WO2016171625A1 - Targeting telomerase for cell therapy - Google Patents
Targeting telomerase for cell therapy Download PDFInfo
- Publication number
- WO2016171625A1 WO2016171625A1 PCT/SG2016/050190 SG2016050190W WO2016171625A1 WO 2016171625 A1 WO2016171625 A1 WO 2016171625A1 SG 2016050190 W SG2016050190 W SG 2016050190W WO 2016171625 A1 WO2016171625 A1 WO 2016171625A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- cells
- htert
- gene
- stem cell
- cell
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
- C12N5/06—Animal cells or tissues; Human cells or tissues
- C12N5/0602—Vertebrate cells
- C12N5/0603—Embryonic cells ; Embryoid bodies
- C12N5/0606—Pluripotent embryonic cells, e.g. embryonic stem cells [ES]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2510/00—Genetically modified cells
Definitions
- the present invention relates to stem cell technology. More particularly, the present invention relates to inducing telomerase knockout in stem cells to limit their life span whilst retaining pluripotency until differentiated. As a result they can be banked with a predetermined lifespan and have reduced ability to cause tumor formation if used in therapy.
- pluripotent stem cells share cellular and genetic similarity with tumor cells; such as unlimited potential for cell proliferation, rapid cell proliferation rate and a propensity for genomic instability when cultured in vitro (Baker, D. E. et al. Nat Biotechnol 25, 207-215 (2007)).
- pluripotent stem cells can form teratomas when injected into immunodeficient mice (Blum, B. & Benvenisty, N. Stem Cells 25, 1924-1930 (2007)), and as little as a few hundred pluripotent stem cells are sufficient (Lee, A. S. et al.
- stem cells may potentially develop into more malignant teratocarcinomas (Blum, B. & Benvenisty, N. Advances in cancer research 100, 133-158 (2008)), raising the legitimate concern of safety in clinical applications.
- a recent report indicates the possibility of donor-derived tumor development following transplantation of undifferentiated neural stem cells (Amariglio, N. et al. PLoS medicine 6 (2009)).
- undifferentiated stem cells show a high propensity to accumulate chromosome aberrations during in vitro culture.
- the differentiated cells derived from stem cells may themselves also acquire genetic mutations and tumorigenicity during in vitro culture. Therefore, the technical burden of separating differentiated cells from undifferentiated stem cells, as well as ensuring the genetic stability of differentiated cells, remain major challenges for the clinical application of cell therapy.
- An unlimited proliferation potential is a hallmark of cancer and is shared by stem cells. In order to proliferate continuously, cells need to find a way to maintain their telomere, a special nucleoprotein complex found at the ends of human linear chromosomes (Blackburn, E. H. Nature 408, 53-56 (2000)).
- telomeres Human chromosome ends are capped by telomeres that contain long six-nucleotide DNA repeats 5'- TTAGGG-3 with single stranded 3' G-rich overhangs.
- the telomeric DNA repeats are bound by shelterin protein complexes consisting of TRF1 , TRF2, RAP1 , TIN2, TPP1 and POT1 that distinguish naturally occurring chromosomal ends from DNA double- strand breaks. Therefore, telomeres are essential for cell genomic stability.
- Telomeres are synthesized by telomerase, a reverse transcriptase that contains two core components: a catalytic protein, hTERT, and a RNA, hTER (Feng, J. et al. Science 269, 1236-1241 (1995); Nakamura, T. M. et al. Science 277, 955-959
- telomere RNA (1997) ). Although the telomerase RNA (hTER) is widely expressed, the catalytic protein hTERT and, consequently, telomerase activity are hardly detectable in the majority of adult human cells, with the exception of stem cells and germ cells (Feng, J. et al. Science 269, 1236-1241 (1995); Nakamura, T. M. et al. Science 277, 955- 959 (1997); Kim, N. W. et al. Science 266, 2011-2015 (1994); Wright, W. E. et al. Dev Genet 18, 173-179 (1996)). Normal somatic cells only have a limited proliferation potential that is controlled by their telomere length (Hayflick, L. & Moorhead, P. S.
- pluripotent stem cells share unlimited proliferation capacity with cancer cells, expressing high telomerase activity for telomere maintenance (Thomson, J. A. et al. Science 282, 1 145-1147
- the novel strategy described herein involves engineering telomerase null stem cells with limited lifespan and reduced tumorigenic potential.
- At least one isolated pluripotent telomerase activity null stem cell comprising two mutated alleles of a telomerase activity gene selected from the group comprising the human telomerase reverse transcriptase (hTERT) gene and the human telomerase RNA (hTER) gene, wherein said at least one telomerase activity null stem cell has limited lifespan and reduced tumorigenic potential.
- hTERT human telomerase reverse transcriptase
- hTER human telomerase RNA
- a preferred embodiment of the invention provides at least one isolated pluripotent inducible telomerase activity knockout stem cell, comprising two mutated alleles of a telomerase activity gene selected from the group comprising the human telomerase reverse transcriptase (hTERT) gene and the human telomerase RNA (hTER) gene; wherein said alleles comprise an introduced and removable portion of said hTERT or hTER gene.
- hTERT human telomerase reverse transcriptase
- hTER human telomerase RNA
- the at least one isolated pluripotent inducible telomerase activity knockout stem cell has been subjected to transient over-expression of hTERT, hTER or both hTERT and hTER to increase the average telomere length.
- Another embodiment of the invention provides at least one isolated pluripotent telomerase activity null stem cell, wherein the pluripotent inducible telomerase activity knockout stem cell described supra has been further contacted with a knockout inducer to remove said introduced removable gene portion thereby resulting in at least one telomerase activity null stem cell with limited lifespan and reduced tumorigenic potential.
- the isolated pluripotent inducible telomerase activity knockout stem cell described supra wherein said removable portion of the hTERT or hTER gene is replaced by homologous DNA flanked by LoxP sites, which retains gene function, and at a selected time transient expression of Cre recombinase in the recombinant cell causes deletion of the homologous DNA resulting in loss of hTERT or hTER activity and, consequently, telomerase activity.
- At least one isolated pluripotent telomerase activity null stem cell wherein said telomerase activity null stem cell has been produced by exposing at least one isolated pluripotent stem cell to a CRISPR-Cas or other synthetic nuclease system to knock out alleles of a telomerase activity gene selected from the group comprising the human telomerase reverse transcriptase (hTERT) gene and the human telomerase RNA subunit (hTER) gene, thereby resulting in at least one telomerase activity null stem cell with limited lifespan and reduced tumorigenic potential.
- hTERT human telomerase reverse transcriptase
- hTER human telomerase RNA subunit
- the at least one isolated pluripotent stem cell has been subjected to transient over-expression of hTERT, hTER or both hTERT and hTER to increase the average telomere length prior to exposure to CRISPR-Cas or other synthetic nuclease system.
- Another aspect of the invention provides a method of producing one or more isolated pluripotent telomerase activity null stem cells with limited lifespan and reduced tumorigenicity compared to wild type cells, comprising the steps of:
- telomere activity gene selected from the group comprising the human telomerase reverse transcriptase (hTERT) gene and the human telomerase RNA subunit (hTER) gene;
- telomerase activity gene selected from the group comprising the human telomerase reverse transcriptase (hTERT) gene and the human telomerase RNA subunit (hTER) gene; and (c) selecting telomerase activity null cells with an average telomere length evaluated to be 5 kb or less and a reduced ability to form a teratoma in vivo; or
- Another aspect of the invention provides a method of producing one or more isolated pluripotent telomerase activity null stem cells suitable for clinical use, comprising: evaluating the average telomere length and/or in vivo tumorigenicity of said pluripotent stem cells in which the human telomerase reverse transcriptase (hTERT) or the human telomerase RNA (hTER) activity has been inactivated; and identifying said pluripotent stem cells as suitable for clinical use if said evaluated average telomere length is about 5 kb or less and/or said cells have reduced ability to form a teratoma in vivo.
- hTERT human telomerase reverse transcriptase
- hTER human telomerase RNA
- Another aspect of the invention provides the use of at least one isolated pluripotent telomerase activity null stem cell as described supra for the preparation of a therapeutic composition for cell therapy of a subject in need thereof.
- the at least one isolated pluripotent telomerase activity null stem cell is differentiated into cells of at least one of ectodermal, endodermal or mesodermal lineage.
- the at least one isolated pluripotent telomerase activity null stem cell is differentiated into cells of at least one lineage selected from the group comprising neurons, astrocytes and/or glia and hematopoietic cells.
- Figure 1 shows the engineering of ZFNs and TALENs for gene targeting.
- Figure 2 shows a schematic design of the gene targeting strategy used to introduce loxP sites flanking the exon 1 and exon 2 of hTERT genomic locus.
- Figure 3 demonstrates the increased stability of the targeting vector that can be achieved with mutated ZFNs binding sites.
- Figure 4 is a schematic representation of the gene targeting procedure in human H1 ES cells, as described in Example 3.
- Figure 5 A is a Southern blot analysis, using genomic DNA samples that were digested with Xbal and Hindi restriction enzymes, confirming the targeted alleles of hTERT.
- the probe used for Southern blotting analysis is shown on Figure 2, to the left of the first LoxP site.
- B). shows the expression of full length hTERT in hTERT (+/+) ; hTERT (+/ -> and hTERT ⁇ ES cells, as analyzed by RNA protection assay (RPA) using 32 P labeled radioactive RNA probe encompassing hTERT exon 2.
- RPA RNA protection assay
- telomere shortening in telomerase null human ES cells A). Genomic Southern analysis of telomere length in independent hTERT + + , hTERT + loxP , hTERT loxP/loxP and hTERT " ' " ES cell lines. P2, P4, P6 and P8: indicate that the hTERT "7" ES cells have been passaged 2, 4, 6 and 8 times, respectively. B).
- Figure 7 show loss of cell proliferation capacity and increased cell death in senescent hTERT (" _) ES cells.
- Figure 8 demonstrates that transient overexpression of hTERT in hTERT io X p/ioxp ES ce
- Figure 9 shows telomere shortening of hTERT ";" ES cells derived from hTERT loxP loxP ES cells whose telomere length was reset by transient overexpression of hTERT.
- OE overexpression; P1 , P5 and P10: indicate the number of passages.
- Figure 10 provides karyotyping of human ES cell lines, which shows that the cells maintained a normal karyotype.
- Figures 11A-D show immunocytochemistry analysis of the expression of ES cell markers in hTERT inducible knockout hTERT + + ; hTERT + " and hTERT " '' " ES cells: A). TRA-1 -60; B). SSEA-4; C). OCT-4; and D). NANOG. The cell nuclei were stained with DAPI.
- Figure 11E sets out the expression of OCT-4, SOX-2, KLF-4, and NANOG in independent hTERT +/+ ; hTERT + " and hTERT “ ' " ES cell lines, as quantified by qRT- PCR and normalized to the expression of GAPDH.
- the expression level of OCT-4, SOX-2, KLF-4, and NANOG in independent hTERT +/+ is indicated by the dotted line.
- Figures 12A-12E demonstrate spontaneous differentiation of human hTERT (+/+> and hTERT ("/_) ES cells in vitro into cell lineages of all three germ layers.
- ectoderm markers Tuj1 and GFAP, respectively; C). and D).
- mesoderm markers Desmin and ⁇ -SMA, respectively; and E).
- endoderm marker AFP.
- Figure 13 A shows the different teratoma formation efficiency in vivo of independent hTERT +/+ (+/+); hTERT +/" (+/-), and three different hTERT " _ (-/-) ES cell lines.
- telomere of the hTERT _ " (-/-) ES cell line is 3.5 kb, the ability of the ES cells to form teratomas in vivo is completely suppressed.
- B shows H&E staining of teratomas derived from independent hTERT + + ; hTERT + " , and hTERT _ " ES cell lines.
- Endoderm respiratory epithelium (e); Mesoderm: cartilage (c) and skeletal muscle (m); Ectoderm: neural epithelium with rosettes (n). Scale bars, 200pm.
- Figure 14 A is a schematic diagram showing the schedule for induction of neural progenitor cells (NPC) from human ES cells.
- NPC neural progenitor cells
- Figures 14B-14E show the differentiation of telomerase null human ES cells to neural lineages in vitro.
- B). provides representative confocal images showing progenitor cells (identified by Nestin and Sox2 staining) induced from hTERT (+/+) ; hTERT ⁇ , and hTERT ⁇ ES cells.
- C). provides representative confocal images showing the differentiation of these 3 groups of ES cells to neurons, identified by DCX staining; HuN: human nuclei; D). is a graphical representation of the percentage of DCX positive neurons (total DAPI positive cells) that are differentiated from neuronal progenitor cells induced from the different groups of ES cells, as indicated.
- E). provides representative confocal images showing the differentiation of these different groups of ES cells to astrocytes, marked by GFAP staining.
- Figures 15A-F shows effects of injection of hTERT (+ +) (with mean telomere length around 13 kb) and hTERT ⁇ ES cells (with mean telomere length around 3.5 kb) into mouse brain.
- E). shows the gross morphology of brains from mice injected with hTERT (+/+) ES cells or hTERT ("A) ES cells. Tumor formation was visible in hTERT (+ +) ES but not hTERT ("A) ES-injected mouse brains.
- F). provides representative confocal images showing human nuclei (HuN) staining of tumors in hTERT (+ +) ES cells-injected mouse.
- Figure 16 includes representative confocal images showing lack of tumor formation but, instead, in vivo differentiation of hTERT ("/_) ES cells (with mean telomere length around 3.5 kb) into mature neurons.
- A demonstrates that there is no tumor formation in immunodeficient mouse brain injected with hTERT ("/_) ES cells at 8 and 16 weeks post-injection.
- B). shows the expression of mature neuronal marker, MAP2a, in hTERT ("A) ES cell-derived neuronal cells in vivo.
- C). shows the expression of TH, a marker for dopaminergic neurons, in hTERT ("A) ES cell-derived neuronal cells in vivo (marked by arrows).
- Figure 17 shows the engineering of telomerase-null ES cells (WA018) using the CRISPR-Cas9 system.
- A) Shows sequences (S1 -S5) of five independent CRISPR guide RNAs targeting hTERT exon 1.
- B) Cel-I assay showing DNA cleavage induced by the five independent CRISPR guide RNAs S1-S5.
- iPSC induced pluripotent stem cell
- pluripotent refers to the potential of a stem cell to make any differentiated cell of an organism. Pluripotent stem cells can give rise to any foetal or adult cell type. However, alone they cannot develop into a foetal or adult organism because they lack the potential to contribute to extraembryonic tissue, such as the placenta.
- Cre refers to Cre recombinase; a tyrosine recombinase enzyme derived from the P1 Bacteriophage.
- the enzyme uses a topoisomerase I like mechanism to catalyse the site specific recombination event between two DNA recognition (LoxP) sites.
- CRISPR-Cas refers to a microbial adaptive immune system that uses RNA-guided nucleases to cleave foreign genetic elements. It comprises clustered regularly interspaced short palindromic repeats (CRISPRs), a CRISPR-associated (Cas) endonuclease and a synthetic guide RNA that can be programmed to identify and introduce a double strand break at a specific site within a targeted gene sequence.
- the palindromic repeats are interspaced by short variable sequences derived from exogenous DNA targets known as protospacers, and together they constitute the CRISPR RNA (crRNA) array.
- each protospacer is always associated with a protospacer adjacent motif (PAM), which can vary depending on the specific CRISPR system.
- PAM protospacer adjacent motif
- CRISPR-Cas9 is a specific version of the system referring to use of RNA-guided Cas9 nuclease, originally derived from Streptococcus pyogenes, whereby the target DNA must immediately precede a 5'-NGG PAM. Variations of the CRISPR-Cas9 system are known [Ran FA, et al., Nat.
- FLP refers to FLP recombinase; derived from the baker's yeast Saccharomyces cerevisiae. The enzyme catalyses a site-specific recombination event between two DNA recognition (FRT) sites.
- FRT refers to a flippase recognition target (FRT) site.
- the 34bp minimal FRT site sequence has the sequence 5'GAAGTTCCTATTCTCTAGAAAGTATAGGAACTTC3' (SEQ ID NO: 1 ), wherein (FLP) binds to both 13-bp 5'-GAAGTTCCTATTC-3' arms flanking the 8 bp spacer.
- LoxP refers to locus of X-over P1 ; a site on the bacteriophage P1 consisting of 34 base pairs (bp).
- the site includes an asymmetric 8 bp sequence, variable except for the middle two bases, in between two sets of palindromic 13 bp sequences.
- the sequence is ATAACTTCGTATAN N NTAN NNTATACGAAGTTAT (SEQ ID NO: 2), wherein ' ⁇ ' indicates bases which may vary.
- TERT telomerase reverse transcriptase
- hTERT telomerase reverse transcriptase
- telomerase reverse transcriptase is a catalytic protein component (or subunit) of the ribonucleoprotein enzyme telomerase which, together with the telomerase RNA component (hTER), comprises the most important unit of the telomerase complex.
- RNA As used herein, the term "Telomerase RNA” (abbreviated to TERC, TER, hTER, TRC3, TR and hTR) is an RNA, found in eukaryotes that is a component (or subunit) of telomerase, that contains a short segment that provides the template for telomere repeat synthesis. As used herein, the term 'comprising' does not preclude the presence of additional steps or substances in the methods and compositions, respectively, of the invention, and is understood to include within its scope the terms 'consisting of and 'consisting essentially of features defined in the claimed invention.
- At least one isolated pluripotent telomerase activity null stem cell comprising two mutated alleles of a telomerase activity gene selected from the group comprising the human telomerase reverse transcriptase (hTERT) gene and the human telomerase RNA (hTER) gene, wherein said telomerase activity null stem cell has limited lifespan and reduced tumorigenic potential.
- a telomerase activity gene selected from the group comprising the human telomerase reverse transcriptase (hTERT) gene and the human telomerase RNA (hTER) gene, wherein said telomerase activity null stem cell has limited lifespan and reduced tumorigenic potential.
- the specific type of mutation or alteration of the hTERT or hTER gene for the purpose of the invention is not intended to be limited, other than the mutation effects loss of telomerase activity in said stem cell.
- the mutation may be a substitution, deletion, insertion or any modification of one or more nucleotides, or combination thereof, providing it results in loss of activity.
- One way of effecting the strategy described herein involves engineering inducible telomerase activity knockout stem cells, using a gene targeting approach, which allows for an unlimited supply of pluripotent genetically-modified stem cells and the convenience to inactivate telomerase activity at the desired time in order to reduce the cells' life-span and reduce tumorigenicity.
- At least one isolated inducible telomerase activity knockout pluripotent stem cell comprising two mutated alleles of a telomerase activity gene selected from the group comprising the human telomerase reverse transcriptase (hTERT) gene and the human telomerase RNA (hTER) gene; wherein said alleles comprise an introduced and removable portion of said hTERT or hTER gene.
- hTERT human telomerase reverse transcriptase
- hTER human telomerase RNA
- telomere length may be reduced by introducing a knockout cassette. Once the telomerase activity gene is knocked out the average telomere length may be around 4 kb which may equate to around 20-30 cell divisions remaining before senescence.
- telomere length in the mutated cells so that, once the activity of the said mutated hTERT or hTER gene is knocked out, the null cells have an increased lifespan so they can be expanded to derive enough cells for clinical use.
- the at least one isolated inducible telomerase activity knockout stem cell has been further subjected to transient overexpression of hTERT, hTER or both hTERT and hTER to increase the average telomere length.
- the average telomere length may be increased to any size between about 6 kb and the approximately 12-14 kb or longer of the parental H1 cells.
- a preferred embodiment relates to an isolated inducible teiomerase activity knockout stem cell as described above, wherein after transient overexpression of hTERT or hTER the average telomere length in the stem cell is increased to at least 6 kb. More preferably, the average telomere length in the isolated inducible teiomerase activity knockout stem cell is increased to at least 9 kb.
- Another aspect of the invention relates to at least one isolated pluripotent teiomerase activity null stem cell, comprising: at least one inducible teiomerase activity knockout pluripotent stem cell comprising an introduced and removable portion of a hTERT or hTER gene which has been contacted with a knockout inducer to remove said introduced removable gene portion; wherein said teiomerase activity null stem cell has limited lifespan and reduced tumorigenic potential.
- said portion of the hTERT or hTER gene is replaced by homologous DNA flanked by LoxP sites, which retains gene function, and at a selected time transient expression of Cre recombinase in the recombinant cell causes deletion of the homologous DNA resulting in loss of hTERT or hTER activity and, consequently, teiomerase activity.
- Cre/LoxP Cre/LoxP to create inducible knockout.
- the LoxP sites could be substituted by FRT sites and the respective portion of the gene removed with FLP recombinase.
- Another way of effecting the strategy described herein involves engineering teiomerase activity knockout stem cells using a gene editing approach.
- An example of such an approach is use of a CRISPR-Cas system.
- a CRISPR-Cas system used may be the CRISPR-Cas9 system described by Ran FA, et al., [Nat. Protoc 8: 2281-2308 (2013)] incorporated herein by reference.
- CRISPR-Cas9 can be engineered to target and insert double strand DNA breaks in the hTERT or hTER gene, as shown in Example 13 herein.
- At least one isolated pluripotent telomerase activity null stem cell wherein said telomerase activity null stem cell has been produced by exposing at least one isolated pluripotent stem cell to a CRISPR-Cas or other synthetic nuclease system to knock out alleles of a telomerase activity gene selected from the group comprising the human telomerase reverse transcriptase (hTERT) gene and the human telomerase RNA subunit (hTER) gene, thereby resulting in at least one telomerase activity null stem cell with limited lifespan and reduced tumorigenic potential.
- hTERT human telomerase reverse transcriptase
- hTER human telomerase RNA subunit
- the CRISPR-Cas9 system is used.
- hTERT exon 1 is targeted by CRISPR-Cas using one or more guide RNAs having a nucleic acid sequence selected from the group comprising SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18 and SEQ ID NO: 19. More preferably, guide RNAs having the sequences SEQ ID NO: 16 and SEQ ID NO: 17 may be used. If the CRISPR-Cas system is used the resulting null cells may have relatively short telomeres which could limit the remaining possible cell divisions to too few to provide sufficient cells for clinical use before the cells senesce.
- the at least one isolated pluripotent stem cell has been subjected to transient over-expression of hTERT, hTER or both hTERT and hTER to increase the average telomere length prior to exposure to CRISPR-Cas or other synthetic nuclease system.
- the isolated telomerase activity null stem cell has an average telomere length of 9 kb or less. More preferably, the average telomere length is 5 kb or less. More preferably, the average telomere length is 4 kb or less. Even more preferred, the average telomere length is 2 kb to 4 kb, or 3 to 4 kb.
- the telomere length has a direct relationship with the number of cell divisions remaining for a cell, and that the cells of the invention may be passaged until the desired average telomere length is obtained.
- the isolated telomerase activity null stem cell described above retains expression of at least one pluripotency marker.
- the at least one pluripotency marker is selected from the group comprising Oct4, Nanog, Sox2 and Klf4.
- the method according to any aspect of the invention may be performed in vitro. Accordingly, the method is performed with isolated pluripotent stem cell(s).
- the pluripotent stem cell(s) for use in the invention may be from any animal.
- the pluripotent stem cells may be human.
- the pluripotent stem cell(s) may comprise induced pluripotent stem cell(s) or embryonic stem cell(s). Any method of preparing pluripotent stem cells or induced pluripotent stem cells is applicable for the invention.
- the stem cell is a human embryonic stem cell (hESC) or induced pluripotent stem cell (iPSC).
- hESC human embryonic stem cell
- iPSC induced pluripotent stem cell
- Specific gene activity may be knocked out either directly or delayed until desired and then knocked out using knockout inducers.
- direct knockout of telomerase activity using for example ZFN, TALEN or CRISPR can be achieved, the cells derived from direct knockout do not last very long before senescing. Moreover, knockout cells generated this way have to be replaced by newly generated knockouts, which is impractical and quality control becomes a problem. Recombinant cells carrying an inducible knockout can be passaged and manipulated for longer before the target gene is knocked out.
- telomere length to allow for expansion of telomerase knockout cells could be obtained by transiently increasing telomerase activity prior to CRISPR Cas-induced TERT or TER knockout.
- Another aspect of the invention provides a method of producing one or more isolated pluripotent telomerase activity null stem cells with limited lifespan and reduced tumorigenicity compared to wild type cells, comprising the steps of:
- telomere activity gene selected from the group comprising the human telomerase reverse transcriptase (hTERT) gene and the human telomerase RNA subunit (hTER) gene;
- hTERT human telomerase reverse transcriptase
- hTER human telomerase RNA subunit
- telomerase activity knockout stem cell clones comprising the human telomerase reverse transcriptase (hTERT) gene and the human telomerase RNA subunit (hTER) gene; and
- telomerase activity null cells with an average telomere length evaluated to be 5 kb or less and a reduced ability to form a teratoma in vivo;
- telomere length is evaluated to be 5 kb or less and the cells have reduced ability to form a teratoma in vivo.
- the average telomere length is around 4 kb. In other preferred embodiments, the average telomere length may be 2 kb to 4 kb or 3 kb to 4 kb. It would be understood that the optimum telomere length desired may depend on the particular use intended for the cells; for example a requirement for in vitro use or a requirement for expansion prior to clinical implantation.
- a portion of the hTERT or hTER gene is replaced by homologous DNA flanked by LoxP sites, which retains gene function, and at a selected time transient expression of Cre recombinase in the recombinant cells causes deletion of the homologous DNA and in (b) a portion of the hTERT or hTER gene is edited by CRISPR-Cas, resulting in loss of telomerase activity.
- the recombinant cells are homozygous for the homologous DNA insert.
- the hTERT gene in (a) is replaced and the portion of the hTERT gene replaced includes exon 1 and/or exon 2.
- the method may further comprise a step of inducing the telomerase activity null cells to differentiate.
- the telomerase activity null cells are induced to differentiate into cells of at least one of ectodermal, endodermal or mesodermal lineage. Methods exist in the art to differentiate stem cells down particular lineages.
- the telomerase activity null cells of the invention are induced to differentiate into neurons.
- the telomerase null cells may be induced to differentiate in dopaminergic neurons, GABAergic neurons, motor neurons, or glutamatergic neurons.
- the telomerase activity null cells are induced to differentiate into astrocytes and/or glia. In yet another preferred embodiment, the telomerase activity null cells are induced to differentiate into hematopoietic cells.
- Another aspect of the invention provides a method of producing one or more isolated pluripotent telomerase activity null stem cells suitable for clinical use, comprising: evaluating the average telomere length and/or in vivo tumorigenicity of said pluripotent stem cells in which the human telomerase reverse transcriptase (hTERT) or the human telomerase RNA subunit (hTER) activity has been inactivated; and identifying said pluripotent stem cells as suitable for clinical use if said evaluated average telomere length is 5 kb or less and/or said cells have reduced ability to form a teratoma in vivo.
- the average telomere length is around 4 kb.
- the average telomere length may be 2 kb to 4 kb or 3 kb to 4 kb. It would be understood that the optimum telomere length desired may depend on the particular clinical use intended for the cells.
- the hTERT or hTER inactivation is by virtue of an induced, or CRISPR-Cas, knockout of hTERT or hTER gene activity.
- a portion of the hTERT or hTER gene is replaced by homologous DNA flanked by LoxP which retains gene function, and at a selected time transient expression of Cre recombinase in the recombinant cells causes deletion of the homologous DNA resulting in loss of hTERT or hTER activity and, consequently, telomerase activity; or (ii) a portion of the hTERT or hTER gene is edited by CRISPR-Cas resulting in loss of hTERT or hTER activity and, consequently, telomerase activity.
- any suitable inducible knockout system could be used, such as FLP/FRT.
- the PGK-neo selection cassette was removed with FLP/FRT because the hTERT gene portion was cloned to be removable with Cre/LoxP.
- the recombinant cells from the Cre-Lox method (i) are homozygous for the homologous DNA insert.
- the stem cells have limited proliferation capacity.
- the stem cells retain expression of at least one stem cell pluripotency marker. More preferably, the at least one stem cell marker is selected from the group comprising Oct4, Nanog, Sox2 and Klf4.
- the pluripotent telomerase activity null stem cells are human embryonic stem cells (hESC), progenitor cells or induced pluripotent stem cells (iPSC).
- the method may further comprise a further step of inducing said at least one isolated pluripotent telomerase activity null stem cells to differentiate.
- the stem cells may be partially differentiated into progenitor cells such as, for example, neural progenitor cells.
- progenitor cells are described by some in the art to be a form of stem cell and will be considered as such for the purpose of the invention.
- the at least one telomerase activity null cells are induced to differentiate into cells of at least one of ectodermal, endodermal or mesodermal lineage. In a preferred embodiment, the at least one telomerase activity null cells are induced to differentiate into neurons.
- the at least one telomerase activity null cells are induced to differentiate into astrocytes and/or glia. In yet another preferred embodiment, the at least one telomerase activity null cells are induced to differentiate into hematopoietic cells.
- said evaluating step comprises performing one or more of: single telomere length analysis (STELA), fluorescence in-situ hybridization (FISH), flow-FISH and Southern blot analysis.
- STELA single telomere length analysis
- FISH fluorescence in-situ hybridization
- FISH flow-FISH
- Southern blot analysis comprises performing one or more of: single telomere length analysis (STELA), fluorescence in-situ hybridization (FISH), flow-FISH and Southern blot analysis.
- the method of producing one or more isolated pluripotent telomerase activity null stem cells suitable for clinical use may further comprise:
- telomere integrity comprises one or more of: karyotyping; analysis of variable number tandem repeats (VNTRs), short tandem repeats (STRs), single nucleotide polymorphisms (SNPs), and/or copy number variations (CNVs); analysis of culture mosaicism; analysis of DNA sequences related to genetic diseases; and complete genome sequencing and analysis; and
- the genome integrity is assessed prior to gene inactivation.
- at least one isolated pluripotent telomerase activity null stem cell herein defined for the preparation of a therapeutic composition for cell therapy of a subject in need thereof.
- the at least one isolated pluripotent telomerase activity null stem cell is differentiated into cells of at least one of ectodermal, endodermal or mesodermal lineage. More preferably, the at least one isolated pluripotent telomerase activity null stem cell is differentiated into cells of at least one lineage selected from the group comprising neurons, astrocytes and/or glia and hematopoietic cells.
- the method according to any aspect of the invention may include inducing differentiation of the at least one isolated pluripotent telomerase activity null stem cells into endoderm, mesoderm or ectoderm lineage. More particularly, the isolated pluripotent telomerase activity null stem cells are induced to differentiate into neurons, glia or hematopoietic cells.
- Zinc Finger Nucleases ZFNs
- TALENs Transcription Activator-Like Effector Nucleases
- DSBs site-specific double strand breaks
- TALENs Transcription Activator-Like Effector Nucleases
- ZFNs zinc finger nucleases
- Paired ZFNs were purchase from Sigma (Cat# CSTZFN-1 KT-hTERT). TALENs was engineered as previously described (Christian M., et al. Genetics 186, 757-761 (2010)). Paired ZFNs and TALENs were used to target distinct genomic DNA sequences in exon 1 of hTERT (refer to Figure 1 ).
- the hTERT genomic locus was targeted to engineer telomerase inducible knockout in human ES cells.
- the gene targeting strategy relies on the replacement of endogenous gene locus by exogenous DNA sequence, mediated by homologous recombination.
- the targeting vector was engineered to introduce two LoxP sites flanking hTERT exon 1 and exon 2, as seen in Figure 2. Upon expression of Cre recombinase, both exon 1 and exon 2 are deleted from the hTERT genomic locus, which encompasses almost 50% of hTERT N-terminal protein coding region.
- the targeting vector pBSK-3kb-5'-LoxP-hTERT-FRT-PGKNeo-FRT-LoxP-3'- PGK-DTA (AZFN) (refer to Figure 2) (refer to Figure 2), was constructed as follows: Genomic DNA from H1 human embryonic stem cells was used as template for
- the amplified PCR fragment was first cloned into pBSK, and the sequence was verified by capillary DNA sequencing. Multiple polymorphisms were detected in the PCR amplified fragments. The PCR fragment was then used in stepwise construction of gene targeting vector, using specific restriction enzymes.
- SL0094 and SL0095 primers were used to amplify the Exon 1 +lntron 1+Exon 2+lntron 2 region with 5' Sail site (underlined) and 3' BamHI site (underlined) and cloned into pBSK (pBSK-5'-hTERT).
- annealed double stranded oligonucleotides (SL0098 and SL0099) that encode a single LoxP site (underlined) were inserted in the 5' Sail site using in-fusion ligation kit (Clontech) to create (pBSK-5'-LoxP-hTERT).
- the 3' homologue arm of the targeting vector was amplified using SL0096 and SL0097 primer set and cloned into pBSK-5'-LoxP-hTERT to create pBSK-5'- LoxP-hTERT-3'. Restriction sites are underlined.
- the DNA fragment containing PGK-neo selection cassette and 3' LoxP site was cut out from pF2L2 vector using BamHI and Nhel, and inserted into the BamHI /Nhel site in pBSK-5'-LoxP-hTERT-3' to derive pBSK-5'-LoxP-hTERT-FRT-PGKNeo- FRT-LoxP-3 1 .
- Step 5 pBSK-5'-LoxP-hTERT-FRT-PGKNeo-FRT-LoxP-3'-PGK-DTA
- the Sall/Xhol DNA fragment from pF2L2 vector that contains PGK-DTA was then cloned into pBSK-5'-LoxP-hTERT-FRT-PGKNeo-FRT-LoxP-3' to create pBSK- 5'-LoxP-hTERT-FRT-PGKNeo-FRT-LoxP-3'-PGK-DTA.
- Step 6 pBSK-5'-LoxP-hTERT-FRT-PGKNeo-FRT-LoxP-3'-PGK-DTA (ASacl) Site-directed mutagenesis was performed to eliminate the Sacl site in the
- PGK-Neo and PGK-DTA fragments in the pBSK-5'-LoxP-hTERT-FRT-PGKNeo- FRT-LoxP-3'-PGK-DTA vector using oligonucleotide primers SL00171 and SL0172 (mutated site underlined).
- 3 kb DNA fragment upstream of hTERT 5' was amplified from genomic DNA using SL0232 and SL0233.
- the PCR fragment was then cloned into Sacl-linearized pBSK- 5'-LoxP-hTERT-FRT-PGKNeo-FRT-LoxP-3'-PGK-DTA (ASacl) using In-Fusion® cloning kit (Clontech Laboratories Inc.).
- SL0232 3 kb DNA fragment upstream of hTERT 5' (-1000— 4000) was amplified from genomic DNA using SL0232 and SL0233.
- the PCR fragment was then cloned into Sacl-linearized pBSK- 5'-LoxP-hTERT-FRT-PGKNeo-FRT-LoxP-3'-PGK-DTA (ASacl) using In-Fusion® cloning kit (Clontech Laboratories
- Step 8 pBSK-3kb-5'-LoxP-hTERT-FRT-PGKNeo-FRT-LoxP-3'-PGK-DTA (AZFN)
- site-directed mutagenesis was performed using SL0259/SL0259 antisense primer pairs.
- Feeder-independent human H1 embryonic stem cells from WiCell (WiCell Research Institute, Madison, WN, USA) were grown on MatrigelTM (BD biosciences)- coated cell culture dishes using mTeSRTM1 culture medium (STEMCELL Technologies). When the cells were 80-90% confluent, the cells were passaged using Dispase, and split 1 :6 to 1 :12 onto new MatrigelTM -coated cell culture dishes.
- the Neon® transfection system (Life Technologies) was used for targeting the first allele of hTERT. Briefly, the cells were harvested using trypsin and counted and the cells washed once with 1 xPBS before being re-suspended in Neon® Re- suspension buffer at 1x10 7 /ml final concentration.
- the cells were plated onto MatrigelTM-coated 10cm dishes in the presence of 6ml of mTeSRTM1 with 10 ⁇ Y-27632 (Rock inhibitor). About 5-6x10 6 cells were plated into one 10cm dish. The cells were maintained in mTeSRTM1 and the medium changed every day.
- mTeSRTM1 with 50 Mg/ml G418 (neomycin) was then added for selection of G418-resistant clones.
- the cells need to be maintained in mTeSRTM1 with 50 Mg/ml G418 for about 12 days before the colonies are big enough for picking.
- the G418-resistant colonies were about 3-4 mm in size, the individual G418-resistant clone on the 10cm dish was picked up using sterile p200 pipette tip and transferred into two new wells on a MatrigelTM-coated 96 well plate. The colonies were allowed to grow 2-3 days before being ready for screening, using PCR as previously described (Zhang et al. Nat Methods 5, 163-165 (2008)).
- the PGK-Neo cassette was first removed by FLP.
- the cells were transiently transfected with pCAG-Flpe:GFP plasmid using Neon® transfection system (as described above).
- the cells were maintained in mTeSRTM1 with 10 ⁇ Y-27632 (Rock inhibitor) for 24 hours, and the GFP-positive cells then sorted out and collected using FACS.
- the cells were then seeded at low density (200-500 cell/well in 6-well dishes) to allow the colonies derived from single ES cells to emerge. When the colonies grew to about 3-4 mm size, the colonies were transferred to 96-well dishes and used for PCR diagnosis for the loop out of PGK-Neo cassette.
- the second allele was targeted exactly as described above for the first allele.
- the targeted alleles of hTERT were confirmed by Southern blotting analysis (shown on Figure 5A).
- the genomic DNA was extracted using Gentra® Puregene® genomic DNA purification kit (Qiagen). Southern blots for detection of targeted genomic insertions were performed as previously described (Liu C.Y. et al. Genes Dev 10, 1835-1843 (1996)). For telomerase activity analysis, telomeric repeat amplification protocol (TRAP) assay was performed as previously described (Kim N.W., et al. Science 266, 2011-2015 (1994)). For telomere length measurement, the genomic DNA was digested with Hphl and Mnll at 37°C for 16 hours. The DNA blot was hybridized to 32 P-labeled (TTAGGG)6 oligonucleotide, as previously described (Li S. et al., Cancer Res 64, 4833-4840 (2004)).
- TTAGGG 32 P-labeled
- pCre-IRES-mCherry plasmid (pmCherry-C1 vector from Clontech in which Cre-IRES was inserted into the multiple cloning site) was transiently transfected into ES cells that have both hTERT genomic alleles flanked by a LoxP site (as generated in Example 3), using Neon® transfection system (as described above).
- the cells were maintained in mTeSRTM1 with 10 ⁇ Y- 27632 (Rock inhibitor) for 24 hours, and the mCherry-positive cells then sorted out and collected using FACS.
- the cells were then seeded at a low density of 200-500 cell/well in 6-well dishes to allow the colonies derived from single ES cells to emerge. When the colonies grew to about 3-4 mm size, the colonies were transferred to 96- well dishes and used for PCR diagnosis for the loop out of hTERT Exons 1 and 2.
- RNA protection assay using Ambion RPA IIITM Ribonuclease Protection Assay Kit; refer to Figure 5B
- deletion of one copy of hTERT results in about 50% loss of hTERT mRNA expression
- deletion of both copies of hTERT results in the complete loss of full-length hTERT mRNA expression in ES cells.
- Figure 5C shows that deletion of one allele of hTERT results in about 50% reduction of telomerase activity, whereas deletion of both alleles of hTERT results in the complete loss of telomerase activity, as shown by TRAP assay.
- telomere length in the parental ES cells is about 13-14 kb as shown by genomic Southern blotting analysis ( Figure 6A).
- ES cell colonies with LoxP sites flanking the only one allele of hTERT showed slight shortening of telomere compared to the parental ES cells. This is probably due to the disruption of hTERT expression by the neomycin cassette in the targeting vector during the gene targeting process ( Figure 4).
- Introduction of LoxP sites flanking the exon 1 and exon 2 of hTERT can potentially inhibit hTERT mRNA expression as well. Consistent with that, further telomere attrition was observed in ES cell colonies with LoxP sites flanking both allele of hTERT (hTERT loxP/loxP ).
- the hTERT lo P/loxP ES cells have relatively short telomere, around 5 kb
- the hTER /_ ES cell colonies derived from hTERT ioxP/loxP ES cells by transient expression of Cre recombinase have even shorter telomere length, and can only be passaged for approximately 8-9 times before they lose the capacity to divide continuously (as can be seen in Figure 6A).
- hTERT +/+ , hTERT + " and hTERT " ES cells were analyzed for their incorporation of 5-ethynyl-2'-deoxyuridine (EdU) which marks dividing cells.
- EdU 5-ethynyl-2'-deoxyuridine
- Luminescence was measured on a microplate reader (Infinite 200, Tecan) every 24 hours.
- hTERT _ " (P8) cells also showed increased cell death.
- Annexin V and 7-AAD staining showed increased apoptosis in hTERT " ' " (P8) ES cells (29.78%) compared to hTERT +/+ , hTERT +/” and hTERT “ “ (P2) ES cells (4.15%) ( Figure 7D).
- Cells were harvested by trypinization, washed once with PBS and stained with 7-AAD (BD Biosciences) and Annexin V (BD Biosciences) for 15 minutes at room temperature in the dark. Samples were acquired on flow cytometer (BD LSRFortessa, BD Biosciences) and data acquired were analyzed using FlowJo (Tree Star).
- telomere length in hTERT loxP/loxP ES cells is maintained at a short (about
- telomere activity in hTERT loxP/loxP ES cells is sufficient for telomere maintenance.
- hTERT-IRES- GFP a mammalian expression vector overexpressing hTERT-IRES- GFP was transiently transfected into the hTERT loxP loxP ES cells, following which the GFP positive cells were FACS sorted and the single cell colonies were isolated.
- the single cell colonies (those numbered 1 , 2 and 5), derived from transient overexpression of hTERT, have elongated telomeres of similar length as, or even longer than, the parental hTERT loxP loxP H1 ES cells.
- No integration of the hTERT-IRES-GFP expressing vector was detectable in the newly derived hTERT loxP/loxP ES cell colonies.
- the hTERT " ' " ES cell colonies derived from the new hTERT loxP/loxP ES cells also have longer telomeres to start with; about 9-10 kb, as shown in Figure 9; and can be passaged much longer than the hTERT " ' " ES cell with short telomeres of about 4 kb as was seen in Figure 6A.
- Engineered hES cells maintain normal karyotype Given the propensity of human ES cells to accumulate genetic aberrations during in vitro culture, karyotyping was done during each step of gene targeting to ensure that the clonally-derived human ES cell lines maintained a normal karyotype.
- the cells were grown to 50-60% confluent, and colcemid was then added to the culture at final concentration of 10 g/ml and incubation continued for 4 hours.
- the cells were harvested by trypsin-EDTA and washed with HEPES buffered saline solution (HBSS).
- HBSS HEPES buffered saline solution
- the cells were then re-suspended in hypotonic solution (2 parts of 0.6% sodium citrate tribasic dihydrate + 1 part of 75 mM KCI) and incubated in 37°C water bath for 20 minutes. Subsequently, 1 ml of fixative (3 parts of methanol + 1 part of glacial acetic acid) was added to the tube and mixed by pipetting up/down.
- ES cell-specific surface antigens (Adewumi O., et al. Nat Biotechnol 25, 803-816 (2007)), such as TRA-1 -60 and SSEA-4, as well as genes involved in the maintenance of undifferentiated ES cell state such as OCT4 and NANOG. This can be seen using immunocytochemistry assays, as set out in Figures 11 A-1 1 D.
- Figure 1 1 E provides qRT-PCR results showing that the expression levels of ES cell marker genes in the hTERT +/" and hTERT _/" ES cells, such as OCT4, SOX2, KLF4 and NANOG, were comparable to the parental ES cells (hTERT +/+ ), although there were small variations in different independent hTERT + " and hTERT "A ES cell lines.
- telomerase null ES cells To determine the differentiation potential of telomerase null ES cells in vitro, these cells were grown in suspension to induce the formation of embryoid bodies (EBs) (Itskovitz-Eldor J., et al. Mol Med 6, 88-95 (2000)).
- EBs embryoid bodies
- Embryoid bodies were formed by trypsinization to a single-cell suspension and plating into low-adherence dishes in human ES cell mTeSRTM1 medium. For spontaneous differentiation, 7-10 day old EBs were used according to the previously established protocol (Dimos J.T., et al. Science 321 , 1218-1221 (2008)). In brief, the EBs (about 5-10) from human ES cells were transferred onto gelatin-coated 24-well plates and allowed to differentiate in DMEM+10% fetal bovine serum for 1 -2 weeks.
- the hTERT +/+ , hTERT +/" and hTERT A EBs were then plated on gelatin-coated plates for 2 weeks.
- the attached cells spontaneously differentiated into cell types representative of the three germ layers (refer to Figures 12A - 12E), which express early differentiation markers for ectoderm (Tuj1 and GFAP); mesoderm (SMA and Desmin) and endoderm (AFP). These data indicate that the hTERT _/" ES cells remain pluripotent.
- mice were fixed in 4% paraformaldehyde for 10 minutes. The fixed cells were washed three times with 0.1 M Tris buffered saline containing 0.1 % Triton-X 100 (TBS-TX) and incubated in primary antibody including: mouse anti-Oct3/4 (1 :500, Santa Cruz Biotechnology), mouse anti-Tra- - 60 (1 :100, Santa Cruz Biotechnology), rabbit anti-Nanog (1 :100, Cell Signaling Technology), mouse anti-SSEA-4 (1 :500, Millipore), rabbit anti-AFP (1 :400, Dako), mouse anti-Desmin (1 :100, Abeam); goat anti-SOX2 (1 : 500, Santa Cruz Biotechnology), mouse anti-SMA (1 :200, Sigma), mouse anti-Tujl (1 :1000, Covance), mouse anti-GFAP (1 :1000, Millipore), mouse anti-Human Nuclei (1 :500, Abeam), mouse anti-Nestin (1
- Telomerase null hES cells do not form teratomas when telomeres are sufficiently short hTERT +/+ , hTERT +/" and hTERT ";” ES cells were injected subcutaneously into the dorsal-lateral area of immunodeficient (NSG) mice, as described previously (Prokhorova T.A., et al. Stem Cells Dev 18, 47-54 (2009); incorporated herein by reference). Eight weeks following the injection, the formation of teratoma was evaluated.
- hTERT "7" ES cells with long telomere (9 kb) form teratomas in immunodeficient mice with high frequency, as can be seen in Figure 13A.
- hTERT ;" ESCs with shorter telomere (4 kb, P2 in Figure 6A) were injected into immunodeficient mice, only one out of 20 injections resulted in the formation of teratoma.
- hTER /_ ES cells with very short telomere (3.5 kb, P4 in Figure 6A) were injected into the immunodeficient mice, none out of 60 injections resulted in the formation of teratoma in vivo.
- ES cells were harvested using Dispase, washed with 1xPBS and re-suspended in 30% MatrigelTM (BD Science). About 1x10 6 cells (100 ⁇ ) were injected subcutaneously into NSG mice (NOD.Cg-Prkdcscid ll2rgtm1Wjl/SzJ) in the dorso-lateral area on both sides, as previously described (Prokhorova T.A., et al. Stem Cells Dev 18, 47-54 (2009)). The mice were sacrificed and the tumors were harvested 8 weeks after injection. The tumors were dissected and fixed in PBS with 4% paraformaldehyde. Paraffin-embedded tissue was sliced and stained with hematoxylin and eosin.
- hTER A ES cells with very short telomeres can only be passaged in vitro for another 4-5 passages (as seen in Figure 6A). Histological examination of the tumors derived from hTERT +/+ , hTERT +/" and TERT “/_ ES cells showed that they contained various tissues derived from all three germ layers, including respiratory epithelium (endoderm); striated muscle and cartilage (mesoderm), and neural epithelium with rosettes (ectoderm). The results are shown in Figure 13B.
- hTERT (+/+) hTERT (+A) and hTERT ("A) ES cells was carried out as previously reported (Li et al., 2011 ) (see Figure 14A).
- hTERT (+/+) and hTERT (“A) ES cells were cultured in mTeSRTM1 medium.
- mTeSRTM1 medium was removed and replaced with neural induction media containing DMEM/F12: Neurobasal (1 :1 ), 1xN2, 1 xB27, 1 % Glutmax, 5 Mg/mL BSA, 4 ⁇ CHIR99021 (Cellagentech), 3 ⁇ SB431542 (Cellagentech), 0.1 ⁇ Compound E ( ⁇ -Secretase Inhibitor XXI, EMD Chemicals Inc.), 10 ng/mL hLIF (Millipore) for 7 days.
- DMEM/F12 neural induction media containing DMEM/F12: Neurobasal (1 :1 ), 1xN2, 1 xB27, 1 % Glutmax, 5 Mg/mL BSA, 4 ⁇ CHIR99021 (Cellagentech), 3 ⁇ SB431542 (Cella
- the culture was then split 1 :3 for the next six passages using AccutaseTM, and cells were cultured in human neural progenitor cells (NPCs) maintenance media containing DMEM/F12: Neurobasal (1 :1 ), 1 xN2, 1 xB27, 1 % Glutmax, 5 ⁇ g/mL BSA, 3 ⁇ CHIR99021 , 2 ⁇ SB431542, 10 ng/mL hLIF on MatrigelTM-coated plates. After six passages, the cells were split 1 :10 regularly.
- NPCs neural progenitor cells
- the human NPCs neural differentiation assay was performed by plating 5x10 4 cells/well on laminin-coated (37°C, 4 hours) 24-well plates in neural differentiation media containing DMEM/F12: Neurobasal (1 :1 ), 1xN2, 1xB27, 1 % Glutmax on polyL- Lysine (4°C, overnight). After 3 days, 10 ng/mL BDNF and 10 ng/mL GDNF (both from R&D Systems, MN, USA) were added to the media every other day and culturing was continued for another 14 days.
- the human NPCs astrocytes differentiation assay was performed by plating 8x10 4 cells/well on 1% Glutmax on MatrigelTM-coated 24-well plates in neural differentiation media containing DMEM/F12: Neurobasal (1 :1 ), 1xN2, 1 % Fetal Bovine Serum (FBS). Immunocytochemistry, carried out as described in Example 9, above, showed that the (NPCs) derived from hTERT (+/+) ; hTERT (+A) and hTERT ( - A) (3.5 kb) ES cells were positive for Nestin and Sox2 ( Figure 14B).
- NPCs derived from hTERT (+/+) ; hTERT (+A) and hTERT ⁇ ES cells showed similar efficiency to differentiate into DCX-positive immature neurons as well as GFAP-positive glial cells ( Figures 14C-14E).
- hTERT (“A> hES cells differentiate into four different neuronal types. 1 ) dopaminergic neurons expressing TH; 2) GABAergic neurons expressing GAD65; 3) glutamatergic neurons expressing vGluTI ; 4) motor neurons expressing ChAT (data not shown). The specific differentiation of these four types of neurons was performed as follows:
- hTERT For dopaminergic neurons expressing TH, hTERT ("A) cells were first treated with 100 ng/mL Sonic hedgehog (SHH) and 100 ng/mL FGF8b in neural differentiation media for 10 days, and then with 10 ng/mL BDNF, 10 ng/mL GDNF, 10 ng/mL IGF1 , 1 ng/mL TGF- 3 and 0.5 mM db-cAMP (Sigma-
- hTERT For GABAergic neurons expressing GAD65, hTERT ("A) cells were treated with SHH (50-500 ng/ml) or its small molecular agonist purmorphamine (0.1-1.5 mM; Calbiochem, San Diego, CA) at days 12-26 to induce ventral progenitors. Retinoic acid (RA, 0.1 mM) was added from day 10 to 23. At day
- cell clusters were dissociated with Accutase (1 unit/ml, Invitrogen) at 37°C for 5 minutes and placed onto polyornithine/laminin-coated coverslips in Neurobasal medium in the presence of valproic acid (VPA, 10 mM, Sigma) for 1 week, followed by a set of trophic factors, including brain-derived neurotrophic factor (BDNF, 20 ng/ml), glial-derived neurotrophic factor
- GDNF GDNF, 10 ng/ml
- IGF1 insulin-like growth factor 1
- cAMP cAMP (1 mM).
- hTERT /_ cells were treated with 200 ng/mL BMP2/4, 100 ng/mL FGF8b and 1 ⁇ RA (Sigma-Aldrich) in neural differentiation media for 10 days, and then with 10 ng/mL BDNF, 10 ng/mL GDNF, 1 ng/mL TGF- 3 and 0.5 mM db-cAMP (Sigma-Aldrich) for another 14-21 days in neural differentiation media.
- hTERT ⁇ cells were sequentially treated with 1 ⁇ RA (Sigma-Aldrich) in neural differentiation media for 7 days, then with 100 ng/mL SHH and 0.1 ⁇ RA for additional 7 days, and finally with 50 ng/mL SHH and 0.1 ⁇ RA for another 7 days.
- the cells were terminally differentiated in the presence of 10 ng/mL BDNF and 10 ng/mL GDNF in the neural differentiation media for about 7 days. All growth factors were from R&D Systems. All tissue culture products were obtained from Invitrogen except where mentioned.
- hTERT (+/+) and hTERT (“/_) 3.5 kb ES cells directly into the midbrain of immunodeficient mice.
- Coronal sections at 40 ⁇ thickness were cut using a cryostat, and serial sections were transferred to individual wells of a 24- well tissue culture dish. Sections were incubated in blocking solution (5% normal goat serum and 0.1 % Triton X-100 in TBS) for 1 hour. Subsequently, primary antibody (Mouse anti-Human Nuclei, 1 :500, Abeam; goat anti-DCX, 1 : 500, Santa Cruz; mouse anti-MAP2, 1 :1 :1 ,000, Sigma; mouse anti-NeuN, 1 :500, Abeam; mouse anti-GFAP, 1 :1000, Millipore) in blocking solution was added to the sections and they were incubated overnight at 4°C.
- blocking solution 5% normal goat serum and 0.1 % Triton X-100 in TBS
- MAP2a-positive cells, a neuronal marker, and tyrosine hydroxylase (TH)-positive cells, a marker for mature dopaminergic neurons, differentiated from hTERT ("A) ES cells can be detected at 16 weeks after injection (see Figures 16B and 16C, respectively).
- DNA sequences encoding five CRISPR guide RNAs (S1-S5; SEQ ID NOs: 15-19) targeting hTERT exon 1 were designed, and all resulted in efficient, site-specific double strand breaks (DSBs).
- the protospacer adjacent motif (PAM) in each sgRNA is at the 3' end and is shaded or underlined.
- Feeder-independent human WA018 embryonic stem cells from WiCell were grown on MatrigelTM (BD biosciences)- coated cell culture dishes using mTeSRTM1 culture medium (Stemcell Technologies). When the cells were 80-90% confluent, the cells were passaged using Dispase, and split 1 :6 to 1 :12 onto new MatrigelTM -coated cell culture dishes.
- telomerase-null WA018 cells using CRISPR/Cas9 system a Cas9 nickase expression vector, (pSPCas9 D10A_GFP S2/S3-derived from pSPCas9 D10A_GFP expression plasmid-Addgene Plasmid #44720 that co-express sgRNAs S2 and S3 as shown in Figure 17C), was transiently transfected into WA018 human ES cells using a Neon® transfection system to introduce targeted DSBs according to the methods in Ran FA, et al., Cell 154: 1380-1389 (2013) and illustrated in Figure 17C.
- the ES cells grown on MatrigelTM were harvested using AccutaseTM and counted. The cells were washed once with 1xPBS before being re-suspended in Neon® Re-suspension buffer at 1x10 7 /ml final concentration.
- Neon® Re-suspension buffer 50 pg of pSPCas9 D10A_GFP S2/S3 vector was added and mixed well before electroporation.
- 100 ⁇ of cells and DNA mixture in Re-suspension buffer was electroporated using 100 ⁇ Neon® pipette in Neon® tube with 3 ml of Neon® Electrolytic Buffer.
- the electroporation condition Pulse, V 1050, MS 30, Number 2.
- the cells were plated onto MatrigelTM-coated 10cm dishes in the presence of 6ml of mTeSRTM1 with 10 ⁇ Y-27632 (Rock inhibitor). About 5-6x10 6 cells were plated into one 10 cm dish. The cells were maintained in mTeSRTM1 with 10 ⁇ Y-27632.
- GFP positive ES cells were sorted out and collected using FACS.
- the cells were seeded at low density (800-2000 cells/ 10 cm dish) on MatrigelTM -coated cell culture dish in mTeSRTM1 with 10 ⁇ Y-27632 for the first 48 hours, then cultured in mTeSRTM1 for about 12 days before the single cell- derived colonies were big enough for picking.
- the colonies were about 3-4 mm in size, the individual clone on the 10 cm dish was picked up using sterile p200 pipette tip and transferred into two new wells on a MatrigelTM-coated 96 well plate.
- telomere-induced insertion/deletion (indel) mutations in three clones were confirmed by Sanger sequencing ( Figure 17D). As shown in Figure 17E, the DSB- induced indels resulted in complete loss of telomerase activity in the three ES cell clones. All three telomerase-null ES cell clones maintained normal karyotype (data not shown). However, these telomerase null ES cell clones had short median telomeres, approximately 5-6 kb in length ( Figure 17F, lanes 2-4).
- telomere deficient cells show an alternative approach for generating telomerase deficient cells with the same characteristics as those generated using the Cre-LoxP type system.
- An advantage of the CRISPR-Cas 9 system is that it is simpler and much more time- efficient, generating telomerase deficient cells in a few months compared to around 12 months using the Cre-LoxP method described herein.
- the telomeres may need to be increased in length prior to CRISPR-Cas treatment by transient increased expression of telomerase.
- Pluripotent stem cells such as human embryonic stem cells and induced pluripotent stem cells, hold great promise for cell therapy.
- stem cell-based therapy also brings concern due to the tumorigenic potential of stem cells.
- pluripotent stem cells form teratomas when injected into immunodeficient mice. If the stem cell contains genetic mutations, it may potentially develop into more malignant teratocarcinomas.
- Current approaches to reduce the risk of tumorigenicity of stem cells have focused on separating differentiated cells from undifferentiated stem cells. The technical burden of such application is enormous.
- the high propensity of stem cells to accumulate chromosome aberrations during in vitro culture may result in the accumulation of genetic mutations in differentiated cells as well, which may result in tumorigenicity in vivo. It is close to impossible to check differentiated cells for their genetic variation and therefore eliminate their tumorigenicity in vivo.
- the present invention provides telomerase knockout human embryonic stem cells, engineered by gene targeting.
- the data herein indicate that by inactivating telomerase in stem cells, the two unique properties of stem cell can be functionally separated: the ability to proliferate indefinitely and the ability to differentiate into various cell types.
- transgenic stem cells constitute an unlimited source for cell engineering but provide, in addition, the concomitant advantage that by limiting their proliferation capacity at a desired time, the risk of their developing tumors in vivo is significantly reduced.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Genetics & Genomics (AREA)
- Zoology (AREA)
- Gynecology & Obstetrics (AREA)
- Biotechnology (AREA)
- Organic Chemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Developmental Biology & Embryology (AREA)
- Chemical & Material Sciences (AREA)
- Wood Science & Technology (AREA)
- Reproductive Health (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Cell Biology (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
The present invention relates to stem cell technology. More particularly, the present invention relates to a method for engineering telomerase null pluripotent stem cells. These telomerase null stem cells remain pluripotent and have a limited life span and reduced tumor formation potential in vivo, which suggests they are useful for cell therapy.
Description
TARGETING TELOMERASE FOR CELL THERAPY
FIELD OF THE INVENTION
The present invention relates to stem cell technology. More particularly, the present invention relates to inducing telomerase knockout in stem cells to limit their life span whilst retaining pluripotency until differentiated. As a result they can be banked with a predetermined lifespan and have reduced ability to cause tumor formation if used in therapy.
BACKGROUND OF THE INVENTION
Since the isolation of human embryonic stem (ES) cells, the potential of stem cells' unlimited renewal capacity and their pluripotency to differentiate into any cell type have opened up the possibility of cell therapy and disease modelling (Thomson, J. A. et al. Science 282, 1 145-1 147 (1998)). The development of human induced pluripotent stem cells (iPSCs) further established personalized cell therapy by providing a solution to overcome the immune rejection of cells transplanted into unmatched patients (Takahashi, K. et al. Cell 131 , 861-872 (2007); Takahashi, K. & Yamanaka, S. Cell 126, 663-676 (2006); Yu, J. et al. Science 318, 1917-1920 (2007)).
However, stem cell-based therapy also brings new safety challenges. One major concern is the tumorigenic potential of stem cells. Pluripotent stem cells share cellular and genetic similarity with tumor cells; such as unlimited potential for cell proliferation, rapid cell proliferation rate and a propensity for genomic instability when cultured in vitro (Baker, D. E. et al. Nat Biotechnol 25, 207-215 (2007)). Such pluripotent stem cells can form teratomas when injected into immunodeficient mice (Blum, B. & Benvenisty, N. Stem Cells 25, 1924-1930 (2007)), and as little as a few hundred pluripotent stem cells are sufficient (Lee, A. S. et al. Cell Cycle 8, 2608- 2612 (2009); Hentze, H. et al. Stem cell research 2, 198-210 (2009)). Furthermore, if the stem cells contain genetic mutations they may potentially develop into more malignant teratocarcinomas (Blum, B. & Benvenisty, N. Advances in cancer research 100, 133-158 (2008)), raising the legitimate concern of safety in clinical applications. A recent report indicates the possibility of donor-derived tumor development
following transplantation of undifferentiated neural stem cells (Amariglio, N. et al. PLoS medicine 6 (2009)).
In addition to tumorigenicity, undifferentiated stem cells show a high propensity to accumulate chromosome aberrations during in vitro culture. The differentiated cells derived from stem cells may themselves also acquire genetic mutations and tumorigenicity during in vitro culture. Therefore, the technical burden of separating differentiated cells from undifferentiated stem cells, as well as ensuring the genetic stability of differentiated cells, remain major challenges for the clinical application of cell therapy. An unlimited proliferation potential is a hallmark of cancer and is shared by stem cells. In order to proliferate continuously, cells need to find a way to maintain their telomere, a special nucleoprotein complex found at the ends of human linear chromosomes (Blackburn, E. H. Nature 408, 53-56 (2000)). Human chromosome ends are capped by telomeres that contain long six-nucleotide DNA repeats 5'- TTAGGG-3 with single stranded 3' G-rich overhangs. The telomeric DNA repeats are bound by shelterin protein complexes consisting of TRF1 , TRF2, RAP1 , TIN2, TPP1 and POT1 that distinguish naturally occurring chromosomal ends from DNA double- strand breaks. Therefore, telomeres are essential for cell genomic stability. Telomeres are synthesized by telomerase, a reverse transcriptase that contains two core components: a catalytic protein, hTERT, and a RNA, hTER (Feng, J. et al. Science 269, 1236-1241 (1995); Nakamura, T. M. et al. Science 277, 955-959
(1997) ). Although the telomerase RNA (hTER) is widely expressed, the catalytic protein hTERT and, consequently, telomerase activity are hardly detectable in the majority of adult human cells, with the exception of stem cells and germ cells (Feng, J. et al. Science 269, 1236-1241 (1995); Nakamura, T. M. et al. Science 277, 955- 959 (1997); Kim, N. W. et al. Science 266, 2011-2015 (1994); Wright, W. E. et al. Dev Genet 18, 173-179 (1996)). Normal somatic cells only have a limited proliferation potential that is controlled by their telomere length (Hayflick, L. & Moorhead, P. S. Exp Cell Res 25, 585-621 (1961 )), whereas pluripotent stem cells share unlimited proliferation capacity with cancer cells, expressing high telomerase activity for telomere maintenance (Thomson, J. A. et al. Science 282, 1 145-1147
(1998) ; Takahashi, K. et al. Cell 131 , 861-872 (2007); Takahashi, K. & Yamanaka, S. Cell 126, 663-676 (2006); Yu, J. et al. Science 318, 1917-1920 (2007)).
Previous studies in a mouse model have shown that inactivation of telomerase activity by inducible knockout of either mTERT or mTER does not result in dramatic phenotype in the first 2-3 generations, owing to the extremely long telomeres in laboratory mice (Lee, H. W. er a/. Nature 392, 569-574 (1998); Strong, M. A. et al. Mol Cell Biol 31 , 2369-2379 (2011 )), but as the telomeres shortened over generations of breeding there was loss of tissue renewal in several proliferative organs.
It is desirable to provide a method that allows expansion of pluripotent stem cell numbers followed by inducible inhibition of telomerase activity to limit their proliferation capacity yet retain pluripotency until differentiated.
SUMMARY OF THE INVENTION
The novel strategy described herein involves engineering telomerase null stem cells with limited lifespan and reduced tumorigenic potential.
According to one aspect of the invention, there is provided at least one isolated pluripotent telomerase activity null stem cell, comprising two mutated alleles of a telomerase activity gene selected from the group comprising the human telomerase reverse transcriptase (hTERT) gene and the human telomerase RNA (hTER) gene, wherein said at least one telomerase activity null stem cell has limited lifespan and reduced tumorigenic potential. One way of effecting the strategy described herein involves engineering inducible telomerase activity knockout stem cells, using a gene targeting approach which allows for an unlimited supply of pluripotent genetically-modified stem cells and the convenience to inactivate telomerase activity at the desired time in order to reduce the cells' life-span and reduce tumorigenicity. A preferred embodiment of the invention provides at least one isolated pluripotent inducible telomerase activity knockout stem cell, comprising two mutated alleles of a telomerase activity gene selected from the group comprising the human telomerase reverse transcriptase (hTERT) gene and the human telomerase RNA (hTER) gene; wherein said alleles comprise an introduced and removable portion of said hTERT or hTER gene.
In a preferred embodiment of the invention the at least one isolated pluripotent inducible telomerase activity knockout stem cell has been subjected to transient over-expression of hTERT, hTER or both hTERT and hTER to increase the average telomere length. Another embodiment of the invention provides at least one isolated pluripotent telomerase activity null stem cell, wherein the pluripotent inducible telomerase activity knockout stem cell described supra has been further contacted with a knockout inducer to remove said introduced removable gene portion thereby resulting in at least one telomerase activity null stem cell with limited lifespan and reduced tumorigenic potential.
In a preferred embodiment of the invention there is provided the isolated pluripotent inducible telomerase activity knockout stem cell described supra, wherein said removable portion of the hTERT or hTER gene is replaced by homologous DNA flanked by LoxP sites, which retains gene function, and at a selected time transient expression of Cre recombinase in the recombinant cell causes deletion of the homologous DNA resulting in loss of hTERT or hTER activity and, consequently, telomerase activity.
In another embodiment of the invention there is provided at least one isolated pluripotent telomerase activity null stem cell, wherein said telomerase activity null stem cell has been produced by exposing at least one isolated pluripotent stem cell to a CRISPR-Cas or other synthetic nuclease system to knock out alleles of a telomerase activity gene selected from the group comprising the human telomerase reverse transcriptase (hTERT) gene and the human telomerase RNA subunit (hTER) gene, thereby resulting in at least one telomerase activity null stem cell with limited lifespan and reduced tumorigenic potential.
In a preferred embodiment of the invention the at least one isolated pluripotent stem cell has been subjected to transient over-expression of hTERT, hTER or both hTERT and hTER to increase the average telomere length prior to exposure to CRISPR-Cas or other synthetic nuclease system.
Another aspect of the invention provides a method of producing one or more isolated pluripotent telomerase activity null stem cells with limited lifespan and reduced tumorigenicity compared to wild type cells, comprising the steps of:
(a)(i) engineering, by gene targeting, at least one isolated pluripotent stem cell to have inducible knockout alleles of a telomerase activity gene selected from the group comprising the human telomerase reverse transcriptase (hTERT) gene and the human telomerase RNA subunit (hTER) gene;
(a)(ii) selecting engineered pluripotent stem cell clones;
(a) (iii) contacting the engineered pluripotent stem cell clones with a gene knockout inducer; or
(b) (i) engineering, by gene editing, at least one isolated pluripotent stem cell having knocked out alleles of a telomerase activity gene selected from the group comprising the human telomerase reverse transcriptase (hTERT) gene and the human telomerase RNA subunit (hTER) gene; and (c) selecting telomerase activity null cells with an average telomere length evaluated to be 5 kb or less and a reduced ability to form a teratoma in vivo; or
(d) selecting telomerase activity null cells and passaging them until the average telomere length is evaluated to be 5 kb or less and the cells having reduced ability to form a teratoma in vivo. Another aspect of the invention provides a method of producing one or more isolated pluripotent telomerase activity null stem cells suitable for clinical use, comprising: evaluating the average telomere length and/or in vivo tumorigenicity of said pluripotent stem cells in which the human telomerase reverse transcriptase (hTERT) or the human telomerase RNA (hTER) activity has been inactivated; and identifying said pluripotent stem cells as suitable for clinical use if said evaluated average telomere length is about 5 kb or less and/or said cells have reduced ability to form a teratoma in vivo.
Another aspect of the invention provides the use of at least one isolated pluripotent telomerase activity null stem cell as described supra for the preparation of a therapeutic composition for cell therapy of a subject in need thereof.
In a preferred embodiment of the invention, the at least one isolated pluripotent telomerase activity null stem cell is differentiated into cells of at least one of ectodermal, endodermal or mesodermal lineage.
Preferably, the at least one isolated pluripotent telomerase activity null stem cell is differentiated into cells of at least one lineage selected from the group comprising neurons, astrocytes and/or glia and hematopoietic cells.
BRIEF DESCRIPTION OF THE FIGURES
Figure 1 shows the engineering of ZFNs and TALENs for gene targeting. A). Binding sequences of synthetic ZFNs (underlined italics) and TALENs (bold). B). Cel-I assay showing the double strand breaks (DSBs) (indicated with "*") resulting from the expression of ZFNs and TALENs in different cell lines.
Figure 2 shows a schematic design of the gene targeting strategy used to introduce loxP sites flanking the exon 1 and exon 2 of hTERT genomic locus.
Figure 3 demonstrates the increased stability of the targeting vector that can be achieved with mutated ZFNs binding sites. A). ZFNs recognition sequences in the targeting vector were mutated by site-directed mutagenesis. B). The stability of targeting vectors with or without ZFNs binding sequence in vivo. The relative amount of intact DNA as measured by P1 primer set is normalized to the total input DNA as measured by P2 primer set. WT: wild type; AZFN: mutated ZFN binding sites. Figure 4 is a schematic representation of the gene targeting procedure in human H1 ES cells, as described in Example 3.
Figure 5 A) is a Southern blot analysis, using genomic DNA samples that were digested with Xbal and Hindi restriction enzymes, confirming the targeted alleles of hTERT. The probe used for Southern blotting analysis is shown on Figure 2, to the left of the first LoxP site. B). shows the expression of full length hTERT in hTERT(+/+); hTERT(+/-> and hTERT^ ES cells, as analyzed by RNA protection assay (RPA) using 32P labeled radioactive RNA probe encompassing hTERT exon 2. C). provides the results of a TRAP assay, performed using whole cell extracts from independent hTERT(+ +); hTERT(+/_) and hTERT("A) ES cell lines to measure the telomerase activity. The RNase-treated sample was used as negative control.
Figure 6 shows telomere shortening in telomerase null human ES cells. A). Genomic Southern analysis of telomere length in independent hTERT+ +, hTERT+ loxP, hTERTloxP/loxP and hTERT"'" ES cell lines. P2, P4, P6 and P8: indicate that the hTERT"7" ES cells have been passaged 2, 4, 6 and 8 times, respectively. B). The expression of senescence-associated β-galactosidase activity in young WI38 primary lung fibroblast cells (PD35) and senescent WI38 (PD67) cells. PD: population doubling. C). Expression of senescence-associated β-galactosidase activity in late passage (P8) hTERT"7" ES cells.
Figure 7 show loss of cell proliferation capacity and increased cell death in senescent hTERT(" _) ES cells. A). Incorporation of 5-ethynyl-2'-deoxyuridine (EdU) during S phase in independent hTERT(+/+); hTERT(+/"}, and hTERT(" _) ES cell lines. B). Cell viability was measured using CellTiter-Glo® luminescent assay in independent hTERT(+/+); hTERT(+A), and hTERT("A) ES cell lines. C). Cell cycle profile analysis of independent hTERT(+/+); hTERT(+/_), and hTERT("A) ES cell lines using FACS. D). Annexin V and 7-AAD staining in independent hTERT(+ +); hTERT(+ ), and hTERT^ ES cell lines.
Figure 8 demonstrates that transient overexpression of hTERT in hTERTioXp/ioxp ES ce||s resets te|0mere |ength
Figure 9 shows telomere shortening of hTERT";" ES cells derived from hTERTloxP loxP ES cells whose telomere length was reset by transient overexpression of hTERT. OE: overexpression; P1 , P5 and P10: indicate the number of passages.
Figure 10 provides karyotyping of human ES cell lines, which shows that the cells maintained a normal karyotype.
Figures 11A-D show immunocytochemistry analysis of the expression of ES cell markers in hTERT inducible knockout hTERT+ +; hTERT+ " and hTERT"''" ES cells: A). TRA-1 -60; B). SSEA-4; C). OCT-4; and D). NANOG. The cell nuclei were stained with DAPI.
Figure 11E sets out the expression of OCT-4, SOX-2, KLF-4, and NANOG in independent hTERT+/+; hTERT+ " and hTERT"'" ES cell lines, as quantified by qRT- PCR and normalized to the expression of GAPDH. The expression level of OCT-4, SOX-2, KLF-4, and NANOG in independent hTERT+/+ is indicated by the dotted line.
Figures 12A-12E demonstrate spontaneous differentiation of human hTERT(+/+> and hTERT("/_) ES cells in vitro into cell lineages of all three germ layers. Representative confocal images showing pluripotency of ES cells in culture, capable of differentiating into cells of the 3 specific lineages, are provided: A), and B). ectoderm: markers Tuj1 and GFAP, respectively; C). and D). mesoderm: markers Desmin and α-SMA, respectively; and E). endoderm: marker AFP.
Figure 13 A), shows the different teratoma formation efficiency in vivo of independent hTERT+/+ (+/+); hTERT+/" (+/-), and three different hTERT" _(-/-) ES cell lines. When the telomere of the hTERT_ "(-/-) ES cell line is 3.5 kb, the ability of the ES cells to form teratomas in vivo is completely suppressed. B). shows H&E staining of teratomas derived from independent hTERT+ +; hTERT+ ", and hTERT_ " ES cell lines. Endoderm: respiratory epithelium (e); Mesoderm: cartilage (c) and skeletal muscle (m); Ectoderm: neural epithelium with rosettes (n). Scale bars, 200pm.
Figure 14 A), is a schematic diagram showing the schedule for induction of neural progenitor cells (NPC) from human ES cells.
Figures 14B-14E show the differentiation of telomerase null human ES cells to neural lineages in vitro. B). provides representative confocal images showing progenitor cells (identified by Nestin and Sox2 staining) induced from hTERT(+/+); hTERT^, and hTERT^ ES cells. C). provides representative confocal images showing the differentiation of these 3 groups of ES cells to neurons, identified by DCX staining; HuN: human nuclei; D). is a graphical representation of the percentage of DCX positive neurons (total DAPI positive cells) that are differentiated from neuronal progenitor cells induced from the different groups of ES cells, as indicated. E). provides representative confocal images showing the differentiation of these different groups of ES cells to astrocytes, marked by GFAP staining.
Figures 15A-F shows effects of injection of hTERT(+ +) (with mean telomere length around 13 kb) and hTERT^ ES cells (with mean telomere length around 3.5 kb) into mouse brain. Representative images showing immunocytochemistry of brain sections from mice injected with: A)-B) hTERT(+/+) ES cells; C)-D) hTERT^ ES cells. E). shows the gross morphology of brains from mice injected with hTERT(+/+) ES cells or hTERT("A) ES cells. Tumor formation was visible in hTERT(+ +) ES but not hTERT("A) ES-injected mouse brains. n=5 is the number of mice injected with hTERT+/+ ES cells
or hTERT"'" ES cells. F). provides representative confocal images showing human nuclei (HuN) staining of tumors in hTERT(+ +) ES cells-injected mouse.
Figure 16 includes representative confocal images showing lack of tumor formation but, instead, in vivo differentiation of hTERT("/_) ES cells (with mean telomere length around 3.5 kb) into mature neurons. A), demonstrates that there is no tumor formation in immunodeficient mouse brain injected with hTERT("/_) ES cells at 8 and 16 weeks post-injection. B). shows the expression of mature neuronal marker, MAP2a, in hTERT("A) ES cell-derived neuronal cells in vivo. C). shows the expression of TH, a marker for dopaminergic neurons, in hTERT("A) ES cell-derived neuronal cells in vivo (marked by arrows).
Figure 17 shows the engineering of telomerase-null ES cells (WA018) using the CRISPR-Cas9 system. A) Shows sequences (S1 -S5) of five independent CRISPR guide RNAs targeting hTERT exon 1. B) Cel-I assay showing DNA cleavage induced by the five independent CRISPR guide RNAs S1-S5. C) Schematic of paired CRISPR guide RNAs (S2 and S3) used for gene targeting. D) Shows Sanger sequencing results confirming DSB-induced insertion/deletion (indel) mutations in three independent ES cell clones derived from parental WA018 ES cells. E) TRAP assay showing complete loss of telomerase activity in three independent telomerase-null ES cell clones. Parental WA018 ES cells and one isogenic hTERT+/+ ES cell clones are positive controls. F) Shows the median telomere length in hTERT-/- ES cells is very short compared to parental WA018 ES cells and isogenic hTERT+/+ ES cells.
Definitions
The term "induced pluripotent stem cell" (iPSC) refers to a pluripotent stem cell derived from a non-pluripotent cell (e.g. an adult somatic cell). Induced pluripotent stem cells are identical to embryonic stem cells in the ability to form any adult cell, but are not derived from an embryo.
As used herein, the term "pluripotent" refers to the potential of a stem cell to make any differentiated cell of an organism. Pluripotent stem cells can give rise to any foetal or adult cell type. However, alone they cannot develop into a foetal or
adult organism because they lack the potential to contribute to extraembryonic tissue, such as the placenta.
As used herein, the term "Cre" refers to Cre recombinase; a tyrosine recombinase enzyme derived from the P1 Bacteriophage. The enzyme uses a topoisomerase I like mechanism to catalyse the site specific recombination event between two DNA recognition (LoxP) sites.
As used herein, the term "CRISPR-Cas" system refers to a microbial adaptive immune system that uses RNA-guided nucleases to cleave foreign genetic elements. It comprises clustered regularly interspaced short palindromic repeats (CRISPRs), a CRISPR-associated (Cas) endonuclease and a synthetic guide RNA that can be programmed to identify and introduce a double strand break at a specific site within a targeted gene sequence. The palindromic repeats are interspaced by short variable sequences derived from exogenous DNA targets known as protospacers, and together they constitute the CRISPR RNA (crRNA) array. Within the DNA target, each protospacer is always associated with a protospacer adjacent motif (PAM), which can vary depending on the specific CRISPR system. CRISPR-Cas9 is a specific version of the system referring to use of RNA-guided Cas9 nuclease, originally derived from Streptococcus pyogenes, whereby the target DNA must immediately precede a 5'-NGG PAM. Variations of the CRISPR-Cas9 system are known [Ran FA, et al., Nat. Protoc 8, 2281-2308 (2013); Ran FA, et al., Cell 154, 1380-1389 (2013)] and although CRISPR-Cas9 has been used herein in the Examples, it is not intended that the present invention be limited to a particular CRISPR-Cas system.
As used herein, the term "FLP" refers to FLP recombinase; derived from the baker's yeast Saccharomyces cerevisiae. The enzyme catalyses a site-specific recombination event between two DNA recognition (FRT) sites.
As used herein, the term "FRT" refers to a flippase recognition target (FRT) site. The 34bp minimal FRT site sequence has the sequence 5'GAAGTTCCTATTCTCTAGAAAGTATAGGAACTTC3' (SEQ ID NO: 1 ), wherein (FLP) binds to both 13-bp 5'-GAAGTTCCTATTC-3' arms flanking the 8 bp spacer.
As used herein, the term "LoxP" refers to locus of X-over P1 ; a site on the bacteriophage P1 consisting of 34 base pairs (bp). The site includes an asymmetric 8 bp sequence, variable except for the middle two bases, in between two sets of palindromic 13 bp sequences. The sequence is ATAACTTCGTATAN N NTAN NNTATACGAAGTTAT (SEQ ID NO: 2), wherein 'Ν' indicates bases which may vary.
As used herein, the term "Telomerase reverse transcriptase" (abbreviated to TERT, or hTERT in humans) is a catalytic protein component (or subunit) of the ribonucleoprotein enzyme telomerase which, together with the telomerase RNA component (hTER), comprises the most important unit of the telomerase complex.
As used herein, the term "Telomerase RNA" (abbreviated to TERC, TER, hTER, TRC3, TR and hTR) is an RNA, found in eukaryotes that is a component (or subunit) of telomerase, that contains a short segment that provides the template for telomere repeat synthesis. As used herein, the term 'comprising' does not preclude the presence of additional steps or substances in the methods and compositions, respectively, of the invention, and is understood to include within its scope the terms 'consisting of and 'consisting essentially of features defined in the claimed invention.
DETAILED DESCRIPTION OF THE INVENTION According to one aspect of the invention, there is provided at least one isolated pluripotent telomerase activity null stem cell, comprising two mutated alleles of a telomerase activity gene selected from the group comprising the human telomerase reverse transcriptase (hTERT) gene and the human telomerase RNA (hTER) gene, wherein said telomerase activity null stem cell has limited lifespan and reduced tumorigenic potential.
It would be understood that the specific type of mutation or alteration of the hTERT or hTER gene for the purpose of the invention is not intended to be limited, other than the mutation effects loss of telomerase activity in said stem cell. The mutation may be a substitution, deletion, insertion or any modification of one or more nucleotides, or combination thereof, providing it results in loss of activity.
One way of effecting the strategy described herein involves engineering inducible telomerase activity knockout stem cells, using a gene targeting approach, which allows for an unlimited supply of pluripotent genetically-modified stem cells and the convenience to inactivate telomerase activity at the desired time in order to reduce the cells' life-span and reduce tumorigenicity.
According to a preferred embodiment, there is provided at least one isolated inducible telomerase activity knockout pluripotent stem cell, comprising two mutated alleles of a telomerase activity gene selected from the group comprising the human telomerase reverse transcriptase (hTERT) gene and the human telomerase RNA (hTER) gene; wherein said alleles comprise an introduced and removable portion of said hTERT or hTER gene.
The generation of such inducible telomerase activity knockout pluripotent stem cells tends to result in the cells having a reduced average telomere length compared to wild type cells. The inventors have found that mutating both alleles of the cells by introducing a knockout cassette may reduce the average telomere length to around 5 kb. Once the telomerase activity gene is knocked out the average telomere length may be around 4 kb which may equate to around 20-30 cell divisions remaining before senescence. It may be advantageous to increase the average telomere length in the mutated cells so that, once the activity of the said mutated hTERT or hTER gene is knocked out, the null cells have an increased lifespan so they can be expanded to derive enough cells for clinical use.
In a preferred embodiment of the invention, the at least one isolated inducible telomerase activity knockout stem cell has been further subjected to transient overexpression of hTERT, hTER or both hTERT and hTER to increase the average telomere length. The average telomere length may be increased to any size between about 6 kb and the approximately 12-14 kb or longer of the parental H1 cells. An advantage of increasing the average telomere length of the isolated inducible knockout cells is that it is then possible to generate telomerase activity null cells that can be passaged until they have a desired average telomere length and, consequently, a desired fixed number of cell divisions remaining. This allows for banking of cells from a single cell line that have different set lifespans.
A preferred embodiment relates to an isolated inducible teiomerase activity knockout stem cell as described above, wherein after transient overexpression of hTERT or hTER the average telomere length in the stem cell is increased to at least 6 kb. More preferably, the average telomere length in the isolated inducible teiomerase activity knockout stem cell is increased to at least 9 kb.
Another aspect of the invention relates to at least one isolated pluripotent teiomerase activity null stem cell, comprising: at least one inducible teiomerase activity knockout pluripotent stem cell comprising an introduced and removable portion of a hTERT or hTER gene which has been contacted with a knockout inducer to remove said introduced removable gene portion; wherein said teiomerase activity null stem cell has limited lifespan and reduced tumorigenic potential. In a preferred embodiment of the invention, said portion of the hTERT or hTER gene is replaced by homologous DNA flanked by LoxP sites, which retains gene function, and at a selected time transient expression of Cre recombinase in the recombinant cell causes deletion of the homologous DNA resulting in loss of hTERT or hTER activity and, consequently, teiomerase activity. It would be understood by the person skilled in the art that other systems may be used instead of Cre/LoxP to create inducible knockout. For example, the LoxP sites could be substituted by FRT sites and the respective portion of the gene removed with FLP recombinase.
Another way of effecting the strategy described herein involves engineering teiomerase activity knockout stem cells using a gene editing approach. An example of such an approach is use of a CRISPR-Cas system.
A CRISPR-Cas system used may be the CRISPR-Cas9 system described by Ran FA, et al., [Nat. Protoc 8: 2281-2308 (2013)] incorporated herein by reference. CRISPR-Cas9 can be engineered to target and insert double strand DNA breaks in the hTERT or hTER gene, as shown in Example 13 herein.
In another preferred embodiment of the invention there is provided at least one isolated pluripotent telomerase activity null stem cell, wherein said telomerase activity null stem cell has been produced by exposing at least one isolated pluripotent stem cell to a CRISPR-Cas or other synthetic nuclease system to knock out alleles of a telomerase activity gene selected from the group comprising the human telomerase reverse transcriptase (hTERT) gene and the human telomerase RNA subunit (hTER) gene, thereby resulting in at least one telomerase activity null stem cell with limited lifespan and reduced tumorigenic potential.
Preferably the CRISPR-Cas9 system is used. In a preferred embodiment, hTERT exon 1 is targeted by CRISPR-Cas using one or more guide RNAs having a nucleic acid sequence selected from the group comprising SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18 and SEQ ID NO: 19. More preferably, guide RNAs having the sequences SEQ ID NO: 16 and SEQ ID NO: 17 may be used. If the CRISPR-Cas system is used the resulting null cells may have relatively short telomeres which could limit the remaining possible cell divisions to too few to provide sufficient cells for clinical use before the cells senesce. To increase the number of cell divisions, it may be necessary to transiently expose the stem cells to a telomerase inducer to increase telomere length prior to CRISPR-Cas treatment. In a preferred embodiment of the invention the at least one isolated pluripotent stem cell has been subjected to transient over-expression of hTERT, hTER or both hTERT and hTER to increase the average telomere length prior to exposure to CRISPR-Cas or other synthetic nuclease system.
In a preferred embodiment, the isolated telomerase activity null stem cell has an average telomere length of 9 kb or less. More preferably, the average telomere length is 5 kb or less. More preferably, the average telomere length is 4 kb or less. Even more preferred, the average telomere length is 2 kb to 4 kb, or 3 to 4 kb. The person skilled in the art would understand that the telomere length has a direct relationship with the number of cell divisions remaining for a cell, and that the cells of the invention may be passaged until the desired average telomere length is obtained.
In another preferred embodiment, the isolated telomerase activity null stem cell described above retains expression of at least one pluripotency marker. Preferably, the at least one pluripotency marker is selected from the group comprising Oct4, Nanog, Sox2 and Klf4. The method according to any aspect of the invention may be performed in vitro. Accordingly, the method is performed with isolated pluripotent stem cell(s).
The pluripotent stem cell(s) for use in the invention may be from any animal. For example, the pluripotent stem cells may be human. The pluripotent stem cell(s) may comprise induced pluripotent stem cell(s) or embryonic stem cell(s). Any method of preparing pluripotent stem cells or induced pluripotent stem cells is applicable for the invention.
In another preferred embodiment of the invention, the stem cell is a human embryonic stem cell (hESC) or induced pluripotent stem cell (iPSC).
Specific gene activity may be knocked out either directly or delayed until desired and then knocked out using knockout inducers. Although direct knockout of telomerase activity using for example ZFN, TALEN or CRISPR can be achieved, the cells derived from direct knockout do not last very long before senescing. Moreover, knockout cells generated this way have to be replaced by newly generated knockouts, which is impractical and quality control becomes a problem. Recombinant cells carrying an inducible knockout can be passaged and manipulated for longer before the target gene is knocked out. Alternatively, if a CRISPR-Cas system is to be used, a more practical telomere length to allow for expansion of telomerase knockout cells could be obtained by transiently increasing telomerase activity prior to CRISPR Cas-induced TERT or TER knockout. Another aspect of the invention provides a method of producing one or more isolated pluripotent telomerase activity null stem cells with limited lifespan and reduced tumorigenicity compared to wild type cells, comprising the steps of:
(a)(i) engineering, by gene targeting, at least one isolated pluripotent stem cell to have inducible knockout alleles of a telomerase activity gene selected from the group comprising the human telomerase reverse transcriptase (hTERT) gene and the human telomerase RNA subunit (hTER) gene;
(a)(ii) selecting engineered pluripotent inducible telomerase activity knockout stem cell clones;
(a)(iii) contacting the engineered pluripotent inducible telomerase activity knockout stem cell clones with a gene knockout inducer; or (b)(i) engineering, by gene editing, at least one isolated pluripotent stem cell having knocked out alleles of a telomerase activity gene selected from the group comprising the human telomerase reverse transcriptase (hTERT) gene and the human telomerase RNA subunit (hTER) gene; and
(c) selecting telomerase activity null cells with an average telomere length evaluated to be 5 kb or less and a reduced ability to form a teratoma in vivo; or
(d) selecting telomerase activity null cells and passaging them until the average telomere length is evaluated to be 5 kb or less and the cells have reduced ability to form a teratoma in vivo.
In a preferred embodiment, the average telomere length is around 4 kb. In other preferred embodiments, the average telomere length may be 2 kb to 4 kb or 3 kb to 4 kb. It would be understood that the optimum telomere length desired may depend on the particular use intended for the cells; for example a requirement for in vitro use or a requirement for expansion prior to clinical implantation.
In a preferred embodiment, in (a) a portion of the hTERT or hTER gene is replaced by homologous DNA flanked by LoxP sites, which retains gene function, and at a selected time transient expression of Cre recombinase in the recombinant cells causes deletion of the homologous DNA and in (b) a portion of the hTERT or hTER gene is edited by CRISPR-Cas, resulting in loss of telomerase activity.
In a preferred embodiment, in (a) the recombinant cells are homozygous for the homologous DNA insert.
In another preferred embodiment, in (a) the hTERT gene is replaced and the portion of the hTERT gene replaced includes exon 1 and/or exon 2.
The method may further comprise a step of inducing the telomerase activity null cells to differentiate.
In a preferred embodiment, the telomerase activity null cells are induced to differentiate into cells of at least one of ectodermal, endodermal or mesodermal lineage. Methods exist in the art to differentiate stem cells down particular lineages.
In a preferred embodiment, the telomerase activity null cells of the invention are induced to differentiate into neurons. For example, the telomerase null cells may be induced to differentiate in dopaminergic neurons, GABAergic neurons, motor neurons, or glutamatergic neurons.
In another preferred embodiment, the telomerase activity null cells are induced to differentiate into astrocytes and/or glia. In yet another preferred embodiment, the telomerase activity null cells are induced to differentiate into hematopoietic cells.
Another aspect of the invention provides a method of producing one or more isolated pluripotent telomerase activity null stem cells suitable for clinical use, comprising: evaluating the average telomere length and/or in vivo tumorigenicity of said pluripotent stem cells in which the human telomerase reverse transcriptase (hTERT) or the human telomerase RNA subunit (hTER) activity has been inactivated; and identifying said pluripotent stem cells as suitable for clinical use if said evaluated average telomere length is 5 kb or less and/or said cells have reduced ability to form a teratoma in vivo. In a preferred embodiment, the average telomere length is around 4 kb. In other preferred embodiments, the average telomere length may be 2 kb to 4 kb or 3 kb to 4 kb. It would be understood that the optimum telomere length desired may depend on the particular clinical use intended for the cells.
In a preferred embodiment, the hTERT or hTER inactivation is by virtue of an induced, or CRISPR-Cas, knockout of hTERT or hTER gene activity.
In a preferred embodiment, (i) a portion of the hTERT or hTER gene is replaced by homologous DNA flanked by LoxP which retains gene function, and at a selected time transient expression of Cre recombinase in the recombinant cells causes deletion of the homologous DNA resulting in loss of hTERT or hTER activity and, consequently, telomerase activity; or (ii) a portion of the hTERT or hTER gene
is edited by CRISPR-Cas resulting in loss of hTERT or hTER activity and, consequently, telomerase activity.
As stated supra, any suitable inducible knockout system could be used, such as FLP/FRT. However, consideration must be had as to the system used to remove, for example, the selection cassette. In Example 2 shown herein, the PGK-neo selection cassette was removed with FLP/FRT because the hTERT gene portion was cloned to be removable with Cre/LoxP.
In a preferred embodiment, the recombinant cells from the Cre-Lox method (i) are homozygous for the homologous DNA insert. In a preferred embodiment, the stem cells have limited proliferation capacity.
In a preferred embodiment, the stem cells retain expression of at least one stem cell pluripotency marker. More preferably, the at least one stem cell marker is selected from the group comprising Oct4, Nanog, Sox2 and Klf4.
In a preferred embodiment, the pluripotent telomerase activity null stem cells are human embryonic stem cells (hESC), progenitor cells or induced pluripotent stem cells (iPSC).
The method may further comprise a further step of inducing said at least one isolated pluripotent telomerase activity null stem cells to differentiate. The stem cells may be partially differentiated into progenitor cells such as, for example, neural progenitor cells. Progenitor cells are described by some in the art to be a form of stem cell and will be considered as such for the purpose of the invention.
In a preferred embodiment, the at least one telomerase activity null cells are induced to differentiate into cells of at least one of ectodermal, endodermal or mesodermal lineage. In a preferred embodiment, the at least one telomerase activity null cells are induced to differentiate into neurons.
In another preferred embodiment, the at least one telomerase activity null cells are induced to differentiate into astrocytes and/or glia.
In yet another preferred embodiment, the at least one telomerase activity null cells are induced to differentiate into hematopoietic cells.
In a preferred embodiment of the method of producing one or more isolated pluripotent telomerase activity null stem cells suitable for clinical use, said evaluating step comprises performing one or more of: single telomere length analysis (STELA), fluorescence in-situ hybridization (FISH), flow-FISH and Southern blot analysis.
The method of producing one or more isolated pluripotent telomerase activity null stem cells suitable for clinical use may further comprise:
(a) assessing the genomic integrity of said pluripotent telomerase activity null stem cells to obtain a genomic integrity result, wherein said assessing comprises one or more of: karyotyping; analysis of variable number tandem repeats (VNTRs), short tandem repeats (STRs), single nucleotide polymorphisms (SNPs), and/or copy number variations (CNVs); analysis of culture mosaicism; analysis of DNA sequences related to genetic diseases; and complete genome sequencing and analysis; and
(b) identifying the pluripotent telomerase activity null stem cells as suitable for clinical use based on the genomic integrity result.
In a preferred embodiment, the genome integrity is assessed prior to gene inactivation. In another aspect of the invention there is provided the use of at least one isolated pluripotent telomerase activity null stem cell herein defined for the preparation of a therapeutic composition for cell therapy of a subject in need thereof.
In a preferred embodiment, the at least one isolated pluripotent telomerase activity null stem cell is differentiated into cells of at least one of ectodermal, endodermal or mesodermal lineage. More preferably, the at least one isolated pluripotent telomerase activity null stem cell is differentiated into cells of at least one lineage selected from the group comprising neurons, astrocytes and/or glia and hematopoietic cells.
In particular, the method according to any aspect of the invention may include inducing differentiation of the at least one isolated pluripotent telomerase activity null
stem cells into endoderm, mesoderm or ectoderm lineage. More particularly, the isolated pluripotent telomerase activity null stem cells are induced to differentiate into neurons, glia or hematopoietic cells.
Having now generally described the invention, the same will be more readily understood through reference to the following examples which are provided by way of illustration, and are not intended to be limiting of the present invention.
EXAMPLE 1
Zinc Finger Nucleases (ZFNs) and Transcription Activator-Like Effector Nucleases (TALENs) expression vectors for generating double strand breaks in telomerase (hTERT) exon 1 .
Given the low homologous recombination efficiency in human ES cells, synthetic nucleases were necessary to create site-specific double strand breaks (DSBs) to stimulate DNA recombination efficiency (Jasin M, Trends Genet 12, 224- 228 (1996); Van der Oost, Science 339, 768-770 (2013)). The introduction of DSBs is made possible due to the recent advances in engineering of synthetic nucleases. Both Transcription Activator-Like Effector Nucleases (TALENs) and zinc finger nucleases (ZFNs) utilize the heterodimeric Fok-I nuclease and provide high specificity and low off-target effects in the generation of site-specific DSB. Paired ZFNs were purchase from Sigma (Cat# CSTZFN-1 KT-hTERT). TALENs was engineered as previously described (Christian M., et al. Genetics 186, 757-761 (2010)). Paired ZFNs and TALENs were used to target distinct genomic DNA sequences in exon 1 of hTERT (refer to Figure 1 ).
We proceeded with ZFNs for gene targeting to create hTERT inducible knockout human ES cells. EXAMPLE 2
Generation of a targeting vector for use in abolishing telomerase activity
The hTERT genomic locus was targeted to engineer telomerase inducible knockout in human ES cells. The gene targeting strategy relies on the replacement of endogenous gene locus by exogenous DNA sequence, mediated by homologous recombination. The targeting vector was engineered to introduce two LoxP sites
flanking hTERT exon 1 and exon 2, as seen in Figure 2. Upon expression of Cre recombinase, both exon 1 and exon 2 are deleted from the hTERT genomic locus, which encompasses almost 50% of hTERT N-terminal protein coding region.
To avoid the cutting of the targeting vector by the co-expressed ZFNs during the gene targeting process, the ZFNs binding sites on the targeting vector were mutated. A dramatic improvement in the stability of full-length targeting vector was thereby achieved (Figures 3A and 3B).
The targeting vector, pBSK-3kb-5'-LoxP-hTERT-FRT-PGKNeo-FRT-LoxP-3'- PGK-DTA (AZFN) (refer to Figure 2), was constructed as follows: Genomic DNA from H1 human embryonic stem cells was used as template for
PCR amplification using platinum Taq HiFi. The amplified PCR fragment was first cloned into pBSK, and the sequence was verified by capillary DNA sequencing. Multiple polymorphisms were detected in the PCR amplified fragments. The PCR fragment was then used in stepwise construction of gene targeting vector, using specific restriction enzymes.
Step 1 pBSK-5'-hTERT
SL0094 and SL0095 primers were used to amplify the Exon 1 +lntron 1+Exon 2+lntron 2 region with 5' Sail site (underlined) and 3' BamHI site (underlined) and cloned into pBSK (pBSK-5'-hTERT).
Primer SL0094
5'-TTTTGTCGACTGCTGCGCACGTGGGAAGCCCT-3' (SEQ ID NO: 3) Primer SL0095
5'-TTTTGGATCCATGCAAACTGGACAGGAGGGAGA-3' (SEQ ID NO: 4)
Step 2 pBSK-5'-LoxP-hTERT
Subsequently, the annealed double stranded oligonucleotides (SL0098 and SL0099) that encode a single LoxP site (underlined) were inserted in the 5' Sail site using in-fusion ligation kit (Clontech) to create (pBSK-5'-LoxP-hTERT).
SL0098
5'-CAGGCAGCGCTGCGTCATAACTTCGTATAATGTATGCTATACGAAGTTAT
CTGCTGCGCACGTGGG-3' (SEQ ID NO: 5)
SL0099 5'-CCCACGTGCGCAGCAGATAACTTCGTATAGCATACATTATACGAAGTTATG ACGCAGCGCTGCCTG-3' (SEQ ID NO: 6) Step 3 pBSK-5'-LoxP-hTERT-3'
The 3' homologue arm of the targeting vector was amplified using SL0096 and SL0097 primer set and cloned into pBSK-5'-LoxP-hTERT to create pBSK-5'- LoxP-hTERT-3'. Restriction sites are underlined.
SL0096
5'-AAAAGCTAGCTTACGAGGTTCACCTTCACGTTTTG-3' (SEQ ID NO: 7) SL0097 5'- AAAACTCGAGAACAGCAATGACAGGCAGAGTCCT-3' (SEQ ID NO: 8) Step 4 pBSK-5'-LoxP-hTERT-FRT-PGKNeo-FRT-LoxP-3'
The DNA fragment containing PGK-neo selection cassette and 3' LoxP site was cut out from pF2L2 vector using BamHI and Nhel, and inserted into the BamHI
/Nhel site in pBSK-5'-LoxP-hTERT-3' to derive pBSK-5'-LoxP-hTERT-FRT-PGKNeo- FRT-LoxP-31.
Step 5 pBSK-5'-LoxP-hTERT-FRT-PGKNeo-FRT-LoxP-3'-PGK-DTA The Sall/Xhol DNA fragment from pF2L2 vector that contains PGK-DTA was then cloned into pBSK-5'-LoxP-hTERT-FRT-PGKNeo-FRT-LoxP-3' to create pBSK- 5'-LoxP-hTERT-FRT-PGKNeo-FRT-LoxP-3'-PGK-DTA.
Step 6 pBSK-5'-LoxP-hTERT-FRT-PGKNeo-FRT-LoxP-3'-PGK-DTA (ASacl) Site-directed mutagenesis was performed to eliminate the Sacl site in the
PGK-Neo and PGK-DTA fragments in the pBSK-5'-LoxP-hTERT-FRT-PGKNeo- FRT-LoxP-3'-PGK-DTA vector, using oligonucleotide primers SL00171 and SL0172 (mutated site underlined).
SL0171 5'-GAGCAGTGGTGGAATGCAGATCCTAGCAGCTCGCTGATCAGCCTCGACTG TGC-3' (SEQ ID NO: 9) SL0172
5'-CTG AG GG GATCAATTCTCTAG CAG CTCG CTG ATC AG CCTCGAC-3' (SEQ ID NO: 10) Step 7 pBSK-3kb-5'-LoxP-hTERT-FRT-PGKNeo-FRT-LoxP-3'-PGK-DTA
To extend the homology arm of the targeting vector, 3 kb DNA fragment upstream of hTERT 5' (-1000— 4000) was amplified from genomic DNA using SL0232 and SL0233. The PCR fragment was then cloned into Sacl-linearized pBSK- 5'-LoxP-hTERT-FRT-PGKNeo-FRT-LoxP-3'-PGK-DTA (ASacl) using In-Fusion® cloning kit (Clontech Laboratories Inc.).
SL0232
5'- A AG G G AAC AAAAG CTGGAGCTCG-3' (SEQ ID NO: 1 1 ) SL0233
5'- CAGTAG AAG CCACACG G CCACTG-3' (SEQ ID NO: 12) Step 8 pBSK-3kb-5'-LoxP-hTERT-FRT-PGKNeo-FRT-LoxP-3'-PGK-DTA (AZFN)
To eliminate the ZFN binding sites on the targeting vector, site-directed mutagenesis was performed using SL0259/SL0259 antisense primer pairs.
SL0259 5'-GAGCCGTGCGCTCCCTGCTGAGATCTCACTACAGAGAGGTGCTGCCGCT GGCCACGT-3' (SEQ ID NO: 13) SL0259 antisense
5'-ACGTGGCCAGCGGCAGCACCTCTCTGTAGTGAGATCTCAGCAGGGAGCG CACGGCTC-3' (SEQ ID NO: 14) EXAMPLE 3
Engineering of hTERT inducible knockout human embryonic stem (hES) cells
Feeder-independent human H1 embryonic stem cells from WiCell (WiCell Research Institute, Madison, WN, USA) were grown on Matrigel™ (BD biosciences)- coated cell culture dishes using mTeSR™1 culture medium (STEMCELL Technologies). When the cells were 80-90% confluent, the cells were passaged using Dispase, and split 1 :6 to 1 :12 onto new Matrigel™ -coated cell culture dishes.
Two rounds of gene targeting were performed to introduce the loxP sites to flank both alleles of hTERT genomic loci. This is shown diagrammatically in Figure 4.
The Neon® transfection system (Life Technologies) was used for targeting the first allele of hTERT. Briefly, the cells were harvested using trypsin and counted and
the cells washed once with 1 xPBS before being re-suspended in Neon® Re- suspension buffer at 1x107/ml final concentration. For 1x107 cells in 1 ml of Re- suspension buffer, 6.25 g of pZFN1 and 6.25 Mg of pZFN2 and 37.5 pg of Sacl- linearized and purified pBSK-3kb-5'-LoxP-hTERT-FRT-PGKNeo-FRT-LoxP-3'-PGK- DTA(AZFN) targeting plasmid was added and mixed well before electroporation. For electroporation, 100μΙ of cells and DNA mixture in Re-suspension buffer was electroporated using 100μΙ Neon pipette in Neon tube with 3ml of Neon® Electrolytic Buffer. The electroporation condition: Pulse, V 1050, MS 30, Number 2. After the electroporation, the cells were plated onto Matrigel™-coated 10cm dishes in the presence of 6ml of mTeSR™1 with 10μΜ Y-27632 (Rock inhibitor). About 5-6x106 cells were plated into one 10cm dish. The cells were maintained in mTeSR™1 and the medium changed every day.
At 48 hour after electroporation, mTeSR™1 with 50 Mg/ml G418 (neomycin) was then added for selection of G418-resistant clones. The cells need to be maintained in mTeSR™1 with 50 Mg/ml G418 for about 12 days before the colonies are big enough for picking. When the G418-resistant colonies were about 3-4 mm in size, the individual G418-resistant clone on the 10cm dish was picked up using sterile p200 pipette tip and transferred into two new wells on a Matrigel™-coated 96 well plate. The colonies were allowed to grow 2-3 days before being ready for screening, using PCR as previously described (Zhang et al. Nat Methods 5, 163-165 (2008)).
For targeting the second allele of hTERT, the PGK-Neo cassette was first removed by FLP. The cells were transiently transfected with pCAG-Flpe:GFP plasmid using Neon® transfection system (as described above). The cells were maintained in mTeSR™1 with 10μΜ Y-27632 (Rock inhibitor) for 24 hours, and the GFP-positive cells then sorted out and collected using FACS. The cells were then seeded at low density (200-500 cell/well in 6-well dishes) to allow the colonies derived from single ES cells to emerge. When the colonies grew to about 3-4 mm size, the colonies were transferred to 96-well dishes and used for PCR diagnosis for the loop out of PGK-Neo cassette. The second allele was targeted exactly as described above for the first allele.
The targeted alleles of hTERT were confirmed by Southern blotting analysis (shown on Figure 5A).
The genomic DNA was extracted using Gentra® Puregene® genomic DNA purification kit (Qiagen). Southern blots for detection of targeted genomic insertions were performed as previously described (Liu C.Y. et al. Genes Dev 10, 1835-1843 (1996)). For telomerase activity analysis, telomeric repeat amplification protocol (TRAP) assay was performed as previously described (Kim N.W., et al. Science 266, 2011-2015 (1994)). For telomere length measurement, the genomic DNA was digested with Hphl and Mnll at 37°C for 16 hours. The DNA blot was hybridized to 32P-labeled (TTAGGG)6 oligonucleotide, as previously described (Li S. et al., Cancer Res 64, 4833-4840 (2004)).
EXAMPLE 4
Engineering of hTERT null ES cells
To create hTERT null ES cells, pCre-IRES-mCherry plasmid (pmCherry-C1 vector from Clontech in which Cre-IRES was inserted into the multiple cloning site) was transiently transfected into ES cells that have both hTERT genomic alleles flanked by a LoxP site (as generated in Example 3), using Neon® transfection system (as described above). The cells were maintained in mTeSR™1 with 10μΜ Y- 27632 (Rock inhibitor) for 24 hours, and the mCherry-positive cells then sorted out and collected using FACS. The cells were then seeded at a low density of 200-500 cell/well in 6-well dishes to allow the colonies derived from single ES cells to emerge. When the colonies grew to about 3-4 mm size, the colonies were transferred to 96- well dishes and used for PCR diagnosis for the loop out of hTERT Exons 1 and 2.
As shown by RNA protection assay (using Ambion RPA III™ Ribonuclease Protection Assay Kit; refer to Figure 5B), deletion of one copy of hTERT (hTERT+/-) results in about 50% loss of hTERT mRNA expression, while deletion of both copies of hTERT (hTERT-/-) results in the complete loss of full-length hTERT mRNA expression in ES cells. Consistent with the hTERT mRNA expression results, Figure 5C shows that deletion of one allele of hTERT results in about 50% reduction of telomerase activity, whereas deletion of both alleles of hTERT results in the complete loss of telomerase activity, as shown by TRAP assay.
EXAMPLE 5
Progressive loss of telomere length in engineered hES cells
The telomere length in the parental ES cells (hTERT+/+) is about 13-14 kb as shown by genomic Southern blotting analysis (Figure 6A). ES cell colonies with LoxP sites flanking the only one allele of hTERT (hTERT+/loxP) showed slight shortening of telomere compared to the parental ES cells. This is probably due to the disruption of hTERT expression by the neomycin cassette in the targeting vector during the gene targeting process (Figure 4). Introduction of LoxP sites flanking the exon 1 and exon 2 of hTERT can potentially inhibit hTERT mRNA expression as well. Consistent with that, further telomere attrition was observed in ES cell colonies with LoxP sites flanking both allele of hTERT (hTERTloxP/loxP).
As predicted, transient expression of Cre recombinase in hTERTloxP/loxP ES cells resulted in the loss of telomerase activity (Figure 5C) and gradual shortening of telomere length (Figure 6A) in hTER A ES cells. EXAMPLE 6
Telomerase null ES cells have limited life span
Since the hTERTlo P/loxP ES cells have relatively short telomere, around 5 kb, the hTER /_ ES cell colonies derived from hTERTioxP/loxP ES cells by transient expression of Cre recombinase have even shorter telomere length, and can only be passaged for approximately 8-9 times before they lose the capacity to divide continuously (as can be seen in Figure 6A).
Previous studies have shown that when primary fibroblast cells (WI38) are cultured in vitro, they eventually lost their proliferation capacity and entered a senescent state (Hayflick and Moorhead, Exp Cell Res 25, 585-621 (1961 )). Cellular senescence was analyzed using senescence β-galactosidase staining kit (Cell Signaling) according to the protocol provided. As shown in Figure 6B, the senescent primary fibroblast (WI38 PD67; ATCC, USA) cells have enlarged cell morphology and stained positive for senescence-associated β-galactosidase activity (Dimri G.P., et al. Proc Natl Acad Sci USA 92, 9363-9367 (1995)), which is distinct from young fibroblasts (WI38 PD35; ATCC, USA). Similar to the primary
fibroblasts, gradual loss of cell proliferation capacity and increased cell death of the hTERT" ES cells was observed around passage 8-9. Moreover, again similar to senescent primary fibroblast cells, these hTERT7" ES cells also express senescence- associated β-galactosidase activity (Figure 6C). To further address whether the loss of hTERT expression affects the proliferation capacity of ES cells, hTERT+/+, hTERT+ " and hTERT " ES cells were analyzed for their incorporation of 5-ethynyl-2'-deoxyuridine (EdU) which marks dividing cells.
Cell proliferation was detected through the incorporation of 0μΜ EdU within an hour, using Click-iT® EdU Alexa Fluor® 488 Imaging Kit (Life Technologies). Immunocytochemistry was done in accordance with the protocol provided by the manufacturer.
As shown in Figure 7A, cellular incorporation of EdU during the S phase is comparable in hTERT+ +, hTERT+/" and hTERT7" ES cells. In addition, Celltiter-Glo® luminescent cell viability assay showed that hTERT" " ES cells at early passage (P2) (refer to Figure 6A), have similar cell viability and cell proliferation rate as compared to TERT+/+ and hTERT+/" ES cells. These results can be seen on Figure 7B. For this assay, cells were seeded into 96-well plates at a density of 1 ,000 cells/well/96-well plate, and cultured over a period of 7 days to monitor cell proliferation using ATP assay (CellTitre-Glo® Luminescent Cell Viability Assay, Promega). Luminescence was measured on a microplate reader (Infinite 200, Tecan) every 24 hours.
Cell cycle profile analysis was also undertaken. Cells were harvested by trypsinization, washed and fixed in ice-cold 70% ethanol followed by staining with propidium iodide (PI) with RNase A. Cell cycle profiles were acquired on flow cytometer (MACSQuant VYB, Miltenyi Biotec) and analyzed using ModFit LT. This analysis also showed comparable G1 , S and G2/M cell cycle distribution in hTERT7" (P2) and hTERT+ + and hTERT+ " ES cells. However, the hTERT"7" ES cells at late passage - hTERT"7" (P8; refer to Figure 6A) - lost proliferation potential and entered a senescence state. Increased cell population at G1 and decreased cell population
at G2/M phase were also observed in the hTERT"'" (P8) cells. These results can be seen in Figure 7C.
In addition to loss of cell proliferation, hTERT_ " (P8) cells also showed increased cell death. Annexin V and 7-AAD staining showed increased apoptosis in hTERT"'" (P8) ES cells (29.78%) compared to hTERT+/+, hTERT+/" and hTERT" " (P2) ES cells (4.15%) (Figure 7D). Cells were harvested by trypinization, washed once with PBS and stained with 7-AAD (BD Biosciences) and Annexin V (BD Biosciences) for 15 minutes at room temperature in the dark. Samples were acquired on flow cytometer (BD LSRFortessa, BD Biosciences) and data acquired were analyzed using FlowJo (Tree Star).
These results indicate that the cell proliferation capacity of the ES cells is limited by their telomere length in the absence of telomerase activity.
EXAMPLE 7
Transient overexpression of hTERT resets telomere length The telomere length in hTERTloxP/loxP ES cells is maintained at a short (about
5 kb) and stable state as compared to parental cells. This indicates that the telomerase activity in hTERTloxP/loxP ES cells is sufficient for telomere maintenance. These results also raised a possibility that transient overexpression of hTERT, boosting the telomerase activity in hTERTloxP loxP ES cells, may be able to reset their telomere length.
To test this, a mammalian expression vector overexpressing hTERT-IRES- GFP was transiently transfected into the hTERTloxP loxP ES cells, following which the GFP positive cells were FACS sorted and the single cell colonies were isolated. As shown in Figure 8, several of the single cell colonies (those numbered 1 , 2 and 5), derived from transient overexpression of hTERT, have elongated telomeres of similar length as, or even longer than, the parental hTERTloxP loxP H1 ES cells. No integration of the hTERT-IRES-GFP expressing vector was detectable in the newly derived hTERTloxP/loxP ES cell colonies.
Accordingly, the hTERT"'" ES cell colonies derived from the new hTERTloxP/loxP ES cells also have longer telomeres to start with; about 9-10 kb, as shown in Figure
9; and can be passaged much longer than the hTERT"'" ES cell with short telomeres of about 4 kb as was seen in Figure 6A.
EXAMPLE 8
Engineered hES cells maintain normal karyotype Given the propensity of human ES cells to accumulate genetic aberrations during in vitro culture, karyotyping was done during each step of gene targeting to ensure that the clonally-derived human ES cell lines maintained a normal karyotype.
For karyotyping, the cells were grown to 50-60% confluent, and colcemid was then added to the culture at final concentration of 10 g/ml and incubation continued for 4 hours. The cells were harvested by trypsin-EDTA and washed with HEPES buffered saline solution (HBSS). The cells were then re-suspended in hypotonic solution (2 parts of 0.6% sodium citrate tribasic dihydrate + 1 part of 75 mM KCI) and incubated in 37°C water bath for 20 minutes. Subsequently, 1 ml of fixative (3 parts of methanol + 1 part of glacial acetic acid) was added to the tube and mixed by pipetting up/down. Cells were spun down and re-suspended in 4ml of fixative and kept at -20°C overnight. The next day, the cells were spun down and re-suspended in fresh fixative buffer and dropped onto slides. The slides were baked at 56°C overnight, and stained with Giemsa stain (Sigma GS-500) before being analysed using Metafer slide scanning platform. As Figure 10 demonstrates, the karyotype was always normal and no gross abnormalities were detected.
EXAMPLE 9
Demonstration of continued pluripotency of telomerase null hES cells in vitro
Like their parental ES cells (hTERT+/+), the hTERT+/- and hTERT-/- ES cells express ES cell-specific surface antigens (Adewumi O., et al. Nat Biotechnol 25, 803-816 (2007)), such as TRA-1 -60 and SSEA-4, as well as genes involved in the maintenance of undifferentiated ES cell state such as OCT4 and NANOG. This can be seen using immunocytochemistry assays, as set out in Figures 11 A-1 1 D.
Figure 1 1 E provides qRT-PCR results showing that the expression levels of ES cell marker genes in the hTERT+/" and hTERT_/" ES cells, such as OCT4, SOX2, KLF4 and NANOG, were comparable to the parental ES cells (hTERT+/+), although there were small variations in different independent hTERT+ " and hTERT"A ES cell lines.
To determine the differentiation potential of telomerase null ES cells in vitro, these cells were grown in suspension to induce the formation of embryoid bodies (EBs) (Itskovitz-Eldor J., et al. Mol Med 6, 88-95 (2000)).
Embryoid bodies (EBs) were formed by trypsinization to a single-cell suspension and plating into low-adherence dishes in human ES cell mTeSR™1 medium. For spontaneous differentiation, 7-10 day old EBs were used according to the previously established protocol (Dimos J.T., et al. Science 321 , 1218-1221 (2008)). In brief, the EBs (about 5-10) from human ES cells were transferred onto gelatin-coated 24-well plates and allowed to differentiate in DMEM+10% fetal bovine serum for 1 -2 weeks.
The hTERT+/+, hTERT+/" and hTERTA EBs were then plated on gelatin-coated plates for 2 weeks. The attached cells spontaneously differentiated into cell types representative of the three germ layers (refer to Figures 12A - 12E), which express early differentiation markers for ectoderm (Tuj1 and GFAP); mesoderm (SMA and Desmin) and endoderm (AFP). These data indicate that the hTERT_/" ES cells remain pluripotent.
For immunofluorescence assays, the cells were fixed in 4% paraformaldehyde for 10 minutes. The fixed cells were washed three times with 0.1 M Tris buffered saline containing 0.1 % Triton-X 100 (TBS-TX) and incubated in primary antibody including: mouse anti-Oct3/4 (1 :500, Santa Cruz Biotechnology), mouse anti-Tra- - 60 (1 :100, Santa Cruz Biotechnology), rabbit anti-Nanog (1 :100, Cell Signaling Technology), mouse anti-SSEA-4 (1 :500, Millipore), rabbit anti-AFP (1 :400, Dako), mouse anti-Desmin (1 :100, Abeam); goat anti-SOX2 (1 : 500, Santa Cruz Biotechnology), mouse anti-SMA (1 :200, Sigma), mouse anti-Tujl (1 :1000, Covance), mouse anti-GFAP (1 :1000, Millipore), mouse anti-Human Nuclei (1 :500, Abeam), mouse anti-Nestin (1 :1000, Millipore), or goat anti-DCX (1 :500, Santa Cruz Biotechnology) overnight at 4°C in blocking buffer. The following day, cells were
washed with TBS-TX and incubated with Alexa Fluor-conjugated secondary antibodies (Invitrogen, 500*) in TBS-TX for two hours at room temperature. Nuclei were visualized by DAPI staining (Sigma-Aldrich). Images were acquired on a Zeiss LSM 710 confocal microscope or LSM 7 ELYRA PS.1 system (Carl Zeiss, Pte. Ltd., Singapore).
EXAMPLE 10
Telomerase null hES cells do not form teratomas when telomeres are sufficiently short hTERT+/+, hTERT+/" and hTERT";" ES cells were injected subcutaneously into the dorsal-lateral area of immunodeficient (NSG) mice, as described previously (Prokhorova T.A., et al. Stem Cells Dev 18, 47-54 (2009); incorporated herein by reference). Eight weeks following the injection, the formation of teratoma was evaluated. Similar to hTERT+/+ and hTERT+/" ES cells, hTERT"7" ES cells with long telomere (9 kb) form teratomas in immunodeficient mice with high frequency, as can be seen in Figure 13A. However, when hTER ;" ESCs with shorter telomere (4 kb, P2 in Figure 6A) were injected into immunodeficient mice, only one out of 20 injections resulted in the formation of teratoma. When hTER /_ ES cells with very short telomere (3.5 kb, P4 in Figure 6A) were injected into the immunodeficient mice, none out of 60 injections resulted in the formation of teratoma in vivo.
For the teratoma assay, ES cells were harvested using Dispase, washed with 1xPBS and re-suspended in 30% Matrigel™ (BD Science). About 1x106 cells (100μΙ) were injected subcutaneously into NSG mice (NOD.Cg-Prkdcscid ll2rgtm1Wjl/SzJ) in the dorso-lateral area on both sides, as previously described (Prokhorova T.A., et al. Stem Cells Dev 18, 47-54 (2009)). The mice were sacrificed and the tumors were harvested 8 weeks after injection. The tumors were dissected and fixed in PBS with 4% paraformaldehyde. Paraffin-embedded tissue was sliced and stained with hematoxylin and eosin.
Consistent with these results, the hTER A ES cells with very short telomeres (3.5 kb) can only be passaged in vitro for another 4-5 passages (as seen in Figure 6A). Histological examination of the tumors derived from hTERT+/+, hTERT+/" and TERT"/_ ES cells showed that they contained various tissues derived from all three
germ layers, including respiratory epithelium (endoderm); striated muscle and cartilage (mesoderm), and neural epithelium with rosettes (ectoderm). The results are shown in Figure 13B.
These results indicate that inactivation of telomerase activity does not affect the pluripotency of ES cells. However, the proliferation capacity of hTER _ ES cells and their ability to form teratoma in vivo is limited by the telomere length, which presets their proliferation potential.
EXAMPLE 11
Telomerase null hES cells differentiate into neurons in vitro To test whether hTERT"7" ES cells could be differentiated into specific cell types, neural induction of hTERT(+/+); hTERT(+A) and hTERT("A) ES cells was carried out as previously reported (Li et al., 2011 ) (see Figure 14A).
Briefly, hTERT(+/+) and hTERT("A) ES cells were cultured in mTeSR™1 medium. When the hESCs cultures reached ~20% confluence, mTeSR™1 medium was removed and replaced with neural induction media containing DMEM/F12: Neurobasal (1 :1 ), 1xN2, 1 xB27, 1 % Glutmax, 5 Mg/mL BSA, 4 μΜ CHIR99021 (Cellagentech), 3 μΜ SB431542 (Cellagentech), 0.1 μΜ Compound E (γ-Secretase Inhibitor XXI, EMD Chemicals Inc.), 10 ng/mL hLIF (Millipore) for 7 days. The culture was then split 1 :3 for the next six passages using Accutase™, and cells were cultured in human neural progenitor cells (NPCs) maintenance media containing DMEM/F12: Neurobasal (1 :1 ), 1 xN2, 1 xB27, 1 % Glutmax, 5 μg/mL BSA, 3 μΜ CHIR99021 , 2 μΜ SB431542, 10 ng/mL hLIF on Matrigel™-coated plates. After six passages, the cells were split 1 :10 regularly.
The human NPCs neural differentiation assay was performed by plating 5x104 cells/well on laminin-coated (37°C, 4 hours) 24-well plates in neural differentiation media containing DMEM/F12: Neurobasal (1 :1 ), 1xN2, 1xB27, 1 % Glutmax on polyL- Lysine (4°C, overnight). After 3 days, 10 ng/mL BDNF and 10 ng/mL GDNF (both from R&D Systems, MN, USA) were added to the media every other day and culturing was continued for another 14 days.
The human NPCs astrocytes differentiation assay was performed by plating 8x104 cells/well on 1% Glutmax on Matrigel™-coated 24-well plates in neural differentiation media containing DMEM/F12: Neurobasal (1 :1 ), 1xN2, 1 % Fetal Bovine Serum (FBS). Immunocytochemistry, carried out as described in Example 9, above, showed that the (NPCs) derived from hTERT(+/+); hTERT(+A) and hTERT(-A)(3.5 kb) ES cells were positive for Nestin and Sox2 (Figure 14B). When the NPCs were further induced to differentiate into either immature neurons or astrocytes, NPCs derived from hTERT(+/+); hTERT(+A) and hTERT^ ES cells showed similar efficiency to differentiate into DCX-positive immature neurons as well as GFAP-positive glial cells (Figures 14C-14E). hTERT("A> hES cells differentiate into four different neuronal types. 1 ) dopaminergic neurons expressing TH; 2) GABAergic neurons expressing GAD65; 3) glutamatergic neurons expressing vGluTI ; 4) motor neurons expressing ChAT (data not shown). The specific differentiation of these four types of neurons was performed as follows:
1 ) For dopaminergic neurons expressing TH, hTERT("A) cells were first treated with 100 ng/mL Sonic hedgehog (SHH) and 100 ng/mL FGF8b in neural differentiation media for 10 days, and then with 10 ng/mL BDNF, 10 ng/mL GDNF, 10 ng/mL IGF1 , 1 ng/mL TGF- 3 and 0.5 mM db-cAMP (Sigma-
Aldrich) for another 14-21 days in neural differentiation media.
2) For GABAergic neurons expressing GAD65, hTERT("A) cells were treated with SHH (50-500 ng/ml) or its small molecular agonist purmorphamine (0.1-1.5 mM; Calbiochem, San Diego, CA) at days 12-26 to induce ventral progenitors. Retinoic acid (RA, 0.1 mM) was added from day 10 to 23. At day
26, cell clusters were dissociated with Accutase (1 unit/ml, Invitrogen) at 37°C for 5 minutes and placed onto polyornithine/laminin-coated coverslips in Neurobasal medium in the presence of valproic acid (VPA, 10 mM, Sigma) for 1 week, followed by a set of trophic factors, including brain-derived neurotrophic factor (BDNF, 20 ng/ml), glial-derived neurotrophic factor
(GDNF, 10 ng/ml), insulin-like growth factor 1 (IGF1 , 10 ng/ml), and cAMP (1 mM).
3) For glutamatergic neurons expressing vGluTI , hTERT("/_) cells were treated with 200 ng/mL BMP2/4, 100 ng/mL FGF8b and 1 μΜ RA (Sigma-Aldrich) in neural differentiation media for 10 days, and then with 10 ng/mL BDNF, 10 ng/mL GDNF, 1 ng/mL TGF- 3 and 0.5 mM db-cAMP (Sigma-Aldrich) for another 14-21 days in neural differentiation media.
4) For motor neurons expressing ChAT, hTERT^ cells were sequentially treated with 1 μΜ RA (Sigma-Aldrich) in neural differentiation media for 7 days, then with 100 ng/mL SHH and 0.1 μΜ RA for additional 7 days, and finally with 50 ng/mL SHH and 0.1 μΜ RA for another 7 days. The cells were terminally differentiated in the presence of 10 ng/mL BDNF and 10 ng/mL GDNF in the neural differentiation media for about 7 days. All growth factors were from R&D Systems. All tissue culture products were obtained from Invitrogen except where mentioned.
EXAMPLE 12 Telomerase null hES cells with short telomeres differentiate in vivo without forming tumors
To test whether the newly engineered hTERT("A) ES cells can offer additional advantages by reducing safety risks, we injected hTERT(+/+) and hTERT("/_)(3.5 kb) ES cells directly into the midbrain of immunodeficient mice. Immunodeficient mice (SCID, NOD.CB17-Pr/cdcsc/cVNcrCrl) (n=5) were anaesthetized with Ketamine (85 mg/kg) plus Xylazine (10 mg/kg) and fixed in a Stoelting stereotaxic apparatus. A small hole was drilled in the skull above the intended injection sites and a syringe (1 μΙ, Hamilton) containing 1 μΙ of human Accutase-dissociated ES cells (5 * 104 cells per μΙ) in PBS (pH 7.4) was lowered into the striatum at -0.5 mm posterior to bregma, 2.0 mm lateral to midline, 3.2 mm ventral to dura. Four, 8 or 12 weeks after transplantation, animals were deeply anaesthetized, and perfused trans-cardially with 50 ml of saline, followed by 100 ml of 4% paraformaldehyde for 30 minutes. Coronal sections at 40 μητι thickness were cut using a cryostat, and serial sections were transferred to individual wells of a 24- well tissue culture dish. Sections were incubated in blocking solution (5% normal goat serum and 0.1 % Triton X-100 in TBS) for 1 hour. Subsequently, primary antibody (Mouse anti-Human Nuclei, 1 :500, Abeam; goat anti-DCX, 1 : 500, Santa
Cruz; mouse anti-MAP2, 1 :1 :1 ,000, Sigma; mouse anti-NeuN, 1 :500, Abeam; mouse anti-GFAP, 1 :1000, Millipore) in blocking solution was added to the sections and they were incubated overnight at 4°C. After three TBS washes, sections were incubated with Alexa Fluor-conjugated secondary antibody solution for 2 hours at room temperature. Nuclei were visualized by DAPI staining (Sigma-Aldrich). Sections were then mounted to the glass slide. Images were acquired on a Zeiss LSM 710 confocal microscope or LSM 7 ELYRA PS.1 system (Carl Zeiss, Pte. Ltd., Singapore).
As shown in Figures 15A-15D, DCX-positive human cells were detected in mouse brain that received either hTERT<+/+) or hTERT("A) ES cells four weeks after the injection. However, mice that received the injection of hTERT(+/+) ES cells also showed local proliferation and expansion of cell mass positive for human nuclei (HuN) staining. These data indicate continuous proliferation of hTERT(+/+) ES cells- derived cells following injection. At 16 weeks after injection, large tumors could be observed in all five mice injected with hTERT(+/+) ES cells (Figure 15E). In contrast, no tumors were found in mice that were injected with hTERT "'"
ES cells with mean telomere length around 3.5 kb; these failed to form teratoma in vivo even after 16 weeks (Figure 16A). In addition, MAP2a-positive cells, a neuronal marker, and tyrosine hydroxylase (TH)-positive cells, a marker for mature dopaminergic neurons, differentiated from hTERT("A) ES cells, can be detected at 16 weeks after injection (see Figures 16B and 16C, respectively).
These data establish the improved safety that can be achieved by using telomerase null human ES cells for cell therapy in vivo.
EXAMPLE 13
Engineering of telomerase-null ES cells (WA018) using CRISPR-Cas9 The exon 1 of human hTERT gene was subjected to potential sgRNA target search using the online software created by Feng Zhang's group [Ran FA, et al., Nat. Protoc 8: 2281-2308 (2013)]. The very top hits were chosen and used for the experiments hence described.
As shown in Figures 17A and 17B, DNA sequences encoding five CRISPR guide RNAs (S1-S5; SEQ ID NOs: 15-19) targeting hTERT exon 1 were designed,
and all resulted in efficient, site-specific double strand breaks (DSBs). The protospacer adjacent motif (PAM) in each sgRNA is at the 3' end and is shaded or underlined.
S1 5-GGGGGCGGCC GTGCGTCCCA GGG-3 SEQ ID NO: 15
S2 5-GCTGCGCAGC CACTACCGCG AGG-3 SEQ ID NO: 16
S3 5-GCAGCAGGGA GCGCACGGCT CGG-3 SEQ ID NO: 17
S4 5-GGGGAGCGCG CGGCATCGCG GGG-3 SEQ ID NO: 18
S5 5-GGGAGCGCGC GGCATCGCGG GGG-3 SEQ ID NO: 19
Feeder-independent human WA018 embryonic stem cells from WiCell (WiCell Research Institute, Madison, WN, USA) were grown on Matrigel™ (BD biosciences)- coated cell culture dishes using mTeSR™1 culture medium (Stemcell Technologies). When the cells were 80-90% confluent, the cells were passaged using Dispase, and split 1 :6 to 1 :12 onto new Matrigel™ -coated cell culture dishes.
For engineering of telomerase-null WA018 cells using CRISPR/Cas9 system a Cas9 nickase expression vector, (pSPCas9 D10A_GFP S2/S3-derived from pSPCas9 D10A_GFP expression plasmid-Addgene Plasmid #44720 that co-express sgRNAs S2 and S3 as shown in Figure 17C), was transiently transfected into WA018 human ES cells using a Neon® transfection system to introduce targeted DSBs according to the methods in Ran FA, et al., Cell 154: 1380-1389 (2013) and illustrated in Figure 17C.
Briefly, the ES cells grown on Matrigel™ were harvested using Accutase™ and counted. The cells were washed once with 1xPBS before being re-suspended in Neon® Re-suspension buffer at 1x107/ml final concentration. For 1x107 cells in 1 ml of Re-suspension buffer, 50 pg of pSPCas9 D10A_GFP S2/S3 vector was added and mixed well before electroporation. For electroporation, 100 μΙ of cells and DNA mixture in Re-suspension buffer was electroporated using 100 μΙ Neon® pipette in Neon® tube with 3 ml of Neon® Electrolytic Buffer. The electroporation condition: Pulse, V 1050, MS 30, Number 2. After the electroporation, the cells were plated onto Matrigel™-coated 10cm dishes in the presence of 6ml of mTeSR™1 with 10 μΜ
Y-27632 (Rock inhibitor). About 5-6x106 cells were plated into one 10 cm dish. The cells were maintained in mTeSR™1 with 10μΜ Y-27632.
At 48 hours after electroporation, GFP positive ES cells were sorted out and collected using FACS. The cells were seeded at low density (800-2000 cells/ 10 cm dish) on Matrigel™ -coated cell culture dish in mTeSR™1 with 10 μΜ Y-27632 for the first 48 hours, then cultured in mTeSR™1 for about 12 days before the single cell- derived colonies were big enough for picking. When the colonies were about 3-4 mm in size, the individual clone on the 10 cm dish was picked up using sterile p200 pipette tip and transferred into two new wells on a Matrigel™-coated 96 well plate. The colonies were allowed to grow 2-3 days before being ready for screening, using PCR as previously described [Ramlee MK, Sci. Rep. 5: 15587 (2015)]. No GFP expression was detected in the isolated clones, indicating that there was no integration of the pSPCas9 D10A_GFP S2/S3 targeting vector.
Six independent ES cell clones derived from the WA018 ES cell line with a deletion in hTERT exon 1 were isolated.
DSB-induced insertion/deletion (indel) mutations in three clones were confirmed by Sanger sequencing (Figure 17D). As shown in Figure 17E, the DSB- induced indels resulted in complete loss of telomerase activity in the three ES cell clones. All three telomerase-null ES cell clones maintained normal karyotype (data not shown). However, these telomerase null ES cell clones had short median telomeres, approximately 5-6 kb in length (Figure 17F, lanes 2-4). As a result, they could only be cultured for another 5-6 passages before loss of cell proliferation and induction of cell death, which is consistent with previous CRISPR-Cas work [Sexton AN, Genes Dev. 28: 1885-1899 (2014)] and with what is seen with the Cre-Lox approach described in Example 7.
These data show an alternative approach for generating telomerase deficient cells with the same characteristics as those generated using the Cre-LoxP type system. An advantage of the CRISPR-Cas 9 system is that it is simpler and much more time- efficient, generating telomerase deficient cells in a few months compared to around 12 months using the Cre-LoxP method described herein. As was the situation using the Cre-Lox approach, in order to engineer cells that retain a practical number of remaining cell divisions to enable expansion to sufficient numbers for clinical use
before senescence, the telomeres may need to be increased in length prior to CRISPR-Cas treatment by transient increased expression of telomerase.
SUMMARY
Pluripotent stem cells, such as human embryonic stem cells and induced pluripotent stem cells, hold great promise for cell therapy. However, stem cell-based therapy also brings concern due to the tumorigenic potential of stem cells. Such pluripotent stem cells form teratomas when injected into immunodeficient mice. If the stem cell contains genetic mutations, it may potentially develop into more malignant teratocarcinomas. Current approaches to reduce the risk of tumorigenicity of stem cells have focused on separating differentiated cells from undifferentiated stem cells. The technical burden of such application is enormous. In addition, the high propensity of stem cells to accumulate chromosome aberrations during in vitro culture may result in the accumulation of genetic mutations in differentiated cells as well, which may result in tumorigenicity in vivo. It is close to impossible to check differentiated cells for their genetic variation and therefore eliminate their tumorigenicity in vivo.
The present invention provides telomerase knockout human embryonic stem cells, engineered by gene targeting. The data herein indicate that by inactivating telomerase in stem cells, the two unique properties of stem cell can be functionally separated: the ability to proliferate indefinitely and the ability to differentiate into various cell types.
Such transgenic stem cells constitute an unlimited source for cell engineering but provide, in addition, the concomitant advantage that by limiting their proliferation capacity at a desired time, the risk of their developing tumors in vivo is significantly reduced.
References:
(Adewumi O., et al., Characterization of human embryonic stem cell lines by the International Stem Cell Initiative. Nat Biotech nol 25, 803-816 (2007).
Amariglio, N. et al. Donor-derived brain tumor following neural stem cell transplantation in an ataxia telangiectasia patient. PLoS medicine 6 (2009).
Baker, D. E. et al. Adaptation to culture of human embryonic stem cells and oncogenesis in vivo. Nat Biotechnol 25, 207-215 (2007).
Blackburn, E. H. Telomere states and cell fates. Nature 408, 53-56 (2000).
Blum, B. & Benvenisty, N. Clonal analysis of human embryonic stem cell differentiation into teratomas. Stem Cells 25, 1924-1930 (2007).
Blum, B. & Benvenisty, N. The tumorigenicity of human embryonic stem cells. Advances in cancer research 100, 133-158 (2008).
Christian, M., et al. Targeting DNA double-strand breaks with TAL effector nucleases. Genetics 186, 757-761 (2010). Dimos, J.T., et al. Induced pluripotent stem cells generated from patients with ALS can be differentiated into motor neurons. Science 321 , 1218-1221 (2008).
Dimri, G.P., et al. A biomarker that identifies senescent human cells in culture and in aging skin in vivo. Proc Natl Acad Sci U S A 92, 9363-9367 (1995).
Feng, J. et al. The RNA component of human telomerase. Science 269, 1236-1241 (1995).
Hayflick, L, and Moorhead, P.S. The serial cultivation of human diploid cell strains. Exp Cell Res 25, 585-621 (1961 ).
Hentze, H. et al. Teratoma formation by human embryonic stem cells: evaluation of essential parameters for future safety studies. Stem cell research 2, 198-210 (2009). Itskovitz-Eldor, J., et al. Differentiation of human embryonic stem cells into embryoid bodies compromising the three embryonic germ layers. Mol Med 6, 88-95 (2000).
Jasin, M. Genetic manipulation of genomes with rare-cutting endonucleases. Trends Genet 12, 224-228 (1996).
Kim, N.W., et al. Specific association of human telomerase activity with immortal cells and cancer [see comments]. Science 266, 2011-2015 (1994). Lee, A. S. et al. Effects of cell number on teratoma formation by human embryonic stem cells. Cell Cycle 8, 2608-2612 (2009).
Li, S., et al. Rapid inhibition of cancer cell growth induced by lentiviral delivery and expression of mutant-template telomerase RNA and anti-telomerase short-interfering RNA. Cancer Res 64, 4833-4840 (2004). Li, W., et al. Rapid induction and long-term self-renewal of primitive neural precursors from human embryonic stem cells by small molecule inhibitors. Proc Natl Acad Sci U S A 108, 8299-8304 (201 1 ).
Liu, C.Y., et al. Inactivation of the mouse Brcal gene leads to failure in the morphogenesis of the egg cylinder in early postimplantation development. Genes Dev 10, 1835-1843 (1996).
Nakamura, T. M. et al. Telomerase catalytic subunit homologs from fission yeast and human. Science 277, 955-959 (1997).
Prokhorova, T.A., et al. Teratoma formation by human embryonic stem cells is site dependent and enhanced by the presence of Matrigel. Stem Cells Dev 18, 47-54 (2009).
Ramlee MK, et al. High-throughput genotyping of CRISPR/Cas9-mediated mutants using fluorescent PCR-capillary gel electrophoresis. Sci. Rep. 5: 15587 (2015).
Ran FA, et al. Genome engineering using the CRISPR-Cas9 system. Nat. Protoc 8, 2281-2308 (2013). Ran FA, Hsu PD, Lin CY et al. Double nicking by RNA-guided CRISPR Cas9 for enhanced genome editing specificity. Cell 154:1380-1389 (2013).
Sexton AN, et al. Genetic and molecular identification of three human TPP1 functions in telomerase action: recruitment, activation, and homeostasis set point regulation. Genes Dev 28: 1885-1899 (2014).
Strong, M. A. et al. Phenotypes in mTERT(+)/(-) and mTERT(-)/(-) mice are due to short telomeres, not telomere-independent functions of telomerase reverse transcriptase. Mol Cell Biol 31 , 2369-2379 (201 1 ).
Takahashi, K. et al. Induction of pluripotent stem cells from adult human fibroblasts by defined factors. Cell 131 , 861-872 (2007).
Takahashi, K. & Yamanaka, S. Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors. Cell 126, 663-676 (2006).
Thomson, J. A. et al. Embryonic stem cell lines derived from human blastocysts. Science 282, 1145-1147 (1998).
Van der Oost, J. Molecular biology. New tool for genome surgery. Science 339, 768- 770 (2013). Wright, W. E. et al. Telomerase activity in human germline and embryonic tissues and cells. Dev Genet 18, 173-179 (1996).
Yu, J. ef al. Induced pluripotent stem cell lines derived from human somatic cells. Science 318, 1917-1920 (2007).
Zhang, X., ef al. Epitope tagging of endogenous proteins for genome-wide ChlP-chip studies. Nat Methods 5, 163-165 (2008).
Claims
1. An isolated pluripotent stem cell, comprising two mutated alleles of a telomerase activity gene selected from the group comprising the human telomerase reverse transcriptase (hTERT) gene and the human telomerase RNA (hTER) gene; wherein said alleles comprise an introduced and removable portion of said hTERT or hTER gene.
2. The isolated stem cell of claim 1 , wherein the cell has been further subjected to transient overexpression of hTERT or hTER to increase the average telomere length.
3. The isolated stem cell of claim 2, wherein after transient overexpression of hTERT or hTER the average telomere length in the stem cell is increased to at least 6 kb.
4. The isolated stem cell of claim 3, wherein the average telomere length in the stem cell is increased to at least 9 kb.
5. An isolated pluripotent telomerase activity null stem cell, comprising two mutated alleles of a telomerase activity gene selected from the group comprising the human telomerase reverse transcriptase (hTERT) gene and the human telomerase RNA (hTER) gene; wherein said telomerase activity null stem cell has limited lifespan and reduced tumorigenic potential.
6. The isolated pluripotent telomerase activity null stem cell of claim 5, comprising: a) the pluripotent stem cell of any one of claims 1 to 4 which has been contacted with a knockout inducer to remove said introduced removable gene portion; or b) a pluripotent stem cell which has been contacted with CRISPR-Cas to knock out alleles of a telomerase activity gene selected from the group comprising the human telomerase reverse transcriptase (hTERT) gene and the human telomerase RNA subunit (hTER) gene; wherein said telomerase activity null stem cell has limited lifespan and reduced tumorigenic potential.
7. The isolated telomerase activity null stem cell of claim 5 or 6, wherein the average telomere length is 9 kb or less.
8. The isolated telomerase activity null stem cell of claim 7, wherein the average telomere length is in a range selected from the group comprising 5 kb or less, 4 kb or less, 2kb to 4 kb, 3kb to 4 kb and about 4 kb.
9. The isolated pluripotent stem cell of any one of claims 1 to 4, wherein said portion of the hTERT or hTER gene is replaced by homologous DNA flanked by LoxP sites, which retains gene function, and at a selected time transient expression of Cre recombinase in the recombinant cell causes deletion of the homologous DNA resulting in loss of hTERT or hTER activity and, consequently, telomerase activity.
10. The isolated stem cell of any one of the previous claims, wherein the stem cell retains expression of at least one pluripotency marker selected from the group comprising Oct4, Nanog, Sox2 and Klf4.
11. The isolated stem cell of any one of claims 1 to 10, wherein the stem cell is a human embryonic stem cell (hESC) or induced pluripotent stem cell (iPSC).
12. A method of producing one or more isolated pluripotent stem cells with limited lifespan and reduced tumorigenicity compared to wild type cells, comprising the steps of:
(a)(i) engineering, by gene targeting, at least one isolated pluripotent stem cell to have inducible knockout alleles of a telomerase activity gene selected from the group comprising the human telomerase reverse transcriptase (hTERT) gene and the human telomerase RNA subunit (hTER) gene;
(a)(ii) selecting engineered pluripotent stem cell clones;
(a) (iii) contacting the engineered pluripotent stem cell clones with a gene knockout inducer; or
(b) (i) engineering, by gene editing, at least one isolated pluripotent stem cell having knocked out alleles of a telomerase activity gene selected from the group comprising the human telomerase reverse transcriptase (hTERT) gene and the human telomerase RNA subunit (hTER) gene; and
(c) selecting telomerase activity null cells with an average telomere length evaluated to be 5 kb or less and a reduced ability to form a teratoma in vivo; or
(d) selecting telomerase activity null cells and passaging them until the average telomere length is evaluated to be 5 kb or less and the cells having reduced ability to form a teratoma in vivo.
13. The method of claim 12, wherein the average telomere length is around 4 kb.
14. The method of claim 12 or 13, wherein in (a) a portion of the hTERT or hTER gene is replaced by homologous DNA flanked by LoxP sites, which retains gene function, and at a selected time transient expression of Cre recombinase, in the recombinant cells causes deletion of the homologous DNA, and wherein in (b) a portion of the hTERT or hTER gene is edited by CRISPR-Cas, resulting in loss of telomerase activity.
15. The method of claim 14, wherein in (a) the recombinant cells are homozygous for the homologous DNA insert.
16. The method of claim 14 or 15, wherein in (a) the hTERT gene is replaced and the portion of the hTERT gene replaced includes exon 1 and/or exon 2.
17. The method of any one of claims 11 to 16, further comprising a step of inducing the telomerase activity null cells to differentiate into cells of at least one of ectodermal, endodermal or mesodermal lineage.
18. The method of claim 17, wherein the telomerase null cells are induced to differentiate into at least one of the group comprising neurons, astrocytes, glia and hematopoietic cells.
19. A method of producing one or more isolated pluripotent telomerase activity null stem cells suitable for clinical use, comprising: evaluating the average telomere length and/or in vivo tumorigenicity of said pluripotent stem cells in which the human telomerase reverse transcriptase (hTERT) or the human telomerase RNA subunit (hTER) activity has been inactivated; and identifying said pluripotent stem cells as suitable for clinical use if said evaluated average telomere length is 5 kb or less and/or said cells have reduced ability to form a teratoma in vivo.
20. The method of claim 19, wherein the evaluated telomere length is around 4 kb.
21. The method of claim 19 or 20, wherein the hTERT or hTER inactivation is by virtue of an induced, or CRISPR-Cas, knockout of hTERT or hTER gene activity.
22. The method of claim 21 , wherein: i) a portion of the hTERT or hTER gene is replaced by homologous DNA flanked by LoxP sites, which retains gene function, and at a selected time transient expression of Cre recombinase in the recombinant cells causes deletion of the homologous DNA resulting in loss of hTERT or hTER activity and, consequently, telomerase activity; or ii) a portion of the hTERT or hTER gene is edited by CRISPR-Cas resulting in loss of hTERT or hTER activity and, consequently, telomerase activity.
23. The method of claim 22, whereby in i) the recombinant cells are homozygous for the homologous DNA insert.
24. The method of any one of claims 19 to 23, wherein the stem cells have limited proliferation capacity.
25. The method of claim 24, wherein the stem cells retain expression of at least one stem cell pluripotency marker selected from the group comprising Oct4, Nanog, Sox2 and Klf4.
26. The method of any one of claims 19 to 25, wherein the stem cells are human embryonic stem cells (hESC) or induced pluripotent stem cells (iPSC).
27. The method of any preceding claim, comprising a further step of inducing said stem cells to differentiate into cells of at least one of ectodermal, endodermal or mesodermal lineage.
28. The method of claim 27, wherein the stem cells are induced to differentiate into at least one of the group comprising neurons, astrocytes, glia and hematopoietic cells.
29. The method of any preceding claim, wherein said evaluating step comprises performing one or more of: single telomere length analysis (STELA), fluorescence in- situ hybridization (FISH), flow-FISH and Southern blot analysis.
30. The method of any preceding claim, further comprising:
(a) assessing the genomic integrity of said pluripotent stem cells to obtain a genomic integrity result, wherein said assessing comprises one or more of: karyotyping; analysis of variable number tandem repeats (VNTRs), short tandem repeats (STRs), single nucleotide polymorphisms (SNPs), and/or copy number variations (CNVs); analysis of culture mosaicism; analysis of DNA sequences related to genetic diseases; and complete genome sequencing and analysis; and
(b) identifying the pluripotent stem cells as suitable for clinical use based on the genomic integrity result.
31. The method of claim 30, wherein the genome integrity is assessed prior to gene inactivation.
32. Use of at least one isolated telomerase activity null stem cell of any one of claims 5 to 11 for the preparation of a therapeutic composition for cell therapy of a subject in need thereof.
33. The use according to claim 32, wherein the at least one cell is differentiated into cells of at least one of ectodermal, endodermal or mesodermal lineage.
34. The use according to claim 33, wherein the at least one cell is differentiated into cells of at least one lineage selected from the group comprising neurons, astrocytes, glia and hematopoietic cells.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| SG10201503148P | 2015-04-22 | ||
| SG10201503148P | 2015-04-22 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2016171625A1 true WO2016171625A1 (en) | 2016-10-27 |
Family
ID=57143322
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/SG2016/050190 Ceased WO2016171625A1 (en) | 2015-04-22 | 2016-04-22 | Targeting telomerase for cell therapy |
Country Status (1)
| Country | Link |
|---|---|
| WO (1) | WO2016171625A1 (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114144231A (en) * | 2019-05-15 | 2022-03-04 | 得克萨斯系统大学评议会 | CRISPR methods for treating cancer |
| CN116189765A (en) * | 2023-02-23 | 2023-05-30 | 上海捷易生物科技有限公司 | An iPS cytogenetics risk assessment system and its application |
| CN116200427A (en) * | 2022-10-18 | 2023-06-02 | 广东省农业科学院动物卫生研究所 | A method and application of directionally knocking hTERT gene into porcine primary alveolar macrophages to obtain immortalized cell lines |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2009061442A1 (en) * | 2007-11-06 | 2009-05-14 | Children's Medical Center Corporation | Method to produce induced pluripotent stem (ips) cells form non-embryonic human cells |
| WO2012010976A2 (en) * | 2010-07-15 | 2012-01-26 | Cellectis | Meganuclease variants cleaving a dna target sequence in the tert gene and uses thereof |
-
2016
- 2016-04-22 WO PCT/SG2016/050190 patent/WO2016171625A1/en not_active Ceased
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2009061442A1 (en) * | 2007-11-06 | 2009-05-14 | Children's Medical Center Corporation | Method to produce induced pluripotent stem (ips) cells form non-embryonic human cells |
| WO2012010976A2 (en) * | 2010-07-15 | 2012-01-26 | Cellectis | Meganuclease variants cleaving a dna target sequence in the tert gene and uses thereof |
Non-Patent Citations (6)
| Title |
|---|
| KINOSHITA, T. ET AL.: "Telomerase reverse transcriptase has an extratelomeric function in somatic cell reprogramming", THE JOURNAL OF BIOLOGICAL CHEMISTRY, vol. 289, no. 22, 2014, pages 15776 - 15787, XP055324996 * |
| PUCCI, F. ET AL.: "Short telomeres in ESCs lead to unstable differentiation", CELL STEM CELL, vol. 12, 2013, pages 479 - 486, XP055324985 * |
| SCARIA, G. ET AL., BLOOD, vol. 124, 2014, pages 5816 * |
| WANG, F. ET AL.: "Molecular insights into the heterogeneity of telomere reprogramming in induced pluripotent stem cells", CELL RESEARCH, vol. 22, 2012, pages 757 - 768, XP055324989 * |
| WINKLER, T. ET AL.: "Defective telomere elongation and hematopoiesis from telomerase-mutant aplastic anemia iPSCs", THE JOURNAL OF CLINICAL INVESTIGATION, vol. 123, no. 5, 2013, pages 1952 - 1963, XP055324981 * |
| ZENG, S. ET AL.: "Telomerase-mediated telomere elongation from human blastocysts to embryonic stem cells", JOURNAL OF CELL SCIENCE, vol. 127, 2014, pages 752 - 762, XP055324999 * |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114144231A (en) * | 2019-05-15 | 2022-03-04 | 得克萨斯系统大学评议会 | CRISPR methods for treating cancer |
| CN114144231B (en) * | 2019-05-15 | 2024-05-24 | 得克萨斯系统大学评议会 | CRISPR approaches for treating cancer |
| CN116200427A (en) * | 2022-10-18 | 2023-06-02 | 广东省农业科学院动物卫生研究所 | A method and application of directionally knocking hTERT gene into porcine primary alveolar macrophages to obtain immortalized cell lines |
| CN116189765A (en) * | 2023-02-23 | 2023-05-30 | 上海捷易生物科技有限公司 | An iPS cytogenetics risk assessment system and its application |
| CN116189765B (en) * | 2023-02-23 | 2023-08-15 | 上海捷易生物科技有限公司 | A risk assessment system and application of iPS cytogenetics |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| RU2690352C2 (en) | Genetic modification of rats | |
| JP6993063B2 (en) | Genome engineering | |
| JP2025106394A (en) | De novo generation of pluripotent cells | |
| EP2989199B1 (en) | Isolated naive pluripotent stem cells and methods of generating same | |
| Sato et al. | Genome editing in mouse spermatogonial stem cell lines using TALEN and double-nicking CRISPR/Cas9 | |
| CN107532142A (en) | Mescenchymal stem cell is transformed using homologous recombination | |
| JP2015500637A (en) | Haploid cells | |
| US20240060047A1 (en) | Cells with sustained transgene expression | |
| CN109996873A (en) | Cell population for transplantation and method for producing the same | |
| US20190365818A1 (en) | Genetically-tagged stem cell lines and methods of use | |
| KR20050096974A (en) | Directed genetic modifications of human stem cells | |
| Liu et al. | Distinct responses of stem cells to telomere uncapping—a potential strategy to improve the safety of cell therapy | |
| CN105051188A (en) | Novel method | |
| WO2021216622A1 (en) | Gene editing of gba1 in stem cells and method of use of cells differentiated therefrom | |
| Balmas et al. | Manipulating and studying gene function in human pluripotent stem cell models | |
| JP2024107098A (en) | Bird breeding method and egg production method | |
| CN107365803A (en) | Exempt from the method that drug screening quickly obtains mouse Rosa26 Gene targeting foreign genes | |
| WO2016171625A1 (en) | Targeting telomerase for cell therapy | |
| US20100233142A1 (en) | Stem Cells Derived from Uniparental Embryos and Methods of Use Thereof | |
| KR101796518B1 (en) | Method for manufacturing gene-corrected induced pluripotent stem cell combining reprogramming and gene-editing | |
| Young et al. | Patient-specific induced pluripotent stem cells as a platform for disease modeling | |
| JP2025501617A (en) | Methods for producing human induced pluripotent stem cells by homologous recombination and integrase-mediated recombination | |
| KR102944658B1 (en) | NANOG Knockin Cell line for tracing differentiation of germ cell and use thereof | |
| 엄경현 | Strategies for Rapid Propagation of Gene-Edited Cattle | |
| KR20200011817A (en) | Composition for correcting blood coagulation factor Ⅷ and method using the same |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 16783512 Country of ref document: EP Kind code of ref document: A1 |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 16783512 Country of ref document: EP Kind code of ref document: A1 |