KR101796518B1

KR101796518B1 - Method for manufacturing gene-corrected induced pluripotent stem cell combining reprogramming and gene-editing

Info

Publication number: KR101796518B1
Application number: KR1020150177270A
Authority: KR
Inventors: 정선구; 권은정; 정상균
Original assignee: 한국한의학연구원
Priority date: 2014-12-12
Filing date: 2015-12-11
Publication date: 2017-11-14
Also published as: WO2016093668A3; KR20160072795A; WO2016093668A2

Abstract

The present invention relates to a method for producing an induced pluripotent stem cell (iPSC) -generating pluripotent stem cell-induced pluripotent stem cell (iPSC) -generating pluripotent stem cell (IPSC) having a genetic modification by one-step is a reprogramming episome vector inducing the repopulation of adult somatic cells, and Genetically modified iPSC or a mutation-induced disease model iPSC can be produced by introducing a gene correcting or mutagenic transporter into the host cell at the same time, and the gene-corrected or mutagenized iPSC can be produced in the same manner as other kinds of normal type iPSCs And can be used for screening a cell therapy agent or therapeutic substance for treating a disease by showing different characteristics and different characteristics.

Description

[0001] The present invention relates to a method for producing an all-in-one gene therapy induced pluripotent stem cell,

The present invention relates to a method for preparing iPSCs from a somatic cell line or a disease model in a one-step manner by combining induced pluripotent stem cell (iPSC) production elements and genetic manipulation elements.

The development of precise genetic engineering techniques not only promoted genetic studies, but also facilitated their application to medical care more effectively. Zinc-finger nucleases (ZFN), transcription activator-like effector nucleases (TALEN), and short regressive repeat-caspase 9 nuclease systems (short palindromic Genome editing tools as powerful molecular scissors, including RNA-guided endonucleases (RGEN) from microbial clusters that routinely have a repeat-cas9 nuclease system, In addition to applying homologous recombination based on bacterial artificial chromosomes, it is possible to insert, delete or replace the target gene effectively from the genome. do.

The discovery of induced pluripotent stem cells (iPSCs) opens up new avenues for autologous stem cell transplantation and new strategies for human disease models, including neurological diseases, blood malformations, spinal cord injury , Heart disease, diabetes, and arthritis. In addition, iPSC as a disease model will be more useful when combined with the genetic manipulation tools described above. Recent studies have shown that gene-modified iPSCs have been produced using genetic engineering tools for application to the study of pathogenesis mechanisms of disease through cell replacement therapy or mechanistic studies and also to increase the gene manipulation efficiency of the iPSC (Daisy A, et al., Nature , 481: 295-305, 2012).

In this way, human iPSCs, which are very similar to embryonic stem cells using genetic engineering tools, can be produced because the stem cells are constantly dividing while maintaining self-renewal. In addition, despite the wide variety of cell lines that can grow indefinitely, iPSC has the ability to differentiate into various cells and many studies are underway to produce genetically engineered iPSCs by applying genetic engineering tools to iPCS Matthias Stadtfeld et al., Science , 322 (5903): 945-949, 2008). However, in order to apply the existing genetic manipulation tool to iPSC, generally, induction pluripotent stem cells are produced, and genetic manipulation tools have to be introduced into the pluripotent pluripotent stem cells. In other words, laborious, costly, and time-consuming processes are necessary.

Fibrodysplasia ossificans progressiva (FOP) is a congenital disorder characterized by heterotopic ossification of connective tissue and muscle tissue by autosomal dominant mutation in the ACVR1 gene. Lt; / RTI > The ACVR1 gene encodes a type 1 activin A type I receptor and is also referred to as ALK2. A typical mutant form of progressive ossifying dysplasia is ACVR1 p.R206H, and the receptor protein expressed in this gene It is activated and causes the disease.

In the production of iPSCs derived from FOP patients, the genetic variation in ACVR1 p.R206H of the patient-derived cells indicates that even when an unusual colony is detected in the production stage of iPSC, this colony shows non-amylogenesis as a stem cell , It is known that it is difficult to maintain the iPSC in undifferentiated status. Therefore, introducing genetic manipulation tools into iPSCs derived from FOP patients is limited, which allows researchers to try different methods to apply direct genetic manipulation to FOP-derived somatic cells.

Thus, the present inventors have found that a reprogrammed episome vector that induces the de-differentiation of adult somatic cells while performing experiments to solve the problem that it is difficult to manufacture iPSC derived from a patient, such as FOP, Genetically calibrated iPSC or mutation-induced disease model iPSC can be produced by introducing a gene correcting or mutagenic transporter into adult somatic cells at the same time, and iPSC, in which the gene is calibrated or mutated, has the same characteristics as other kinds of normal iPSC Or exhibit different characteristics.

It is an object of the present invention to provide an inducible pluripotent stem cell (iPSC) and an inducible pluripotent stem cell gene-treated stem cell from a patient-derived somatic cell line through a one-step method combining gene therapy elements, And to provide a method for producing induced pluripotent stem cells genetically edited from somatic cells for gene function studies.

In order to achieve the above object, the present invention provides a method for preparing a gene-corrected iPSC comprising:

1) inducing inducible pluripotent stem cells (iPSC) by simultaneously introducing a reprogramming episomal vector and a mutation correcting transporter into an adult somatic cell isolated from an individual; And

2) screening the produced iPSC of step 1).

The present invention also provides a method of preparing a genetically modified iPSC comprising:

1) FOB patients were treated with either one selected from the group consisting of a fibroblast reprogramming episomal vector, sgRNA consisting of SEQ ID NO: 1, and ssODN consisting of SEQ ID NO: 2 at the same time, Preparing an induced pluripotent stem cell (iPSC); And

2) screening the produced iPSC of step 1).

In addition, the present invention provides a method of producing a disease model iPSC comprising:

1) preparing inducible pluripotent stem cells (iPSCs) by simultaneously introducing reprogramming episomal vectors and mutagenic inducers into isolated somatic somatic cells; And

2) screening the produced iPSC of step 1).

The method for producing induced pluripotent stem cells (iPSCs) having a genetic modification by one-step of the present invention comprises a reprogramming episome vector inducing the repopulation of adult somatic cells, Or a mutagen-inducing carrier can be simultaneously introduced into a host cell to produce a genetically-modified iPSC or a mutagen-induced disease model iPSC, and the gene-corrected or mutagenized iPSC can have the same characteristics and functions as the other types of normal- Can be used for screening of cell therapy agents or therapeutic agents for treating diseases by showing different characteristics.

FIG. 1A is a graph showing the results of TALEN and Hprt1 for producing knockout induced induced pluripotent stem cells (iPSC) by Hypoxanthine-Guanine Phosphoribosyltransferase 1 ( Hprt1 ) &Lt; / RTI >
1B shows a T7 endonuclease I (T7EI) assay result in which a TALEN plasmid was used as a template and a PCR product produced by genomic DNA of a transfected fibroblast .
1C is a diagram illustrating a method of manufacturing an iPSC in which Hprt1 is knocked out in one-step.
FIG. 1D shows the result of single-strand conformation polymorphism (SSCP) assay of a clone in which Hprt1 mutation has been induced.
FIG. 1E shows the sensitivity of 6-thioguanine (6-TG) to the sensitivity of the Hprt1 mutant-induced clone in Hypoxanthine-aminopterin thymidine (HAT) medium .
FIG. 1F shows the sequence of a clone in which an SSCP assay or Hprt1 mutation was induced by HAT or 6-TG treatment.
Figure 2a shows a negative selection of Hprt1 mutant iPSC:
i: human fibroblast;
ii: Negative selective or non-selective Hprt1 mutant iPSC;
iii: 1 day after 6-TG treatment; And
iV: 5 days after 6-TG treatment.
FIG. 2B shows the number of generated Hprt1 mutant iPSCs.
Figure 2c shows T7EI assay results of the PCR products obtained from the normal or Hprt1 mutant iPSC.
3A shows a single-guided RNA (sgRNA) for the AAVS1 gene.
FIG. 3B is a diagram showing the result of T7 endonuclease I (T7EI) assay performed with a PCR product produced from a genomic DNA of a fibroblast into which sgRNA is introduced as a template.
3C is a diagram illustrating a method for producing iPSC into which sgRNA is introduced in one-step.
FIG. 3D is a diagram showing T7EI assay results of the PCR product obtained from iPSC in which the sgRNA was introduced in a normal or sgRNA.
FIG. 3E shows the sequence of a clone in which gene deletion occurred by sgRNA.
FIG. 4A shows colonies generated after induction of differentiation into iPSC from an FOP patient-derived cell line by an existing method.
FIG. 4B is a diagram showing the differentiation state of iPSC derived from an FOP patient manufactured by an existing method.
FIG. 4c is a diagram showing semi-quantitative RT-PCR analysis of the expression of the differentiation-ability markers of iPSCs derived from FOP patients prepared by the conventional method.
FIG. 5A shows the expression of GFP after one day of introduction of a GFP expression vector into iPSC derived from an FOP patient.
FIG. 5B shows the expression of GFP after 15 days of introduction of a GFP expression vector into iPSC derived from an FOP patient.
FIG. 5C is an enlarged view of FIG. 5B. FIG.
FIG. 5D is a graph showing alkaline phosphatase and GFP expressing cell line shown in FIG. 5C. FIG.
FIG. 5E is a graph showing GFP expression and alkaline phosphatase staining results of iPSCs derived from FOP patients after treatment with LDN-193189 after introducing a GFP expression vector into iPSCs derived from FOP patients.
6A is a diagram showing a single-guided RNA (sgRNA) for the ACVR1 gene.
FIG. 6B is a diagram showing homology-directed repair (HDR) efficiency of a single-strand oligodeoxynucleotide (ssODN) template mediated FOP-derived fibroblast.
Fig. 6C is a diagram showing the target efficiency of sgRNA introduced into FOP-derived fibroblasts through deep base sequence analysis.
FIG. 6D is a diagram showing the target efficiency of ssODN introduced into FOP-derived fibroblasts through deep base sequence analysis.
6E is a diagram showing a method for producing iPSC gene-corrected from FOP-derived fibroblasts.
FIG. 6F is a diagram showing a result of analyzing a genotype for finding a candidate group of iPSC derived from a genetically-modified FOP patient.
FIG. 6G is a diagram showing a result of sequence analysis of iPSC derived from homologous delivery restored FOP patients.
Figure 7A is a diagram showing on-target and off-target candidates for the ACVR1 sgRNA.
FIG. 7B is a diagram showing sequence of ACVR1 and off-target candidate genes FILIP1L, RIC8A and BYSL and primer binding site for PCR amplification to confirm off-target.
FIG. 7C is a diagram showing off-target availability and efficiency of ACVR1 sgRNA through a T7 endonuclease assay method for off-target candidate groups.
8 is a diagram showing the result of sequencing of fibroblasts derived from FOP patients and iPSC gene-corrected.
FIG. 9A shows the expression of an alkaline phosphatase in an iPSC derived from an FOP patient whose gene is corrected.
FIG. 9B shows the expression of a multipotent marker in an iPSC derived from a FOP patient whose gene has been corrected.
9C is a diagram showing a karyotypic analysis result of an iPSC derived from a FOP patient whose gene is corrected.
FIG. 10A is a diagram showing the result of von kossa staining for iPSC cultured in a stem cell culture medium.
Fig. 10B is a diagram showing the results of Bonho cosmetic staining for differentiated cells cultured under minerals differentiation conditions.

Hereinafter, terms of the present invention will be described.

As used herein, the term "one-step" refers to the simultaneous introduction of reprogramming and gene-editing.

As used herein, the term " reprogramming episomal vector " refers to a vector not introduced into the chromosome, i.e., OCT4, shp53, SOX2, Klf4, Lin28 and L means a vector constructed to express a transcription regulatory gene such as -myc.

For example, a vector comprising one or more transcriptional regulatory genes selected from the group consisting of OCT4, shp53, SOX2, Klf4, Lin28 and L-myc.

The vector may include, but is not limited to, a vector comprising OCT4-shp53, a vector comprising Sox2-Klf4, and a vector comprising Lin28-L-myc.

As used herein, the term "Lesch-nyhan syndrome" refers to a disorder in which the function of the hypoxanthine-guanine phosphoribosyltransferase 1 (Hprt1) gene is lost.

As used herein, the term " TALEN " refers to a system for cleaving a DNA target site by a restriction enzyme to which a TAL effect DNA binding domain that specifically recognizes a DNA target site is bound do.

As used herein, the term " fibrodysplasia ossificans progressiva (FOP) " refers to a gene that is involved in BMP signal transduction because it is continuously undergoing BMP signaling through a gain- of function by mutation of the ACVR1 gene And bone and connective tissues are ossified.

As used herein, the term 'single-guided RNA (sgRNA)' is an RNA complementary to a target DNA sequence, consisting of a crRNA and a tracrRNA.

As used herein, the term 'single-strand oligodeoxynucleotide (ssODN)' is composed of a single strand of DNA, and is used as a donor of a normal gene to replace an abnormal base with a normal base ).

Hereinafter, the present invention will be described in detail.

2) screening the produced iPSC of step 1).

The individual may refer to any animal, including humans, that are susceptible to or susceptible to mutation. The animal may be a mammal such as, but not limited to, a cow, horse, sheep, pig, goat, camel, nutritionist, dog, cat,

Preferably, the individual of step 1) is a patient suffering from fibrodysplasia ossificans progressiva (FOP) or fanconi anemia, but not limited thereto. Any patient suffering from a mutation of the gene may be applied It is possible.

The somatic somatic cells in step 1) are preferably human fibroblasts, but not limited thereto, and all somatic cells derived from all animals such as monkey, pig, horse, cow, sheep, dog, cat, mouse, rabbit and the like can be used. In addition, the iPSC is preferably cultured under embryonic stem cell culture conditions generally used in the art, but not limited thereto.

The reprogramming episomal vector of step 1) above preferably comprises any one or more selected from the group consisting of Oct4, shp53, Sox2, Klf4, Lin28 and L-myc.

Preferably, the mutant correcting transducer of step 1) comprises gene scissors and the gene scissors are composed of zinc-finger nuclease (ZFN), transcription activator-like effector nuclease (TALEN) and RNA-guided DNA endonuclease It is preferable to use the RGEN according to the embodiment of the present invention. In addition, the mutant transcriptional carrier using the RGEN gene scissors preferably includes but is not limited to a single-guided RNA (sgRNA) or a single-strand oligodeoxynucleotide (ssODN) .

The sgRNA may comprise SEQ ID NO: 27 or target ACVR1 p.R206H mutations, but is not limited thereto.

The ssODN may be composed of SEQ ID NO: 28 or is preferably, but not limited to, for restoring the ACVR1 c.617G > A mutation.

The genetically-calibrated iPSC prepared by the above method is characterized in that primary iPSC colonies are separated and transported to a matrigel-coated plate for 3 to 4 weeks after culturing, but the present invention is not limited thereto. The iPSC may be cultured in a fibroblast culture medium for 48 hours and then replaced with a stem cell culture medium to continue culturing. However, the present invention is not limited thereto.

Also, it is preferable that at least one of the allele genes of the genetically-calibrated iPSC prepared by the above method is inserted into the target of donor DNA, and at the same time, an insert-deletion (indel) mutation is generated by the allen at the position of another allele, Not limited.

The step 2) for selecting the iPSC prepared in the step 1) can be selected by a method for confirming whether the gene is corrected or not known in the art.

In a preferred embodiment of the present invention, the inventors used ACVR1 p.R206H mutant to produce iPSCs from fibrodysplasia ossificans progressiva (FOP) patient-derived cell lines using a one-step strategy Targeted single-guided RNA (sgRNA) or single-strand oligodeoxynucleotide (ssODN) templates were prepared by electroporation with reprogrammed episomal vectors in FOB patient-derived fibroblasts Two bands were identified from the 292 bp PCR amplicon, 191 bp and 101 bp, respectively, and they were intentionally screened for the convenience of screening through genetic analysis, which is a consideration in donor DNA preparation It was confirmed that the target efficiency of the donor DNA was about 6.5% through the induced mutation (see FIG. 6B).

In addition, as a result of analysis of the genotype of iPSC derived from genetically modified FOP patients prepared by the above method, 8 clones among 88 clones identified as genotypes showed that at least one of the alleles was inserted into the target, and the target frequency The targeting frequency was found to be about 9% (see FIG. 6g), and as a result of the sequence analysis, it was confirmed that the mutant residue in the FOP patient was substituted with the wild-type donor DNA (see FIG. 8).

Furthermore, the expression of the alkaline phosphatase of iPSC derived from the gene-corrected FOP patient of the present invention was confirmed. As a result, the expression of strong alkaline phosphatase was observed in the iPSC derived from the FOP patient whose gene was corrected (see Fig. 9A). The expression of SOX2 and DNMT3B was decreased in iPSCs derived from FOP patients, but in iPSCs derived from FOP patients with genetically modified strains, the expression was markedly similar to the normal form (see Fig. 9b) It was confirmed that iPSCs derived from genetically-modified FOP patients had a common karyotype (Fig. 9C).

As a result of confirming the gene correcting effect of the iPSC derived from the patient's genetically modified FOP patient, the stem cell which was genetically corrected through the one-step method from the FOP patient-derived cell line showed a similar shape to the wild type iPSC, In the case of stem cells prepared from patient-derived cells, a large amount of minerals were contained and it was confirmed that the black part appears strongly (see FIGS. 10A and 10B).

In conclusion, the iPSC preparation method of the present invention effectively produced iPSCs from fibroblasts derived from FOP patients, which were difficult to produce, and confirmed that they can be used for FOP treatment.

1) Fibroblast growth factor (FOP) patients were simultaneously introduced with at least one selected from the group consisting of a fibroblast reprogramming episomal vector, sgRNA consisting of SEQ ID NO: 27, and ssODN consisting of SEQ ID NO: 28, Preparing an induced pluripotent stem cell (iPSC); And

2) screening the produced iPSC of step 1).

The somatic somatic cells in step 1) are preferably human fibroblasts, but not limited thereto, and all somatic cells derived from all animals such as monkey, pig, horse, cow, sheep, dog, cat, mouse, rabbit and the like can be used. The iPSC culture is preferably cultured under embryonic stem cell culture conditions, but is not limited thereto.

The reprogramming episomal vector of step 1) preferably expresses at least one selected from the group consisting of Oct4, shp53, Sox2, Klf4, Lin28 and L-myc, but is not limited thereto.

Preferably, the mutation-inducing carrier of step 1) comprises gene scissors and the gene scissors are comprised of zinc-finger nuclease (ZFN), transcription activator-like effector nuclease (TALEN) and RNA-guided DNA endonuclease Preferably, TALEN is selected according to an embodiment of the present invention. The mutagenesis inducer including TALEN is preferably knocked out of Hypoxanthine-Guanine Phosphoribosyltransferase 1 (Hprt1), but it is not limited thereto. To knockout Hprt1, TALEN The recognized gene sequence preferably comprises the sequence consisting of SEQ ID NO: 29 or SEQ ID NO: 30, but is not limited thereto.

The Hprt1 is preferably composed of SEQ ID NO: 31, but is not limited thereto.

The disease is most preferably Lesch-Nyhan syndrome, but is a disease caused by a mutation of a specific gene, and includes all of metabolic diseases, cancer diseases, brain diseases, cardiovascular diseases, blood diseases, bone diseases and the like It is applicable to all genetic diseases.

In a preferred embodiment of the present invention, the present inventors produced inducible pluripotent stem cells (iPSC) having the characteristics of Lesch-Nyhan syndrome using a one-step strategy , A knockout vector of Hypoxanthine-Guanine Phosphoribosyltransferase 1 (Hprt1) and a reprogramming episomal vector were simultaneously introduced into normal type fibroblasts by electroporation, As a result, it was confirmed that genetic manipulation occurred at an efficiency of about 10% (see FIG. 1B). As a result of alkaline phosphatase staining, gene cloning was performed simultaneously with reprogramming in some clones prepared by the above method. And 36%, respectively (see Figs. 1C and 2A).

In addition, the genetically engineered iPSCs were selected from the cells generated by the above method, and the sequence near the mutant was analyzed. As a result, Hprt1 was removed, and some of the clones showing resistance to 6-TG were found to have a single- 1e), it is possible to grow in Hypoxanthine-aminopterin thymidine medium (see FIG. 1e), and the sequence analysis showed that the growth of bases in the left and right arms of TALEN Insertion or deletion was confirmed (see Fig. 1F).

In addition, genetically engineered iPSCs through T7 endonuclease I, T7E1 assays showed that all of the regenerated DNA mixture products were cleaved by T7E1 (see FIG. 2C) ), Confirming that all the separate clones were mutated by TALEN.

In conclusion, since the disease model iPSC of the present invention can be produced economically from normal adult somatic cells in a short time, it can be useful for drug screening of a specific disease using the disease model iPSC.

Hereinafter, the present invention will be described in detail with reference to examples. However, the following examples are intended to illustrate the contents of the present invention, and the scope of the present invention is not limited by the following examples.

< Example 1> One-step strategy Reishnihan syndrome( Lesch - Nyhan syndrome Induced pluripotent stem cells induced pluripotent stem cell, iPSC )

<1-1> Hypoxanthin - guanine Phospholiposyl transferase 1 knockout and Reprogramming Episode Introduction of vectors

Cell lines with the genetic characteristics of the Lhoshinian syndrome caused by the deficiency of Hypoxanthine-Guanine Phosphoribosyltransferase 1 ( Hprt1 ) linked to the X-chromosome were prepared by the following method To prepare the cell line, a reprogramming episomal vector (Addgene, USA) was used, which was prepared by Shinya Yamanaka of Japan and was used for the production of the virus of Ebstein-B-virus It is a vector called pCXLE into which EBNA-1 gene is introduced. In this empty vector, OCT4-shp53, Sox2-Klf4 and Lin28-L-myc are paired respectively. OCT4 is expressed by the CAG promoter, and shp53 is expressed by the U6 promoter, in particular OCT4-shp53. All under the control of the CAG promoter.

Specifically, 1 x 10 < ⁶ > fibroblast cells were diluted in 150 [mu] l of R-butter, and then TALEN to knock out 2 [mu] g X- linked hyphocaxanthin-guanine phospholysyl transferase 1 A reprogramming episomal vector for reprogramming 1.5 ug of cells was added to the vector (Fig. 1a), and a 1,200 V, 30 ms, 2x pulses Were simultaneously introduced into the fibroblast cell line using the electroporation method. After the introduction, the cells were cultured in fibroblast culture medium (DMEM medium containing 10% FBS) for 48 hours, and the efficiency of gene manipulation was found to be about 10% as shown in FIG. 1B (FIG. After 48 hours of culturing the prepared cells in fibroblast culture medium, cells were replaced with stem cell medium (mTesR1). Two weeks after culture in stem cell culture, when immature iPSC was formed, 1x 6-thioguanine was added to the stem cell culture to continue culturing, and the medium was replaced every day for 5 days.

As a result, after 20 days of transfection, some pre-iPSC (6-thioguanine, 6-thioguanine) genes showing resistance to 6-thioguanine, 6-TG by removal of TALEN- mediated Hprt1 gene in clones prepared by the above- ) Clones were selected and its efficiency was easily verified by the activity of alkaline phosphatase staining specifically in stem cells (Fig. 1C and Fig. 2A). Some of them were genetically manipulated simultaneously with reprogramming, and their efficiency was 36% compared with the control group.

&Lt; 1-2 > iPSC Screening and confirmation

IPSC was selected from the clones prepared in the procedure of Example <1-1> according to the single-strand conformational pattern method.

Specifically, 21 Hprt1 which shows resistance to 6-TG The mutant clone was separated by hand using a tip, and the PCR product generated by PCR amplification was denatured into a single-strand, and the result was confirmed by electrophoresis on a single-stranded structural polymorphic gel. In addition, a PCR amplicon obtained by PCR using the above-described method in the vicinity of a mutation caused by TALEN was cloned into a vector pTOP TA V2, and then an M13 universal primer present in the T vector After sequencing using an automatic sequencing analyzer, the results were compared to the original wild-type sequence and nucleotide insertions or deletions were confirmed in the vicinity of a spacer truncated by a pair of TALENs.

As a result, as shown in Fig. 1d, not only Hprt1 was removed and some of the clones showing resistance to 6-TG exhibited other forms of single-stranded structural polymorphism in the normal form (Fig. 1d), hippoxanthin aminopterin It was confirmed that growth was possible in hypoxanthine-aminopterin thymidine medium (Fig. 1E).

Sequence analysis also confirmed insertion or deletion of bases in the space between the left and right arms of TALEN (Fig. 1F).

<1-3> T7 Endonuclease I (T7 endonuclease I, T7E1 ) Assay Genetically engineered iPSC Confirm

The T7 endonuclease assay was performed using the genetically engineered iPSC selected in Example <1-2> to confirm whether mutations were generated in the selected clones.

Specifically, genomic DNA was isolated from mutant clone candidates and wild-type cell lines, and the mutation predicted site was amplified by PCR. From the amplified PCR products, the wild-type cell line derived products were mixed with the respective mutant clone candidate products, and a 2-type heteroduplex shape was formed by lowering the initial 95 ° C to 25 ° C / Type double strand was treated with 2 units of T7E1 for 20 minutes and then electrophoresed on 2% agarose gel.

As a result, it was confirmed that all of the regenerated DNA mixture products were cleaved by T7E1 (Fig. 2C), indicating that all the separated clones were mutated by TALEN.

Thus, the method of the present invention for producing a Lyssinan syndrome model cell line can produce efficient genetically engineered iPSC in 3 to 4 weeks by simultaneously generating iPSC from somatic cells while inducing disease-specific gene mutation.

< Example 2> Human using a one-step strategy foreskin Fibroblasts (human foreskin fibroblasts, hFFn ) from iPSC Produce

<2-1> AAVS1 single-guided RNAs targeting safe-harbor locus, sgRNA ) Introduction

In order to measure the efficiency of the one-step strategy including reprogramming and genetic manipulation steps, single-guided RNA (sgRNA) targeting AAVS1 safe-harbor locus was prepared (Fig. 3a). As the vectors used for the production of degenerated stem cells, an episome vector (Addgene, USA) in which OCT4-shp53, Sox2-Klf4, and Lin28-L-myc were paired was used. The sgRNA targeting the AAVS1 safe-harbor locus was produced by commissioning of Tulzen (Korea). The sgRNA was prepared so as to contain a protospacer adjacent motif (PAM) sequence (SEQ ID NO: 32: CTCCCTCCCAGGATCCTCTCTGG) in the sgRNA sequence.

The U6 promoter present in the sgRNA plasmid was used for the expression of sgRNA composed of tracrRNA and crRNA. The CAG promoter was replaced by a CMV promoter present in the original plasmid encoding Cas9-endonuclease. The method of preparing iPSCs into which sgRNA is introduced is as follows.

Specifically, human foreskin fibroblasts (hFFn) were treated with 0.05%% TrypLE ^™ express (Invitrogen) to trypsinize and then washed with DPBS. 1 × 10 ⁶ human foreskin fibroblasts (hFFn) were diluted in 150 μl of R-butter, and then 1.5 μg of each of the above episome vectors, 1.5 μg Cas9-encoding plasmid and 1.5 μg of AAVS1 -sgRNA was added. The additive was introduced into human foreskin fibroblasts using electroporation under conditions of 1,200 V, 30 ms, 2x pulses using a Neon electric perforator with a 10 or 100 [mu] l tip. After the introduction, the cells were cultured in fibroblast culture medium (DMEM medium containing 10% FBS) for 48 hours.

As a result, it was confirmed that the genetic engineering efficiency was about 34% as shown in FIG. 3B (FIG. 3B).

<2-2> T7 Endonuclease I (T7 endonuclease I, T7E1 ) Assay Genetically engineered iPSC Confirm

Cells prepared according to Example 2-1 were replaced with stem cell medium (mTesR1) for 48 hours after culturing in the fibroblast culture medium, and the medium was changed every day. Three weeks after culture in stem cell culture, primary iPSC colonies were transferred to 96-well plates, respectively, for differentiation. The cells were cultured until the colonies filled 80% of each well (Fig. 3C). 50 iPSC clones were selected from the cultured primary iPSCs and T7 endonuclease assay was performed according to Example 1-3 to confirm whether mutations were generated in the selected clones.

As a result, it was confirmed that the mutation efficiency was 82% (FIG. 3D), indicating that most of the isolated clones were mutated in the AAVS1 safe-harbor locus by the sgRNA.

<2-3> Sequence analysis

Sequence analysis revealed that an indel (insertion or deletion) mutation occurred near Pam (FIG. 3e).

< Comparative Example 1 > Ossification Fiber dysplasia ( fibrodysplasia ossificans progressiva , FOP) from patient-derived cell lines iPSC Produce

&Lt; 1-1 > From the FOP patient-derived cell line iPSC Induction of differentiation

The following method was performed to produce iPSC using somatic cells isolated from FOP patients having genetic mutations in ACVR1 p.R206H.

Specifically, a fibroblast cell line derived from 1 x 10 ⁶ FOP patients was diluted with 150 μl of R-buffer for electroporation, and then three reprogramming episomal vectors hOCT4-shp53, hSox2-hKLF4, and hL -myc-hLin28 were diluted and added to the FOP patient-derived fibroblast cell line. Then, the cell line was cultured in a fibroblast culture medium (DMEM medium containing 10% FBS) at 1,200 V, 30 ms and 2x pulses conditions in a Neon electric perforator for 48 hours, and then cultured in mTesR1 Stem cells were formed by continuously culturing for 3 to 4 weeks.

As a result, it was confirmed that an appropriate-sized colony to be selected was formed after the reprogramming proceeded as shown in FIG. 4A (FIG. 4A). Although most of the colonies exhibit unusual morphology and weak alkaline phosphatase activity, twelve of these colonies were randomly selected to continue subculture.

&Lt; 1-2 > iPSC Supply of culture assisted cells

MEF-feeder cells commonly used were co-cultured so that the atypical undifferentiated state of the iPSC cells derived from the FOP patients induced in the above Comparative Example <1-1> could be improved Later, the differentiation of iPSC cells derived from FOP patients was confirmed by alkaline phosphatase staining.

Specifically, a 6-well tissue culture plate was coated with 0.1% gelatin in a 37 ° C incubator, and then 1 x 10 ⁴ mitomycine-treated CF-1 supplemented cells were added per well. After 24 hours The culture-assisted cells attached to the wells with D-PBS were washed and then 1 × 10 ³ iPSCs were cultured thereon. After 7 days of incubation, the cultured iPSC was fixed with 10% formaldehyde for 1 minute and washed with 0.1% TBS for 2-3 times to remove the formaldehyde.

Meanwhile, an alkaline phosphatase staining kit (Sigma, USA) was prepared according to the manufacturer's protocol. Specifically, 1 ml of sodium nitrate is added to 1 ml of FRV-alkali solution and gently mixed to prepare a diazonium salt. Two minutes after the preparation of the diazonium salt solution, the diazonium salt solution and 1 ml of the naphthol AS-BI alkali solution were sequentially added to 45 ml of distilled water. The prepared solution was treated with immobilized iPSC, allowed to stand at room temperature (25 ° C) for 15 minutes, washed with tap water, and observed with an optical microscope and a digital camera.

As a result, as shown in FIG. 4B, the iPSC cell line derived from the FOP patient was properly adhered by the MEF-supplementary cell, but the iPSC cell line derived from the FOP patient still was not helped by the MEF- It was confirmed by alkaline phosphatase staining. This indicates that the iPSC cell line derived from the FOP patient prepared by the known method does not recover as a stem cell even in the co-culture with the MEF-culture supporting cell, which is the most ideal undifferentiated condition (Fig.

&Lt; 1-3 > iPSC Total differentiation ability Confirm gene expression

In order to compare the ability of the iPSC cells derived from the FOP patient derived in Example <1-1> to the wild-type iPSC cells, the expression of the differentiable gene was confirmed by semi-quantitative RT-PCR.

Specifically, in order to perform semi-quantitative RT-PCR, each cell line was treated with trizol (Invitrogen, USA) to extract total RNA, and RNAeasy mini kit (quiagen, USA) Lt; RTI ID = 0.0 > RNA < / RTI > Using 2 쨉 g of the purified RNA as a template, cDNA was synthesized according to the manufacturer's protocol using an iScrpit 占 cDNA Synthesis Kit (BioRad, USA) at a temperature of 42 ° C. Then, quantification was performed using the generated PCR product, and 10 ng of cDNA was used for each quantitative PCR in terms of the amount of RNA used in the initial reaction. The PCR conditions used in the quantitative analysis were repeated for 20 to 40 cycles at 95 ° C for 1 minute, 58 ° C for 1 minute, and 72 ° C for 1 minute, and the exponential phase for each gene was determined. The control GAPDH was repeated 21 times and the other gene was repeated 36 times. As a result, 10 μl of the resulting PCR amplicon was loaded on a 2% agarose gel and confirmed by EtBr staining. The primers used for the quantification of each gene are as follows.

gene Sequence (5'3 ') direction SEQ ID NO: OCT4 AAGCTCCTGAAGCAGAAGAGGA Forward One ATGGTCGTTTGGCTGAATACCT Reverse 2 SOX2 TGGACTTCTTTTTGGGGGACTA Forward 3 GCAAAGCTCCTACCGTACCACT Reverse 4 LIN28A AAAGGAAAGAGCATGCAGAAGC Forward 5 AAGTAGGTTGGCTTTCCCTGTG Reverse 6 ESG1 TCGTGGTTTACGGCTCCTATTT Forward 7 TCACTTCATCCAAGGGCCTAGT Reverse 8 GDF3 TGTACTTCGCTTTCTCCCAGAC Forward 9 TTCCCTTTCTTTGATGGCAGAC Reverse 10 DNMT3B TCTCACGGTTCCTGGAGTGTAA Forward 11 GTAGGTTGCCCCAGAAGTATCG Reverse 12 GAPDH CCTCAACGACCACTTTGTCAAG Forward 13 TCTTCCTCTTGTGCTCTTGCTG Reverse 14

As a result, the expression of SOX2 and DNMT3B was lower than that of wild-type iPSC cells as shown in Fig. 4C (Fig. 4C).

&Lt; 1-4 > FOP patient-derived cell lines From iPSC Identify the ability to maintain undifferentiated state during gene transfer

We performed gene correction based on iPSC cells prepared from FOP patient - derived cell lines. Before attempting genetic correction in the iPSC, a gene manipulation tool was introduced using an electroporation method, and its efficiency was checked using a GFP expression vector. In order to introduce a GFP expression vector into an iPSC derived from an FOP patient, a large amount (at least 1 x 10 ⁵ cells) of undifferentiated cells are required. However, as shown in the above results, iPSC derived from an FOP patient maintains undifferentiated state GFP expression vectors were introduced into iPSC cells derived from 1 x 10 < ⁶ > FOP patients.

Specifically, GFP was introduced into iPSC cells derived from FOP patients using electroporation as described in Comparative Example < 1-1 >.

As a result, as shown in FIG. 5E, in the iPSC cell line prepared from the FOP patient-derived cell line, a similar amount of GFP was expressed on day 1 after transfection, but on the 15th day after introduction, the wild type iPSC was expressed in stem cell colonies 48) were more well formed. In addition, wild-type iPSCs showed GFP expression in the formed colonies (12 in total), whereas in the case of iPSC cell lines prepared from FOP patient-derived cell lines, 1 to 2 stem cell colonies were formed (FIGS. 5B to 5D ).

In addition, the cause of FOP is caused by the continuous activation of Alk2, a mutant protein of ACVR1. Although the ALK2 inhibitor LDN-193189 was treated after the GFP expression vector was introduced, it is still difficult to form GFP-expressing stem cell colonies (Fig. 5E). This indicates that it is difficult to introduce a genetic engineering tool for gene therapy into cells based on iPSC prepared from a cell line derived from an FOP patient by a known method.

< Example 3> One-step strategy Ossification Fiber dysplasia ( fibrodysplasia ossificans progressiva , FOP) from patient-derived cell lines iPSC Produce

<3-1> ACVR1 p. R206H Single-guided RNAs targeting mutations (single-guided RNA, sgRNA ) Production

In order to induce iPSC from a cell line derived from an FOP patient, a single-guide RNA targeting mutant residues of the sixth exon of the ACVR1 gene was applied by applying the iPSC production method having the features of the Lyssinan syndrome of Example 1 above Respectively.

Specifically, the sgRNA was constructed by commissioning to Tulgen (Korea) to include a protospacer adjacent motif (PAM) sequence (SEQ ID NO: 15: CACACTCCAACAGTGTAATCTGG) in the sgRNA sequence targeting the therapeutic site for gene therapy of ACVR1 mutation T7E1 assay was performed using the method described in Example <1-3> above.

As a result, it was confirmed that the single-guide RNA prepared by the above method cleaved the target by sgRNA-cas9 endonuclease in HEK293 cells and that the target gene was also cleaved locally in fibroblasts of FOP patients .

&Lt; 3-2 > Single-strand Oligodeoxynucleotide (single-strand oligodeoxynucleotide , ssODN) Production of mold

Single-stranded oligodeoxynucleotide templates were constructed as donor DNA for homology-directed repair (HDR).

Specifically, the donor DNA was ssODN consisting of 90 residues in total and was ordered and manufactured by Integrated DNA technology (IDT). Since the position of the prepared donor DNA is for the purpose of correcting ACVR1 c.617G> A mutation, And a donor DNA sequence with a total of 90 residues on either side centered on the residue expected to be cleaved by RGEN.

As a result, in order to restore the ACVR1 c.617G > A mutation as shown in Fig. 6A, the ssODN produced was largely divided into three parts. First, the c.617 mutated alanine site must be replaced with a wild-type guanine, so it contains a wild-type residue. Second, even if the gene is corrected, if the ACVR1 gene continues to function, Because another mutation may occur in the DNA, the silent mutation is intentionally induced in the Pam sequence so that the corrected donor is not affected by the arsenic. Third, the final corrected clone is subjected to genotyping ), A second mutation was introduced into the same residue, including a second consideration, so that the restriction enzyme Hpy188I could recognize it.

<3-3> sgRNA And ssODN Introduction of FOP patients into fibroblasts

The reprogrammed episome vector prepared in Example <1-1> and the sgRNA and ssODN prepared in Examples <3-1> and <3-2> were added to fibroblasts isolated from FOP patients in the same manner as in Example <1-1>, and then a part of the iPSC in which the gene was corrected was obtained. Then, the genomic DNA was extracted to confirm the target efficiency of the donor DNA, and PCR amplification Was synthesized.

As a result, the restriction enzyme Hpy188I was treated with the PCR amplicon, and as a result, two bands were found to be 191 bp and 101 bp in length from the 292 bp PCR amplicon in the agarose gel, respectively, as shown in FIG. 6B 6b).

As described above, it was confirmed that the target efficiency of the donor DNA was effectively 6.5% because there was Hpy188I-recognized residue in the secret mutation deliberately induced for the convenience of screening through genetic analysis, which is a consideration in preparation of donor DNA. Efficiency was determined by measuring the intensity of the cut band in Image J software.

<3-4> Analysis of Deep Sequencing

Deep sequencing analysis was performed to confirm target efficiency of sgRNA prepared according to <3-3> and ssRNA of ssODN-introduced iPSC.

Specifically, on-target and three off-targets containing an amplicon were PCR amplified using hot-start Taq polymerase and SolgTM h-Taq DNA polymerase (SolGent, Korea). The PCR primers used for the amplification of each amplicon are shown in Table 2 below. The amplicon was manipulated with sequencing through 5'-terminal kination, adapter ligation, and a bar codeed sequence module, Illumina Miseq platform, required for PCR reactions. The paired-end readings obtained by multiple parallel sequencing using the Miseq platform were verified against the wild type for each ampiclone using the BLAST program. We determined that a mutation occurred in the presence of deletions in less than 20 bases from PAM, and confirmed the number using a Perl script.

gene Sequence (5'3 ') direction SEQ ID NO: ACVR1 / ALK2 ATCAGGAAGTGGCTCTGGTCTT Forward 16 TGCATATTACCCACAAAGAAAGGA Reverse 17 FILIP1L TCCAAAAAGAGAAGAAGAAAACG Forward 18 GGTACCGTGCAGGTGTTGAT Reverse 19 RIC8A CTCCCTGCCCACAGAGACT Forward 20 GGACAGGATTCGGACACTCT Reverse 21 BYSL TCTCATCCTGGGCTCACAGT Forward 22 CTTCCCGGAGGGTACAAGTG Reverse 23

As a result, it was confirmed that the deletion region appeared only when ALK2 primer was used, and the indel frequency in mALK2-hDF was about 8% (except 2.1% ssODN-mediated homology-directed target) 6c). In addition, the efficiency of ssODN-mediated HDT was 2.1% (Fig. 6d).

<3-5> Culture of cells

Cells were cultured in order to screen iPSC from the cell lines produced by the method of Example <3-3>.

Specifically, at 3 to 4 weeks after co-transfection, primary iPSC colonies were separated by hand using a tip and transferred to a 96-well plate coated with Matrigel . The cells transferred in the above manner were cultured until the colonies filled 80% of the wells while changing 100 쨉 l of the stem cell medium, mTesR1 (Fig. 6E).

< Example 4 > FOP < / RTI > iPSC Confirm

<4-1> Genotypic analysis genotyping )

In order to analyze the genotype of the iPSC cell line prepared and differentiated according to the method of Example 3, the following experiment was conducted.

Specifically, the genomic DNA was extracted from each of the cells cultured in Example <3-5> using half of each well, and the PCR amplicon was amplified using the extracted DNA as a template. PCR was performed at 95 캜 for 5 minutes; 5 times (95 캜 for 1 min, 62 캜 for 1 min, 72 캜 for 1 min); 5 times (95 캜 for 1 min, 60 캜 for 1 min, 72 캜 for 1 min); Repeat 25 times (95 ° C for 1 min, 58 ° C for 1 min, 72 ° C for 1 min); (5'-TTTCCCCTTGTCTTAAACCAC-3 ') shown in SEQ ID NO: 24 and the primer 5 (SEQ ID NO: 25) described in SEQ ID NO: 25, '-CAAGTTCAGGTGCTCCAACATT-3') to confirm the gene correction by the donor DNA of the obtained PCR amplicons, a total of 88 clones were treated with Hpy188I.

As a result, clones with two bands truncated to 191 bp and 101 bp length, respectively, were identified from a 292 bp PCR amplicon, as shown in Figure 6 (f).

In addition, as shown in FIG. 6G, eight clones among 88 clones that confirmed the genotype had at least one of the alleles inserted into the target and the target frequency was about 9%. Six of the eight HDR clones were replaced by alleles of the donor DNA and one insertional deletion mutation at the other alleles was generated. However, the remaining two of the eight clones containing the donor had wild-type sequences in both alleles # 13 and # 81. Alzene does not affect wild-type alleles, but acts only on mutant alleles, so that donor DNA mediated HDR occurs precisely at mutant allele positions (Fig. 6G).

<4-2> Sequence analysis

Sequence analysis confirmed the presence of gene correction in iPSC cell lines derived from FOP patients.

Specifically, the PCR amplicon was purified and inserted into a vector pTOP TA V2 (engine culture, Korea) in order to identify two alleles of the clones generated in Example <4-1>, and the PCR amplicon was inserted The sequences were analyzed using known primers for M13 present in the pTOP TA V2 vector (Fig. 6g). In order to confirm whether or not the gene confirmed to be corrected in the above Example <4-1>, the PCR amplicon was purified and the primer (5'-AAAAGCAGATTTTCCAAGTTCCA-3 ') shown in SEQ ID NO: 26 was used Sequence analysis was requested.

As a result, as shown in Fig. 8, it was confirmed that the mutant residue in the FOP patient was replaced with the wild-type donor DNA (Fig. 8).

Microscopic observation of the iPSC cell line during its growth revealed that the iPSC derived from the genetically modified FOP patient showed a similar pattern to that of the wild type iPSC, and it was confirmed that the culture was cultured without any restriction.

<4-3> Alkali Phosphatase Confirmation of expression

Alkaline phosphatase staining was performed as described in the comparative example <1-2> in order to confirm the expression of alkaline phosphatase in iPSC derived from genetically-modified FOP patients induced by the method of <Example 3>.

As a result, it was confirmed that the expression of the strong alkaline phosphatase was confirmed in the iPSC derived from the FOP patient whose gene was corrected as shown in FIG. 9A, whereas the expression of the alkaline phosphatase was weak in the iPSC derived from the FOP patient without genetic correction 9a).

<4-4> Multiparameter Marker Confirmation of expression

Expression of OCT4, SOX2, LIN28A, ESG1, GDF3, and DNMT3B genes, which are known as typical multipotentialization markers in iPSC derived from genetically-modified FOP patients induced by the method of Example 3 above, And confirmed by performing semi-quantitative RT-PCR as described above.

As a result, as shown in Fig. 9B, the expression of SOX2 and DNMT3B was decreased in iPSC derived from FOP patients, but strongly expressed in iPSCs derived from FOP patients whose genes were corrected, which was similar to that of wild-type iPSC (Fig. 9B).

<4-5> Karyotype ( karyotype ) analysis

The iPSC derived from the genetically-modified FOP patient derived by the method of Example 3 was subcultured 20 times or more, and 85% of the T-25 tissue culture plate was fully cultured and then analyzed by genetic analysis .

As a result, it was confirmed that the genetically-calibrated FOP patient-derived iPSC had a common karyotype as shown in FIG. 9C (FIG. 9C).

<4-6> Confirmation of gene correction effect of gene-treated stem cells prepared from FOP patient-derived cell lines

FOP is a disease that appears to be ossified by including minerals in the cell, which is the basic unit of muscle or connective tissue. The von Kossa staining method was used to confirm the degree of genetic correcting effect of the gene-treated stem cells prepared from somatic cells derived from FOP patients compared with the untreated stem cells derived from FOP patients.

Specifically, 5 x 10 ⁴ of each stem cell was cultured in a 24-well tissue culture plate coated with matrigel. L-ascorbic acid 2-phosphate sesquimagnesium salt hydrate (Sigma, Sigma, USA), 50 μg / ml L-ascorbic acid 2-phosphate sesquimagnesium salt hydrate (Sigma, , DMEM supplemented with 50 [mu] g / ml [beta] -glycerophosphate disodium salt hydrate (Sigma, USA), and 20% FBS] for 7 or 14 days respectively. The obtained samples were fixed in 10% formaldehyde for 5 minutes, washed with tap water 2 to 3 times, stained with 5% silver nitrate for 30 minutes, and washed again with tap water 2 to 3 times. Then, the mixture was reacted with 5% sodium carbonate and 10% formaldehyde solution for 2 minutes, and then it was confirmed that the reaction was black, and images were taken with a digital camera.

As a result, as shown in FIGS. 10A and 10B, genetically-calibrated stem cells from a FOP patient-derived cell line were similar to those of wild-type iPSC, whereas stem cells prepared from FOP patient- (Fig. 10 (a) and (b)).

In conclusion, the iPSC preparation method of the present invention effectively produced iPSCs from fibroblasts derived from FOP patients, which were difficult to produce, and confirmed that they can be used for FOP treatment. In addition, since it is produced for the purpose of tailor-made pluripotent stem cell patient, application of the above-described technique in the development of a cell therapy agent through gene therapy by a refractory genetic disease can effectively reduce the cost, time, and labor You will be able to perform a universal customized treatment. On the other hand, applying this method, as in the case of Lrshniyan Syndrome for Hprt1 presented above, in studying the loss of function or gain of function of a gene, effectively secures a mutant clone can do.

From the above description, it will be understood by those skilled in the art that the present invention may be embodied in other specific forms without departing from the spirit or essential characteristics thereof. In this regard, it should be understood that the above-described embodiments are to be considered in all respects as illustrative and not restrictive. The scope of the present invention should be construed as being included in the scope of the present invention without departing from the scope of the present invention as defined by the appended claims.

<110> Korea Institute of Oriental Medicine <120> Method for manufacturing gene-corrected induced pluripotent stem cell combining reprogramming and gene-editing <130> KPA151238-KR-P1 <150> KR 10-2014-0179767 <151> 2014-12-12 <160> 31 <170> Kopatentin 1.71 <210> 1 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> OCT4 forward primer <400> 1 aagctcctga agcagaagag ga 22 <210> 2 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> OCT4 reverse primer <400> 2 atggtcgttt ggctgaatac ct 22 <210> 3 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> SOX2 forward primer <400> 3 tggacttctt tttgggggac ta 22 <210> 4 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> SOX2 reverse primer <400> 4 gcaaagctcc taccgtacca ct 22 <210> 5 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> LIN28A forward primer <400> 5 aaaggaaaga gcatgcagaa gc 22 <210> 6 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> LIN28A reverse primer <400> 6 aagtaggttg gctttccctg tg 22 <210> 7 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> ESG1 forward primer <400> 7 tcgtggttta cggctcctat tt 22 <210> 8 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> ESG1 reverse primer <400> 8 tcacttcatc caagggccta gt 22 <210> 9 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> GDF3 forward primer <400> 9 tgtacttcgc tttctcccag ac 22 <210> 10 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> GDF3 reverse primer <400> 10 ttccctttct ttgatggcag ac 22 <210> 11 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> DNMT3B forward primer <400> 11 tctcacggtt cctggagtgt aa 22 <210> 12 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> DNMT3B reverse primer <400> 12 gtaggttgcc ccagaagtat cg 22 <210> 13 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> GAPDH forward primer <400> 13 cctcaacgac cactttgtca ag 22 <210> 14 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> GAPDH reverse primer <400> 14 tcttcctctt gtgctcttgc tg 22 <210> 15 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> protospacer adjacent motif sequence <400> 15 cacactccaa cagtgtaatc tgg 23 <210> 16 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> ACVR1 / ALK2 forward primer <400> 16 atcaggaagt ggctctggtc tt 22 <210> 17 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> ACVR1 / ALK2 reverse primer <400> 17 tgcatattac ccacaaagaa agga 24 <210> 18 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> FILIP1L forward primer <400> 18 tccaaaaaga gaagaagaaa acg 23 <210> 19 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> FILIP1L reverse primer <400> 19 ggtaccgtgc aggtgttgat 20 <210> 20 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> RIC8A forward primer <400> 20 ctccctgccc acagagact 19 <210> 21 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> RIC8A reverse primer <400> 21 ggacaggatt cggacactct 20 <210> 22 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> BYSL forward primer <400> 22 tctcatcctg ggctcacagt 20 <210> 23 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> BYSL reverse primer <400> 23 cttcccggag ggtacaagtg 20 <210> 24 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> ssODN forward primer <400> 24 tttccccttg tcttaaacca c 21 <210> 25 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> ssODN reverse primer <400> 25 caagttcagg tgctccaaca tt 22 <210> 26 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> primer for sequencing <400> 26 aaaagcagat tttccaagtt cca 23 <210> 27 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> ACVR1 sgRNA <400> 27 cacactccaa cagtgtaatc 20 <210> 28 <211> 90 <212> DNA <213> Artificial Sequence <220> <223> ssODN <400> 28 ctggtcttcc ttttctggta caaagaacag tggctcgtca gattacactg ttggagtgtg 60 tcggtaattc ttttttttcc tttctttgtg 90 <210> 29 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> sequence recognized by TALEN <400> 29 ttatgacctt gatttatttt 20 <210> 30 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> sequence recognized by TALEN <400> 30 attatgctga ggatttggaa 20 <210> 31 <211> 1435 <212> PRT <213> Homo sapiens <400> 31 Gly Gly Cys Gly Gly Gly Gly Cys Cys Thr Gly Cys Thr Thr Cys Thr 1 5 10 15 Cys Cys Thr Cys Ala Gly Cys Thr Thr Cys Ala Gly Gly Cys Gly Gly 20 25 30 Cys Thr Gly Cys Gly Ala Cys Gly Ala Gly Cys Cys Cys Thr Cys Ala 35 40 45 Gly Gly Cys Gly Ala Ala Cys Cys Thr Cys Thr Cys Gly Gly Cys Thr 50 55 60 Thr Thys Cys Cys Cys Gys Cys Gys Cys Gly Gly Cys Cys Gly Cys Cys Gly 65 70 75 80 Cys Cys Thr Cys Thr Thr Gly Cys Thr Gly Cys Gly Cys Cys Thr Cys 85 90 95 Cys Gly Cys Cys Thr Cys Cys Thr Cys Cys Thr Cys Thr Gly Cys Thr 100 105 110 Cys Cys Gly Cys Cys Ala Cys Cys Gly Gly Cys Thr Thr Cys Cys Thr 115 120 125 Cys Cys Thr Cys Cys Thr Gly Ala Gly Cys Ala Gly Thr Cys Ala Gly 130 135 140 Cys Cys Cys Gly Cys Gly Cys Gly Cys Cys Gly Gly Cys Cys Gly Gly 145 150 155 160 Cys Thr Cys Cys Gly Thr Thr Ala Thr Gly Gly Cys Gly Ala Cys Cys 165 170 175 Cys Gly Cys Ala Gly Cys Cys Cys Thr Gly Gly Cys Gly Thr Cys Gly 180 185 190 Thr Gly Ala Thr Thr Ala Thr Gly Ala Thr Gly Ala Thr Gly Ala 195 200 205 Ala Cys Cys Ala Gly Aly Cys Cys Thr Thr 210 215 220 Gly Ala Thr Thr Thr Ala Thr Thr Thr Thr Gly Cys Ala Thr Ala Cys 225 230 235 240 Cys Thr Ala Ala Thr Cys Ala Thr Thr Ala Thr Gly Cys Thr Gly Ala 245 250 255 Gly Gly Ala Thr Thr Thr Gly 260 265 270 Thr Thr Ala Thr Thr Cys Cys Thr Cys Ala Thr Gly Gly Ala Cys 275 280 285 Thr Ala Thr Thr Ala Thr Gly Gly Ala Cys Ala Gly Gly Ala Cys 290 295 300 Thr Gly Ala Ala Cys Gly Thr Cys Thr Thr Gly Cys Thr Cys Gly Ala 305 310 315 320 Gly Ala Thr Gly Thr Gly Ala Gly Aly 325 330 335 Thr Gly Gly Gly Aly Gly Gly Cys Ays Thr Cys Aly Cys Ala Thr 340 345 350 Thr Gly Thr Ala Gly Cys Cys Cys Thr Cys Thr Gly Thr Gly Thr Gly 355 360 365 Cys Thr Cys Ala Gly Gly Gly Gly Gly Gly Gly Cys Thr Ala Thr Ala 370 375 380 Ala Ala Thr Thr Cys Thr Thr Thr Gly Cys Thr Gly Ala Cys Cys Thr 385 390 395 400 Gly Cys Thr Gly Gly Ala Thr Thr Ala Cys Ala Thr Cys Ala Ala Ala 405 410 415 Gly Cys Ala Cys Thr Gly Ala Ala Thr Ala Gly Ala Ala Ala Thr Ala 420 425 430 Gly Thr Gly Ala Thr Ala Gly Ala Thr Cys Cys Ala Thr Thr Cys Cys 435 440 445 Thr Ala Thr Gly Ala Cys Thr Thr Thr Ala Gly Ala Thr Thr Thr Thr 450 455 460 Ala Thr Cys Ala Gly Ala Cys Thr Gly Ala Ala Gly Ala Gly Cys Thr 465 470 475 480 Ala Thr Thr Gly Thr Ala Ala Thr Gly Ala Cys Cys Ala Gly Thr Cys 485 490 495 Ala Ala Ays Aly Aly Aly Aly Aly Aly Aly Aly Aly Aly Aly Aly Aly 500 505 510 Gly Thr Ala Ala Thr Thr Gly Gly Thr Gly Aly Gly Aly Thr Gly 515 520 525 Ala Thr Cys Thr Cys Thr Cys Ala Ala Cys Thr Thr Thr Ala Ala Cys 530 535 540 Thr Gly Gly Ala Ala Gly Ala Ala Thr Gly Thr Cys Thr Thr Gly 545 550 555 560 Ala Thr Thr Gly Thr Gly Gly Ala Gly Ala Thr Ala Thr Ala Ala 565 570 575 Thr Thr Gly Ala Cys Ala Cys Thr Gly Gly Cys Ala Ala Ala Cys 580 585 590 Ala Ala Thr Gly Cys Ala Gly Ala Cys Thr Thr Thr Gly Cys Thr Thr 595 600 605 Thr Cys Cys Thr Thr Gly Gly Thr Cys Ala Gly Gly Cys Ala Gly Thr 610 615 620 Ala Thr Ala Ala Thr Cys Cys Ala Ala Ala Gly Ala Thr Gly Gly Thr 625 630 635 640 Cys Ala Ala Gly Gly Thr Cys Gly Cys Ala Ala Gly Cys Thr Thr Gly 645 650 655 Cys Thr Gly Gly Thr Gly Ala Ala Ala Gly Aly Cys Cys Cys 660 665 670 Cys Ala Cys Gly Ala Ala Gly Thr Gly Thr Thr Gly Gly Ala Thr Ala 675 680 685 Thr Ala Ala Gly Cys Cys Ala Gly Ala Cys Thr Thr Thr Gly Thr Thr 690 695 700 Gly Gly Ala Thr Thr Thr Gly Ala Ala Thr Thr Cys Cys Ala Gly 705 710 715 720 Ala Cys Ala Ala Gly Thr Thr Thr Gly Thr Thr Gly Thr Ala Gly Gly 725 730 735 Ala Thr Ala Thr Gly Cys Cys Cys Thr Thr Gly Ala Cys Thr Ala Thr 740 745 750 Ala Ala Thr Gly Ala Ala Thr Ala Cys Thr Thr Cys Ala Gly Gly Gly 755 760 765 Ala Thr Thr Thr Gly Ala Ala Thr Cys Ala Thr Gly Thr Thr Thr Gly 770 775 780 Thr Gly Thr Cys Ala Thr Thr Ala Gly Thr Gly Ala Ala Ala Cys Thr 785 790 795 800 Gly Gly Ala Ala Ala Gly Cys Ala Ala Ala Ala Thr Ala Cys Ala 805 810 815 Ala Gly Aly Gly Aly Gly Aly Gly Aly Gly Aly Gly Aly Gly Aly Gly 820 825 830 Thr Thr Cys Ala Ala Gly Thr Thr Gly Ala Gly Thr Thr Thr Gly Gly 835 840 845 Ala Ala Ala Cys Ala Thr Cys Thr Gly Gly Ala Gly Thr Cys Cys Thr 850 855 860 Ala Thr Thr Gly Ala Cys Ala Thr Cys Gly Cys Cys Ala Gly Thr Ala 865 870 875 880 Ala Ala Ala Thr Thr Ala Thr Cys Ala Ala Thr Gly Thr Thr Cys Thr 885 890 895 Ala Gly Thr Thr Cys Thr Gly Thr Gly Gly Cys Cys Ala Thr Cys Thr 900 905 910 Gly Cys Thr Thr Ala Gly Thr Ala Gly Ala Gly Cys Thr Thr Thr Thr 915 920 925 Thr Gly Cys Ala Thr Gly Thr Ala Thr Cys Thr Thr Cys Thr Ala Ala 930 935 940 Gly Ala Ala Thr Thr Thr Thr Ala Thr Cys Thr Gly Thr Thr Thr Thr 945 950 955 960 Gly Thr Ala Cys Thr Thr Thr Ala Gly Ala Ala Ala Thr Gly Thr Cys 965 970 975 Ala Gly Thr Thr Gly Cys Thr Gly Cys Ala Thr Thr Cys Cys Thr Ala 980 985 990 Ala Ala Cys Thr Gly Thr Thr Thr Thr Thr Thr Thr Gly Cys Ala Cys 995 1000 1005 Thr Ala Thr Gly Ala Gly Cys Cys Thr Ala Thr Ala Gly Ala Cys Thr 1010 1015 1020 Ala Thr Cys Ala Gly Thr Thr Cys Cys Cys Thr Thr Thr Gly Gly Gly 1025 1030 1035 1040 Cys Gly Gly Ala Thr Thr Gly Thr Thr Gly Thr Thr Thr Ala Ala Cys 1045 1050 1055 Thr Thr Gly Thr Ala Ala Ala Thr 1060 1065 1070 Thr Cys Thr Cys Thr Thr Ala Ala Ala Cys Cys Ala Cys Ala Gly Cys 1075 1080 1085 Ala Cys Thr Ala Thr Thr Gly Ala Gly Thr Gly Ala Ala Ala Cys Ala 1090 1095 1100 Thr Thr Gly Ala Ala Cys Thr Cys Ala Thr Ala Thr Cys Thr Gly Thr 1105 1110 1115 1120 Ala Ala Gly Ala Ala Ala Gly Ala Ala Gly Ala Ala Gly 1125 1130 1135 Ala Thr Ala Thr Ala Thr Thr Ala Gly Thr Thr Thr Thr Thr Thr Ala 1140 1145 1150 Ala Thr Thr Gly Gly Thr Ala Thr Thr Thr Thr 1155 1160 1165 Thr Thr Ala Thr Ala Thr Ala Thr Gly Cys 1170 1175 1180 Gly Ala Ala Thr Ala Gly Ala Ala Gly Aly Thr Gly Aly Thr Thr Gly Ala 1185 1190 1195 1200 Ala Thr Ala Thr A Thr Thr A Thr Thr Ala Ala Thr Thr Ala Thr Ala Cys 1205 1210 1215 Cys Ala Cys Cys Gly Thr Gly Thr Gly Thr Thr Ala Gly Ala Ala Ala 1220 1225 1230 Ala Gly Thr Ala Ala Gly Ala Ala Gly Cys Ala Gly Thr Cys Ala Ala 1235 1240 1245 Thr Thr Thr Cys Ala Cys Ala Thr Cys Ala Ala Ala Gly Ala Cys 1250 1255 1260 Ala Gly Cys Ala Thr Cyr Thr Ala Ala Gly Ala Gly Thr Thr Thr 1265 1270 1275 1280 Thr Gly Thr Thr Cys Thr Gly Thr Cys Cys Thr Gly Gly Ala Ala Thr 1285 1290 1295 Thr Ala Thr Thr Thr Thr Ala Gly Thr Ala Gly Thr Thr Thr Thr Thr 1300 1305 1310 Cys Ala Gly Thr Ala Ala Thr Gly Thr Thr Gly Ala Cys Thr Gly Thr 1315 1320 1325 Ala Thr Thr Thr Thr Cys Cys Ala Ala Cys Thr Thr Gly Thr Thr Cys 1330 1335 1340 Ala Ala Ala Thr Thr Ala Thr Thr Ala Cys Ays Aly Gly Thr Gly Ala 1345 1350 1355 1360 Ala Thr Cys Thr Thr Thr Gly Thr Cys Ala Gly Cys Ala Gly Thr Thr 1365 1370 1375 Cys Cys Cys Thr Thr Thr Thr Ala Ala Thr Gly Cys Ala Ala Ala 1380 1385 1390 Thr Cys Ala Ala Thr Ala Ala Ala Thr Thr Cys Cys Cys Ala Ala Ala 1395 1400 1405 Ala Ala Thr Thr Thr Ala Ala Ala Ala 1410 1415 1420 Facebook facebook Ala Ala to contact Ala Ala. 1425 1430 1435

Claims

1) inducing inducible pluripotent stem cells (iPSC) by simultaneously introducing a reprogramming episomal vector and a mutation correcting transporter into an adult somatic cell isolated from an individual; And
2) selecting the iPSC produced in step 1), comprising the steps of:
Wherein the individual of step 1) is a patient with fibrodysplasia ossificans progressiva (FOP) or a fanconi anemia.

delete

2. The method according to claim 1, wherein the somatic somatic cells in step 1) are fibroblasts.

2. The method of claim 1, wherein the reprogramming episomal vector of step 1) comprises at least one selected from the group consisting of Oct4, shp53, Sox2, Klf4, Lin28 and L-myc. &Lt; / RTI >

2. The method of claim 1, wherein the mutagenic transduction carrier of step 1) comprises a single-guided RNA (sgRNA) and a single-strand oligodeoxynucleotide (ssODN) A method for producing genetically calibrated iPSCs.

6. The method of claim 5, wherein the sgRNA comprises SEQ ID NO: 27.

6. The method of claim 5, wherein the sgRNA targets an ACVR1 p.R206H mutation.

6. The method of claim 5, wherein the ssODN comprises SEQ ID NO: 28.

6. The method of claim 5, wherein the ssODN is for restoring the ACVR1 c.617G > A mutation.

1) a reprogramming episomal vector isolated from FOP patients, and either sgRNA consisting of SEQ ID NO: 27 or ssODN consisting of SEQ ID NO: 28 were simultaneously introduced into induced pluripotent stem cells (induced a pluripotent stem cell (iPSC); And
2) selecting the iPSC produced in step 1).

1) preparing inducible pluripotent stem cells (iPSCs) by simultaneously introducing reprogramming episomal vectors and mutagenic inducers into isolated somatic somatic cells; And
2) selecting the iPSCs produced in step 1).

12. The method according to claim 11, wherein the somatic somatic cells in step 1) are fibroblasts.

12. The disease model iPSC according to claim 11, wherein the reprogramming episomal vector of step 1) expresses any one or more selected from the group consisting of Oct4, shp53, Sox2, Klf4, Lin28 and L- Gt;

12. The method according to claim 11, wherein the mutagenesis carrier of step 1) is knocked out of Hypoxanthine-Guanine Phosphoribosyltransferase 1 ( Hprt1 ).

15. The method of claim 14, wherein the Hprt1 comprises SEQ ID NO: 31.

12. The method according to claim 11, wherein the disease is Lesch-Nyhan syndrome.