of toxic solvents required for purification steps are environmental concerns that should be solved.
  • the tag can be removed by enzymatic cleavage following purification.
  • This enzymatic cleavage-step and removal of the tag are bottlenecks in the whole process, due to the need for expensive cleavage enzymes as well as possible scar sequence left from the proteolytic cleavage site, and it may cause safety concerns, depending on the source of the cleavage enzyme.
  • the cleavage enzyme has to be removed to obtain a highly pure protein product, thus adding a further purification step to the production process. Also product stability and requirement of modifications such as o amidation and backbone cyclization are difficult to achieve using traditional protein production methods. Attempts have been made to avoid the use of additional cleavage enzymes to remove tags.
  • IMPACTTM Intelligent Protein Mediated Purification with an Affinity Chitin-binding Tag
  • NewEngland Biolabs that has been used as a protein purification system utilizing the self-cleavage activity of protein-splicing elements, i.e. inteins [1], to separate the target protein from the affinity tag (Fig. 1 ).
  • the intein tag contains a chitin binding domain (CBD) for the affinity purification of the fusion protein on a chitin resin [2,3].
  • CBD chitin binding domain
  • Induction of on- column cleavage is induced by reducing thiol reagents, such as dithiothreitol (DTT), that release the target protein from the intein tag.
  • DTT dithiothreitol
  • this system has been used for Expressed Protein Ligation as it can also produce an alpha-thiol modified C-terminus of the target protein, which can be subsequently used for native chemical ligation [4,5].
  • the IMPACTTM system suffers e.g. from premature cleavage of the fusion protein because an active intein capable of cleavage is produced as a part of the fusion protein, and the intein is partially functional also in the absence of a thiol reagent [3].
  • the system requires using DTT which is toxic and harmful to the environment. Additionally, purification of proteins containing disulphide bonds is difficult when DTT is used.
  • cytotoxic proteins of interest it would also be desirable for cytotoxic proteins of interest to be produced in an inactive form (to avoid toxicity to the host cell) and to activate it by synthesis using ligation using EPL or protein trans-splicing.
  • Split inteins have been used for ligation of two or more proteins by protein trans-splicing (PTS). Natural or artificial split inteins have been used for ligation by PTS. However, fusion proteins with natural or artificial split intein fragments could result in insoluble requiring additional re-folding process and optimization [8].
  • the present disclosure relates to modified proteins and fusion proteins comprising an ion- inducible protein-splicing domain or fragments of an ion-inducible protein-splicing domain, wherein the ion-inducible protein-splicing domain is capable of controlled cleavage or splicing under predetermined conditions of ionic strength.
  • ion-inducible protein-splicing domains are therefore useful in controlling the cleavage reaction or splicing reaction and they can be used in various applications wherein controlled fusion protein modification is needed.
  • modified proteins and fusion proteins of the present disclosure are many fold. These include for example control of a target protein's enzymatic activity, purification of modified proteins, cleavage of tags from the fusion proteins, production of proteins toxic to host cells, ligation of proteins, cyclisation of proteins and peptides, antibody-drug conjugation, production of bi-specific antibodies, production of bi- specific antibody-drug conjugation, immobilization of proteins, C-terminal amidation of proteins, and modifying the carboxyl terminus of a protein with a thioester. Therefore, it is an object to provide a solution to at least some of these problems.
  • a protein fragment conjugation system comprising a first fusion protein and a second fusion protein wherein the first fusion protein comprises a first protein of interest followed by an N- terminal part of a split ion-inducible protein-splicing domain (ll-PSD N ) and, the second fusion protein comprises a C-terminal part of the split ion-inducible protein-splicing domain (ll-PSD c ), followed by a second protein of interest, wherein the N-terminal amino acid of the second protein of interest is Cys, Ser, or Thr; the C-terminal amino acids of the C-terminal part of the ion-inducible protein- splicing domain is Asn, Asp, or Gin; and wherein the ion-inducible protein-splicing domain fragment has a capability to remain unfolded and soluble at low ionic strength and to fold into an active form at a higher ionic strength retaining solubility.
  • the ion-inducible protein-splicing domain fragment has a capability to fold into an active form at a higher ionic strength retaining high solubility.
  • the higher ionic strength is an ionic strength, which is higher than the low ionic strength.
  • the protein fragment conjugation system allows producing the two fusion proteins independently and to ligate them together later. Because the protein-splicing domains of both fusion proteins remain inactive and soluble at a low ionic strength, the two proteins of interest can be ligated from the fusion proteins in a controlled manner by increasing the ionic strength of the medium in which they are provided.
  • the protein fragment conjugation system, as well as the fusion proteins used therein, also allows the production of poorly soluble proteins of interest or fragments thereof because the intein parts increase the solubility of the fusion protein.
  • the protein-splicing domain can be activated by increasing the ionic strength of the medium in which it is provided. Thus, e.g. multi-domain or large proteins that are toxic to a host cell can be expressed, and conjugated after production.
  • a fusion protein comprising a protein of interest followed by an ion-inducible protein-splicing domain (ll-PSD) and at least one purification tag sequence wherein the N-terminal amino acid of the ll-PSD is Cys, Ser or Ala ; the C-terminal amino acid of the ion-inducible protein-splicing domain comprises any amino-acid except for Asn or Gin followed by at least one purification tag sequence; and wherein the ion-inducible protein-splicing domain has a capability to remain unfolded at low ionic strength and to fold into an active form at a higher ionic strength.
  • ll-PSD ion-inducible protein-splicing domain
  • ion-inducible protein-splicing domains have a characteristic amino acid composition of the increased number of acidic amino acids (Glu and Asp) as observed typically for proteins from halophilic organisms compared with proteins from mesophilic organisms.
  • the ll-PSD comprises at least one conserved intein motif illustrated in Fig. 2 panel (A) or Fig. 3 illustrated in the reference by Tori et al [6] or listed as splicing motifs in InBase, the Intein Database (www.inteins.com) [1 ], accessed 22.04.2016.
  • the fusion protein of the second aspect makes it possible to produce and purify a protein/peptide of interest initially with the protein-splicing domain, and to cleave the protein of interest from the fusion protein in a controlled manner without premature cleavages.
  • the fusion protein can be produced in a low ionic strength medium and optionally purified when fused with the intein.
  • the ion- inducible protein-splicing domain adopts an active conformation, or form, and catalyzes cleavage and release of the protein/peptide of interest into the aqueous medium as exemplified in the embodiment of Fig. 1 1 .
  • the fusion protein is inactive at the low ionic strength, premature cleavage (in vivo cleavage) of the fusion protein can be avoided. Reducing agents are not necessary for the cleavage reaction. If optional reducing agents are used, they may be added to enhance the cleavage reaction. Further, the fusion protein is advantageous in that the C-terminal carboxyl group of the protein of interest can be modified with an amido group or thio-ester group when optional cleavage reagents are used as exemplified in the embodiment of Fig. 15. A thio-ester modified protein of interest can be subsequently modified with an N-terminally cysteinyl peptide by native chemical ligation (NCL) (Fig. 5.).
  • NCL native chemical ligation
  • the fusion protein is advantageous in that the presence of the ll-PSD and purification tag increases the solubility of the protein of interest when it is produced, as confirmed in Fig. 13B. Accordingly, the fusion protein helps to produce proteins that would normally be poorly soluble under such conditions, such as membrane proteins as exemplified in the embodiment of example 3 and in Fig.13.
  • a fusion protein comprising a protein of interest followed by an ion-inducible protein-splicing domain and at least one purification tag sequence, wherein the N-terminal amino acid of the protein of interest is a Cys residue; and the C-terminal amino acid of the ion-inducible protein-splicing domain is any amino acid except for Gin or Asn followed by any amino acid except for Ser, Cys or Thr; and the N-terminus of the at least one purification tag sequence connects to the C- terminus of the ion-inducible splicing tag wherein the ion-inducible protein-splicing domain has a capability to remain unfolded at low ionic strength and to fold into an active form at a higher ionic strength.
  • the ion-inducible protein-splicing domain has a capability to remain unfolded and soluble at low ionic strength and to fold into an active form at a higher ionic strength retaining solubility.
  • An advantage for the third aspect is that premature cyclisation of proteins/peptides of interest as well as undesired premature cleavages can be avoided by the fusion protein because the ion-inducible protein-splicing domain (ll-PSD) remains unfolded and inactive at low ionic strength.
  • Figs.H B and 1 1 C confirms the absence of premature cleavages when ll-PSD was fused instead of conventional inteins such as in IMPACTTM system (Fig. 1 1 A).
  • the protein-splicing domain remains attached to the purification tag (c.f. His-tag) and, consequently, bound to a column when ionic strength is increased. Because only the protein of interest is eluted, purification is enhanced and simplified.
  • the third aspect is illustrated by an embodiment shown in Fig. 6 and example 1 in Fig 1 1 , or example 4 in Fig. 14.
  • a fusion protein comprising a C-terminal part of an ion-inducible protein-splicing domain (ll-PSD c ), followed by a protein/peptide of interest followed by an N-terminal part of the ion-inducible protein-splicing domain (ll-PSD N ), wherein the N-terminal amino acid of the protein of interest comprises a Cys, Ser or Thr residue, the N-terminal amino acid of the N-terminal part of the ion-inducible protein- splicing domain is Cys or Ser; the C-terminal amino acid of the ion-inducible protein-splicing domain is Asn, Asp, or Gin, wherein the ion-inducible protein-splicing domain has a capability to remain unfolded at low ionic strength and to fold into an active form at a higher ionic strength.
  • An advantage for the fourth aspect is that the N-terminal and C-terminal parts of the protein/peptide of interest are not conjugated when the fusion protein is provided at a low ionic strength.
  • protein/peptide cyclization is induced only when the ionic strength is increased to a level where the ion-inducible protein-splicing domain adopts an active form.
  • FIG. 14 provided the evidence for the absence of cyclization/cleavage by ll-PSD and for the induced cyclization by increasing the ionic strength, as confirmed by mass-spectrometry (Fig. 14B) and by proteolytic digestion (Fig. 14E)
  • a polynucleotide encoding the fusion protein of any one of aspects, 2, 3, or 4, or the protein fragment conjugation system of the first aspect.
  • a plasmid comprising the polynucleotide of the fifth aspect.
  • a method of producing a protein of interest comprising a. Providing in an aqueous medium a fusion protein comprising the protein of interest and an ion-inducible protein-splicing domain, wherein the N-terminal amino acid of the ion-inducible protein-splicing domain is Cys, Ser or Ala; the C-terminal amino acid of the ion-inducible protein-splicing domain is any amino acid except for Asn or Gin and the ionic strength of the aqueous medium is low enough to keep the intein inactive; b. Increasing the ionic strength of the medium to fold the ion-inducible protein splicing domain into an active form; and c. Allowing the ion-inducible protein-splicing domain to cleave or ligate the protein of interest from the fusion protein.
  • Fig. 1 1 (B) and Fig. 14(A) confirm that the method is effective in producing the model protein of interest in the absence or presence of reducing agents.
  • an optional tag is attached to the ion- inducible protein-splicing domain or fragments of the ion-inducible protein-splicing domain, after the fusion protein is bound on a column, a highly pure protein of interest or a ligated protein of interest can be eluted by increasing ionic strength (Fig. 1 1 (C) and Fig. 12(C)).
  • a method of cyclizing a protein of interest comprising a. providing in an aqueous medium an optionally tagged fusion protein comprising the protein of interest with an N-terminal Cys residue followed by an ion-inducible protein-splicing domain with an N-terminal Cys, Ala or Ser residue, wherein the C-terminal amino acid of the ion-inducible protein-splicing domain is any amino acids except for Asn or Gin, which is followed by any purification tag sequence which does not start with Cys, Ser or Thr residue; the ion-inducible protein-splicing domain having a capability to remain unfolded at low ionic strength and a capability to fold into an active form at a higher ionic strength and wherein the ionic strength of the aqueous medium is low enough to keep the intein in an inactive form; b.
  • a ninth aspect there is provided a method of cyclizing a protein/peptide of interest comprising a.
  • a fusion protein comprising a C-terminal part of an ion-inducible protein-splicing domain (ll-PSD c ) followed by a protein of interest followed by an N-terminal part of the ion-inducible protein-splicing domain (ll-PSD N ), wherein the C-terminal amino acid of the ion-inducible protein-splicing domain is Asn, Asp, or Gin; and wherein the N-terminal residue protein of interest is Cys, Ser or Thr; and wherein the ion-inducible protein-splicing domain has a capability to remain unfolded at low ionic strength and a capability to fold into an active form at a higher ionic strength and wherein the ionic strength of the aqueous medium is low enough to keep the ion-inducible protein-splicing domain in an inactive form; b.
  • aqueous medium Increasing the ionic strength of the aqueous medium to fold the ion-inducible protein-splicing domain into an active form; c. Optionally adding a reducing agent when the protein of interest comprises a Cys residue; and d. Allowing the ion-inducible protein-splicing domain to catalyze cleavage of the cyclized protein of interest from the fusion protein.
  • a method of conjugating proteins of interest comprising a.
  • a first fusion protein comprising a first protein of interest attached to an N-terminal part of an ion-inducible protein-splicing domain (II- PSD N ), and a second fusion protein comprising a C-terminal part of the ion- inducible protein-splicing domain (ll-PSD c ), and a second protein of interest, wherein the C-terminal amino acid of the ion-inducible protein-splicing domain fused with the second protein of interest is Asn, Asp or Gin, and the first residue of 5 the second protein of interest is Cys, Ser, or Thr; the ion-inducible protein-splicing domain has a capability to remain unfolded at low ionic concentration and a capability to fold into an active form at a higher ionic strength; and the ionic strength of the aqueous medium is low enough to keep the proteinic) splicing domain inactive b.
  • step c the kinetics of the conjugation can be controlled by adjusting the ionic strength of the reaction solution.
  • a slower conjugation can be achieved at an ionic strength which deviates from the ionic strength in which an optimal conjugation speed is achieved, whereas faster conjugation can be achieved at an ionic strength which is near the ionic strength wherein an optimal conjugation speed is achieved.
  • aspects and embodiments of the present disclosure provide certain benefits.
  • One or several of the following benefits may be achieved: improved protein production; improved solubility of the fusion protein; improved antibody-drug conjugation, possibility to produce proteins that are sensitive to proteases, instable, or toxic; decreased thiol consumption; controlled conjugation; controlled cleavage; prevention of premature cleavage of the fusion protein.
  • Fig. 1 illustrates the principle and an embodiment of the ion-inducible self-cleavage tag (11ST) system. Any suitable promoter, such as T7 promoter, can be used.
  • Ni-NTA is an example embodiment of a tag (e.g. polyhistidine tag) used to purify the fusion protein.
  • IIST denotes the ion-inducible self-cleavage tag.
  • the IIST comprises an ion-inducible protein-splicing 30 domain followed by a purification tag.
  • POI stands for "protein of interest" or the target protein.
  • Fig. 2 shows the canonical intein motif catalyzing the protein-splicing reaction and the conserved regions of inteins [1 ,6].
  • Fig. 3A shows the conformational changes of the ion-inducible protein-splicing domains by increasing the ionic strength.
  • the ion-inducible feature of the ion-inducible protein-splicing domain can be verified by testing the activity or three-dimensional structural formation at low and high ionic strengths as could be monitored by [ 1 H, 15 N]-HSQC spectra of an ion-inducible protein-splicing domain.
  • Fig. 4 shows the purification mechanism used by the 11ST system exploiting an ion-inducible protein-splicing domain (ll-PSD).
  • the N-terminal ll-PSD residue can be Cys, Ser or Ala.
  • An identical system could be used for C-terminal amidation of POI.
  • Fig. 5 illustrates the principle of protein modification (ligation) by the 11ST system. In addition to high ionic concentration, thiol agents or/and N-cysteinyl peptide are used for C-terminal modification (Ligation) of the protein of interest (POI).
  • Fig. 6 illustrates the principle of protein cyclisation by the 11ST system.
  • the protein of interest contains an N-terminal cysteine, which can be introduced genetically or proteolytically.
  • Thio- ester mediated ligation by native chemical ligation results in a cyclized backbone of POI.
  • Fig. 7 illustrates the principle of using split ion-inducible protein-splicing domain (ll-PSD) to modify (ligate) proteins/peptides.
  • ll-PSD split ion-inducible protein-splicing domain
  • A Conventional split intein catalyzes spontaneous protein irans-splicing (PTS) upon mixing two precursor fusion proteins.
  • B Protein Ligation can only be initiated by increasing the ionic strength of the reaction mixture when a split ion-inducible protein-splicing domain is used as the fusion partner.
  • Fig. 8 illustrates the principle of protein/peptide cyclization using split ion-inducible protein- splicing domain.
  • Two split precursor fragments which can catalyze protein ligation in trans, can be re-arranged in one precursor by connecting the N-terminus of POI c and the C- terminus of POI N with a peptide bond. This can be achieved on the DNA level.
  • the precursor will produce a backbone-cyclized POI upon ion-induced protein splicing.
  • Fig 9 illustrates in vitro protein cyclization procedure using a split ion-inducible protein- splicing domain. Spontaneous cyclization of POI by split intein in cells and during purification is avoided using ion-inducible protein-splicing domain. Protein/peptide cyclization can be induced after protein purification by increasing the ionic strength.
  • Figs. 10 shows activation of an ion-inducible protein-splicing domain (HutMCM2 intein) by increasing (A) K + or (B) Na + concentration.
  • Fig. 10, panel (C) shows activation by different ionic salts and concentrations.
  • Fig. 1 1 shows comparison between IMPACTTM and the IIST system.
  • A Expression of fusion proteins using IMPACTTM system with various junction amino acids at 25 and 37 degrees Celsius. The fusion protein and premature cleavage products are indicated by arrows. The 25 and 37 indicate the temperatures used for the expression in Celsius. Junction amino acid types are indicated above the panel using standard single letter amino acid abbreviations.
  • GFP model protein
  • Fig. 12 shows the time course of protein ligation (modification) of a model protein (GB1 s) by protein irans-splicing (PTS) using a split HufMCM2 intein as ll-PSD at 2 M NaCI (A) or at 4 M NaCI (B).
  • the two time courses demonstrate that ligation kinetics can be controlled by adjusting the ionic strength. ON indicates overnight incubation.
  • C Production of TonB protein by inducible PTS using split ll-PSD.
  • Lane 1 purified N-precursor before mixing; lane 2, purified C-precursor before mixing; lane 3, immediately after mixing the N- and C- precursors in 3.5 M NaCI; lane 4, after 16-hour dialysis in 0 M NaCI; lane 5, after 16-hour dialysis in 3.5 M NaCI; lane 6, after 22-hour dialysis in 0 M NaCI; lane 7, after 22-hour dialysis in 3.5 M NaCI; lane 8, after 39-hour dialysis in 0 M NaCI; lane 9, after 39-hour in 3.5 M NaCI; lane 10, the ligation product after the second purification by IMAC.
  • Fig. 13 shows (A) protein ligation of a model membrane protein (GPCR) by protein irans- splicing using a split ion-inducible protein-splicing domain.
  • the ion-inducible protein-splicing domains are active in the presence of 1 % DDM (n-Dodecyl ⁇ -D-maltoside) which was used to solubilize the membrane protein and
  • B Comparison of the solubility of the N-terminal precursor using a split HutMCM2 intein with mesophilic inteins (SspDnaE and ⁇ /pt/DnaE inteins). S and P stand soluble fraction and pellet, respectively.
  • Fig. 14 shows examples of cyclization of a peptide (KalataBI ) (A-C) and GFP (D and E) by split ion-inducible protein-splicing domains
  • A Expression and purification of the precursor protein, followed by ion-induction without and with reducing reagents of DTT or TCEP.
  • B Purification of cyclized peptide (kalataBI ) from processed precursors by HPLC. The dotted line indicates the HPLC profile of authentic cyclic kalataBI .
  • C Mass analysis of HPLC peaks confirms formation of the cyclic peptide (kalataBI ).
  • FIG. 1 Illustration of the fusion protein bearing a green fluorescent protein (GFP) and linearization of cyclized GFP. The inverse triangle indicates a specific cleavage site of thrombin used for the backbone linearization.
  • E SDS-PAGE analysis of cyclization of GFP and linearization of cyclized GFP by thrombin digestion. Left panel shows time course of cyclization of GFP in the presence of 3.5 M NaCI. Lanes 0, 1 , 2, and 3 indicate 0 hour, 1 hour, 3 hours, and 19 hours after the salt-induction, respectively. Right panel shows linearization of circular GFP by thrombin digestion. Thr- and Thr+ indicate without and with thrombin digestion, respectively. Black and grey arrows indicate circular and linear GFP, respectively. The result confirms the cyclization of GFP as previously demonstrated [14].
  • Fig. 15 shows an example of purification and the C-terminal amidation of an antibody fragment (VHH) by IIST system.
  • A SDS-PAGE analysis of the purification and cleavage using a mixture of 2M NaCI and 1 M 15 N-labeled ammonium sulfate.
  • E indicates the elution from the first Ni-NTA purification of the fusion protein.
  • C indicates the cleavage reaction by increasing ionic concentration using NaCI and 15 N-labeled ammonium sulfate.
  • FT indicates the flow-through fraction from Ni-NTA column after removing the IIST-tag.
  • B [ 1 H, 15 N]- HSQC spectrum of the eluted VHH domain. The two peaks observed originate from the C- terminal 15 N-labeled amide group.
  • Fig. 16 shows (A) schematic drawing illustrating the procedure of antibody or antibody fragment conjugation with a toxin using split ll-PSD and (B) an example of conjugation of an antibody fragment (VHH domain) and a bacterial toxin by ion-induced PTS using split ll-PSD (HutMCM2 intein).
  • N-prec and C-prec indicates the purified N-precursor protein containing the N-terminal split ll-PSD and C-precursor protein containing the C-terminal split ll-PSD, respectively.
  • 0 indicate the sample immediately after the mixing the two precursors.
  • O/N indicates the sample after overnight incubation after the mixing in 4M NaCI.
  • FT indicates the flow-through fraction from Ni-NTA column to remove spliced split ll-PSD.
  • Fig. 17 shows examples of production of Fc-fusions using ll-PSD.
  • A Conjugation of a lectin (SVN) and Fc domain by PTS using ll-PSD.
  • B Conjugation of Sumo domain and Fc domain by PTS using ll-PSD.
  • 0, 1 , 2, 3, 8 indicates zero hour, 1 hour, two hours, three hours, and eight hours after induction of PTS.
  • Fig. 19 shows the sequence alignment of ten sequences of the protein-splicing domains from halophilic organisms grouped into Cluster 1 using ClustalW2 server (EMBL-EBI, http://www.ebi.ac.uk/Tools/msa/clustalw2/). Blocks A and G are indicated by underlines.
  • Fig. 20 shows the sequence alignment of seven sequences of the protein-splicing domains from halophilic organisms grouped into Cluster 2 using ClustalW2 server (EMBL-EBI, http://www.ebi.ac.uk/Tools/msa/clustalw2/). Blocks A and G are indicated by underlines.
  • Fig. 21 shows the sequence alignment of four sequences of the protein-splicing domains from halophilic organisms grouped into Cluster 4 using ClustalW2 server (EMBL-EBI, http://www.ebi.ac.uk/Tools/msa/clustalw2/). Blocks A and G are indicated by underlines.
  • SEQ ID NO: 1 is the amino acid sequence of Hut MCM2
  • SEQ ID NO: 2 is the amino acid sequence of Nph PolB1
  • SEQ ID NO: 3 is the amino acid sequence of Hwa RP0A2
  • SEQ ID NO: 4 is the nucleic acid sequence of a codon optimized Hut MCM2 fusion protein.
  • SEQ ID NO: 5 is the nucleotide of the oligonucleotide 1139
  • SEQ ID NO: 6 is the nucleotide of the oligonucleotide 11 19
  • SEQ ID NO: 7 is the nucleotide of the oligonucleotide 1140
  • SEQ ID NO: 8 is the nucleic acid sequence of Ht/iMCM2-kalataB1
  • SEQ ID NO: 9 is the nucleotide of the oligonucleotide 1120
  • SEQ ID NO: 10 is the nucleotide of the oligonucleotide 1731
  • SEQ ID NO: 1 1 is the nucleotide of the oligonucleotide I732
  • SEQ ID NO: 12 is the nucleotide of the oligonucleotide 1716
  • SEQ ID NO: 13 is the nucleotide of the oligonucleotide I822
  • SEQ ID NO: 14 is the nucleotide of the oligonucleotide I646
  • 15 is the nucleotide of the oligonucleotide I849
  • SEQ ID NO: 16 is the nucleotide of the oligonucleotide I850 Detailed description
  • IIST refers to ion-inducible self-cleavage tag comprising ll-PSD and a purification tag.
  • a "peptide” and a “polypeptide” are amino acid sequences including a plurality of consecutive polymerized amino acid residues.
  • peptides are molecules including up to 30 amino acid residues, and polypeptides include more than 30 amino acid residues.
  • the peptide or polypeptide may include modified amino acid residues, naturally occurring amino acid residues not encoded by a codon, and non- naturally occurring amino acid residues.
  • sequence identity means the percentage of exact matches of amino acid residues between two aligned sequences over the number of positions where there are residues present in both sequences. When one sequence has a residue with no corresponding residue in the other sequence, the alignment program allows a gap in the alignment, and that position is not counted in the denominator of the identity calculation. Sequence identity percentage can be calculated with any algorithm or software known in the art, such as clustal Omega (EMBL-EBI server).
  • a "protein of interest” refers to a peptide or a polypeptide of any size which may be produced with the products and methods of the present disclosure.
  • proteins of interest are an enzyme, a protein, an antibody, an antibody fragment, a membrane protein, a peptide hormone, or any other protein.
  • the terms "ion-inducible protein-splicing domain" and "N-PSD” refer to an intein-derived protein-splicing domain which is inactive at low ionic strength and active at a higher ionic strength.
  • the ion-inducible protein-splicing domain may have mutations in its amino acid sequence compared to the sequence from which it is derived. The mutations may have an effect on its properties, such as cleavage activity and specificity, salt tolerance, stability.
  • the ion-inducible protein-splicing domain may comprise at least a part of the canonical intein motif and/or a hedgehog/intein (HINT) family fold as described in Fig. 2 and in Fig. 3A.
  • the ll-PSD may comprise at least one highly conserved region Block 5 A, Block B, Block F or Block G of class 1 , 2 or 3 as defined in Fig. 2(B).
  • the N-terminal amino acid of the ion-inducible protein-splicing domain may be Cys, Ser or Ala and the C- terminal amino acid of the ion-inducible protein-splicing domain is Asn or Gin.
  • the ion-inducible protein-splicing domain may include the conserved residues at the N-terminal splicing region (Block A, Fig 2B).
  • a skilled person is able to asses suitability of a candidate II- 10 PSD e.g.
  • low ionic strength refers to an ionic strength wherein the ion-inducible 15 protein-splicing domain remains mostly unfolded to such a degree that is not capable of catalyzing ligation (protein splicing) of a peptide bond, i.e. it is inactive.
  • the exact ionic strength wherein a given ion-inducible protein-splicing domain remains inactive depends on factors such as the amino acid composition of the ion-inducible protein-splicing domain, presence of polar, non- 20 polar, charged and uncharged chemical groups in the medium, pH temperature, and co- solutes.
  • a suitable low ionic strength and high ionic strength for any ion-inducible protein-splicing domain e.g. by determining peptide bond ligation activity at different conditions with varying ionic strength, or structural analysis by NMR spectral analysis.
  • a low ionic strength may in 25 certain embodiments be the ionic strength of a growth medium, or a fermentation broth, in which the fusion protein comprising the ion-inducible protein-splicing domain is produced, when over-expressed in a host cell.
  • Non-limiting examples of low ionic strength include ionic strengths below 500mM such as at or below 450mM, 400mM, 350mM, 300mM, 300mM, 250mM, 200mM, 150mM, "l OOmM, 90mM, 8mM, 70mM, 60mM, 50mM, 45mM, 40mM, 30 35mM, 30mM, 25mM, 20mM, 15mM, "l OmM, 9mM, 8mM, 7mM, 6mM, or 5mM.
  • high ionic strength and “higher ionic strength” refers to an ionic strength wherein the ion-inducible protein-splicing domain is folded to such a degree that is capable of catalyzing cleavage or ligation of a peptide bond, i.e. wherein the intein is active.
  • the exact ionic strength wherein a given ion-inducible protein-splicing domain is active depends on 35 factors such as the amino acid composition of the ion-inducible protein-splicing domain, presence of polar, non-polar, charged and uncharged chemical groups in the medium, pH and temperature.
  • a high ionic strength may in certain embodiments be an ionic strength which is higher than that of the low ionic strength as defined above or higher than the ionic strength of a growth medium or a fermentation broth, in which the fusion protein comprising the ion-inducible protein-splicing domain is produced.
  • Non-limiting examples of high ionic strength include ionic strengths of 400mM or higher, such as 500mM, 600mM, 700mM, 800mM, 900mM 1 M, 1.5M, 2M, 2.5M, 3M, 3.5M, 4M, 4.5M, 5M or higher but preferably not exceeding the solubility of the salt produced to increase the ionic strength.
  • the high ionic strength is 400mM, when the low ionic strength is below this value.
  • the ratio of the high ionic strength to the low ionic strength is at least 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 1 ,5 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90 or 100, 150, 200, 250, 300, or 350.
  • the high ionic strength may be selected from a range between 400mM and 5M.
  • a "C-terminal part of an ion-inducible protein-splicing domain” refers to a part comprising at least 6 residues of the C-terminus of the ion-inducible protein-splicing domain.
  • an "N-terminal part of an ion-inducible protein-splicing domain” refers to a part comprising at least 10 residues of the N-terminus of the ion-inducible protein-splicing domain.
  • N-terminal and C-terminal parts of the ion-inducible protein-splicing domain complement each other such that when together, the two parts result into an active intein capable of catalyzing ligation and cleavage of a peptide bond at high ionic strength.
  • a "reducing thiol agent” refers to compounds having a thiol moiety, i.e -SH.
  • Non-limiting examples of reducing thiol agents are for example Dithiothreitol (DTT), mercaptoethanol, 2-Mercaptoethanol, cysteine, ethanethiol, thio-phenol, sodium methanethiolate (MESNA), (4-carboxylmethyl)thiophenol (MPAA), and a protein comprising a Cys residue.
  • the reducing thiol agent is a protein having the formula R-SH, wherein R is the protein.
  • a "reducing agent” refers to compounds having reducing capability such as TCEP (tris(2-carboxyethyl)phosphine) including reducing thiol agents.
  • a cleavage reagent refers to any compound with a hydroxyl group or an amino group.
  • aqueous medium is any aqueous medium wherein a peptide bond can be ligated by protein-splicing domain.
  • aqueous media include cell culture media, fermentation broths, cell-free protein synthesis media, aqueous solution mixed with water-soluble organic solvents, and buffered solutions.
  • an "active form" of an ion-inducible protein-splicing domain is a form in which it is able to catalyse formation of a peptide bond by protein splicing, or cleavage of a peptide bond.
  • the ion-inducible protein-splicing domain according to the present invention typically adapts the active form at a high ionic strength, and remains unfolded and inactive (>80% or > >90% or >95% of the fusion protein remaining unreacted), at a low ionic strength (as demonstrated in Fig.3).
  • the ion-inducible protein-splicing domain When the ion-inducible protein-splicing domain is derived from a halophilic or halotolerant organism, an active form can be obtained when the ion-inducible protein-splicing domain is at an ionic strength which is at or near the ionic strength typically encountered by or which is optimal for the halophilic or halotolerant organism in its natural environment.
  • the responsiveness of the ion-inducible protein-splicing domain to ionic strength required for the activity can be engineered by modifying the sequence component of any protein-splicing domains that are usually not responsive to ionic strength.
  • tags can be any tag attached to the intein.
  • tags are purification tags such as polyhistidine tags, chitin binding domain (CBD) tag, Streptavidin-tag, Avi-tag, Fc-tag, glutathione-S-transferase (GST) tag.
  • the ionic strength is increased by adding a salt.
  • the salts are sodium chloride, potassium chloride, sodium phosphate, potassium phosphate, magnesium chloride, ammonium sulfate, sodium bicarbonate, and sodium sulfate.
  • the last residue of an ion- inducible protein-splicing domain and the following residue is Ala.
  • the last residue of the ll-PSD is Ala, cleavage of the peptide bond at the C-terminal end of the ll-PSD by the ion-inducible protein-splicing domain cannot occur, yet it is capable of cleavage at the N- terminal junction of ll-PSD upon increasing the ionic strength.
  • FIG. 7 panel (B) An embodiment of the first aspect is illustrated in Fig 7 panel (B) and in Figs 12 and 13A.
  • An embodiment of the first aspect is illustrated in Fig. 7A and Fig. 7B with results of protein ligation experiments shown in Example 2 and Figure 12, providing the evidence for protein ligation/modification by PTS using ll-PSD domain.
  • Fig.13A demonstrates general applicability to membrane proteins.
  • Fig.13B confirms the advantage of split ll-PSD over other split intein for the improved solubility.
  • first fusion protein and the second fusion protein as the first precursor and the second precursor can be produced by chemical synthesis and at 5 least one precursor may comprise at least one non-natural amino acid in its sequence.
  • FIG. 1 An embodiment of the second aspect is illustrated in Fig. 1.
  • the tag at the C-terminus of the ion-inducible protein-splicing domain is optional. Any promoter can be used to control protein expression.
  • the C-terminal residue of the ion-inducible proteinic) splicing domain is any amino acid type except for Asn, Asp or Gin and/or the following amino acid of the C-terminal residue of the ion-inducible protein-splicing domain is any amino acid type except for Cys, Ser or Thr.
  • the C-terminal amino acid of the ion- inducible protein-splicing domain is Ala or Gly. In another embodiment it is any amino acid 15 except for Asp, Asn, Gin.
  • FIG. 4 An embodiment of the second aspect is illustrated in Fig. 4 and in Example 1 with results shown in Fig. 1 1 , providing the evidence for protein purification using ion-inducible cleavage.
  • FIG.6 An embodiment of the third aspect is illustrated in Fig.6.
  • FIG. 9 An embodiment of the fourth aspect is illustrated in Fig. 9.
  • the fusion protein comprises a purification tag.
  • Purification tags can be fused in front of the N-terminal part of an ion-inducible protein- splicing domain or at the downstream of the C-terminal part of an ion-inducible protein- splicing domain for convenient protein purification. Cyclisation can be induced when the ionic strength is increased after protein purification, thereby facilitating convenient purification of
  • Fig. 9 and Fig. 14 show the principle of protein/peptide cyclization and confirm production of a cyclized model protein/peptide (GFP and kalataBI ).
  • the ion-inducible protein-splicing domain has a sequence identity of at least 18% over the first 90 residues and the last 30 residues with, or 30 has the sequence of, an ion-inducible protein-splicing domain selected from the group listed in Table I, or an intein having the sequence of SEQ ID NO: 1 , 2 or 3.
  • sequence identity is 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39, 40, 41 , 42, 43, 44, 45, 46, 47, 48, 49, 50, 51 , 52, 53, 54, 55, 56, 57, 58, 59, 60, 61 , 62, 63, 64, 65, 66, 67, 68, 69, 70, 71 , 72, 73, 74, 75, 76, 77, 78, 79, 80, 81 , 82, 83, 84, 85, 86, 87, 88, 89, 90, 91 , 92, 93, 94, 95, 96, 97, 98, 99 or 100%.
  • the first 90 residues and the last 30 residues correspond to the numbering in SEQ ID NO: 1 .
  • At least 18% of the amino acids of the 120 residues comprising or consisting of the first 90 residues and the last 30 residues of the ion-inducible protein-splicing domain are either Glu or Asp.
  • At least 30% of the 120 residues comprising or consisting of the first 90 residues and the last 30 residues of the ion-inducible protein-splicing domain are either Glu, Asp, Ser, or Thr.
  • the protein of interest is a cytotoxic protein, an enzyme, a membrane protein, a large protein (>500 residues), an antibody, a bi-specific antibody, antibody fragments (Fv, Fab, VH, Fc fragments), a fragment of a large protein, effector domain, tag, label, drug, or toxin and wherein it optionally comprises a protease cleavage site.
  • the fusion protein comprises a tag, preferably an affinity tag or a detection tag such as a chitin binding domain, a polyhistidine tag, FLAG-tag, GST tag, Streptavidin tag, or Avi-tag.
  • the fusion protein is a fusion protein according to the second aspect.
  • N H3 is added to amidate the C-terminus of the protein of interest.
  • a reducing thiol agent is added to allow formation of a cleaved protein of interest with a C-terminal thioester, and the method further comprises d. providing a second protein of interest having a N-terminal Cys: and e. ligating the C-terminus of the protein of interest with the N-terminal Cys of the second protein of interest of step d.
  • a reducing thiol agent is added to allow formation of a cleaved the protein of interest with a C-terminal thioester, and the method further comprising d.
  • the second protein of interest having a N-terminal Cys: and e. ligating the C-terminus of the protein of interest with the N-terminal Cys of the second protein of interest of step d; and the second protein of interest is a marker, an affinity tag, or a chemical or radioactive label or an antigenic determinant.
  • the reducing thiol agent is a protein with an R-SH group.
  • the C-terminus of the protein of interest is modified by the N-terminal Cys residue of the protein of interest.
  • the aqueous medium is a fermentation medium and/or a buffer in which the fusion protein is provided after purification and before step b.
  • the first fusion protein is expressed by a first plasmid and the second fusion protein is expressed by a second plasmid.
  • the first protein of interest and/or the second protein of interest is selected from proteins or fragments from a group consisting of toxin, cytotoxic protein, restriction endonuclease, protease, antibody, bi-specific antibody, large protein, antibody fragments (Fv, Fab, VH, Fc), membrane protein.
  • the fusion protein comprises at least one tag.
  • the low ionic strength is below 400 mM and the ion-inducible protein-splicing domain is folded to an active form (>80% or >90% or >95% activity) at a concentration selected from the range from 400mM to 5M. Lower concentration reduces the ligation/cleavage rates.
  • the protein-splicing domain comprises at least one highly conserved region of Fig. 2A (blocks A, B, F, G) and the fusion protein shows disordered [ 1 H, 15 N]-HSQC spectrum at 20 mM Na phosphate buffer and well-dispersed [ 1 H, 15 N]-HSQC spectrum at 3.5M NaCI.
  • Protein-splicing domains which were identified as inteins in InBase [5], from halophilic organisms were cloned using polymerase chain reactions (Table I). The activity of cloned inteins was tested as the fusion proteins bearing an ion-inducible protein-splicing domain. Additionally several protein-splicing domains annotated as intein in other uniprot database were also tested (Table I). The cis-splicing precursors bearing an intein from halophilic organisms were expressed in E.coli under an inducible T7 promoter.
  • an active protein-splicing domain produces the expected spliced product (His-tagged GB1 -GB1 without the protein-splicing domain)
  • ion-inducible protein-splicing domains are inactive in E.coli, resulting in the N-terminally His-tagged precursor proteins without any spliced product.
  • the non-spliced fusion protein bearing inactive protein-splicing domains were purified by I MAC using the N-terminal His-tagged for in vitro activity tests.
  • Fusion proteins at a final concentration of 100 ⁇ purified from IMAC was mixed with various salts, varying the final concentrations of from 0 to 4.5 M (Fig.10) in the presence of 0.5 mM (tris(2-carboxyethyl)phosphine) (TCEP).
  • TCEP tris(2-carboxyethyl)phosphine
  • the reactions were incubated at 37°C overnight (-20 hours), which were followed by mixing with SDS-Buffer and transferring the tubes on ice to stop the reaction.
  • the reaction mixtures were analyzed on 18% SDS-PAGEs for quantifying the activity of the protein-splicing domain.
  • the band intensities on SDS-PAGE gels were quantified using ImageJ (NIH) from the gels stained by PhastGelTM Blue R (GE Healthcare).
  • the splicing activity was calculated from the ratio between the reacted precursor and the residual unspliced precursor.
  • the data represent mean ⁇ standard deviation obtained from three independent experiments.
  • Example 1 Expression, purification and cleavage of fusion proteins
  • Vector Construction Green fluorescent protein (GFP) was used as a model system for the target proteins to create fusion proteins bearing an ion-inducible protein-splicing domain according to the first aspect.
  • the codon-optimized gene of an ion-inducible protein-splicing domain derived from MCM2 intein from Halorhabdus utahensis DSM 12940 was synthesized with the following DNA sequence, SEQ ID NO: 4:
  • This gene contains a mutation of Ala from Asn at the C-terminus of HutMCM2 intein, which is followed by Ala to replace the first flanking C-terminal Ser and by a chitin-binding domain with the C-terminal octa-histidine tag.
  • This gene was cloned into pET-GFP (Plasmid #29716 at Addgene) for the construction of GFP-fusion protein, resulting in plasmid pBH(etGFP)Syn13.
  • the fusion protein was expressed in E.coli ER2566 at a final concentration of 1 mM IPTG for 4 hours at 37°C when the OD600 reached 0.6-0.8.
  • the cells was lysed by ultrasonication and cleared at 40,000g for 50min before loading to HisTrap HP column (GE Healthcare) (Fig. 1 1 (B)).
  • the cleavage of the fusion protein was induced at a final concentration of 4 M NaCI at room temperature with or without 1 mM DTT (Fig. 1 1 B and Fig. 1 1 C).
  • the reaction mixture was passed through chitin-beads to remove the lon-inducible tag as demonstrated in Fig 1 1 (C) to obtain the protein of interest (GFP).
  • Fig. 1 1 B and 1 1 C in example 1 confirm that there is no premature cleavage of the precursor protein during protein expression and purification unlike IMPACT system shown in Fig. 1 1 A.
  • the fusion protein containing the IIST tag was cleaved only when the ionic-strength was increased with and without a reducing agent or a reducing thiol agent, as shown in Fig. 1 1 B and Fig.1 1 C.
  • the IIST tag was efficiently removed by additional IMAC purification or on-column cleavage (Fig. 1 1 C), providing the evidence that IIST system could be used for purification using ion-induction.
  • Example 2 Peptide/Protein modification (ligation) by an ion-inducible protein- splicing domain
  • the gene of the C-terminal 42 residues from HutMCM2 intein was amplified from pSADuet616 by PCR with two oligonucleotides 1139, SEQ ID NO: 5: GTCATATGGGCGATATCGGGCTTCGA and 1120, SEQ ID NO: 9: TAGGTACCGTCCTCGGAATTATGGACGACCATTCC, and inserted into pSABAD14-98 [6] between Nde ⁇ and Kpn ⁇ sites to fuse the B1 domain of IgG binding protein B (GB1 ) with a C- terminal H6-tag.
  • the construct was then transferred in pHYRSF-1 [7] between Nde ⁇ and Hind ⁇ sites, resulting in pSARSF619 bearing a fusion protein of H6-/-/t/iMCMc42-GB1 -H 6 .
  • the N-terminal 125-residue gene fragment of HutMCM2 intein was amplified by PCR with two oligonucleotides 11 19, SEQ ID NO: 6: TCGGATCCATGCGGTGCGTTACTGGGGATACTCTC and 1140, SEQ ID NO: 7: TCAAGCTTAACCGTCAGTTGCCATCGCTG, followed by digestion using the two restriction enzymes BamYW and Hind ⁇ and ligation into plasmid pSKDuetl [8], resulting in pSADuet620.
  • the two precursor proteins were expressed in E. coli expression strain ER2566 cells bearing either pSARSF619 or pSADuet620 in 1 L of LB-media supplemented with kanamycin (25 g/mL) followed by the addition of a final concentration of 0.5 mM IPTG when the ⁇ reached 0.6-0.8. After three hours of induction at 37°C, the cells were harvested by centrifuging and resuspended in Buffer A (50mM NaPi, 300mM NaCI, pH 8.0). The harvested cells were lysed by ultrasonification and cleared by centrifugation at 38,500g at 4°C for 50 min.
  • Buffer A 50mM NaPi, 300mM NaCI, pH 8.0
  • the cleared soluble fraction was loaded onto 5ml_ His-Trap FF column (GE Healthcare) and eluted by a linear gradient of 25-250 mM imidazole.
  • the fractions containing the precursors were collected and dialyzed against MQ water and concentrated using centrifugal filter devices with a cut-off of 5,000 Da (Sartorius).
  • the two precursor proteins expressed from pSARSF619 and pSADuet620 were mixed at an equimolar ratio of 30 ⁇ concentration in the presence of either 2 or 4 M NaCI, supplemented with 0.5 mM TCEP.
  • the reaction was incubated at 37 °C by taking samples periodically and analyzed on SDS-PAGEs for quantification of spliced products to monitor the activity. TonB protein ligation by ion-inducible PTS
  • pACRSF5 As N-terminal precursor (HpTonB(36-154)-/-/i/fMCMAC62-H 8 ), pACRSF5 was constructed.
  • the CBD domain was removed by inverse PCR using the two oligonucleotides of 1731 , SEQ ID NO: 10: 5'-
  • HpTonB(36-154) was first amplified from genomic DNA of Helicobacter pylori (Marshall et al.) (ATCC Number: 700392D-5) using the two oligonucleotides 1716, SEQ ID NO: 12: 5'- CTC ATATG C G C G AAG AC G C C C C AG AG C CTTTAG and I822, SEQ ID NO: 13: 5 ' - GTATCCCCAGTAACGCATTTTTCTTTAGCTTCCTCTTTAG, followed by another PCR amplification with the two oligonucleotides, 1816 and I646, SEQ ID NO: 14: 5'- TGCACTAGTGTATCCCCAGTAACGCANC.
  • the amplified gene and the gene of HpTonB(36-154) were cloned into a vector pHYDuet194 in a stepwise manner using the restriction sites of Nde ⁇ , BamYW, Hind ⁇ and Spel.
  • the plasmid pHYDuet194 was derived from pHYRSFI (Addgene #34549) and bears a mutation of Nco ⁇ to Nde ⁇ site at the start codon.
  • the C-terminal precursor (H6-/-/t/iMCM2c42-HpTonB(155-285)) was encoded in the plasmid pBHRSF165 for protein expression.
  • the gene of HpTonB(155-285) was amplified from genomic DNA of Helicobacter pylori (ATCC Number: 700392D-5) using two oligonucleotides, I849, SEQ ID NO: 15: 5 ' -GGAATGGTCGTCCATAATAGCGCTCCTAAACAAGTAACAAC and I850, SEQ ID NO: 16: 5 ' -
  • the amplified DNA fragment was used for overlap extension PCR cloning (OEC) using plasmid pSARSF619 as the template.
  • the resulted plasmid of pBHRSF165 contains the gene of H6-/-/t/iMCM2c42- HpTonB(155-285) under T7 promoter.
  • the plasmid pBHRSFI 65 was transformed into E. coli ER2566 strain for production of the C- terminal precursor bearing HpTonB(155-285).
  • the transformed E.coli cells were grown in 2 liter LB medium supplemented with 25 ⁇ g ml kanamycin. When OD600 reached at -0.6, the protein expression was induced by addition of a final concentration of 1 mM IPTG, followed by an additional 5 h incubation at 30 °C before the cells were harvested by centrifugation at 4 00 xg for 10 min. The cells were re-suspended in buffer A and stored at -70 °C for further purification.
  • the plasmid pACRSF5 was transformed into E. coli ER2566 strain.
  • the cells were grown in 2 liter LB medium supplemented with 25 ⁇ g ml kanamycin at 37 °C.
  • OD600 reached at -0.6
  • the protein was induced with a final concentration of 1 mM IPTG, followed by further 4 hour incubation before harvested by centrifugation at 4'900 xg for 10 min.
  • the N- and C-precursor proteins were purified by IMAC using HisTrap HP column.
  • C-terminal precursor and unlabeled N- terminal precursor were mixed at a molar ratio of 1 :1 .
  • a final concentration of -0.1 mM 14 mg and 1 1 mg for the N- and C-precursor, respectively) was used for the ligation of HpTonB(36-154)-Ht/iMCM AC 62-H 8 and H 6 -Ht/iMCM2 C 42-HpTonB(155-285).
  • the reaction was performed in a volume of 4.5 ml and dialyzed against 1 liter of 0.5 M NaPi, 3.5 M NaCI, pH 7.0 in the presence of 0.5 mM TCEP.
  • the reaction mixture was dialyzed for 16 - 40 hours at room temperature in a dialysis tube with MWCO of 6-8 kDa. After dialysis, the ligation reaction was stopped by diluting the reaction mixture to a final concentration of 50 mM NaPi, 150 mM NaCI.
  • samples (20 ⁇ ) were taken from the reaction mixture after 2, 16, 22, and 39 hours of dialysis. The samples were diluted by mixing each sample with 1 * SDS-loading buffer (60 ⁇ ) and analyzed on 18 % SDS-PAGE after heating at 95 °C for 5 min.
  • the ligation mixture after dialysis was further purified by IMAC using HisTrap HP 5 ml column (GE Healthcare).
  • the ligated product Since the ligated product does not contain any his-tags, the ligated product was obtained from the flow-through fractions, separating from the precursors and excised intein fragments.
  • the flow-through fractions from IMAC containing the ligation product were pooled and dialyzed against 20 mM NaPi, pH 6.0.
  • Fig. 12A and 12B in example 2 confirm ligation kinetics of conjugation can be controlled by adjusting the ionic strength using ll-PSD.
  • Fig. 12C provides another successful example of protein conjugation using Ser at the +1 position by producing a full-length TonB protein, which does not contain any scar residue from ll-PSD fusion protein in the ligated product.
  • Example 3 Peptide modification (ligation) of a membrane protein by a split ion- inducible protein-splicing domain and solubility comparison of fusion proteins with ll- PSD.
  • the N-terminal integral membrane part (1 -354) of ⁇ 2 adrenergic receptor was fused with the
  • the second fusion precursor bearing the C-terminal 42 residues of HutMCM2 intein and residue 355-413 of ⁇ 2 adrenergic receptor was fused genetically and ligated in pBAD vector, resulting in pYSBAD25.
  • N-terminal hexahistidine tag was introduced at the front of the C-terminal fragment of HutMCM2 intein.
  • the N-terminal fusion protein was purified using IMAC according to the previously published protocol [10].
  • the C-terminal fusion precursor was expressed in E.coli strain ER2566 and purified by IMAC using HisTrap HP (GE Healthcare).
  • the final concentration of 20 ⁇ M of the N-terminal precursor and a final concentration of 100 ⁇ M of C-terminal precursor was mixed and incubated at room temperature in 20 mM Hepes-NaOH (pH 7.2), 4 M NaCI, 0.5 mM TCEP, either with or without 1 % n-Dodecyl ⁇ -D-maltoside (DDM).
  • the protein ligation was monitored by SDS- PAGE.
  • the solubility of the fusion protein with ll-PSD N using an identical extein of GB1 was compared by analyzing soluble and insoluble fraction after the cell-lysis.
  • the plasmids for ⁇ - GB1 -SspDnaE N (pJJDuet30) [1 1 ], H 6 -GB1 -/Vpt/DnaE N (pSKDuetl ) [9] and H 6 -GB1 - HutMCM2n (the above described pSADuet620) were used.
  • the plasmid was transformed into E. coli ER2566 expression strain, which was grown in 5 ml LB medium supplemented with 25 ⁇ g ml kanamycin at 37 °C.
  • the protein expression was induced with a final concentration of 1 mM IPTG.
  • the cells were grown for an additional 4 hours at 37 °C before harvest by centrifugation at 4 00 xg for 10 min at 4 °C.
  • the cells were lysed by mixing withl OO ⁇ B-PER® Bacterial Protein Extraction Reagent and shaking at 1000 rpm for 10 minutes at room temperature.
  • the soluble fraction was separated from the pellet by centrifugation at 21 ⁇ 00 xg for 5 min.
  • the pellet was re-suspended in 100 ⁇ 1 * SDS-loading buffer and the supernatant was twice diluted with 2 ⁇ SDS-loading buffer.
  • the samples were incubated at 95 °C for 5 min before loading to 18% SDS-PAGE gels (5 ⁇ / lane).
  • Fig. 13A in example 3 confirms that ll-PSD could be used for ion-induced ligation/conjugation of membrane proteins at the presence of detergent.
  • Fig. 3C provides the evidence that a fusion protein containing split ll-PSD is more soluble than other naturally occurring mesophilic split inteins, making ll-PSD more advantageous for in vitro applications.
  • Example 4 Backbone peptide/protein cyclization of kalataBI and GFP by an ion- inducible protein-splicing domain
  • a gene encoding a fusion protein containing the gene of kalataBI [12] as the protein of interest was derived from Ht/iMCM2 intein and was chemically synthesized with the optimized codons for the expression in E. coli.
  • the DNA sequence is as following, SEQ ID NO: 8:
  • the synthetic gene was cloned into pHYRSF53 [13] as a his-tagged SUMO-fusion protein, resulting in plasmid pSCFRSF1 1 1A.
  • E.coli strain ER2566 was transformed with the plasmid pSCFRSF1 1 1A for the expression.
  • the cells bearing pSCFRSF1 1 1A was grown in LB medium and induced with a final concentration of 1 mM IPTG for 4 hours when the ⁇ reached 0.6-0.8.
  • the cells were harvested by centrifugation at 5000 g for 10min and flash- frozen for storage at -70°C.
  • the cells was lysed by ultrasonication and cleared by centrifugation at 40,000g for 50min for the purification using ion-metal chelate chromatography (HisTrap FF, GE Healthcare).
  • the IMAC eluent was dialyzed against milli-Q quality water overnight and lyophilized.
  • the lyophilized protein was dissolved in water.
  • For cyclization the dissolved protein was incubated at a final concentration of 4M NaCI either with 1 mM DTT or 0.5 mM TCEP overnight.
  • the reaction was separated by HPLC chromatography using Resource RPC (GE Healthcare).
  • the backbone cyclization was confirmed by MALDI-TOF Mass spectrometry (Fig. 14C).
  • Fig. 14 in example 4 provides the evidence for an embodiment of the fourth aspect, demonstrating that the precursor proteins were purified without premature cyclization and cleavages, followed by backbone cyclization of the protein/peptide by increasing the ionic strength, protein/peptide cyclization by ll-PSD was confirmed by Mass-spectrometry (Fig. 14C) or thrombin digestion (Fig. 14E). The cyclized GFP migrate faster than the linearized GFP by thrombin digestion, confirming the backbone cyclization [14].
  • Example 5 C-terminal Amidation of VHH domain using IIST system
  • the gene of anti-hCG VHH (H14) with signal peptide was chemically synthetized [15].
  • the gene of VHH (H14) and the gene of the HutMCM2 intein with AA mutation fused to C- terminal CBD- and He-tags from pBH(etGFP)Syn13 were cloned into into a variant of pRSF- 1 b vector, of which ⁇ /col site was mutated into Nde ⁇ , in a step-wise manner using Nde ⁇ , Bam ⁇ , and Hind ⁇ resulting plasmid pBHRSF99 encoding for VHH-HuiMCM2 intein (AA)- CBD-Hs.
  • Plasmid pBHRSF99 carrying VHH fused to the cleavage and affinity domains was transformed into ER2566 strain of E. coli.
  • Cells were grown in 2L LB-media supplemented with kanamycin (25 ⁇ g /mL) till ⁇ ⁇ was 0.6 at 30 °C, followed by addition of a final concentra- tion of 0.5 mM IPTG.
  • the cells were induced for overnight (-20 hours) before harvested by centrifuging 6,700 xg for 10 min at 4 °C.
  • the harvested cells were re-suspended in Buffer A, and lysed using EmulsiFlex C-5 Homogenizer (Avestin).
  • the Soluble fraction was separated by centrifuging for one hour 38,500 xg at 4 °C and filtered through 0.45 ⁇ filter before loading on 5ml_ His-Trap HP column (GE Healthcare Life Sciences). Elution fractions containing the precursor protein were pooled, dialyzed against MQ for overnight at 10 °C, and concentrated using Vivaspin Turbo 15 (Sartorius) centrifugal concentrator with MWCO of 5,000 Dal- ton. The purified precursor protein was incubated in Amidation Buffer (1 M ( 15 N H4)2SC>4, 2M NaCI, 50mM NaPi, 50mM DTT, pH 7.0) in a final concentration of 80 ⁇ at 25 °C for 20 hours.
  • Amidation Buffer (1 M ( 15 N H4)2SC>4, 2M NaCI, 50mM NaPi, 50mM DTT, pH 7.0
  • the reaction mixture with the salt was exchanged into Buffer A with PD-10 column (GE Healthcare Life Sciences) after centrifugation at 15,000 xg for 5 min at RT and then loaded on the 5mL HisTrapHP column.
  • the flow-through fractions were collected and analyzed on 18% SDS-PAGE.
  • the cleaved VHH was concentrated using Vivaspin Turbo 15 (Sartorius) centrifugal concentrator with MWCO 3000 Dalton and the buffer was exchanged to 20 mM potassium phosphate buffer pH 6.0 for NMR measurement.
  • Fig. 15 in example 5 provides the evidence for an embodiment of the second aspect, demonstrating that the fusion protein were purified without premature cleavages, followed by amidation of the protein/peptide by increasing the ionic strength in the presence of 15 N-labeled ammonium sulfate.
  • the two peaks in [ 1 H, 15 N]-HSQC spectrum appeared in the purified POI confirms selective C-terminal amidation by selective conjugation using II- PSD.
  • Example 6 Antibody-toxin conjugation by PTS using split ll-PSD
  • Human embryonic kidney cells HEK293F (Invitrogen) were used for production of a fusion protein of lgG-ll-PSD N .
  • the cells were grown in serum free FreeStyleTM 293 Expression Medium (Invitrogen) on 37°C and in an atmosphere containing 8% CO2 on a rotator. Cells were 5 divided app. 3 times a week and kept at densities of 10 5 -10 6 /ml (suspension) or confluent adherent.
  • Plasmid has a gene for hygromycin resistance and two multiple cloning sites for expression of two polypeptides simultaneously.
  • the gene of the first 389 residues of diphtheria toxin (DT) was constructed from pBR.DT-A and (pET-22b-DT-A_E55/K144, addgene #1 1081 ) by PCR and fused with the C- terminal split ll-PSDc of HutMCM2 intein, resulting in a plasmid coding H 6 -/-/t/iMCM2c42- Dab389 [17].
  • the catalytic domain (A-domain) (194 aa) (DT-A) was amplified by PCR and inserted to pSARSF619 vector between Kpn ⁇ and Hind ⁇ sites to get a fusion protein of ⁇ -
  • DT-ll-PSDc fusion proteins were expressed in E. coli strain ER2566 in 2L of LB-media 25 supplemented with kanamycin (25 g/ml) using plasmids of pJTRSFH314 and pJTRSFH338.
  • the overexpression of the fusion proteins was induced by addition of a final concentration of 0.5 mM IPTG when the cultures reached ⁇ ⁇ at 0.6. After 3 hours of induction, the cells were harvested by centrifugation and suspended to buffer A (50 mM NaPi, 300 mM NaCI, pH 8.0) and lysed using Emulsiflex equipment. Supernatants after centrifugation at 38 500 g for 30 40 min were loaded onto 5 ml HisTrap columns (GE Healthcare). The fusion proteins were eluted by a linear gradient of imidazole (20 - 300 mM). The fractions containing the fusion proteins were collected for dialysis against PBS for overnight and concentrated by Sartorius centrifugal devices.
  • the N-terminal precursor protein of IgG-ll-PSDN fusion protein was produced from HEK293F cells grown to a density of 3x10 7 /ml in a 30 ml volume. 35 Transfections of all the plasmids encoding the fusion proteins were performed as follows:
  • plasmid and 37.5 ⁇ of FreeStyle MAX reagent were both mixed separately to 1 ml of Opti-MEM® (Invitrogen) medium. The mixtures were combined and incubated 10 min in RT, after which they were gently added to the cell cultures. 24 hours after transfection hygromycin (100 g/ml) was added to cultures. The cells were grown under hygromycin selection for 30 days. The supernatants were collected and kept at -80°C before use.
  • the fusion protein of lgG-/-/i/fMCM2AC62-He was purified by IMAC.
  • the cell culture supernatants were loaded on a His-Trap column and eluted with 300 mM imidazole.
  • the fusion protein was dialyzed against PBS and concentrated to 1 mg/ml using an Amicon centrifugal concentrator with MWCO of 30000 Dalton.
  • the gene of VHH fragment (H14) of llama antibody against hGC was synthesized as abovementioned and fused with /-/t/iMCM2 A c62-H 8 by replacing the gene of HuiMCM2 intein (AA)-CBD-H 8 in pBHRSF99.
  • the VHH-/-/t/iMCM2AC62-H8 fusion protein was expressed in E.coli ER2566 and purified by IMAC. The elution fraction was dialyzed against PBS and concentrated using centrifugal devices.
  • Fig. 16 in example 6 provides the evidence for production of antibody conjugation as an embodiment of the first aspect, demonstrating that a fusion protein containing antibody fragment (VH) was conjugated with a toxin by ion-induced PTS using split ll-PSD.
  • the C-terminal precursor (H6-ll-PSDc-hinge-CH2-CH3) containing Fc domain of human lgG1 was expressed in Brevibacillus choshinensis using a commercial plasmid pAJNCM21 , in which the precursor was cloned in pNCM02 (TaKara Bio Inc).
  • the hinge region contains a sequence of "PAPELLGG” according to natural antibody hinge sequence.
  • the N-terminal precursor (H6-SU MO-I I-PSDN) containing SU MO domain (yeast Smt3 gene) was fused with I I-PSDN at the C-terminus and expressed and purified with the N-terminal His-tag from E.coli strain ER2566.
  • An antiviral lectin of cyanobacterial (Scytonema varium) SVN was fused with thioredoxin (TRX) to enhance disulphide-bond formation and I I-PSDN resulting in the N- terminal precursor of H6-TRX-SVN- I I-PSDN [18].
  • TRX thioredoxin
  • the lectin fusion protein was expressed in E.coli strain Rosettagami2 (DE3) and purified by Immobilized metal ion affinity chromatography (IMAC).
  • B. choshinensis was transformed by electroporation with plasmid pAJNCM21 according to the manufacture's protocol.
  • the C-terminal precursor fusion protein was expressed from the B.
  • TM media in 14 mL at 30 °C, 200 min "1 for 3-4 days.
  • the proteins were purified by IMAC, which was followed by additional purification using HiTrap Protein A HP column (GE Healthcare).
  • the elution fractions were neutralized and dialyzed against ligation buffer (10 mM Tris, 500 mM NaCI, 1 mM EDTA, pH 7) and concentrated using a centrifugal filter device (Microcon YM-10, 10 kDa MWCO, Millipore) before ligation.
  • Fig. 17 in example 7 provides the evidence for production of antibody conjugation as an embodiment of the first aspect, demonstrating that a fusion protein containing an antibody fragment (Fc) was conjugated with a binding domain (SUMO or a lectin) by PTS using split ll-PSD.
  • the results confirm that antibody, antibody-like proteins (lectin-body), and antibody conjugates could be produced by in vitro ligation using ll-PSD.
  • Table I A list of the tested inteins from halophilic organisms.
  • the % of Asp/Glu and % of Asp/Glu/Ser/Thr values indicate the percentage of said amino acids in the 120 residues comprising of consisting of the first 90 residues and the last 30 residues of the ion-inducible protein-splicing domain.

Abstract

La présente invention concerne le domaine de la ligature, de la production, de la purification et du clivage de protéines de fusion. Elle concerne un procédé de production d'une protéine de fusion comprenant une protéine d'intérêt et un domaine d'épissage de protéines inductibles par des ions qui peut être utilisé pour produire (ligaturer ou cliver) la protéine d'intérêt à partir de la protéine de fusion de manière contrôlée par augmentation de la force ionique du milieu dans lequel la protéine de fusion est fournie.
PCT/FI2016/050277 2015-04-30 2016-04-29 Modification des protéines inductibles par des ions WO2016174311A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
FI20155319 2015-04-30
FI20155319 2015-04-30

Publications (1)

Publication Number Publication Date
WO2016174311A1 true WO2016174311A1 (fr) 2016-11-03

Family

ID=55967314

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/FI2016/050277 WO2016174311A1 (fr) 2015-04-30 2016-04-29 Modification des protéines inductibles par des ions

Country Status (1)

Country Link
WO (1) WO2016174311A1 (fr)

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2011057163A2 (fr) * 2009-11-06 2011-05-12 Agrivida, Inc. Enzymes modifiées par une intéine, leur production et leurs applications industrielles
WO2013045632A1 (fr) * 2011-09-28 2013-04-04 Era Biotech, S.A. Intéines divisées et leurs utilisations

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2011057163A2 (fr) * 2009-11-06 2011-05-12 Agrivida, Inc. Enzymes modifiées par une intéine, leur production et leurs applications industrielles
WO2013045632A1 (fr) * 2011-09-28 2013-04-04 Era Biotech, S.A. Intéines divisées et leurs utilisations

Non-Patent Citations (23)

* Cited by examiner, † Cited by third party
Title
A. SESILJA ARANKO ET AL: "Structure-based engineering and comparison of novel split inteins for protein ligation", MOLECULAR BIOSYSTEMS, vol. 10, no. 5, 1 January 2014 (2014-01-01), GB, pages 1023, XP055291217, ISSN: 1742-206X, DOI: 10.1039/c4mb00021h *
ARANKO, A.S.; OEEMIG, J.S.; KAJANDER, T.; IWAI, H., NAT. CHEM. BIOL., vol. 9, 2013, pages 616 - 622
CHONG, S. ET AL., GENE, vol. 192, 1997, pages 271 - 281
DANIELIAN ET AL., ONCOGENE, vol. 27, 2008, pages 6561 - 70
DATABASE UniProt [online] 13 October 2009 (2009-10-13), "Transcriptional regulator, XRE family from Halorhabdus utahensis", XP002760336, retrieved from EBI accession no. UNIPROT:C7NUH7 Database accession no. C7NUH7 *
DAWSON, P.E. ET AL., SCIENCE, vol. 266, 1994, pages 776 - 779
DODEV, T. S. ET AL., SCIENTIFIC REPORTS, vol. 4, 2014, pages 5885
INBASE, THE INTEIN DATABASE, 22 April 2016 (2016-04-22), Retrieved from the Internet <URL:www.inteins.com>
IWAI, H.; ZUGER, S.; JIN, J.; TAM, P.-H., FEBS LETT., vol. 580, 2006, pages 1853 - 1858
KOFUKU, Y.; UEDA, T.; OKUDE, J.; SHIRAISHI, Y.; KONDO, K.; MIZUMURA, T.; SUZUKI, S.; SHIMADA, ANGEWANDTE CHEMIE-INTERNATIONAL EDITION, vol. 53, 2014, pages 13376 - 13379
LWAI, H.; LINGEL, A.; P UCKTHUN, A., J. BIOL. CHEM., vol. 276, 2001, pages 16548 - 16554
MUIR, T.W.; SONDHI, D.; COLE, P.A.: "Expressed protein ligation: a general method for protein engineering", PROC. NATL. ACAD. SCI. U.S.A., vol. 95, 1998, pages 6705 - 6710, XP002257746, DOI: doi:10.1073/pnas.95.12.6705
MUONA, M.; ARANKO, A.S.; IWAI, H., CHEMBIOCHEM, vol. 9, 2008, pages 2958 - 2961
MUONA, M.; ARANKO, A.S.; RAULINAITIS, V.; IWAI, H., NAT PROTOC, vol. 5, 2010, pages 574 - 587
PERLER, F.B., NUCLEIC ACIDS RES., vol. 30, 2002, pages 383 - 384
RENISIO, J. G. ET AL., PROTEINS, vol. 47, 2002, pages 546 - 555
SAETHER O ET AL., BIOCHEMISTRY-US, vol. 34, 1995, pages 4147 - 4158
SKANDER ELLEUCHE ET AL: "Inteins, valuable genetic elements in molecular biology and biotechnology", APPLIED MICROBIOLOGY AND BIOTECHNOLOGY, SPRINGER, BERLIN, DE, vol. 87, no. 2, 7 May 2010 (2010-05-07), pages 479 - 489, XP019841626, ISSN: 1432-0614 *
SOUTHWORTH ET AL., BIOTECHNIQUES, vol. 27, 1999, pages 110 - 120
TORI, K. ET AL., J BIOL CHEM., vol. 285, 2010, pages 2515 - 2526
XIONG, C.; O'KEEFE, B. R.; BOTOS, I.; WLODAWER, A.; MCMAHON, J. B., PROTEIN EXPR. PURIF., vol. 46, 2006, pages 233 - 239
YUEJUAN ZHANG ET AL: "A pH-induced, intein-mediated expression and purification of recombinant human epidermal growth factor in Escherichia col i", BIOTECHNOLOGY PROGRESS., vol. 31, no. 3, 10 April 2015 (2015-04-10), US, pages 758 - 764, XP055291417, ISSN: 8756-7938, DOI: 10.1002/btpr.2086 *
ZÜGER, S.; IWAI, H., NAT. BIOTECHNOL., vol. 23, 2005, pages 736 - 740

Similar Documents

Publication Publication Date Title
US6849428B1 (en) Intein-mediated protein ligation of expressed proteins
AU2013280693B2 (en) Split inteins, conjugates and uses thereof
Mao A self-cleavable sortase fusion for one-step purification of free recombinant proteins
KR20150008852A (ko) 계면활성제 펩타이드의 제조 방법
Rickert et al. Production of soluble and active microbial transglutaminase in Escherichia coli for site‐specific antibody drug conjugation
Korepanova et al. Expression of membrane proteins from Mycobacterium tuberculosis in Escherichia coli as fusions with maltose binding protein
WO2021185360A1 (fr) Nouveaux variants tronqués de sortase
CN113811548A (zh) 抗原结合蛋白
US11674164B2 (en) Periplasmic fusion proteins
Xu et al. Intermolecular disulfide bonds between unpaired cysteines retard the C-terminal trans-cleavage of Npu DnaE
WO2009026089A1 (fr) Procédés et compositions utilisés pour diriger des protéines d&#39;intérêt vers l&#39;enveloppe de cellules hôtes
EP1151117B1 (fr) Ligation de proteines exprimees induite par inteines
EP2935577B1 (fr) Procédé de production d&#39;une protéine recombinante d&#39;intérêt
WO2016170447A1 (fr) Transglutaminases microbiennes recombinantes
Canals et al. Production of engineered human pancreatic ribonucleases, solving expression and purification problems, and enhancing thermostability
AU2012219225A1 (en) Protein secretion
JP2016518855A (ja) 融合プロテアーゼ
Feng et al. A novel self-cleavage system for production of soluble recombinant protein in Escherichia coli
WO2016174311A1 (fr) Modification des protéines inductibles par des ions
Amaranto et al. Novel intein-based self-cleaving affinity tag for recombinant protein production in Escherichia coli
US8981067B2 (en) Composition, method and kit for obtaining purified recombinant proteins
US10077447B2 (en) Coryneform bacterium and method for producing heterologous fusion proteins
KR101667023B1 (ko) 무세포 단백질 합성 방법을 이용하여 생산된 항체의 세포질 내로의 유입을 간편하게 분석하는 방법
KR101300672B1 (ko) 세포 내 절단 시스템을 이용하여 수용성 외래 단백질을 제조하는 방법
US7348408B2 (en) Fusion proteins

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 16722262

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 16722262

Country of ref document: EP

Kind code of ref document: A1