WO2016168264A1 - Méthodes et compositions pour traiter un cancer avec des cellules dendritiques - Google Patents

Méthodes et compositions pour traiter un cancer avec des cellules dendritiques Download PDF

Info

Publication number
WO2016168264A1
WO2016168264A1 PCT/US2016/027235 US2016027235W WO2016168264A1 WO 2016168264 A1 WO2016168264 A1 WO 2016168264A1 US 2016027235 W US2016027235 W US 2016027235W WO 2016168264 A1 WO2016168264 A1 WO 2016168264A1
Authority
WO
WIPO (PCT)
Prior art keywords
cells
inhibitor
tumor
cancer
antigen
Prior art date
Application number
PCT/US2016/027235
Other languages
English (en)
Inventor
Maurizio Chiriva-Internati
Original Assignee
Kiromic, Llc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Kiromic, Llc filed Critical Kiromic, Llc
Publication of WO2016168264A1 publication Critical patent/WO2016168264A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C12N5/0602—Vertebrate cells
    • C12N5/0634—Cells from the blood or the immune system
    • C12N5/0639—Dendritic cells, e.g. Langherhans cells in the epidermis
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A61K38/18—Growth factors; Growth regulators
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/46—Cellular immunotherapy
    • A61K39/461—Cellular immunotherapy characterised by the cell type used
    • A61K39/4615—Dendritic cells
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/46—Cellular immunotherapy
    • A61K39/462—Cellular immunotherapy characterized by the effect or the function of the cells
    • A61K39/4622—Antigen presenting cells
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/46—Cellular immunotherapy
    • A61K39/464—Cellular immunotherapy characterised by the antigen targeted or presented
    • A61K39/4643—Vertebrate antigens
    • A61K39/4644—Cancer antigens
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/46—Cellular immunotherapy
    • A61K39/464—Cellular immunotherapy characterised by the antigen targeted or presented
    • A61K39/4643—Vertebrate antigens
    • A61K39/4644—Cancer antigens
    • A61K39/464402—Receptors, cell surface antigens or cell surface determinants
    • A61K39/464403—Receptors for growth factors
    • A61K39/464406—Her-2/neu/ErbB2, Her-3/ErbB3 or Her 4/ ErbB4
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/46—Cellular immunotherapy
    • A61K39/464—Cellular immunotherapy characterised by the antigen targeted or presented
    • A61K39/4643—Vertebrate antigens
    • A61K39/4644—Cancer antigens
    • A61K39/464484—Cancer testis antigens, e.g. SSX, BAGE, GAGE or SAGE
    • A61K39/464486—MAGE
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/46—Cellular immunotherapy
    • A61K39/464—Cellular immunotherapy characterised by the antigen targeted or presented
    • A61K39/4643—Vertebrate antigens
    • A61K39/4644—Cancer antigens
    • A61K39/464484—Cancer testis antigens, e.g. SSX, BAGE, GAGE or SAGE
    • A61K39/464488—NY-ESO
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2239/00—Indexing codes associated with cellular immunotherapy of group A61K39/46
    • A61K2239/31—Indexing codes associated with cellular immunotherapy of group A61K39/46 characterized by the route of administration
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2239/00—Indexing codes associated with cellular immunotherapy of group A61K39/46
    • A61K2239/38—Indexing codes associated with cellular immunotherapy of group A61K39/46 characterised by the dose, timing or administration schedule
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2239/00—Indexing codes associated with cellular immunotherapy of group A61K39/46
    • A61K2239/46—Indexing codes associated with cellular immunotherapy of group A61K39/46 characterised by the cancer treated
    • A61K2239/59—Reproductive system, e.g. uterus, ovaries, cervix or testes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2501/00—Active agents used in cell culture processes, e.g. differentation
    • C12N2501/20—Cytokines; Chemokines
    • C12N2501/22—Colony stimulating factors (G-CSF, GM-CSF)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2501/00—Active agents used in cell culture processes, e.g. differentation
    • C12N2501/20—Cytokines; Chemokines
    • C12N2501/23—Interleukins [IL]
    • C12N2501/2304—Interleukin-4 (IL-4)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2501/00—Active agents used in cell culture processes, e.g. differentation
    • C12N2501/999—Small molecules not provided for elsewhere
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2510/00—Genetically modified cells

Definitions

  • the present invention relates to methods and compositions for the treatment and/or prevention of cancer.
  • the present invention relates to immunotherapy using antigen-presenting cells loaded with tumor associated antigens.
  • Ovarian cancer has been referred to as a "silent killer", since the lack of specific symptoms prevents detecting the disease in early, ovary-confined stage with favorable prognosis. Yu et al, Protective CD8+ T-cell responses to cytomegalovirus driven by rAAV/GFP/IEl loading of dendritic cells. J Transl Med 6, 56 (2008). Therefore, ovarian cancer remains a lethal disease. Chiriva-Internati et al, Sperm protein 17 (Spl7) in multiple myeloma: opportunity for myeloma-specific donor T cell infusion to enhance graft-versus-myeloma effect without increasing graft-versus-host disease risk.
  • Spl7 Sperm protein 17
  • Cellular immunotherapy based on adoptive T-cell or dendritic cell (DC) transfer, has the potential to provide long-term protection and prevent metastatic dissemination of the tumor.
  • Carpenito et al Control of large, established tumor xenografts with genetically retargeted human T cells containing CD28 and CD137 domains. Proc Natl Acad Sci U S A 106, 3360-3365 (2009).
  • Santin et al In vitro induction of tumor-specific human lymphocyte antigen class I- restricted CD8 cytotoxic T lymphocytes by ovarian tumor antigen-pulsed autologous dendritic cells from patients with advanced ovarian cancer. Am J Obstet Gynecol 183, 601-609 (2000).
  • TIL tumor-infiltrating lymphocytes
  • T-cell priming aims to induce tumor-specific helper and cytotoxic T-cells capable of efficiently targeting and eradicating ovarian cancer. This has been attempted by in vitro expansion of TIL, and engineered T-cells. Fujita et a/., Prolonged disease-free period in patients with advanced epithelial ovarian cancer after adoptive transfer of tumor-infiltrating lymphocytes. Clin Cancer Res 1, 501-507 (1995). Nonetheless, the most efficient physiological process for T-cell priming requires dendritic cell (DC) activation and antigen presentation.
  • DC dendritic cell
  • T-cells tumor-infiltrating regulatory T-cells
  • Curiel et a/. Specific recruitment of regulatory T cells in ovarian carcinoma fosters immune privilege and predicts reduced survival. Nat Med 10, 942-949 (2004).
  • DCs Dendritic cells
  • APCs antigen-presenting cells
  • DCs undergo maturation and activation in the presence of specific immunogenic antigens and serve as a critical link between innate and adaptive immunity resulting in antitumor responses [3].
  • DC vaccination studies have been conducted in several different neoplasms [4,5] with variable results [52].
  • SM metastatic or progressive solid malignancies
  • DCs can be generated from blood-derived monocytes in the presence of GM-CSF and IL- 4 and administered to cancer patients [14,15]. Moreover, DCs pulsed with specific tumor associated peptide antigens (TAP As) are capable of eliciting immune and antitumor responses, without prohibitive toxicity [8-13,16].
  • TEP As tumor associated peptide antigens
  • CTA Cancer/testis antigens
  • SP17 sperm protein 17
  • SP17 sperm protein 17
  • the suitability of SP 17 as a target for immunotherapy is supported by the finding that it is expressed by primary and metastatic ovarian cancer lesions in up to 70% of patients. Nakazato et al, Sperm protein 17 influences the tissue-specific malignancy of clear cell adenocarcinoma in human epithelial ovarian cancer. Int J Gynecol Cancer 17, 426-432 (2007).
  • rAAV recombinant adeno-associated virus vectors
  • the MAPK signaling pathway is a main component in several steps of tumorigenesis including cancer cell proliferation, migration, invasion and survival. Overall, the activation of a MAPK employs a core three-kinase cascade.
  • the extracellular mitogen binds to the membrane receptor (e.g., receptor tyrosine kinases, cytokine receptors, and some G protein-coupled receptors), which allows Ras (a GTPase) to swap its GDP for a GTP.
  • the membrane receptor e.g., receptor tyrosine kinases, cytokine receptors, and some G protein-coupled receptors
  • MAPKs can phosphorylate and activate a variety of intracellular targets including transcription factors, nuclear pore proteins, membrane transporters, cytoskeletal elements, and other protein kinases. Seger et al., FASEB J., 1995, 9: 726-735; Lewis et al., Adv. Cancer Res., 1998, 74: 49-139; and Pearson et al., Endocr. Rev., 2001, 22: 153-183. Hodis et al., 2012.
  • phosphorylation may favor a switch from Treg induction to Thl7 differentiation. This could be of importance for DC vaccination against OC since Treg expansion and infiltration is known to correlate with increased morbidity and mortality, whereas Thl7 infiltration is strongly associated with prolonged patient survival.
  • Jarnicki et al Attenuating regulatory T cell induction by TLR agonists through inhibition of p38 MAPK signaling in dendritic cells enhances their efficacy as vaccine adjuvants and cancer immunotherapeutics.
  • J Immunol 183, 1715-1723 (2009).
  • Kryczek et al Phenotype, distribution, generation, and functional and clinical relevance of Thl7 cells in the human tumor environments. Blood 114, 1141-1149 (2009).
  • the present application provides for a method of treating and/or preventing cancer in a subject.
  • the method may comprise the following steps: (a) introducing at least one tumor- associated antigen (or a fragment thereof) into antigen-presenting cells; (b) treating the antigen- presenting cells with at least one inhibitor of the mitogen-activated protein kinase (MAPK) signaling pathway; and (c) administering the antigen-presenting cells to the subject.
  • Step (a) may be conducted before, after, simultaneously with or overlapping with step (b).
  • a pharmaceutical composition comprising dendritic cells comprising at least one tumor-associated antigen or a fragment thereof, wherein the dendritic cells are treated with at least one MAPK signaling pathway inhibitor.
  • the present application provides for a pharmaceutical composition comprising dendritic cells comprising nucleic acids encoding at least one tumor-associated antigen, wherein the dendritic cells are treated with at least one MAPK signaling pathway inhibitor.
  • the tumor-associated antigen may be SP17, Ropporin, AKAP-4, PTTG1, Span-xb, Her- 2/neu, HM1.24, NY-ESO-1, MAGE-1 or combinations thereof.
  • SP17 comprises the amino acid sequence of SEQ ID NO:6.
  • tumor-associated antigen or a fragment thereof into antigen- presenting cells (e.g., in step (a) of the present method, or when preparing the present
  • the antigen-presenting cells may be infected with viral vectors (e.g., adeno- associated viral vectors) encoding the tumor-associated antigen.
  • viral vectors e.g., adeno- associated viral vectors
  • the MAPK signaling pathway inhibitor may be an inhibitor of RAF, an inhibitor of MEK, an inhibitor of ERK, an inhibitor of RAS, an inhibitor of receptor tyrosine kinases (RTKs), or combinations thereof.
  • the MAPK signaling pathway inhibitor is an inhibitor of p38.
  • the inhibitor may be a small molecule, a polynucleotide (e.g., a small interfering RNA (siRNA) or an antisense molecule), a polypeptide, or an antibody or antigen- binding portion thereof.
  • the MAPK signaling pathway inhibitors include ML3403, PLX4720, PD325901, GW5074, BAY 43-9006, ISIS 5132, PD98059,
  • the immunosuppressive agent Prior to administration of the antigen presenting cells to the subject (e.g., before step (c) the method) or administration of the present composition, at least one immunosuppressive agent may be administered to the subject.
  • the immunosuppressive agent may be an alkylating agent.
  • the alkylating agent is cyclophosphamide.
  • granulocyte-macrophage colony- stimulating factor may be administered to the subject.
  • the antigen-presenting cells may be dendritic cells, macrophages, B cells, etc.
  • the dendritic cells may be derived from autologous monocytes.
  • the monocytes can be cultured in vitro to induce differentiation into dendritic cells.
  • the differentiation into dendritic cells is facilitated by at least one maturation factor, including, but not limited to, granulocyte-macrophage colony-stimulating factor (GM-CSF), IL-4, IL- ⁇ , T Fa, IFN-a, poly (I:C) and combinations thereof.
  • the monocytes may be isolated from the subject's blood. Before the subject's blood is obtained, granulocyte-macrophage colony- stimulating factor (GM-CSF) may be administered to the subject.
  • GM-CSF granulocyte-macrophage colony- stimulating factor
  • the cancer may be solid malignancy or hematologic malignancy.
  • the subject has ovarian cancer, melanoma, breast cancer, colon cancer, pancreatic cancer, cervical cancer, thyroid cancer, bladder cancer or combinations thereof. In one embodiment, the subject has ovarian cancer.
  • FIG. 1 AAV-mSP17 vector map.
  • B mSpl7 expression in DCs
  • c Virus stock titers.
  • DNA extracted from the crude lysates of AAV-mSP17 was used as the template for PCR. The DNA from 1000 ⁇ , 500 ⁇ and 250 ⁇ crude lysates was tested, respectively.
  • EG encapsulated genomes.
  • FIG. 1 Characterization of DC.
  • Figure 3 (A,B ? C). Survival rates and tumor dissemination in mice that received different DC vaccination protocols, a) Survival rates are presented as the percentage of live mice in each group per day. Experimental end-point was day 300. Statistically significant survival curves using a Log-rank (Mantel-Cox) Test (p ⁇ 0.0001) are shown, b) Influence of DC vaccination on tumor growth. Upper panel: macroscopic impact of AAV-mSP17+p38i DC vaccination on primary tumor mass and lymph node metastases.
  • Figure 4 (A,B,C,D). Measurement of IgG and cytokines production following vaccinations, a) DC vaccine-induced production of anti-mSP17 IgGi. Humoral responses against mSP17 were evaluated through ELISA performed using pooled sera from each vaccination group (5 mice per group), b) ELISA assay for cytokine production. Sera from vaccinated mice and controls (5 mice per group) were collected post-mortem and analyzed by ELISA assay. IFN- ⁇ and TNF-a were highly expressed; bars, SD calculated in triplicates, c) ELISPOT assay for IFN- ⁇ . d) ELISPOT assay for TNF-a.
  • Splenocytes from vaccinated mice and controls (5 animals/group) were collected post-mortem and analyzed by ELISA assay. Data are presented as the frequency of IFN- ⁇ and TNF-a spot-forming cells per 10 6 splenocytes. Spot numbers represent the mean of ten mice for each vaccination; bars, SD calculated in triplicates. Two-tailed t-test p value versus no treatment group ⁇ 0.05 (*) or ⁇ 0.01 (**).
  • FIG. 6 Flow cytometry estimation of splenic Thl7 and Treg frequencies following DC vaccination.
  • Splenocytes were harvested and duplicate samples from 5 mice per group were analyzed by flow cytometry (1. No tumor, 2. ID8 only, 3. rAAV only, 4. rAAV-mSpl7, 5. rAAV-mSpl7+p38i).
  • Time points were selected according to the survival times shown in Figure 3a (no tumor: day 0; no vaccination, day 45; rAAV DC vaccination, day 45; rAAV-mSP17 DC vaccination, day 80; rAAV-mSP17 DC + p38 MAPK inhibition, day 300).
  • CD4 + Thl7 and Treg frequencies were based on intracellular staining for IL-17 expression and Foxp3 expression, respectively, without any further manipulation in vitro.
  • Plots display the percentage of positive events for splenocytes from individual mice treated with the indicated DC vaccine formulations.
  • Figure 7 Representative flow-cytometry analysis of human monocyte-derived DC. Histograms from one representative subject are shown. The cut-off was set at the maximum fluorescent intensity level given by the corresponding isotypic control.
  • FIG. 8 Mean Fluorescence Intensity (MFI) analysis.
  • MFI Mean Fluorescence Intensity
  • This invention provides methods and compositions for the treatment and/or prevention of cancer, including ovarian cancer.
  • the present invention relates to immunotherapy using antigen-presenting cells (e.g., dendritic cells) loaded with tumor associated antigens whereas the antigen-presenting cells are also treated with at least one inhibitor of the mitogen- activated protein kinase (MAPK) signaling pathway.
  • antigen-presenting cells e.g., dendritic cells
  • MAPK mitogen- activated protein kinase
  • Encompassed by the present invention is a method of treating and/or preventing cancer in a subject.
  • the method may contain the following steps: (a) introducing at least one tumor- associated antigen (or a fragment thereof) into antigen-presenting cells (or, loading antigen- presenting cells with at least one tumor-associated antigen or a fragment thereof); (b) treating the antigen-presenting cells with at least one inhibitor of the mitogen-activated protein kinase (MAPK) signaling pathway; and (c) administering the antigen-presenting cells to the subject.
  • the step of introducing at least one tumor-associated antigen (or a fragment thereof) into antigen-presenting cells may be conducted before, after, simultaneously with, or overlapping, the step of treating the antigen-presenting cells with at least one inhibitor of the MAPK signaling pathway.
  • Any component of the MAPK pathway may be inhibited by the present inhibitors. They include an inhibitor of RAF, an inhibitor of MEK, an inhibitor of MAPK (e.g., ERK), an inhibitor of RAS, an inhibitor of a receptor tyrosine kinase (RTK), or combinations thereof.
  • an inhibitor of RAF an inhibitor of MEK
  • an inhibitor of MAPK e.g., ERK
  • RAS an inhibitor of a receptor tyrosine kinase (RTK)
  • RTK receptor tyrosine kinase
  • the present invention provides for a pharmaceutical composition
  • a pharmaceutical composition comprising dendritic cells loaded with at least one tumor-associated antigen (or a fragment thereof), wherein the dendritic cells are also treated with at least one MAPK signaling pathway inhibitor.
  • tumor antigens include cancer-testis (CT) antigens, epidermal growth factor receptor (EGFR, such as Her-2/neu), Ropporin, PTTG1, Span-xb, HM1.24, mucins (e.g., mucin 16 or MUC16, also known as CA125), human epididymis protein 4 (HE4), Beta human chorionic gonadotropin (beta-hCG), urinary gonadotropin fragment, Alpha-fetoprotein (AFP), Inhibin, estradiol, carcinoembryonic antigen (CEA), squamous cell carcinoma (SCC) antigen, Miillerian inhibiting substance (MIS), topoisomerase II, Carbohydrate antigen 19-9, Cancer antigen 27-29, human telomerase reverse transcriptase (hTERT), ferritin, lysophosphatidic acid, MIBl
  • CT cancer-testis
  • EGFR epidermal growth factor receptor
  • Ropporin PTTG1, Span-
  • CT antigens are proteins expressed in normal gametogenic tissues and in different types of tumors (Scanlan et al., 2002, Immunol Rev. 188:22-32. Scanlan et al., 2004, Cancer Immun. 4: 1. Zendman et al., 2003, J Cell Physiol. 194(3):272-88. Simpson et al., 2005, Nat Rev Cancer. 5(8):615-25. Bodey, 2002, Expert Opin Biol Ther. 2(6):577-84).
  • CT antigens are expressed exclusively in cells of the germ cell lineage, although there is a marked variation in the protein expression pattern during different stages of sperm development.
  • CT antigens include SP17, ASP, NY-ESO (e.g., NY-ESO-1, etc.) CABYR, TSP50, BORIS, RQCD1, BAGE, SSX, SCP-1, Piwil2, OY-TES-1, LAGE-1, AKAP (e.g., AKAP-4 etc.), SCP-l/HOM-TES-14, MAGE (e.g., MAGE-1, MAGE-A, MAGE-B, MAGE-C, etc.), GAGE (GAGE-A, GAGE-B, etc.), PAGE, XAGE, CAGE, HOM-TES-85, SAGE, BAGE, CT9/3BRDT, HAGE, SPOl l, and SPAG9.
  • NY-ESO e.g., NY-ESO-1, etc.
  • CABYR CABYR
  • TSP50 BORIS
  • RQCD1 RQCD1
  • BAGE SSX
  • SCP-1 Piwil2
  • the present method comprises the step of introducing at least one tumor-associated antigen, e.g., selected from Spl7, Ropporin, AKAP-4, PTTG1, Span-xb, Her- 2/neu, HM1.24, NY-ESO-1, MAGE-1 and combinations thereof, into an APC.
  • a fragment of the tumor-associated antigen may be introduced into an APC.
  • the APC is also treated with at least one inhibitor of the MAPK signaling pathway.
  • SP17 is a highly immunogenic spermatozoan protein which has been considered a potential therapeutic target for immunocontraception in the last few years [25].
  • CTA cancer-testis antigen
  • SP17 is expressed in human lung cancer cell lines and tumor tissues, but not in normal lung [29]. More importantly, we have shown SP17-loaded DCs activate CTLs capable of eliciting antitumor responses, in vitro [29]. Dadabayev et al have reported the safety and clinical response of SP17-pulsed DCs in patients with MM and ovarian cancer, validating the clinical potential of this protein as an immunotherapeutic target [30].
  • Amino acid sequences of human SP17 may be found under the following NCBI Reference Sequence (RefSeq) accession number: NP 059121 (SEQ ID NO:6). Nucleic acid sequences encoding human SP17 may be found under the following NCBI RefSeq accession number: NM O 17425, or GenBank accession number BC032457.
  • A-kinase anchoring protein 4 (AKAP-4) is a member of a family of scaffolding proteins involved in the control of signal transduction by targeting cyclic adenosine monophosphate- dependent protein kinase- A, and directing its actions [31, 32].
  • AKAP-4 is expressed in lung cancer and MM (multiple myeloma) cells, at both the transcriptional and the protein level, with no evidence of expression in human normal tissues, other than the testis [29, 33].
  • AKAP-4 serves as a marker of disease status in a murine model of MM [34].
  • AKAP-4 is a potential target for developing specific immunotherapeutic strategies against MM, lung cancer and other SM [29, 35].
  • Ropporin is a rhophilin-associated protein normally expressed in the inner fibrous sheath of sperm flagella. Ropporin has previously been found to interact with other fibrous sheath proteins, including Spl7 and AKAP-110, suggesting a common or related biological function.
  • a study by Li et al has demonstrated a very restricted RNA expression of ropporin in normal tissues, with the exception of testicular and fetal liver tissue [36].
  • Ropporin expression was also detected in tumor cells derived from the bone marrow in 6 of 16 (37.5%) patients with MM, 6 of 14 (43%)) cases of CLL and 2 of 11 (18%>) cases of acute myeloid leukemia. No ropporin transcripts were detected in the peripheral blood mononuclear cells of 17 healthy donors.
  • PTTG-1 is a novel oncogene involved in transcriptional and cell cycle regulation with expression in the normal testis and thymus [37].
  • PTTG-1 has been shown to be highly expressed in different hematologic malignancies (HM) including promyelocytic leukemia (PML) cell line HL-60, CML cell line K-562, ALL cell line MOLT-4 and Burkitt's lymphoma cell line Raji [38].
  • HM hematologic malignancies
  • PML promyelocytic leukemia
  • CML cell line K-562 CML cell line K-562
  • ALL cell line MOLT-4 ALL cell line MOLT-4
  • Burkitt's lymphoma cell line Raji [38].
  • PTTG-1 has also been shown to be associated with tumorigenesis, angiogenesis and cancer progression, making it a logical therapeutic target [37].
  • PTTG-1 is expressed at the transcriptional level in MM, with PTTG-1 being expressed in 63%> of MM patients and 66%> of human MM cell lines studied, but not in normal tissues [39].
  • PTTG-1 expression in lung cancer tissues and cell lines More recently, we have also demonstrated PTTG-1 expression in lung cancer tissues and cell lines, and showed PTTG-l-loaded DCs can activate CTL-mediated lysis of human lung cancer cells, m vitro [29]. Therefore, our data indicates the suitability of using PTTG-1 as a potential target for
  • Span-xb is a novel CTA expressed in CML and other HM.
  • RT-PCR we have detected Span-xb transcripts in 20% of MM patients, 33% of patients with CLL, 29% of CML patients and 50% of patients with AML.
  • Span-xb expression was not detected in peripheral blood or bone marrow samples from healthy donors [40].
  • span-xb gene expression has also been found in a variety of SM, including melanoma and carcinomas of the lung, colon and breast, making it a target for immunotherapeutic interventions [41].
  • HER-2/neu is a trans-membrane tyrosine-kinase involved in aberrant signal transduction in a variety of neoplasms [42,43].
  • HER-2/neu amplification has been demonstrated in certain HM and its functional inhibition, using anti-sense oligonucleotides, results in a reduced tumor cell proliferative rate.
  • Her- 2/neu peptides may serve as good candidates for immunotherapy in HER-2-expressing SM.
  • HM1.24 is a 29-33 kDa membrane glycoprotein expressed in mature B-cells.
  • HMl .24 as a new antigen for CTLs activation against MM [45].
  • HMl .24 expression has been found in all five human MM cell lines assayed, as well as in mature, Ig-secreting B- cells (plasma cells and lymphoplasmacytoid cells), but not in non-B-Cells in the peripheral blood, bone marrow, liver, spleen, kidney, or heart of normal individuals or patients with non- plasma-cell-related malignancies.
  • HMl .24 protein represents a specific marker of late- stage B-cell maturation and may potentially serve as a target antigen for the development of immunotherapeutic strategies specific against MM.
  • HMl .24 is also expressed in SM including brain tumors, renal, hepatocellular, breast, ovarian, and breast carcinomas, with some expression in a few normal organs including liver and kidney [46].
  • HMl .24 function is unknown at this time, its promise as a therapeutic target has been demonstrated using a specific HM1.24 monoclonal antibody (MoAb)[47].
  • NY-ESO-1 is one of the most immunogenic tumor antigens known to date. Spontaneous humoral and cellular immune responses against NY-ESO-1 are detected in a substantial proportion of patients with NY-ESO-1 expressing malignancies and NY-ESO-1 antibody titers correlate with clinical development of disease [48]. Moreover, the development of NY-ESO-1 serum antibody is associated with detectable NY-ESO-1 -specific CD8+ T cell reactivity, suggesting this antigen is an excellent immunogen and potential therapeutic target, in vivo [49].
  • MAGE-1 is expressed in HM, including human MM cell lines and malignant plasma cells, as well as melanomas [50,51]. Both RNA and protein expression has been demonstrated in MM cells, but not in polyclonal, reactive plasma cells. Moreover, anti-MAGE-1 HLA-A1 cytotoxic T lymphocytes can efficiently kill MAGE-1 HLA-A1 expressing MM and melanoma cells, suggesting MAGE-1 represents a specific and potential immunotherapeutic target for patients with these malignancies.
  • Any component of the MAPK signaling pathway may be inhibited by the present inhibitors. They include an inhibitor of RAF, an inhibitor of MEK, an inhibitor of MAPK (ERK), an inhibitor of RAS, an inhibitor of a receptor tyrosine kinase (RTK), or combinations thereof.
  • inhibitors include an inhibitor of RAF, an inhibitor of MEK, an inhibitor of MAPK (ERK), an inhibitor of RAS, an inhibitor of a receptor tyrosine kinase (RTK), or combinations thereof.
  • Used in the present methods may be any MAPK signaling pathway inhibitor disclosed herein or any combination thereof.
  • Any isoform of any component the MAPK pathway may be inhibited by the present inhibitors. They include, but are not limited to: an inhibitor of BRAF, CRAF or ARAF; an inhibitor of MEK1, MEK2, MKK3, MKK4, MKK5, MKK6, or MKK7; an inhibitor of ERK 1, ERK2, p38, INK or ERK5; an inhibitor of HRAS, KRAS or NRAS; an inhibitor of epidermal growth factor receptor (EGFR), ErbB-2, ErbB-3, ErbB-4, Trk A/B, Fibroblast growth factor receptor (FGFR) or PDGFR.
  • an inhibitor of BRAF, CRAF or ARAF an inhibitor of MEK1, MEK2, MKK3, MKK4, MKK5, MKK6, or MKK7
  • an inhibitor of ERK 1, ERK2, p38, INK or ERK5 an inhibitor of HRAS, KRAS or NRAS
  • the present inhibitors may target the wild-type or mutant component of the MAPK pathway.
  • the inhibitors may target, inhibit or decrease activity of wild-type BRAF or a mutant BRAF (e.g., BRAF(V600); BRAF(G466); BRAF(G464); BRAF(G469); BRAF(D594); BRAF(G596); BRAF(K601); BRAF(V600), etc.), wild-type MEK or a mutant MEK (e.g., MEK1/2(Q60), MEK1/2(P124), etc.), and wild-type RAS or a mutant RAS (e.g., N/K/H-RAS(Q61), N/K/H-RAS(G12), N/K/H-RAS(G13), etc.).
  • inhibitor refers to agents capable of down-regulating or otherwise decreasing or suppressing the amount and/or activity of any component of the MAPK signaling pathway, including, but not limited to, the extracellular signal regulated mitogen- activated protein kinase (ERK-MAPK) signaling pathway.
  • ERK-MAPK extracellular signal regulated mitogen- activated protein kinase
  • the mechanism of inhibition may be at the genetic level (e.g., interference with or inhibit expression, transcription or translation, etc.) or at the protein level (e.g., binding, competition, etc.).
  • the inhibitors may reduce MAPK signaling, reduce phosphorylation of components of the MAPK signaling pathways (e.g., MEK 1/2, ERKl/2), reduce levels of activated components of the MAPK signaling pathways (e.g., including but not limited to members of the
  • Ras/Raf/MEK/ERK pathways Ras/Raf/MEK/ERK pathways
  • sequester components of the MAPK signaling pathways and prevent signaling.
  • an inhibitor may be utilized that interferes with or inhibits expression of ERKl and/or ERK2, or sequesters ERK 1 and/or ERK2 in the cytoplasm of the cell, preventing nuclear translocation and signaling (Brunet A. et al., EMBO J, 1999, 18: 664- 674).
  • inhibitors may be employed, guided by art-recognized criteria such as efficacy, toxicity, stability, specificity, half-life, etc.
  • small molecules encompasses molecules other than proteins or nucleic acids without strict regard to size.
  • Non-limiting examples of small molecules that may be used according to the methods and compositions of the present invention include, small organic molecules, peptide-like molecules, peptidomimetics, carbohydrates, lipids or other organic (carbon containing) or inorganic molecules.
  • Non-limiting examples of MEK inhibitors include: PD325901, AZD6244 (Selumetinib; 6-(4-bromo-2-chloroanilino)-7-fluoro-N-(2 -hydroxy ethoxy)-3-methylbenzimidazole-5- carboxamide), R04987655, R05126766, TAK-733, MSC1936369B (AS703026), GSKl 120212, BAY86-9766, GDC-0973, GDC-0623, ARRY-438162, 011040, E6201, ARRY300; PD98059, PD184352, U0126 (Dudley D. T. et al., Proc. Natl. Acad.
  • NAMI-A Imidazolium trans- imidazoledimethyl sulfoxide-tetrachlororuthenate
  • Non-limiting examples of RAF inhibitors include: PLX4720; PLX4032 (Vemurafenib; N-(3- ⁇ [5-(4-chlorophenyl)-lH-pyrrolo[2,3-b]pyridin-3-yl]carbonyl ⁇ -2,4- difluorophenyl)propane-l -sulfonamide); R7204; GSK2118436; Sorafenib (BAY-43-9006);
  • BMS-908662 (XL-281); RAF265 (Smalley and Flaherty (2009) Future Oncology, Volume 5, Number 6, pp. 775-778); RG-7256 (RO5212054, PLX3603); R05126766; ARQ-736; E-3810; DCC-2036; 4-(4- ⁇ 3-[4-chloro-3-(trifluoromethyl)phenyl]ureido ⁇ phenoxy)-N2-methylpyri-dine- 2-carboxamide 4-methylbenzenesulfonate (sorafenib); GW5074; BAY 43-9006; and ISIS 5132 (Lackey, K. et al., Bioorg. Med. Chem.
  • Non-limiting examples of ERK inhibitors include: GW5074, BAY 43-9006, ISIS 5132, PD98059, PD184352, U0126, Ro 09-2210, L-783,277, purvalanol (Knockaert M. et al.,
  • Non-limiting examples of p38 inhibitors include, RWJ 67657, SCIO 469, EO 1428, Org 48762-0, SD 169, SB 203580, SB 202190, SB 239063, SB 220025, VX-745, SB 242235, VX- 702, SD-282, PH-797804, L- 167307, RPR200765A, pamapimod, BIRB 796, BMS 582949, PD 169316, PD 98059 (2'-Amino-3'-methoxyflavone, MEK Inhibitor V), U0126, SC-68376 (2- Methyl-4-phenyl-5-(4-pyridyl)oxazole), p38 MAP Kinase inhibitor (2-(4-Chlorophenyl)-4-(4- fluorophenyl)-5-pyridin-4-yl-l,2-dihydropyrazol-3-one), p38 MAP Kinase inhibitor III
  • Non-limiting examples of receptor tyrosine kinases include inhibitors to ErbB: HER1/EGFR (Erlotinib, Gefitinib, Lapatinib, Vandetanib, Sunitinib, Neratinib); HER2/neu (Lapatinib, Neratinib); RTK class III: C-kit (Axitinib, Sunitinib, Sorafenib), FLT3 (Lestaurtinib), PDGFR (Axitinib, Sunitinib, Sorafenib); and VEGFR (Vandetanib, Semaxanib, Cediranib, Axitinib, Sorafenib); bcr-abl (Imatinib, Nilotinib, Dasatinib); Src (Bosutinib) and Janus kinase 2 (Lestaurtinib).
  • RTK class III C-kit (Ax
  • the inhibitors also include lapatinib (Tykerb®); Zactima (ZD6474), Iressa (gefitinib), imatinib mesylate (STI571; Gleevec), erlotinib (OSI-1774; Tarceva), canertinib (CI 1033), semaxinib (SU5416), vatalanib (PTK787/ZK222584), sorafenib (BAY 43- 9006), sutent (SUI 1248) and lefltmomide (SU101).
  • lapatinib Tykerb®
  • Zactima ZD6474
  • Iressa gefitinib
  • imatinib mesylate STI571; Gleevec
  • erlotinib OSI-1774; Tarceva
  • canertinib CI 1033
  • semaxinib SU5416
  • vatalanib PTK787/ZK22258
  • PTK/ZK is a tyrosine kinase inhibitor with broad specificity that targets all VEGF receptors (VEGFR), the platelet-derived growth factor (PDGF) receptor, c-KIT and c-Fms. Drevs (2003) Idrugs 6(8):787-794.
  • the chemical names of PTK/ZK are l-[4-Chloroanilino]-4-[4-pyridylmethyl] phthalazine Succinate or 1-Phthalazinamine, N-(4- chlorophenyl)-4-(4-pyridinylmethyl)-butanedioate (1 : 1).
  • PTK/TK Synonyms and analogs of PTK/TK are known as Vatalanib, CGP79787D, PTK787/ZK 222584, CGP-79787, DE-00268, PTK-787, PTK787A, VEGFR-TK inhibitor, ZK 222584 and ZK.
  • the MAP kinase signaling pathway inhibitor may be ERK Inhibitor II, FR180204; INK Inhibitor II; INK Inhibitor IX; MEK1/2 Inhibitor; MNK1 Inhibitor; MK2a Inhibitor; p38 MAP Kinase Inhibitor V; PD 98059; Raf Kinase Inhibitor IV; SB 203580; Tpl2 Kinase Inhibitor, ZM 336372, or combinations thereof.
  • Inhibitors of the MAPK signaling pathway are also disclosed in U.S. Patent Nos.
  • the MAPK pathway inhibitor used in the methods and compositions of the invention is a polynucleotide that reduces expression of one or more components of the MAPK pathway.
  • the method involves administering an effective amount of a polynucleotide that specifically targets nucleotide sequence(s) within a target gene(s) of the MAPK pathways.
  • the polynucleotides reduce expression of one or more genes within the MAPK pathways, to yield reduced levels of the gene product (the translated polypeptide).
  • the nucleic acid target of the polynucleotides may be any location within the gene or transcript of any component of the MAPK signaling pathway.
  • SiRNAs small interfering RNAs
  • shRNA small-hairpin RNA
  • SiRNAs may have 16-30 nucleotides, e.g., 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides.
  • the siRNAs may have fewer than 16 or more than 30 nucleotides.
  • the polynucleotides of the invention include both unmodified siRNAs and modified siRNAs such as siRNA derivatives etc.
  • SiRNAs can be delivered into cells in vitro or in vivo by methods known in the art, including cationic liposome transfection and electroporation.
  • SiRNAs and shRNA molecules can be delivered to cells using viruses or DNA vectors.
  • the polynucleotide of the invention is an antisense nucleic acid sequence that is complementary to a target region within the mRNA of any component of the MAPK signaling pathway.
  • the antisense polynucleotide may bind to the target region and inhibit translation.
  • the antisense oligonucleotide may be DNA or RNA, or comprise synthetic analogs of ribo-deoxynucleotides. Thus, the antisense oligonucleotide inhibits expression of any component of the MAPK signaling pathway.
  • An antisense oligonucleotide can be, for example, about 7, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, or more nucleotides in length.
  • an antisense oligonucleotide with inhibitory activity toward ERK signaling is ISIS 5132, a 20-base phosphorothioate antisense oligodoxynucleotide designed to hybridize to the 3' untranslated region of the c-raf-1 mRNA (Monia, B. P. et al., Nat. Med., 1996, 2(6): 668-675; Stevenson J. P. et al., J. Clin. Oncol., 1999, 17: 2227-2236; O'Dwyer P. J. et al., Clin. Cancer Res., 1999, 5: 3977-3982). Inhibition of ERK can also employ approaches disclosed in Pages G. et al., Proc. Natl. Acad. Sci. USA, 1993, 90: 8319-8323.
  • antisense nucleic acid molecules of the invention may be administered to a subject, or generated in situ such that they hybridize with or bind to the mRNA of a component of the MAPK signaling pathway.
  • antisense nucleic acid molecules can be modified to target selected cells and then administered systemically.
  • antisense molecules can be modified such that they specifically bind to receptors or antigens expressed on a selected cell surface, e.g., by linking the antisense nucleic acid molecules to peptides or antibodies that bind to cell surface receptors or antigens.
  • the antisense nucleic acid molecules can also be delivered to cells using viruses or DNA vectors.
  • the polynucleotide of the invention is a ribozyme that inhibits expression of the gene of any component of the MAPK signaling pathway.
  • Ribozymes can be chemically synthesized in the laboratory and structurally modified to increase their stability and catalytic activity using methods known in the art.
  • ribozyme encoding nucleotide sequences can be introduced into host cells through gene-delivery mechanisms known in the art.
  • vectors e.g., viral vectors, expression cassettes, plasmids
  • polynucleotides of the subject invention e.g., siRNA, antisense nucleic acids, and ribozymes
  • host cells genetically modified with polynucleotides or vectors of the subject invention.
  • the present inhibitors can also be a polypeptide exhibiting inhibitory activity toward any component of the MAPK signaling pathway.
  • a receptor decoy may be used.
  • a peptide corresponding to the amino-terminal 13 amino acids of MEK1 MPKKKPTPIQLNP; SEQ ID NO: 1
  • MPKKKPTPIQLNP SEQ ID NO: 1
  • polypeptides can be fused to the polypeptide, producing a fusion polypeptide, in which the PTDs are capable of transducing the polypeptide cargo across the plasma membrane (Wadia, J. S. and Dowdy, S. F., Curr. Opin. Biotechnol., 2002, 13(1)52-56).
  • PTDs protein transduction domains
  • recombinant cells can be administered to a patient, wherein the recombinant cells have been genetically modified to express a nucleotide sequence encoding an inhibitory polypeptide.
  • the present inhibitors can be an antibody or antigen-binding portion thereof that is specific to any component of the MAPK signaling pathway, thereby inhibiting the MAPK signaling.
  • the antibody or antigen-binding portion thereof may be the following: (a) a whole immunoglobulin molecule; (b) an scFv; (c) a Fab fragment; (d) an F(ab')2; and (e) a disulfide linked Fv.
  • the antibody or antigen-binding portion thereof may be monoclonal, polyclonal, chimeric and humanized.
  • the antibodies may be murine, rabbit or human antibodies.
  • the tumor-associated antigen(s) may be introduced into antigen-presenting cells using any vectors.
  • vector refers to a polynucleotide capable of transporting another nucleic acid to which it has been linked.
  • the present vectors can be, for example, a plasmid vector, a single- or double-stranded phage vector, or a single- or double-stranded RNA or DNA viral vector.
  • Such vectors include, but are not limited to, chromosomal, episomal and virus-derived vectors, e.g., vectors derived from bacterial plasmids, bacteriophages, yeast episomes, yeast chromosomal elements, and viruses such as baculoviruses, papova viruses, SV40, vaccinia viruses, adenoviruses, fowl pox viruses, pseudorabies viruses and retroviruses, and vectors derived from combinations thereof, such as those derived from plasmid and bacteriophage genetic elements, cosmids and phagemids.
  • vectors include, but are not limited to, chromosomal, episomal and virus-derived vectors, e.g., vectors derived from bacterial plasmids, bacteriophages, yeast episomes, yeast chromosomal elements, and viruses such as baculoviruses, papova viruses, SV40, vaccinia viruses, adenovirus
  • Expression vectors can be used to replicate and/or express the nucleotide sequence encoding a therapeutic agent in a target mammalian cell.
  • a variety of expression vectors useful for introducing into cells the polynucleotides of the inventions are well known in the art.
  • Viral vectors include, but are not limited to, adeno-associated virus, adenovirus, vaccinia virus, alphavirus, retrovirus and herpesvirus vectors.
  • the vector is an adeno-associated virus (AAV, or adenovirus- associated virus) vector.
  • AAV adeno-associated virus
  • adenovirus-associated virus See also, e.g., Walsh et al., 1993, Proc. Soc. Exp. Biol. Med. 204:289- 300; U.S. Pat. No. 5,436, 146).
  • AAV serotypes may be used, including, but not limited to, AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, etc.
  • the present vector may comprise wild-type or mutant AAV capsid (e.g., AAV2, AAV8, etc.) encoded by the AAV cap open reading frame (ORF).
  • AAV capsid e.g., AAV2, AAV8, etc.
  • ORF AAV cap open reading frame
  • Adenoviruses are described in, e.g., Rosenfeld et al., 1991, Science 252:431-434;
  • the present expression vector is a lentivirus (including human immunodeficiency virus (HIV)), which is a sub-type of retrovirus.
  • HIV human immunodeficiency virus
  • Plasmids that may be used as the present expression vector include, but are not limited to, pGL3, pCDM8 (Seed, 1987, "An LFA-3 cDNA encodes a phospholipid-linked membrane protein homologous to its receptor CD2", Nature. 840-842) and pMT2PC (Kaufman et al., 1987, "Translational efficiency of polycistronic mRNAs and their utilization to express heterologous genes in mammalian cells", EMBO J. 6: 187-193). Any suitable plasmid may be used in the present invention.
  • vectors are capable of autonomous replication in a host cell into which they are introduced (e.g., episomal mammalian vectors).
  • Other vectors e.g., non-episomal mammalian vectors
  • APCs Antigen-presenting Cells
  • At least one tumor-associated antigen (or at least one tumor-associated peptide antigen (TAP A) derived from at least one tumor-associated antigen) may be introduced into, or loaded onto, the APCs of the present invention.
  • TEP A tumor-associated peptide antigen
  • nucleic acids encoding at least one tumor-associated antigen (or a fragment thereof) may be introduced into the APCs.
  • Non-limiting examples of antigen-presenting cells including dendritic cells,
  • B cells cells of myeloid lineage, Langerhans cells, epithelial cells, or any nucleated cells.
  • the APC may be autologous or allogeneic.
  • the APC may be isolated from a subject.
  • the APC may also be derived from cells isolated from a subject.
  • the present invention provides a method for eliciting in a subject an immune response to a cell that expresses a tumor-associated antigen, the method comprising administering to the subject antigen-presenting cells (e.g., dendritic cells) comprising at least one tumor-associated antigen, or administering to the subject antigen-presenting cells comprising nucleic acids encoding at least one tumor-associated antigen, wherein the antigen-presenting cells (e.g., dendritic cells), when administered to the subject, elicits the immune response to the cell.
  • the subject antigen-presenting cells e.g., dendritic cells
  • the antigen-presenting cells e.g., dendritic cells
  • the tumor-associated antigen-containing antigen-presenting cells may also be used to activate T lymphocytes. As described herein, the present antigen-presenting cells and/or T lymphocytes may be used for prophylactic or therapeutic applications.
  • DCs Dendritic Cells
  • DCs can be generated in vivo or ex vivo from immature precursors (e.g.,
  • a cell population enriched for DC precursor cells e.g., peripheral blood mononuclear cells (PBMCs)
  • PBMCs peripheral blood mononuclear cells
  • the DC precursor cells are differentiated ex vivo into mature DCs.
  • immature dendritic cells one must first purify or enrich the monocytic precursors from other cell types.
  • PBMCs peripheral blood mononuclear cells
  • the PBMCs will be used to generate monocytic dendritic cell precursors.
  • DCs can be generated from monocytes, CD34+ cells (i.e., cells expressing CD34), etc.
  • monocytic dendritic cell precursors are isolated by adherence to a monocyte-binding substrate.
  • a population of leukocytes e.g., isolated by leukapheresis
  • a monocytic dendritic cell precursor adhering substrate e.g., isolated by leukapheresis
  • the monocytic dendritic cell precursors in the leukocyte population preferentially adhere to the substrate.
  • monocytes are isolated through adherence of the monocytic precursors to a plastic (polystyrene) surface, as the monocytes have a greater tendency to stick to plastic than other cells found in, for example, peripheral blood, such as lymphocytes and natural killer (NK) cells.
  • plastic polystyrene
  • dendritic cell precursors and immature dendritic cells can be isolated by phlebotomy, by apheresis or leukapheresis, by collecting heparinized blood, by preparation of buffy coats, rosetting, centrifugation, density gradient centrifugation (e.g., using Ficoll, Percoll (colloidal silica particles of 15-30 mm diameter coated with polyvinylpyrrolidone (PVP)), sucrose, and the like), differential lysis of cells, filtration, and the like.
  • dendritic cell precursors can be selected using CD14 selection of G-CSF mobilized peripheral blood.
  • GM-CSF granulocyte macrophage colony stimulating factor
  • the subject may be administered at a dose ranging from about 10 ⁇ g/day to about 500 ⁇ g/day, from about 20 ⁇ g/day to about 300 ⁇ g/day, from about 50 ⁇ g/day to about 250 ⁇ g/day, from about 100 ⁇ g/day to about 300 ⁇ g/day, from about 200 ⁇ g/day to about 300 ⁇ g/day, about 200 ⁇ g/day, or about 250 ⁇ g/day.
  • GM-CSF can also be lower or higher.
  • GM-CSF may be administered for about 1 day, about 2 days, about 3 days, about 4 day, about 5 days, about 6 days, about 1 week, about 1.5 weeks, about 2 weeks, or longer.
  • GM-CSF may be potentiated by another immunostimulant (such as plerixafor).
  • Variations on this method include different methods of purifying monocytes, including, for example, tangential flow filtration (TFF), or by binding antibodies attached to beads to surface molecules on the monocytes.
  • the beads with the bound cells are then concentrated in a column, or on a magnetic surface, such that contaminating cells can be washed away, after which the monocytes are eluted off the beads.
  • TNF tangential flow filtration
  • cells expressing the stem cell marker CD34 either from blood (U.S. Patent No.
  • Isolated dendritic cell precursors can be cultured ex vivo for differentiation, maturation and/or expansion.
  • the monocytic dendritic cells precursors are differentiated to form immature dendritic cells.
  • the end result of this process is a cell which expresses T cell costimulatory molecules, as well as high levels of molecules of the major histocompatibility complex (MHC), but does not express the dendritic cell maturation marker CD83.
  • MHC major histocompatibility complex
  • These cells are similar to Langerhans cells in the skin, and their prime physiological function is to capture invading microorganisms.
  • the dendritic cell precursors and/or immature dendritic cells can be cultured and differentiated in suitable culture conditions.
  • the tissue culture media can be supplemented with, e.g., plasma, serum, amino acids, vitamins, cytokines (e.g., granulocyte-macrophage colony- stimulating factor (GM-CSF), interleukins such as Interleukin 4 (IL-4), Interleukin 13 (IL-13), Interleukin 15 (IL-15), or combinations thereof), purified proteins (such as serum albumin), divalent cations (e.g., calcium and/or magnesium ions), growth factors, and the like, to promote differentiation of the cells.
  • cytokines e.g., granulocyte-macrophage colony- stimulating factor (GM-CSF), interleukins such as Interleukin 4 (IL-4), Interleukin 13 (IL-13), Interleukin 15 (IL-15), or combinations thereof
  • purified proteins such as serum albumin
  • divalent cations e.g., calcium and/or magnesium ions
  • the use of type I interferons and Toll-like receptor agonists to induce DC maturation ex vivo have been shown to stimulate generation of immunogenic, rather than tolerogenic, DCs [58, 59].
  • the blood plasma or serum can be heat- inactivated.
  • the plasma or serum can be autologous, allogeneic or heterologous to the cells.
  • the dendritic cell precursors can be cultured in the serum-free media. Such culture conditions can optionally exclude any animal-derived products.
  • a dendritic cell culture medium contains about 200 units/ml to about 1500 units/ml (e.g., about 1000 units/ml, about 500 units/ml, etc.) of GM-CSF and about 200 units/ml to about 1500 units/ml (e.g., about 800 units/ml, about 500 units/ml, etc.) IL-4.
  • Immature DC have a high capacity for taking up and processing antigens, but have a limited ability to initiate immune responses.
  • the ability to initiate an immune response is acquired by maturation of the immature DC. This maturation is also referred to as activating, or activation of, the DC.
  • the maturation process may be initiated and/or induced through contact with, or intake of, maturation-inducing cytokines, tumor-associated antigens or tumor-associated peptide antigens and/or nucleic acids encoding tumor-associated antigens or tumor-associated peptide antigens, and the like, as described herein.
  • APCs e.g., dendritic cells
  • tumor-associated antigen e.g., a tumor-associated peptide antigen
  • 1, 2, 3, 4, 5, 6, 7, 8, 9, or more tumor-associated peptide antigens using any combinations of the tumor-associated peptide antigens of SEQ ID Nos. 7-15 1, 2, 3, 4, 5, 6, 7, 8, 9, or more tumor-associated peptide antigens using any combinations of the tumor-associated peptide antigens of SEQ ID Nos. 7-15.
  • a cell or membrane bound composition e.g., a liposome
  • "loaded" (or "pulsed" with a peptide shall mean that the cell or membrane bound composition has been incubated with the peptide under conditions permitting entry into and/or attachment onto the cell or membrane bound composition of the peptide.
  • APCs e.g., dendritic cells
  • APCs can be incubated with one or more tumor-associated peptide antigens under conditions that are needed to load the MHC of the APC (e.g., the dendritic cell).
  • Suitable conditions for antigen loading are provided that permit an APC to contact, process and/or present one or more antigens on its MHC, whether intracellularly or on the cell surface.
  • the incubation time may range from about 10 minutes to about 3 days or longer, from about 30 minutes to about 36 hours, from about 1 hour to about 28 hours, from about 2 hours to about 24 hours, from about 4 hours to about 24 hours, from about 4 hours to about 16 hours, from about 16 hours to about 24 hours, from about 20 hours to about 28 hours, from about 2 hours to about 4 hours, from about 1 hour to about 12 hours, from about 2 hours to about 8 hours, from about 3 hours to about 5 hours, for less than about a week, illustratively, for about 1 minute to about 48 hours, about 2 minutes to about 36 hours, about 3 minutes to about 24 hours, about 4 minutes to about 12 hours, about 6 minutes to about 8 hours, about 8 minutes to about 6 hours, about 10 minutes to about 5 hours, about 15 minutes to about 4 hours, about 20 minutes to about 3 hours, about 30 minutes to about 2 hours, about 40 minutes to about 1 hour, about 16 hours, about 20 hours, about 24 hours, about 28 hours, about 1 hour, about 2 hours, or about 4 hours.
  • the concentration of the peptide for loading may range from about 1 ⁇ g/ml to about 1 mg/ml, from about 5 ⁇ g/ml to about 800 ⁇ g/ml, from about 10 ⁇ g/ml to about 600 ⁇ g/ml, from about 15 ⁇ g/ml to about 400 ⁇ g/ml, from about 10 ⁇ g/ml to about 200 ⁇ g/ml, from about 10 ⁇ g/ml to about 100 ⁇ g/ml, from about 50 ⁇ g/ml to about 100 ⁇ g/ml, from about 20 ⁇ g/ml to about 100 ⁇ g/ml, about 10 ⁇ g/ml, about 20 ⁇ g/ml, about 30 ⁇ g/ml, about 50 ⁇ g/ml, about 60 ⁇ g/ml, about 80 ⁇ g/ml, or about 100 ⁇ g/ml.
  • one or more tumor-associated antigens can be coupled to a cytolysin to enhance the transfer of the antigens into the cytosol of an antigen-presenting cell for delivery to the MHC class I pathway.
  • cytolysins include saponin compounds such as saponin- containing Immune Stimulating Complexes (ISCOM5), pore-forming toxins (e.g., an alpha- toxin), and natural cytolysins of gram-positive bacteria such as listeriolysin O (LLO), streptolysin O (SLO), and perfringolysin O (PFO).
  • LLO listeriolysin O
  • SLO streptolysin O
  • PFO perfringolysin O
  • Such methods include, but are not limited to, methods involving pH-sensitive liposomes, coupling of antigens to potent adjuvants, apoptotic cell delivery, pulsing cells onto dendritic cells, delivering recombinant chimeric virus-like particles (VLPs) comprising antigen to the MHC class I processing pathway of a dendritic cell line.
  • VLPs chimeric virus-like particles
  • One or more tumor-associated antigens may be introduced into APCs.
  • Methods of introducing a tumor-associated antigen into an APC include, but are not limited to, non-covalent complex formation (Chariot), osmotic lysisis of pinocytic vesicles (Influx pinocytic cell-loading reagent), electric power (electroporation), lipid-based delivery system (Bioporter),
  • PTDs small protein transduction domains
  • T3SS bacterial secretion system type III
  • CPP cell-penetrating peptide
  • APCs may be contacted with nucleic acids encoding one or more tumor-associated antigens.
  • antigen-presenting cells e.g., dendritic cells
  • expression vectors or infected with viral vectors for introducing nucleic acids encoding tumor- associated antigens into the APCs.
  • Non-limiting viral vectors include adeno-associated viruses, lentiviruses, retroviruses, herpes viruses, adenoviruses, vaccinia viruses, baculoviruses, Fowl pox, AV-pox, modified vaccinia Ankara (MVA) and other recombinant viruses.
  • adeno-associated viruses include adeno-associated viruses, lentiviruses, retroviruses, herpes viruses, adenoviruses, vaccinia viruses, baculoviruses, Fowl pox, AV-pox, modified vaccinia Ankara (MVA) and other recombinant viruses.
  • nucleic acids into APCs include, but are not limited to, electroporation, microinjection, hypotonic shock, scrape loading, cationic liposomes, and calcium phosphate coprecipitation.
  • Expression can be optionally effected by targeting the expression construct to specific cells, such as with a viral vector or a receptor ligand, or by using a tissue-specific promoter, or combinations thereof.
  • the time and amount of antigens, or nucleic acids encoding the antigens, necessary for the antigen presenting cells to process and present the antigens can be determined, for example, by assaying T cell cytotoxic activity in vitro or using antigen-presenting cells as targets of CTLs. Other methods that can detect the presence of antigen on the surface of antigen -presenting cells are also contemplated by the presented invention.
  • the antigen-presenting cells loaded with the antigen can be used to stimulate CTL proliferation in vivo or ex vivo.
  • the ability of the loaded dendritic cells to stimulate a CTL response can be measured by assaying the ability of the effector cells to lyse target cells.
  • the non-radioactive LDH cytotoxicity assay or the europium release assay can be used. Volgmann et al., J. Immunol. Methods 119:45-51, 1989.
  • Ex vivo or in vitro maturation of DCs can be induced by various maturation factors, including, but not limited to, IL- ⁇ , tumor necrosis factor alpha (TNF-a), interferon alpha (IFN- a), poly (I:C), interferon gamma (IFN- ⁇ ), Interleukin 1 beta (TL- ⁇ ), Interleukin 6 (IL-6), prostaglandin E2 (PGE2), poly-dldC, vasointestinal peptide (VIP), bacterial lipopolysaccharide (LPS), mycobacteria or components of mycobacteria (such as cell wall constituents), or combinations thereof.
  • TNF-a tumor necrosis factor alpha
  • IFN-a interferon alpha
  • poly I:C
  • IFN- ⁇ interferon gamma
  • IFN- ⁇ Interleukin 1 beta
  • IL-6 Interleukin 6
  • PGE2 prostaglandin E2
  • poly-dldC vas
  • Additional maturation factors include, for example, an imidazoquinoline compound, e.g., R848 (WO 00/47719, incorporated herein by reference in its entirety), a synthetic double stranded polyribonucleotide, agonists of a Toll-like receptor (TLR), such as TLR3, TLR4, TLR7 and/or TLR9, a sequence of nucleic acids containing unmethylated CpG motifs known to induce the maturation of DC, and the like. Further, a combination of any of the above agents can be used in inducing the maturation of immature dendritic cells or dendritic precursor cells.
  • a dendritic maturation cocktail includes (comprises, consists essentially of, or consists of) IL- ⁇ , TNF-a, IFN-a and poly (I:C).
  • the maturation factors can be added to the dendritic cells before, during or after peptide loading of the dendritic cells.
  • Immature dendritic cells are matured to form mature dendritic cells.
  • Mature DCs lose the ability to take up antigen and display up-regulated expression of costimulatory cell surface molecules and various cytokines. Maturation of dendritic cells can be monitored by methods known in the art.
  • Mature dendritic cells can be selected by expression of one or more markers. The markers include, but are not limited to, CD86, CD80, CD83, CD58, CDla, HLA-DR, CD40, CD1 lc, IL-2-beta, TLR-4 and combinations thereof.
  • the dendritic cells can also be identified as lacking or expressing low levels of markers such as CD14.
  • mature dendritic cells are identified as being CD80+, CD83+, CD86+, and CD14-. Greater MHC expression leads to an increase in antigen density on the DC surface, while up-regulation of costimulatory molecules CD80 and CD86 strengthens the T cell activation signal through the counterparts of the costimulatory molecules, such as CD28 on the T cells.
  • Cell surface markers can be detected in suitable assays, such as flow cytometry, immunohistochemistry, and the like. The cells can also be monitored for cytokine production (e.g., by ELISA, FACS, or other immune assay). Dendritic cell precursors, immature dendritic cells, and mature dendritic cells, either primed or unprimed with antigens, can be cryopreserved for use at a later date.
  • the mature DCs of the invention either can be used immediately after their generation (and, optionally, purification) or stored frozen for future use. In certain embodiments, enough mature DCs or T cells are generated to provide an initial dose for the subject as well as cells that can be frozen and stored for future use if necessary.
  • the cells of interest i.e., mature DCs
  • the cells of interest can be purified prior to administration to the subject.
  • Purification of the cells can be done using a variety of methods known in the art, including methods in which antibodies to specific cell surface molecules are employed. These methods include both positive and negative selection methods.
  • cells generated in vitro can be isolated by staining the cells with fluorescently labeled antibodies to cell surface markers followed by sorting of the cells that express both of these markers on their cell surface using fluorescence activated cell sorting (FACS).
  • FACS fluorescence activated cell sorting
  • mature DCs or T cells can be expanded in vitro from freshly isolated or frozen cell stocks to generate sufficient numbers of cells for effective adoptive immunotherapy.
  • the expansion of the cells can be achieved by any means that maintains their functional characteristics.
  • the phenotypic and functional properties of the resultant expanded cells can be tested prior to their therapeutic use and/or storage to verify that the expansion process has altered their activity.
  • Methods are provided for administration of dendritic cells to a subject in need of immunostimulation.
  • such methods are performed by obtaining dendritic cell precursors or immature dendritic cells, differentiating and maturing those cells in the presence of a tumor-associated antigen or a tumor-associated peptide antigen (or a nucleic acid composition) to form a mature dendritic cell population.
  • the immature dendritic cells can be contacted with antigen prior to or during maturation.
  • the DC administration may be given once, twice, three times, four times, five times, six times, seven times, eight times, nine times, ten times, eleven times, twelve times, thirteen times, fourteen times, fifteen times, or more, within a treatment regime to a
  • the DC administration may be given every 2 days, every 3 days, every 4 days, every 5 days, every 6 days, every 7 days, every 8 days, every 9 days, every 10 days, every 11 days, every 12 days, every 13 days, every 14 days, every 16 days, every 18 days, every 20 days, every 1 month, every 2 months, every 3 months, every 6 months, or at different frequencies.
  • the DC may be administered at a dose ranging from about 1 X 10 3 DCs to about 1 X 10 12 DCs, from about 1 X 10 4 DCs to about 1 X 10 10 DCs, from about 1 X 10 5 DCs to about 1 X 10 9 DCs, from about 1 X 10 6 DCs to about 1 X 10 8 DCs, from about 1 X 10 6 DCs to about 1 X 10 7 DCs, from about 1 X 10 7 DCs to about 1 X 10 8 DCs, about 1 X 10 5 DCs, about 1 X 10 6 DCs, about 1 X 10 7 DCs, about 1 X 10 8 DCs, or about 1 X 10 9 DCs.
  • the mature dendritic cells can be contacted with, and thus, activate, lymphocytes.
  • the activated, polarized lymphocytes optionally followed by clonal expansion in cell culture, can be administered to a subject in need of immunostimulation.
  • the present invention provides a method for eliciting in a subject an immune response to a cell expressing at least one tumor-associated antigen.
  • the method comprises administering to the subject antigen-presenting cells (e.g., dendritic cells) comprising at least one tumor- associated antigen (or loaded with at least one tumor-associated peptide antigen), or antigen- presenting cells (e.g., dendritic cells) comprising nucleic acids encoding at least one tumor- associated antigen.
  • the antigen-presenting cells may also be treated with at least one inhibitor of the MAPK signaling pathway.
  • the antigen-presenting cells when administered to the subject, may elicit an immune response to the cell that expresses at least one tumor-associated antigen.
  • the present invention provides a method of treating a tumor cell, the method comprising administering to a subject a therapeutically or prophylactically effective amount of a pharmaceutical composition to reduce or inhibit growth or spread of the cell in the subject, wherein the composition comprises: an antigen-presenting cell comprising at least one tumor-associated antigen or a fragment thereof, a lymphocyte primed against the tumor- associated antigen, or a combination thereof, where the antigen-presenting cells may also be treated with at least one inhibitor of the MAPK signaling pathway.
  • the antigen-presenting cells comprising one or more tumor-associated antigens (or a fragment thereof) may be used to contact lymphocytes under conditions sufficient to produce tumor-associated antigen-specific lymphocyte capable of eliciting an immune response against a tumor cell.
  • the antigen-presenting cells also can be used to provide lymphocytes, including T lymphocytes and B lymphocytes, for eliciting an immune response against a cell that expresses a tumor-associated antigen.
  • a preparation of T lymphocytes is contacted with the antigen-presenting cells described above for a period of time, preferably for at least about 24 hours, for priming the T lymphocytes to the at least one tumor-associated antigen presented by the antigen-presenting cells.
  • a population of antigen- presenting cells can be co-cultured with a heterogeneous population of peripheral blood T lymphocytes together with at least one tumor-associated antigen, or nucleic acids comprising the at least one tumor-associated antigen.
  • the cells can be co-cultured for a period of time and under conditions sufficient for the tumor-associated antigens or their processed forms to be presented by the antigen-presenting cells and the antigen-presenting cells to prime a population of T lymphocytes to respond to cells that express a tumor-associated antigen. Accordingly, T lymphocytes and B lymphocytes that are primed to respond to cells that express a tumor- associated antigen can be prepared.
  • the ability to induce lymphocytes to exhibit an immune response can be determined by any method including, but not limited to, determining T lymphocyte cytolytic activity in vitro using for example tumor-associated antigen-specific antigen-presenting cells as targets of tumor- associated antigen-specific cytolytic T lymphocytes (CTL); assaying tumor-associated antigen- specific T lymphocyte proliferation; and determining B cell response to cells expressing a tumor- associated antigen using, for example, ELISA methods.
  • CTL tumor-associated antigen-specific antigen-presenting cells as targets of tumor- associated antigen-specific cytolytic T lymphocytes
  • B cell response to cells expressing a tumor- associated antigen using, for example, ELISA methods.
  • T lymphocytes can be obtained from any suitable source such as peripheral blood, spleen, and lymph nodes.
  • the T lymphocytes can be used as crude preparations or as partially purified or substantially purified preparations, which can be obtained by standard techniques including, but not limited to, methods involving immunomagnetic or flow cytometry techniques using antibodies.
  • T cells can be removed from an individual and treated in vitro with the antigen(s) or peptide(s), wherein the resulting CTL are reinfused autologously or allogeneically to the subject.
  • the tumor-associated antigen(s) or peptide(s) of the present invention also may be administered to the subject, or in vitro to T cells, in the form of a nucleic acid vaccine, wherein one or more suitable gene transfer vectors, such as a plasmid or an engineered viral vector that contains DNA encoding the peptide fragment(s), is administered to the subject or to T cells in vitro.
  • the present invention provides a method of treating tumor cells, the method comprising administering to a subject (or contacting the tumor cells) antigen-presenting cells, T lymphocytes, or both, where the antigen-presenting cells comprising at least one tumor- associated antigen (or a fragment thereof), or where the antigen-presenting cells comprise nucleic acids encoding at least one tumor-associated antigen.
  • the antigen-presenting cells may also be treated with at least one inhibitor of the MAPK signaling pathway.
  • the T lymphocytes have been contacted with antigen-presenting cells.
  • the antigen-primed antigen-presenting cells of the present invention and the antigen-specific T lymphocytes generated with these antigen-presenting cells can be used as immunomodulating compositions for prophylactic or therapeutic applications for cancer.
  • the tumor-associated antigen-primed antigen-presenting cells of the invention can be used for generating CD8+ CTL, CD4+ CTL, and/or B lymphocytes for adoptive transfer to the subject.
  • tumor-associated antigen-specific CTLs can be adoptively transferred for therapeutic purposes in subjects afflicted with cancer.
  • the present compositions or methods may function to provide or enhance an immune response.
  • the immune response can include humoral immune response, cell-mediated immune response, or both.
  • antigen presentation through an immunological pathway involving MHC class II molecules or direct B-cell stimulation can produce a humoral response; and, antigens presented through a pathway involving MHC I molecules can elicit cell-mediated immune response.
  • a humoral response can be determined by a standard immunoassay for antibody levels in a serum sample from the subject receiving the pharmaceutically acceptable composition.
  • a cellular immune response is a response that involves T cells and can be determined in vitro or in vivo.
  • a general cellular immune response can be determined as the T cell proliferative activity in cells (e.g., peripheral blood leukocytes (PBLs)) sampled from the subject at a suitable time following the administering of a pharmaceutically acceptable composition. Following incubation of e.g., PBMCs with a stimulator for an appropriate period, [ H]thymidine incorporation can be determined. The subset of T cells that is proliferating can be determined using flow cytometry. T cell cytotoxicity can also be
  • the immune response that is elicited or enhanced may be sufficient for prophylactic or therapeutic treatment of a neoplastic disease, or a symptom associated therewith, particularly cancer. Accordingly, a beneficial effect of the present compositions and/or methods will generally at least in part be immune-mediated, although an immune response need not be positively demonstrated in order for the compositions and methods described herein to fall within the scope of the present invention.
  • the immunological efficacy of the present methods and compositions may be determined based on the Distribution Free Resampling (DFR) method proposed and described by Moodie et al [661
  • cytokines e.g., IFN- ⁇ , TNF-a, and/or IL-17
  • ELISpot assay to determine immune responses.
  • the cytokine ELISPOT (Enzyme-Linked ImmunoSPOT) assay is designed to enumerate cytokine-secreting cells.
  • the assay has the advantage of detecting only activated/memory T cells and has the ability to detect cytokine release in response to antigen by a single cell thereby permitting direct calculation of responder T cell frequencies.
  • the high sensitivity and easy performance allowing the determination of peptide-reactive T cells without prior in vitro expansion, makes the ELISPOT assay well suited to monitor T cell responses. Tanguay et al., 1994. Lymphokine Cytokine Res. 13 : 259. Carter et al., 1997. Curr. Opin. Immunol. 9: 177.
  • cells are incubated in the wells of the ELISPOT plate pre-coated with a high- affinity monoclonal antibody to which the cytokine, produced during incubation, will bind. Subsequently, cells are washed away. Areas in which the cytokines have been bound are detected with a combination of biotinylated anti-cytokine detection antibodies and ⁇ -labeled goat anti- biotin antibodies.
  • the last step in the assay is the addition of a reagent allowing the precipitation of silver on ⁇ revealing the site of cytokine secretion (i.e., spot formation).
  • Treating a subject using the present compositions and methods may refer to reducing the symptoms of the disease, reducing the occurrence of the disease, reducing the severity of the disease, and/or preventing a disease from occurring.
  • to treat a subject means both preventing disease occurrence (prophylactic treatment) and treating a subject that has a disease (therapeutic treatment).
  • treating a subject is accomplished by providing or enhancing an immune response in the subject.
  • One or more antigens or antigenic peptides may be introduced into (or loaded onto) the present antigen-presenting cells (e.g., dendritic cells), including 2, 3, 4, 5, 6, 7, 8, 9, 10 or more antigens or antigenic peptides. Additionally, multiple independently generated DCs can be administered to a subject. Furthermore, administration of DCs to a subject can be done as often as is required to ameliorate the symptoms associated with the disease state.
  • present antigen-presenting cells e.g., dendritic cells
  • multiple independently generated DCs can be administered to a subject.
  • administration of DCs to a subject can be done as often as is required to ameliorate the symptoms associated with the disease state.
  • the antigen-presenting cells and/or lymphocytes described above can be administered to a subject for eliciting or enhancing an immune response (such as against tumor cells that express at least one tumor-associated antigen).
  • an immune response such as against tumor cells that express at least one tumor-associated antigen.
  • Such cell-based compositions are useful for treating or preventing cancer.
  • the APCs e.g., dendritic cells
  • T lymphocytes may be autologous, allogenic (e.g., from a different donor subject that is MHC matched or mismatched with the recipient subject) or heterologous to the recipient subject.
  • immature dendritic cells can be harvested from an organ donor and treated in vitro with at least one tumor-associated peptide antigen.
  • the resultant allogeneic mature DCs can then be administered to the subject to promote the cure or treatment of disease in that subject.
  • the antigen-presenting cells and/or lymphocytes described above can be administered to a subject, either by themselves or in combination, for eliciting an immune response, particularly for eliciting an immune response to cells that express a tumor- associated antigen.
  • Such cell-based compositions are useful, therefore, for treating or preventing cancer.
  • the cells can be introduced into a subject by any mode that elicits the desired immune response to cells that express a tumor-associated antigen.
  • the antigen-presenting cells and/or lymphocytes can be derived from the subject (i.e., autologous cells) or from a different subject that is MHC matched or mismatched with the subject (e.g., allogeneic).
  • the present methods induce an immune response to a tumor in a patient.
  • Such methods can comprise one or more steps of (a) obtaining monocytes (which may act as monocytic dendritic cell precursors) from a patient; (b) culturing the monocytes (e.g., with specific cytokines) to induce differentiation into immature dendritic cells; (c) differentiating the immature dendritic cells into mature dendritic cells by contacting the immature dendritic cells with at least one tumor-associated peptide antigen (or tumor-associated antigen); and (d) administering the mature dendritic cells to the patient.
  • the antigen-presenting cells may also be treated with at least one inhibitor of the MAPK signaling pathway.
  • one or more immunosuppressive agents may be administered to the patient.
  • the immunosuppressive agent inhibits or decreases the activity of suppressive T-cell populations, such as suppressor regulatory T-cells (Treg).
  • Immunosuppressive agents are substances that inhibit or prevent activity of the immune system. This includes substances that suppress cytokine production, down-regulate or suppress self-antigen expression, or mask the MHC antigens. Immunosuppressive agents can be glucocorticoids, cytostatics, antibodies, drugs acting on immunophilins, etc. These may be used alone or in combination.
  • Cytostatics include, but are not limited to, alkylating agents, antimetabolites, etc.
  • alkylating agents include nitrogen mustards (e.g., cyclophosphamide), nitrosoureas, platinum compounds, and others.
  • Non-limiting examples of antimetabolites include folic acid analogues (e.g., methotrexate), purine analogues (e.g., azathioprine and mercaptopurine), pyrimidine analogues (e.g., fluorouracil), protein synthesis inhibitors, cytotoxic antibiotics (e.g., dactinomycin, anthracyclines, mitomycin C, bleomycin, mithramycin, etc.).
  • folic acid analogues e.g., methotrexate
  • purine analogues e.g., azathioprine and mercaptopurine
  • pyrimidine analogues e.g., fluorouracil
  • protein synthesis inhibitors e.g., cytotoxic antibiotics (e.g., dactinomycin, anthracyclines, mitomycin C, bleomycin, mithramycin, etc.).
  • Antibodies include polyclonal antibodies and monoclonal antibodies.
  • the antibodies may be T-cell receptor directed antibodies (e.g., CD3-directed antibodies), or JL-2 receptor directed antibodies (e.g., CD25- directed antibodies).
  • Drugs acting on immunophilins include, but are not limited to, ciclosporin, tacrolimus, sirolimus, etc.
  • immunosuppressive drugs include, interferons (e.g., IFN- ⁇ , IFN- ⁇ , etc.), opioids, TNF binding proteins, mycophenolate, and small biological agents (e.g., fingolimod, myriocin etc.).
  • Non-limiting examples of immunosuppressive agents include 2-amino-6-aryl-5- substituted pyrimidines; mycophenolate mofetil; azathioprine; 6-mercaptopurine; bromocryptine; danazol; dapsone; glutaraldehyde; anti -idiotypic antibodies for MHC antigens and MHC fragments; cyclosporin A; steroids such as corticosteroids and glucocorticosteroids, e.g., prednisone, prednisolone (e.g., prednisolone sodium phosphate), methylprednisolone, and dexamethasone; methotrexate; hydroxycloroquine; chloroquine; sulfasalazine; leflunomide; cytokine or cytokine receptor antagonists including anti-interferon-gamma, -beta, or -alpha antibodies, anti-tumor necrosis factor-alpha
  • rapamycin T-cell receptor (Cohen et al., U.S. Pat. No. 5,114,721); T-cell receptor fragments (Offner et al. Science 251 : 430-432 (1991); WO 90/11294; laneway, Nature 341 :482 (1989); and WO 91/01133); T cell receptor antibodies; cyclophosphamide; dapsone; penicillamine; plasma exchange; or intravenous immunoglobulin (IVIG).
  • T-cell receptor Cohen et al., U.S. Pat. No. 5,114,721
  • T-cell receptor fragments Offner et al. Science 251 : 430-432 (1991); WO 90/11294; laneway, Nature 341 :482 (1989); and WO 91/01133
  • T cell receptor antibodies cyclophosphamide; dapsone; penicillamine; plasma exchange; or intravenous immunoglobulin (IVIG).
  • cyclophosphamide may be administered to the patient prior to the present immunotherapy.
  • Cyclophosphamide may exert cytotoxic and/or
  • CYP low-dose cyclophosphamide
  • Greten and colleagues evaluated single-agent CYP doses of 150, 250, and 350 mg/m 2 in patients with hepatocellular carcinoma and reported that the two (2) lower doses induced a decrease in the absolute and relative frequency of Tregs in the blood of patients, and the 250 mg/m 2 dose impaired suppressor function and showed decreased Treg frequency up to day 71.
  • Alpha- fetoprotein-specific T-cell responses were also induced in the lower treatment arms [54].
  • breast cancer patients received 50 mg CYP orally daily for 3 months.
  • Tregs were reduced within 14 days of treatment and remained decreased until day 42, returning to pretreatment levels by day 84.
  • endogenous breast tumor-reactive T cells were detected in 27% of patients before CYP treatment and increased to 73% on day 14, 80% on day 42, and 88% on day 84, indicating enhanced T-cell function after the use of metronomic doses of CYP [55].
  • metronomic CYP combined with active immunotherapy has been reported [56].
  • CYP was given either as oral metronomic (50 mg/day), a single i.v. injection (1,000 mg), or both.
  • Metronomic CYP was given starting 1 week before the adenovirus, and i.v. cyclophosphamide was given 1 hour prior to the adenovirus. All CYP regimens resulted in higher rates of disease control when compared with the rates for the adenovirus vaccine only, and the metronomic groups were most effective in decreasing Treg numbers. Studies are being conducted combining metronomic doses of CYP with active vaccination strategies for a variety of cancers [57].
  • the subject prior to 1, 2, 3, 4, 5, 6, 7, 8, 9 or all of administration of the tumor-associated antigen loaded DCs, the subject will be administered cyclophosphamide at a dose ranging from about 10 mg/day to about 500 mg/day, from about 20 mg/day to about 400 mg/day, from about 30 mg/day to about 300 mg/day, from about 40 mg/day to about 200 mg/day, from about 50 mg/day to about 150 mg/day, from about 40 mg/day to about 120 mg/day, about 150 mg/day, about 50 mg/day, or about 100 mg/day.
  • cyclophosphamide can also be lower or higher.
  • cyclophosphamide may be administered for about 1 day, about 2 days, about 3 days, about 4 days, about 5 days, about 6 days, about 1 week, about 1.5 weeks, about 2 weeks, or longer.
  • administration of cyclophosphamide may be started about 1 day, about 2 days, about 3 days, about 4 days, about 5 days, about 6 days, about 1 week, about 1.5 weeks, about 2 weeks, or earlier, prior to administration of the present loaded DCs to the subject.
  • Administration of the present loaded DCs may be within about 1 day, within about 2 days, within about 3 days, within about 4 days, within about 5 days, within about 6 days, after the cyclophosphamide administration.
  • adjuvants may be administered.
  • the adjuvant may enhance DC migration and activation in vivo.
  • the adjuvant may provide for increased immunogenicity.
  • Adjuvants include, but are not limited to, immunomodulatory molecules (e.g., cytokines), oil and water emulsions, aluminum hydroxide, glucan, dextran sulfate, iron oxide, sodium alginate, Bacto- Adjuvant, synthetic polymers such as poly amino acids and co-polymers of amino acids, saponin, paraffin oil, and muramyl dipeptide.
  • immunomodulatory molecules e.g., cytokines
  • oil and water emulsions aluminum hydroxide
  • glucan dextran sulfate
  • iron oxide iron oxide
  • sodium alginate sodium alginate
  • Bacto- Adjuvant synthetic polymers such as poly amino acids and co-polymers of amino acids, saponin, paraffin oil, and muramyl dipeptide.
  • the adjuvant is an immunomodulatory molecule.
  • the immunomodulatory molecule can be a cytokine, chemokine, or immunostimulatory agent, or nucleic acids encoding cytokines, chemokines, or immunostimulatory agents designed to enhance the immunologic response.
  • Cytokines include, but are not limited to, chemokines, interferons, interleukins, lymphokines, tumor necrosis factor, etc. Cytokines such as granulocyte-macrophage colony- stimulating factor (GM-CSF) are known to induce DC development and serve as an immune adjuvant, both in vitro and in vivo [60, 61]. In one embodiment, low-dose GM-CSF is administered to the subject post vaccination to enhance vaccine-based immune stimulation in patients [62-65].
  • GM-CSF granulocyte-macrophage colony- stimulating factor
  • immunomodulatory cytokines include interferons (e.g., IFN-a, IFN- ⁇ and IFN- ⁇ ), interleukins (e.g., IL-1, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-12, IL-15, IL-20, and IL-21), tumor necrosis factors (e.g., TNF-a and TNF- ⁇ ), erythropoietin (EPO), FLT-3 ligand, glplO, TCA-3, MCP-1, MIF, ⁇ - ⁇ , ⁇ - ⁇ , Rantes, macrophage colony stimulating factor (M-CSF), granulocyte colony stimulating factor (G-CSF), and granulocyte-macrophage colony stimulating factor (GM-CSF), as well as functional fragments of any of the foregoing.
  • interferons e.g., IFN-a, IFN-
  • GM-CSF is administered at a dose ranging from about 10 ⁇ g/day to about 500 ⁇ g/day, from about 20 ⁇ g/day to about 300 ⁇ g/day, from about 50 ⁇ g/day to about 250 ⁇ g/day, from about 25 ⁇ g/day to about 100 ⁇ g/day, from about 30 ⁇ g/day to about 80 ⁇ g/day, from about 100 ⁇ g/day to about 300 ⁇ g/day, from about 200 ⁇ g/day to about 300 ⁇ g/day, about 200 ⁇ g/day, about 250 ⁇ g/day, about 40 ⁇ g/day, about 50 ⁇ g/day, about 60 ⁇ g/day, or about 70 ⁇ g/day.
  • GM-CSF can also be lower or higher.
  • GM-CSF may be administered after the administration of the present loaded DCs for about 1 day, about 2 days, about 3 days, about 4 days, about 5 days, about 6 days, about 1 week, about 1.5 weeks, about 2 weeks, or longer.
  • Any immunomodulatory chemokine that binds to a chemokine receptor i.e., a CXC, CC, C, or CX3C chemokine receptor, also can be used in the context of the present invention.
  • chemokines include, but are not limited to, Mipla, Mip- ⁇ , Mip-3a (Larc), ⁇ -3 ⁇ , Rantes, Hcc-1, Mpif-1, Mpif-2, Mcp-1, Mcp-2, Mcp-3, Mcp-4, Mcp-5, Eotaxin, Tare, Elc, 1309, IL-8, Gcp-2 Gro-a, Gro- ⁇ , Gro- ⁇ , Nap-2, Ena-78, Gcp- 2, Ip-10, Mig, I-Tac, Sdf-1, and Bca-1 (Blc), as well as functional fragments of any of the foregoing.
  • the adjuvant may be expressed from a vector, or may be administered simultaneously or sequentially, in any order.
  • the present invention provides a pharmaceutical composition
  • a pharmaceutical composition comprising antigen- presenting cells (or lymphocytes) comprising at least one tumor-associated antigen, or antigen- presenting cells (or lymphocytes) comprising nucleic acids encoding at least one tumor- associated antigen, described herein, where the dendritic cells are treated with at least one MAPK signaling pathway inhibitor.
  • the composition further comprises an adjuvant as described above.
  • the pharmaceutical composition When administered to a subject, the pharmaceutical composition elicits or enhance an immune response to a cell expressing the tumor-associated antigen.
  • the present pharmaceutical composition comprises antigen- presenting cells contacted in vitro or ex vivo with at least one tumor-associated antigen (or tumor-associated peptide antigen).
  • the present invention provides a composition comprising antigen-presenting cells contacted in vitro with nucleic acids encoding at least one tumor-associated antigen.
  • compositions of the present invention can be useful as vaccine compositions for prophylactic or therapeutic treatment of a neoplastic disease or symptoms thereof, particularly for preventing or treating cancer in the subject.
  • the present invention concerns formulation of one or more dendritic cell compositions disclosed herein in pharmaceutically acceptable carriers for administration to a cell or a subject, either alone, or in combination with one or more other modalities of therapy.
  • the pharmaceutical composition may further comprise a pharmaceutically acceptable carrier, diluent, or excipient.
  • a pharmaceutically acceptable carrier diluent, or excipient.
  • Pharmaceutically acceptable carriers known in the art include, but are not limited to, sterile water, saline, glucose, dextrose, or buffered solutions. Agents such as diluents, stabilizers (e.g., sugars and amino acids), preservatives, wetting agents, emulsifying agents, pH buffering agents, additives that enhance viscosity, and the like. Preferably, the medium or carrier will produce minimal or no adverse effects.
  • the pharmaceutical composition may further comprise an adjuvant.
  • the adjuvant employed provides for increased immunogenicity.
  • the adjuvant can be one that provides for slow release of antigen (e.g., a liposome), or it can be an adjuvant that is immunogenic in its own right thereby functioning synergistically with antigens.
  • the adjuvant can be a known adjuvant or other substance that promotes nucleic acid uptake, recruits immune system cells to the site of administration, or facilitates the immune activation of responding lymphoid cells.
  • Adjuvants include, but are not limited to, immunomodulatory molecules (e.g., cytokines), oil and water emulsions, aluminum hydroxide, glucan, dextran sulfate, iron oxide, sodium alginate, Bacto- Adjuvant, synthetic polymers such as poly amino acids and co-polymers of amino acids, saponin, paraffin oil, and muramyl dipeptide.
  • immunomodulatory molecules e.g., cytokines
  • oil and water emulsions aluminum hydroxide
  • glucan dextran sulfate
  • iron oxide iron oxide
  • sodium alginate sodium alginate
  • Bacto- Adjuvant synthetic polymers such as poly amino acids and co-polymers of amino acids, saponin, paraffin oil, and muramyl dipeptide.
  • the adjuvant is an immunomodulatory molecule.
  • the immunomodulatory molecule can be a recombinant protein cytokine, chemokine, or
  • immunostimulatory agent or nucleic acid encoding cytokines, chemokines, or
  • immunostimulatory agents designed to enhance the immunologic response.
  • immunomodulatory cytokines include interferons (e.g., IFN-a, IFN- ⁇ and IFN- ⁇ ), interleukins (e.g., IL-1, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-12, IL- 15, IL-20, and IL-21), tumor necrosis factors (e.g., TNF-a and TNF- ⁇ ), erythropoietin (EPO), FLT-3 ligand, glplO, TCA-3, MCP-1, MIF, ⁇ - ⁇ , ⁇ - ⁇ , Rantes, macrophage colony stimulating factor (M-CSF), granulocyte colony stimulating factor (G-CSF), and granulocyte- macrophage colony stimulating factor (GM-CSF), as well as functional fragments of any of the foregoing.
  • interferons e.g., IFN-a, IFN- ⁇ and
  • any immunomodulatory chemokine that binds to a chemokine receptor i.e., a CXC, CC, C, or CX3C chemokine receptor, also can be used in the context of the present invention.
  • chemokines include, but are not limited to, Mipla, Mip- ⁇ , Mip-3a (Larc), ⁇ -3 ⁇ , Rantes, Hcc-1, Mpif-1, Mpif-2, Mcp-1, Mcp-2, Mcp-3, Mcp-4, Mcp-5, Eotaxin, Tare, Elc, 1309, IL-8, Gcp-2 Gro-a, Gro- ⁇ , Gro- ⁇ , Nap-2, Ena-78, Gcp-2, Ip-10, Mig, I-Tac, Sdf-1, and Bca-1 (Blc), as well as functional fragments of any of the foregoing.
  • the adjuvant is comprised of incomplete Freund's adjuvant (Montanide ISA 51) or Corynebacterium granulosum P40.
  • the pharmaceutical composition can be administered in a therapeutically or a
  • prophylactically effective amount Administering the pharmaceutically acceptable composition of the present invention to the subject can be carried out using known procedures, and at dosages and for periods of time sufficient to achieve a desired effect.
  • a therapeutically or prophylactically effective amount of the pharmaceutical composition can vary according to factors such as the age, sex, and weight of the subject. Dosage regime can be adjusted by one of ordinary skill in the art to elicit the desired immune response including immune responses that provide therapeutic or prophylactic effects.
  • the pharmaceutically acceptable composition can be administered to the subject at any suitable site, for example, a site that is distal to or proximal to a primary tumor.
  • the route of administering can be parenteral, intramuscular, subcutaneous, intradermal, intraperitoneal, intranasal, intravenous (including via an indwelling catheter), via an afferent lymph vessel, or by any other route suitable in view of the neoplastic disease being treated and the subject's condition.
  • the dose will be administered in an amount and for a period of time effective in bringing about a desired response, be it eliciting the immune response or the prophylactic or therapeutic treatment of the neoplastic disease and/or symptoms associated therewith.
  • Administering can be properly timed, and can depend on the clinical condition of the subject, the objectives of administering, and/or other therapies also being contemplated or administered.
  • an initial dose can be administered, and the subject monitored for an immunological and/or clinical response.
  • Suitable means of immunological monitoring include using patient's peripheral blood lymphocyte (PBL) as responders and neoplastic cells as stimulators.
  • An immunological reaction also can be determined by a delayed inflammatory response at the site of administering.
  • One or more doses subsequent to the initial dose can be given as appropriate, typically on a monthly, semimonthly, or a weekly basis, until the desired effect is achieved. Thereafter, additional booster or maintenance doses can be given as required, particularly when the immunological or clinical benefit appears to subside.
  • Single or multiple administrations of the antigen-presenting cells and lymphocytes can be carried out with cell numbers and treatment being selected by a care provider (e.g., a physician).
  • a care provider e.g., a physician
  • the antigen-presenting cells and/or lymphocytes are administered in a
  • Suitable carriers can be the growth medium in which the cells were grown, or any suitable buffering medium such as phosphate buffered saline.
  • the cells can be administered alone or as an adjunct therapy in conjunction with other therapeutics.
  • the antigen-presenting cells or the lymphocytes are administered systemically, e.g., by injection. Alternately, one can administer locally rather than systemically, for example, via injection directly into tissue.
  • the pharmaceutical composition may be in a depot or sustained release formulation.
  • one can administer in a targeted drug delivery system for example, in a liposome that is coated with tissue-specific antibody. The liposomes can be targeted to and taken up selectively by the tissue.
  • compositions may be administered directly, endoscopically, intratracheally, intratumorally, intravenously, intralesionally, intramuscularly, intraperitoneally, regionally, percutaneously, topically, intrarterially, intravesically, or subcutaneously.
  • Compositions may be administered 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more times, and they may be administered every 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 hours, or 1, 2, 3, 4, 5, 6, 7 days, or 1, 2, 3, 4, 5 weeks, or 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12 months.
  • the present APCs comprise at least one tumor-associated antigen (or a fragment thereof) and are also treated with at least one inhibitor of the MAPK signaling pathway.
  • the combination of introducing the tumor-associated antigen (or a fragment thereof) into the APCs and treating the APCs with the inhibitor of the MAPK pathway may produce an additive or synergistic effect (i.e., greater than additive effect) in treating the cancer compared to the effect of introducing the tumor-associated antigen (or a fragment thereof) into the APCs alone or treating the APCs with the inhibitor of the MAPK pathway alone.
  • the combination may result in a (synergistic or additive) increase in apoptosis of cancer cells, a (synergistic or additive) reduction in tumor volume, and/or a (synergistic or additive) increase in survival time.
  • the combination can inhibit tumor growth, achieve tumor stasis, or achieve substantial or complete tumor regression.
  • our data shows the induction of potent anti-tumor CD8 T-cell and CD4 T-cell mediated responses, providing increased survival rates and long-term prevention of tumor growth and dissemination, associated with diminished accumulation of CD4 + Foxp3 + regulatory T cells, and enhanced accumulation of CD4 + IL17 + cells in the spleens of vaccinated subjects.
  • P38 blockade in the presence of rAAV SP17 transduction is superior to rAAV Spl7 transduction alone, in terms of activation of human DC and their ability to generate effector lymphocytes from autologous PBMCs, in vitro.
  • Human monocyte-differentiated DC that the optimum DC activation status is achieved by rAAV in the presence of p38 blockade.
  • Vaccination with rAAV-SP17 transduced autologous DC treated with p38 MAPK inhibitor efficiently eliminates tumors and prevents dissemination.
  • the present invention provides methods to reduce cancer cell growth, proliferation, and/or metastasis, as measured according to routine techniques in the diagnostic art.
  • relevant responses include reduced size, mass, or volume of a tumor, or reduction in cancer cell number.
  • compositions and methods can have one or more of the following effects on cancer cells or the subject: cell death; decreased cell proliferation; decreased numbers of cells; inhibition of cell growth; apoptosis; necrosis; mitotic catastrophe; cell cycle arrest; decreased cell size; decreased cell division; decreased cell survival; decreased cell metabolism; markers of cell damage or cytotoxicity; indirect indicators of cell damage or cytotoxicity such as tumor shrinkage; improved survival of a subject (e.g., increased survival time of a subject); preventing, inhibiting or ameliorating the cancer in the subject, such as slowing progression of the cancer, reducing or ameliorating a sign or symptom of the cancer; reducing the rate of tumor growth in a patient; preventing the continued growth of a tumor, reducing the size of a tumor; and/or disappearance of markers associated with undesirable, unwanted, or aberrant cell proliferation.
  • Methods and compositions of the present invention can be used for prophylaxis as well as amelioration of signs and/or symptoms of cancer.
  • the combination therapy results in a synergistic or additive effect, for example, introducing at least one tumor-associated antigen (or a fragment thereof) into the APCs and treating the APCs with at least one inhibitor of the MAPK pathway may act synergistically or additively, for example, in the apoptosis of cancer cells, inhibition of proliferation/survival of cancer cells, in the production of tumor stasis.
  • the term “synergy” means that the effect achieved with the methods and combinations of this invention is greater than the sum of the effects that result from using the individual agents alone, e.g., introducing at least one tumor-associated antigen (or a fragment thereof) into the APCs alone, and treating the APCs with at least one inhibitor of the MAPK pathway alone.
  • the effect e.g., apoptosis of cells or an increase in apoptosis of cells, a decrease in cell viability, cytotoxicity or an increase in cytotoxicity, a decrease in cell proliferation, a decrease in cell survival, inhibition of tumor growth, a reduction in tumor volume, the subject's survival time or an increase in the subject's survival time, the amount of the antibodies specific to the tumor associated antigen or an increase in the subject's amount of the antibodies specific to the tumor associated antigen, levels of cytokines such as IFN- ⁇ and/or TNF-a or an increase in levels of cytokines such as IFN- ⁇ and/or TNF-a, levels of TNFa + or IFNy + cells or an increase in levels of TNFa + or IFNy + cells, a decrease in levels of cytokines such as IL-10 and/or IL-4, the migration index of monocytes, macrophages or splenocytes or an increase in the migration index of monocytes, macrophages or
  • the present composition or method e.g., the combination of introducing the tumor-associated antigen (or a fragment thereof) into the APCs and treating the APCs with the inhibitor of the MAPK pathway
  • the present composition or method may be about 1.1 fold, about 1.2 fold, about 1.3 fold, about 1.4 fold, about 1.5 fold, about 1.6 fold, about 1.7 fold, about 1.8 fold, about 1.9 fold, about 2 fold, about 2.5 fold, about 3 fold, about 3.5 fold, about 4 fold, about 4.5 fold, about 5 fold, about 5.5 fold, about 6 fold, about 6.5 fold, about 7 fold, about 8 fold, about 9 fold, about 10 fold, about 12 fold, about 15 fold, about 20 fold, about 25 fold, about 30 fold, about 50 fold, about 100 fold, at least about 1.2 fold, at least about 1.5 fold, at least about 2 fold, at least about 2.5 fold, at least about 3 fold, at least about 3.5 fold, at least about 4 fold, at least about 4.5 fold, at least about 5 fold, at least about 5.5 fold, at
  • Synergistic effects of the combination may also be evidenced by additional, novel effects that do not occur when either agent is administered alone, or by reduction of adverse side effects when either agent is administered alone.
  • Cytotoxicity effects can be determined by any suitable assay, including, but not limited to, assessing cell membrane integrity (using, e.g., dyes such as trypan blue or propidium iodide, or using lactate dehydrogenase (LDH) assay), assaying cell lysis, measuring enzyme activity, measuring cell adherence, measuring ATP production, measuring co-enzyme production, measuring nucleotide uptake activity, crystal violet method, Tritium-labeled Thymidine uptake method, measuring lactate dehydrogenase (LDH) activity, 3-(4, 5-Dimethyl-2-thiazolyl)-2, 5- diphenyl-2H-tetrazolium bromide (MTT) or MTS assay, sulforhodamine B (SRB) assay, WST assay, clonogenic assay, cell number count, monitoring cell growth, etc.
  • assessing cell membrane integrity using, e.g., dyes such as trypan blue or propidium iodide, or
  • Apoptosis of cells may be assayed by any suitable method, including, but not limited to, TU EL (terminal deoxynucleotidyl transferase dUTP nick end labeling) assay, assaying levels of cytochrome C release, assaying levels of cleaved/activated caspases, assaying 5-bromo-2'- deoxyuridine labeled fragmented DNA, assaying levels of survivin etc.
  • TU EL terminal deoxynucleotidyl transferase dUTP nick end labeling
  • compositions and combinations include, but are not limited to, clonogenic assay (colony formation assay) to show decrease in cell survival and/or proliferation, studying tumor volume reduction in animal models (such as in mice, etc.)
  • such synergy provides greater efficacy at the same doses, lower side effects, and/or prevents or delays the build-up of multi-drug resistance.
  • Introducing at least one tumor-associated antigen (or a fragment thereof) into the APCs and treating the APCs with the inhibitor of the MAPK signaling pathway may be carried out simultaneously, separately or sequentially. They may exert an advantageously combined effect (e.g., additive or synergistic effects).
  • At least one tumor-associated antigen (or a fragment thereof) is introduced into the APCs first and then the APCs are treated with
  • the APCs are treated with an MAPK pathway inhibitor first and then at least one tumor-associated antigen (or a fragment thereof) is introduced into the APCs.
  • the first treatment can precede the second treatment by seconds, minutes, hours, days, or weeks.
  • the time difference in non-simultaneous treatments may be greater than 1 minute, and can be, for example, precisely, at least, up to, or less than 5 minutes, 10 minutes, 15 minutes, 30 minutes, 45 minutes, 60 minutes, 2 hours, 3 hours, 6 hours, 9 hours, 12 hours, 24 hours, 36 hours, or 48 hours, or more than 48 hours.
  • the two treatments can be carried out within minutes of each other or within about 0.5, about 1, about 2, about 3, about 4, about 6, about 9, about 12, about 15, about 18, about 24, or about 36 hours of each other or within about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 14 days of each other or within about 2, 3, 4, 5, 6, 7, 8, 9, or 10 weeks of each other. In some cases, longer intervals are possible.
  • the pharmaceutical composition can be given subsequent to, preceding, or
  • the subject may previously or concurrently be treated by
  • Such other therapies preferably are provided in such a way so as not to interfere with the immunogenicity of the compositions of the present invention.
  • the pharmaceutically acceptable composition can be administered at any time that is appropriate.
  • the administering can be conducted before or during traditional therapy of a subject having a tumor burden, and continued after the tumor becomes clinically undetectable.
  • the administration also can be continued in a subject showing signs of recurrence.
  • the chemotherapeutic agent may be naturally occurring or synthetic, for example as described in "Cancer Chemotherapeutic Agents", American Chemical Society, 1995, W. O. Foye Ed.
  • the chemotherapeutic agents may be compounds interacting with or binding tubulin, growth factor receptor antagonists, alkylating agents or platinum compounds, anthracyclines, as DNA intercalators or as DNA cross-linking agents, including DNA minor-groove binding compounds, anti-metabolites, bleomycin type antibiotics, inhibitors of DNA transcribing enzymes, and especially the topoisomerase I or topoisomerase II inhibitors, chromatin modifying agents, antimitotic agents, cell-cycle inhibitors, proteasome inhibitors, enzymes, hormones, hormone antagonists, hormone inhibitors, inhibitors of steroid biosynthesis, steroids, cytokines, hypoxia- selective cytotoxins, inhibitors of cytokines, lymphokines, antibodies directed against cytokines, oral and parenteral tolerance induction agents, supportive agents, chemical radiation sensit
  • Non-limiting examples of chemotherapeutic agents include paclitaxel (taxol), docetaxel, a vinca alkaloid such as navelbine, vinblastin, vincristin, vindesine or vinorelbine, an alkylating agent or a platinum compound such as melphalan, cyclophosphamide, an oxazaphosphorine, cisplatin, carboplatin, oxaliplatin, satraplatin, tetraplatin, iproplatin, mitomycin, streptozocin, carmustine (BCNU), lomustine (CCNU), busulfan, ifosfamide, streptozocin, thiotepa, chlorambucil, a nitrogen mustard such as mechlorethamine, an immunomodulatory drug such as thalidomide and its derivatives, or revimid (CC-5013)), an ethyleneimine compound, an alkylsulphonate, daunorubicin, doxorubicin (
  • chromomycin, olivomycin, a phtalanilide such as propamidine or stilbamidine, an anthramycin, an aziridine, a nitrosourea or a derivative thereof, a pyrimidine or purine analogue or antagonist or an inhibitor of the nucleoside diphosphate reductase such as cytarabine, 5-fluorouracile (5- FU), uracil mustard, fludarabine, gemcitabine, capecitabine, mercaptopurine, cladribine, thioguanine, methotrexate, pentostatin, hydroxyurea, or folic acid, an acridine or a derivative thereof, a rifamycin, an actinomycin, adramycin, a camptothecin such as irinotecan (camptosar) or topotecan, an amsacrine or analogue thereof, a tricyclic carboxamide, an histonedeace
  • cancer cells such as apolizumab or 1D09C3.
  • the cancer that can be treated or prevented by the present methods and compositions includes, but is not limited to, solid malignancies and hematologic malignancies.
  • the cancer may be primary or metastatic.
  • the cancer may be Stage 0, Stage I, Stage II, Stage III, or Stage IV.
  • the cancer also can be characterized as benign or malignant.
  • the cancer may be metastatic, progressive and/or refractory.
  • the cell that expresses a tumor-associated antigen can be any type of cell.
  • the cell can be a cancer cell, a precancerous cell, or a cell-type predisposed to developing cancer.
  • the subject can either have a neoplastic disease (e.g., a tumor), or be at risk of developing the neoplastic disease.
  • Subjects can be characterized by clinical criteria, for example, those with advanced neoplastic disease or high tumor burden exhibiting a clinically measurable tumor.
  • a clinically measurable tumor is one that can be detected on the basis of tumor mass (e.g., by palpation, MRI, CAT scan, X-ray).
  • the pharmaceutically acceptable composition in accordance with the present invention can be administered to subjects with advanced disease with the objective of mitigating their condition.
  • a reduction in tumor mass occurs as a result of administering the pharmaceutically acceptable composition of the present invention, but any clinical improvement constitutes a benefit.
  • Clinical improvement includes decreased risk or rate of progression or reduction in pathological consequences of a tumor, for example.
  • the subject can be one that has a history of cancer and has been responsive or irresponsive to another mode of therapy.
  • the other therapy may have included e.g., surgical resection, radiotherapy, chemotherapy, and other modes of
  • a pharmaceutical composition of the present invention can be administered to the subject to elicit an anti-cancer response primarily as a prophylactic measure against recurrence.
  • administering the composition delays recurrence of the cancer, or more preferably, reduces the risk of recurrence (i.e., improves the cure rate).
  • Such parameters can be determined in comparison with other patient populations and other modes of therapy.
  • Cancers that may be evaluated by methods and compositions of the invention include cancer of the bladder, blood, bone, bone marrow, brain, breast, colon, esophagus, gastrointestine, gum, head, kidney, liver, lung, nasopharynx, neck, ovary, pancreas, prostate, skin, stomach, testis, tongue, or uterus.
  • the cancer may specifically be of the following histological type, though it is not limited to these: neoplasm, malignant; carcinoma; carcinoma,
  • adenocarcinoma papillary and follicular adenocarcinoma; nonencapsulating sclerosing carcinoma; adrenal cortical carcinoma; endometroid carcinoma; skin appendage carcinoma; apocrine adenocarcinoma; sebaceous adenocarcinoma; ceruminous adenocarcinoma;
  • mucoepidermoid carcinoma cystadenocarcinoma; papillary cystadenocarcinoma; papillary serous cystadenocarcinoma; mucinous cystadenocarcinoma; mucinous adenocarcinoma; signet ring cell carcinoma; infiltrating duct carcinoma; medullary carcinoma; lobular carcinoma;
  • inflammatory carcinoma paget's disease, mammary; acinar cell carcinoma; adenosquamous carcinoma; adenocarcinoma w/squamous metaplasia; thymoma, malignant; ovarian stromal tumor, malignant; thecoma, malignant; granulosa cell tumor, malignant; androblastoma, malignant; Sertoli cell carcinoma; leydig cell tumor, malignant; lipid cell tumor, malignant; paraganglioma, malignant; extra-mammary paraganglioma, malignant; pheochromocytoma; glomangiosarcoma; malignant melanoma; amelanotic melanoma; superficial spreading melanoma; malig melanoma in giant pigmented nevus; epithelioid cell melanoma; blue nevus, malignant; sarcoma; fibrosarcoma; fibrous histiocytoma
  • nephroblastoma hepatoblastoma
  • carcinosarcoma mesenchymoma, malignant; brenner tumor, malignant; phyllodes tumor, malignant; synovial sarcoma; mesothelioma, malignant;
  • dysgerminoma embryonal carcinoma; teratoma, malignant; struma ovarii, malignant; choriocarcinoma; mesonephroma, malignant; hemangiosarcoma; hemangioendothelioma, malignant; kaposi's sarcoma; hemangiopericytoma, malignant; lymphangiosarcoma;
  • osteosarcoma juxtacortical osteosarcoma; chondrosarcoma; chondroblastoma, malignant;
  • mesenchymal chondrosarcoma giant cell tumor of bone; ewing's sarcoma; odontogenic tumor, malignant; ameloblastic odontosarcoma; ameloblastoma, malignant; ameloblastic fibrosarcoma; pinealoma, malignant; chordoma; glioma, malignant; ependymoma; astrocytoma; protoplasmic astrocytoma; fibrillary astrocytoma; astroblastoma; glioblastoma; oligodendroglioma;
  • oligodendroblastoma primitive neuroectodermal; cerebellar sarcoma; ganglioneuroblastoma; neuroblastoma; retinoblastoma; olfactory neurogenic tumor; meningioma, malignant;
  • neurofibrosarcoma neurofibrosarcoma; neurilemmoma, malignant; granular cell tumor, malignant; malignant lymphoma; Hodgkin's disease; Hodgkin's lymphoma; paragranuloma; malignant lymphoma, small lymphocytic; malignant lymphoma, large cell, diffuse; malignant lymphoma, follicular; mycosis fungoides; other specified non-Hodgkin's lymphomas; malignant histiocytosis; mast cell sarcoma; immunoproliferative small intestinal disease; leukemia; lymphoid leukemia; plasma cell leukemia; erythroleukemia; lymphosarcoma cell leukemia; myeloid leukemia; basophilic leukemia; eosinophilic leukemia; monocytic leukemia; mast cell leukemia; megakaryoblastic leukemia; myeloid sarcoma; and hairy cell leuk
  • the cancer treated or diagnosed by the present methods or compositions is multiple myeloma. In another embodiment, the cancer treated or diagnosed by the present methods or compositions is lymphoma. In a third embodiment, the cancer treated or diagnosed by the present methods or compositions is breast cancer. In a fourth embodiment, the cancer treated or diagnosed by the present methods or compositions is adenocarcinoma, which may be from breast, colon, liver, stomach, etc. In a fifth embodiment, the cancer treated or diagnosed by the present methods or compositions is metastatic solid malignancy which may or may not demonstrate a measurable response to first-line, conventional systemic therapy. In a sixth embodiment, the cancer treated or diagnosed by the present methods or compositions is progressive and/or refractory solid malignancy.
  • the present invention further pertains to a kit containing the present pharmaceutical composition.
  • the kit or container holds an effective amount of a pharmaceutical composition for carrying out the methods or producing the compositions described herein and/or instructions for producing or using the compositions for therapy of a patient or subject having or suspected of having or at risk of developing cancer.
  • kits can comprise various components of the pharmaceutically acceptable composition or vaccines thereof provided in separate containers as well as various other active ingredients or agents including chemotherapeutic agents.
  • the subject is any living organism in which an immune response can be elicited. Examples of subjects include, without limitation, humans, livestock, dogs, cats, mice, rats, and transgenic species thereof.
  • Example 1 Engineered dendritic cell vaccination for long-term protection against ovarian cancer
  • Immunotherapy for ovarian cancer may prove effective for long-term control of the disease.
  • rAAV adenovirus associated virus vector
  • SP17 sperm protein 17
  • qPCR was performed with mSP17 (murine Spl7) primer sets upstream 5'- AGATCTATGTCGATTCCTTTCTCCAACACCC (SEQ ID NO. 2), downstream 5'- CTCGAGTCAATTGTCTGCCTCTTCTTTCAGA-3' (SEQ ID NO. 3) and ⁇ -actin (upstream 5'- ATGGATGACGATATCGCTGCGC-3 ' (SEQ ID NO. 4), downstream 5'- GGAACCGCTCGTTGCCAATAGTG-3 ') (SEQ ID NO. 5).
  • the AAV-mSP17 genome was constructed as a plasmid as previously described. Chiriva- Internati et al., Testing recombinant adeno-associated virus-gene loading of dendritic cells for generating potent cytotoxic T lymphocytes against a prototype self-antigen, multiple myeloma HM1.24. Blood 102, 3100-3107 (2003). Yu et al, rAAV/Her-2/neu loading of dendritic cells for a potent cellular-mediated MHC class I restricted immune response against ovarian cancer. Viral Immunol 21, 435-442 (2008). The mSP17 (murine SP17) cDNA was inserted into the rAAV vector, dl6-95.
  • Figure la shows a structural map of the rAAV/mSP17 vector.
  • the mSP17 gene was expressed from the rAAV p5 promoter, which has been described to be active in DC.
  • Santin et al In vitro induction of tumor-specific human lymphocyte antigen class I-restricted CD8 cytotoxic T lymphocytes by ovarian tumor antigen-pulsed autologous dendritic cells from patients with advanced ovarian cancer. Am J Obstet Gynecol 183, 601-609 (2000).
  • the rAAV vector infected cells expressed the target antigens, as confirmed by RT-PCR (Fig. lb).
  • the human rAAV-SP17 vector was produced following the same scheme described for mSP17.
  • Human full length SP17 coding sequence was obtained by gene synthesis from GenScript.
  • Amino acid sequences of human SP17 may be found under the following NCBI Reference Sequence (RefSeq) accession number: NP 059121 (SEQ ID NO:6).
  • Nucleic acid sequences encoding human SP17 may be found under the following NCBI RefSeq accession number: NM O 17425, or GenBank accession number BC032457.
  • DNA was extracted from virus crude lysates, and the titer of virus stocks was determined by real-time PCR. Briefly, we used serial dilutions of the corresponding rAAV vector for construction of a standard curve (Fig. lc shows a representative result for rAAV-mSpl7). The real-time PCR was performed on an ABI Prism 7000 instrument (Applied Biosystems, Darmstadt, Germany) in a 50- ⁇ 1 reaction volume.
  • DC dendritic cells
  • Murine DC were generated from splenocytes. We infected adherent monocytes with rAAV as previously described. Chiriva-Internati et al, Testing recombinant adeno-associated virus-gene loading of dendritic cells for generating potent cytotoxic T lymphocytes against a prototype self-antigen, multiple myeloma HM1.24. Blood 102, 3100-3107 (2003). Chiriva- Internati et al , Efficient generation of cytotoxic T lymphocytes against cervical cancer cells by adeno-associated virus/human papillomavirus type 16 E7 antigen gene transduction into dendritic cells. Eur J Immunol 32, 30-38 (2002).
  • PBMCs Peripheral blood mononuclear cells
  • RPMI 1640 Ficoll-Hypaque (Sigma) density gradient centrifugation and either cryopreserved in RPMI 1640 plus 10% dimethyl sulfoxide and 30% autologous plasma or immediately used for DC
  • PBMC peripheral blood were placed into six-well culture plates (Costar, Cambridge, Mass.) containing 3 ml of AIM-V (Gibco-BRL) at 0.5 ⁇
  • DC peripheral blood leukocytes
  • PBL peripheral blood leukocytes
  • rAAV-transduced human DC were differentiated from rAAV-infected monocytes as we have previously described.
  • Chiriva-Internati et al. Testing recombinant adeno-associated virus- gene loading of dendritic cells for generating potent cytotoxic T lymphocytes against a prototype self-antigen, multiple myeloma HM1.24. Blood 102, 3100-3107 (2003).
  • Chiriva-Internati et al Efficient generation of cytotoxic T lymphocytes against cervical cancer cells by adeno- associated virus/human papillomavirus type 16 E7 antigen gene transduction into dendritic cells. Eur J Immunol 32, 30-38 (2002).
  • 10 ⁇ p38 MAP Kinase inhibitor III (p38i, also called ML3403, (RS)- ⁇ 4-[5-(4- Fluorophenyl)-2-methylsulfanyl-3H-imidazol-4-yl]pyridin-2-yl ⁇ -(l-phenylethyl)amine], EMD Chemicals, La Jolla, CA) was added at days 0, 3 and 5.
  • C57BL/6 mice Six-week-old female C57BL/6 mice were obtained from the Jackson Laboratory (Bar Harbor, ME, USA). Cells (e.g., ID8 cells) were cultured in RPMI 1640 medium supplemented with 10% fetal bovine serum in 5% C0 2 at 37 °C.
  • mice Female C57BL/6 mice (6 weeks old) were challenged i.p. (intraperitoneally) with lxlO 6 ID8 cells. Chiriva-Internati et al, Cancer testis antigen vaccination affords long-term protection in a murine model of ovarian cancer. PLoS One 5, el 0471 (2010). 30 days after tumor challenge, mice were i.m. injected (intramuscular injection) once a month for 10 months with rAAV or rAAV-mSP17 transduced DC treated or not with the p38 MAPK inhibitor. Each mouse was injected with 10 6 DC.
  • murine splenocytes from tumor- challenged mice or human non-adherent PBMCs from ovarian cancer patients were washed twice in PBS, incubated with 10% autologous serum in PBS for 30 minutes on ice to block Fc receptors, then incubated with phycoerythrin-conjugated anti-CD3 PE-CF-594 antibody (BD Biosciences) for 1 h on ice in staining buffer (0.5% BSA in PBS). After washing twice in 0.5 mL staining buffer, cells were fixed with 4% buffered paraformaldehyde at 4°C for 30 minutes in the dark.
  • the spleen was meshed with a sterile filter, and then centrifuged at 800 x g for 5 minutes at 4°C. Splenocytes were then isolated by Lympholyte-M (Cedarlane Ltd, Burlington, NC). Human lymphocytes were recovered from the non-adherent fraction of purified PBMCs after a 3 -hour incubation in 6-well plates.
  • Serum anti-mSP17 IgGi levels were measured using commercial ELISA kit (U-CyTech, Utrecht, Netherlands), according to the manufacturer's directions. The absorbance was read at 450 nm using a Victor 2 1420 Multilabel Counter (Perkin Elmer, Waltham, MA).
  • Sera were collected post-mortem, and cytokine levels were measured by using commercial ELISA kits (R&D Systems, Minneapolis, MN), in accordance with the manufacturer's instructions.
  • Cytokine expression by splenocytes was evaluated using an ELISPOT assay (U-CyTech, Utrecht, Netherlands), according to the manufacturer's directions. Positive control for cellular activation was Con-A (5 ⁇ g/mL), and background wells contained RPMI 1640 medium only. Spot counts were performed with the AID ELISPOT Reader System (Cell Technology, Inc., MD). Cytotoxicity assay
  • the bottom chambers of polycarbonate Corning® TranswellTM Permeable Supports (5 ⁇ pore size, Cole-Parmer, Vernon Hills, Illinois) were coated with ID8 cells. 200,000 splenocytes were added in the upper chamber in complete medium. After 4 hours, the density of migrated cells in the bottom wells was determined. The assay was performed in triplicate and mean ⁇ SEM were determined.
  • Tumor growth, cytotoxicity assays, ELISPOT, ELISA, migration assays and flow- cytometry were analyzed by a two-tailed, paired Student's test and survival rates were analyzed by the log-rank test.
  • DC were treated as follows: infection with rAAV alone, infection with rAAV-mSP17 alone, or infection with rAAV-mSP17 plus a p38 MAP-kinase inhibitor treatment.
  • p38i i.e., the rAAV-mSpl7 + p38i sample
  • rAAV-mSpl8 + p38i DC expressed significantly higher levels of MHC-I and lower levels of B7- HI (One-way ANOVA and Bonferroni's post-test p ⁇ 0.001 for both markers). MHC-I increase was 52%, while B7-H1 decrease was 30%, compared with rAAV and rAAV-mSP17 DC.
  • Vaccination with rAAV-mSP '17 transduced autologous DC treated with p38 MAPK inhibitor efficiently eliminates tumors and prevents dissemination, thereby providing long-term protection
  • a total of 50 C57BL/6 female mice were included in the study per experiment. 40 mice were i.p. injected with 10 6 ID8 cells and randomly assigned to the following groups after 30 days: animals in group 1 received i.p.
  • rAAV-mSP17 DC + p38i vaccine prevents mortality for at least 10 months, representing a dramatic improvement in survival rates compared with tumor- bearing mice vaccinated with rAAV-mSP17 DC or rAAV DC (Fig. 3a). Specifically, 95% of rAAV-mSP17 DC + p38i vaccinated animals survived up to 300 days, while rAAV-mSP17 DC- vaccinated mice or rAAV DC-vaccinated mice died within 98 and 60 days, respectively.
  • Figure 3b shows the macroscopic effects of vaccination in five mice randomly chosen from each group. Reduction of body enlargement and ascites was evident in ID8 tumor-bearing mice given rAAV-mSP17 DC vaccination, relative to non-vaccinated mice, but a greater effect was seen in tumor-bearing mice vaccinated with rAAV-mSP17 DC + p38i, in which no macroscopic evidence of tumor growth could be found. Involvement of peritoneal lymph nodes was detected in ID8-injected mice but not in rAAV-mSP17 DC + p38i vaccinated mice.
  • ELISA assays revealed a significant increase in anti-SPl 7 IgG levels following rAAV- mSP17 DC vaccination compared with empty rAAV vector-transduced DC, but even higher levels were detected with rAAV-mSP17 DC + p38i (Fig. 4a; two-tailed t-test rAAV-mSP17 + p38i versus rAAV or rAAV-mSP17 p ⁇ 0.01).
  • Thl cytokine expression is elevated in rAAV-mSpl7 DC + p38 vaccinated mice
  • ELISA assays showed that, compared to untreated DC vaccinated mice, sera collected from rAAV-mSP17 DC + p38i vaccinated animals contained elevated levels of IFN- ⁇ and TNF- a, and relatively lower levels of Th2-type cytokines, namely IL-10 and IL-4 (Fig. 4b). Expression of Thl cytokines correlated with detection of TNF-a and IFN- ⁇ secreting lymphocytes in the spleen taken from mice vaccinated with rAAV-mSP17 DC + p38i (Fig. 4c). rAA V-mSPl 7 DC + p38i vaccination induces potent cytotoxic responses against ID8 cells
  • Cytotoxicity assays were performed using ID8 cells as targets and splenocytes taken postmortem from control or rAAV DC, rAAV-mSP17 DC or rAAV-mSP17 DC + p38i mice after priming with autologous DC as effectors.
  • rAAV-mSP17 DC + p38i or control rAAV-mSP17 DC we used a transwell migration assay to test migration of splenocytes from mice treated with different vaccine formulations.
  • ID 8 cells we observed a 2.5-fold increase in migrating splenocytes from rAAV-mSP17 DC + p38i vaccinated mice compared with splenocytes from rAAV-mSP17 DC vaccinated mice.
  • rAA V-mSPl 7 DC + p38i vaccination amplifies Thl 7 frequencies and hampers T-reg expansion
  • T-reg frequencies in rAAV-mSP17 DC + p38i vaccinated mouse spleens were still higher than in healthy controls, but were significantly lower than in untreated animals (it should be noted that this analysis was conducted with splenocytes rather than with tumor-infiltrating lymphocyte populations, for the simple reason that tumors could not be detected in ID8-injected mice vaccinated with rAAV-mSP17 DC +p38i). Reduced Treg and increased Thl7 frequencies thus correlated with improved survival (Fig. 3a). p38 inhibition improves the activation phenotype and the T cell activation potential of human DC derived from rAA V-transduced monocytes in vitro
  • Non-adherent autologous PBMCs were then co-cultured with different DC preparations detailed above for 7 days, as described in Methods, and their activated versus regulatory phenotype was assayed by flow-cytometry for Foxp3 in the CD3 population (suppressor T cells) and for IFNy/TNFa (activated effector T cells).
  • Figure 9A shows representative plots from one subject and figure 9B shows the statistical analyses.
  • the blockade of p38 did not affect the frequency of TNFa + cells, but resulted in an increase of IFNy + and consequently of TNFa + IFNy + cells (figures 9B). Consistently with these findings, p38i significantly reduced the frequency of Foxp3 + T cells (Foxp3 + CD3 + , figure 9B).
  • rAAV-mSP17 DC + p38i injected mouse splenocytes expressed more Thl (IFN- ⁇ and TNF-a) and less Th2 (IL-10, IL-4) cytokines compared to rAAV-mSP17 DC or AAV DC groups.
  • IFN- ⁇ and T F- ⁇ have been shown to provide protective effects in OC patients, while IL-10 and IL-4 are associated with reduced immune response and worse prognosis.
  • T cell IFN- ⁇ expression correlates with splenocytes ELISPOT and serum ELISA assays, indicating that the rAAV-mSP17 transduction alone provides partial DC programming towards a Thl -polarizing profile, but inhibition of p38 MAPK is required to achieve maximum effects.
  • Our observations are in accordance with the superior anti-tumor cytotoxic activity displayed by the splenocytes of rAAV-mSP17+p38 inhibitor treated mice, compared to all of the other groups.
  • cytotoxic response was achieved without re- stimulation of splenocytes with autologous dendritic cells in vitro, proving that our vaccine strategy induced a memory response, which was dramatically evident in the rAAV-mSP17+p38 inhibitor group, which persisted for 300 days.
  • lymphocytic tumor infiltration is considered a positive prognostic factor in OC patients
  • the observation that only rAAV-mSP17 DC + p38i splenocytes were able to migrate towards ID8 OC cells in vitro highlights the potential clinical relevance of our results.
  • B7-H1 has been shown to be expressed in DC and myeloid cells in OC and this expression suppresses T effector functions by engaging PD-1 receptor expressed on T-cells. Cannon et al, Dendritic cell vaccination against ovarian cancer tipping the Treg/T(H)17 balance to therapeutic advantage? Expert Opin Biol Ther 28, 28 (2011). Liu et al., B7-H1 on myeloid- derived suppressor cells in immune suppression by a mouse model of ovarian cancer. Clin Immunol 129, 471-481 (2008). Accordingly, B7-H1 blockade on tumor-derived DC has been shown to improve T-cell stimulation in vitro.
  • B7-H1 Blockade of B7-H1 improves myeloid dendritic cell-mediated antitumor immunity. Nat Med 9, 562-567 (2003). Thus, down-regulation of B7-H1 is highly significant and we hypothesize that it accounts, in part, for the reduced Treg frequency we detected in vivo.
  • Example 2 Phase I/II study of low-dose cyclophosphamide, tumor associated peptide antigen-pulsed dendritic cell therapy and low dose granulocyte-macrophage colony stimulating factor, as consolidation therapy in patients with metastatic solid malignancies, or in patients with progressive and/or refractory solid malignancies
  • immunogenic maturation cocktail [9,12, 18,19]. Patients will also be treated with low-dose CYP prior to each DC vaccination, in an attempt to decrease the number and activity of Tregs. Low- doses of GM-CSF will be administered following each DC vaccination, in order to optimize immune responses in patients with relapsed/refractory SM. In a recent study conducted by others, dendritic cells loaded with tumor lysates have been combined with GM-CSF, pegylated IFN and cyclophosphamide to treat patients with refractory SM [9].
  • the regime to treat patients with metastatic SM (who may or may not demonstrate a tumor response to conventional first-line systemic therapy) or patients with relapsed and/or refractory SM, and whose tumor cells express at least one TAP A, include, using low-dose CYP followed by an autologous, monocyte-derived, TAPA-pulsed DC vaccine and low-dose GM- CSF.
  • This treatment regime will result in TAPA-specific CD4+ T-cell and CD8+ CTL responses without significant toxicities.
  • CD4+ T-cell and CD8+ CTL responses generated against specific TAPAs may translate into clinical antitumor activity.
  • the methods disclosed herein may be used to treat or prevent solid malignancy or hematologic malignancy.
  • the malignancy is lymphoma.
  • the malignancy is multiple myeloma.
  • the malignancy is breast cancer.
  • SM metastatic solid malignancies
  • TAPAs Tumor Associated Peptide Antigens
  • TAPAs Patients whose tumors express one or more of these TAPAs will receive three (3) days of subcutaneous Granulocyte Macrophage Colony Stimulating Factor (GM-CSF) to increase bone marrow production of monocytes and dendritic cell (DC) precursors, and whole blood will be obtained by phlebotomy and/or leukapheresis performed for generation of autologous DCs.
  • GM-CSF subcutaneous Granulocyte Macrophage Colony Stimulating Factor
  • DCs dendritic cell
  • Patient's DCs will be generated, and activated by pulsing/loading them with the TAPA(s) relevant for each particular patient.
  • Patients will receive 5 days of low-dose cyclophosphamide prior to each vaccination with TAPA-pulsed DCs to decrease Treg activity.
  • TAPA-pulsed DCs will be administered at a dose of 1 X 10 7 DCs at least two (2) days following cyclophosphamide administration.
  • DC vaccination schedule will be once every 14 days via subcutaneous (SC) and intradermal (ID) injections for a total of 6 vaccinations.
  • Low dose GM- CSF will also be administered SC for 5 consecutive days, starting six (6) hours after each TAPA- pulsed DC treatment, to optimize immune responses.
  • Patients will be followed on a weekly basis (or more frequently if required) to evaluate treatment-related toxicity.
  • Immune responses and anti-tumor responses will also be evaluated. Continuation and stopping rules for the study will be defined based on toxicity/tolerability (Phase I) and/or immune responses (Phase II).
  • the more specific protocol of the study is as follows. After patients are enrolled in the study program due to cancer cell expression of one or more of the relevant TAP As by RT-PCR and/or Western blot, IHC, ELISA, they consent for either leukapheresis or phlebotomy. The leukapheresis or phlebotomy product is processed. The PBMCs are separated over Ficoll density gradient centrifugation. PBMC are pelleted and resuspended in CellGro DC serum free media (CellGenix, H, USA) with L-glutamine. PBMCs are counted using a hemacytometer and viability determined using trypan blue (1 : 1) exclusion.
  • PBMCs For generation of a total DC vaccine bank all PBMCs are transferred to T 150 flasks for monocyte sorting and iDC (immature DC) generation. For generation of only one fresh DC vaccine dose five/sixths (5/6 th ) of the total number of PBMCs are cryopreserved in five (5) or more 2 ml NUNC vials. The remaining one- sixth (l/6 th ) of the Ficoll-purified PBMC are utilized for generation of iDCs.
  • iDC immature DC
  • PBMCs are washed and resuspended in T-150 tissue culture flasks at 1.0 X 10 8 per flask in CellGro DC serum free media with L-glutamine and incubated at 37°C for 2 hours in a 5% C0 2 incubator.
  • non-adherent cells are removed by three gentle washes with CellGro DC serum free media and adherent cells cultured in CellGro DC serum free media plus 10% autologous (patient) plasma, 800 U/ml of IL-4 and 1000 U/ml of GM-CSF, and incubated at 37°C and 5% CO 2 for six (6) to eight (8) days (average seven (7) days).
  • Fresh IL-4/GM-CSF are added on days two (2), four (4) and six (6). DC cultures are observed every other day.
  • TVC Total Volume Count
  • DCs are kept on T-150 flasks at a density of approximately 5 X 10 5 DC cells/ml for peptide pulsing or alternatively, washed with phosphate buffered saline (PBS) and transferred (adherent and non-adherent DCs) to 50 ml conical tubes.
  • DC culture is then pulsed with 20 ⁇ g/mL of one or more of the relevant tumor associated peptide antigens (TAP As) (i.e., one or more peptides derived from Spl7, AKAP-4, Ropporin, PTTG-1, HMI.24, Her-2/neu, NY-ESO- 1, MAGE-1, SPAN-Xb; see SEQ ID Nos.
  • TEP As tumor associated peptide antigens
  • DC maturation cocktail IL- ⁇ and TNFa at 50 ng/ml, INF a at 1000 IU/ml and poly (I:C) at 20 ⁇ g/ml.
  • DC culture is then incubated at 37°C and 5% CO 2 for 16-24 hrs (average 20 hrs). After 16-24 hrs of incubation, pulsing/maturation treatment is stopped by centrifugation and peptide/cytokine containing medium removed. DCs are washed twice and resuspend DCs in D- PBS IX (Gibco). Number of pulsed/mature DCs is determined (based on DC phenotype release assay results) and the appropriate dose loaded into a syringe.
  • the DC vaccine release criteria include: a passing result for the phenotype release assay is defined as cells expressing > 70% CD86, CD80, CD83, CD58, CDla, HLA-DR and ⁇ 10% CD14, within the DC gate, DC viability of more than 80%, and negative test results for endotoxin, mycoplasma, fungal, aerobic and anaerobic cultures.
  • DC vaccination strategies have been studied clinically in many different diseases. Both monocyte-derived DCs and CD34+-derived DCs have been used in the presence of serum-free mediums, autologous serum-containing mediums, or fetal calf serum-containing mediums. Because these cells have been generated from autologous cells, their administration either intravenously (IV), subcutaneously (SC) or intradermally (ID) has not been associated with any significant adverse effects. Minor adverse effects may include low grade fever and local reactions, such as erythema, at the sites of injection.
  • DCs Dendritic Cells
  • DCs will be derived from monocyte precursors present in peripheral blood mononuclear cells (PBMC) cultures following phlebotomy and/or leukapheresis.
  • Monocyte precursors will be cultured in CellGro serum free media (CellGenix, USA), 10% plasma from patients or human AB serum (Biowhittaker) tested for endotoxin, 800 U/ml of IL-4 and 1000 U/ml of GM-CSF (CellGenix, USA) for seven (7) days.
  • PBMC peripheral blood mononuclear cells
  • DC vaccine will be prepared by "pulsing" immature DCs with relevant, recombinant TAP As (20 ⁇ g/ml) for four (4) hours followed by the addition of a DC maturation cytokine cocktail containing IL- ⁇ and TNFa at 50 ng/ml (CellGenix, USA), poly (I:C) at 20 (Hemisphere or InvivoGene, USA) and INFa at 1000 IU/ml
  • DCs for the first vaccine dose will be generated from one sixth (l/6 th ) of the original pool of PBMCs, with subsequent DC vaccine doses generated from cryopreserved PBMCs prior to vaccination day.
  • Mature DCs (or PBMCs for later generation of fresh mature DCs) will be cryopreserved and stored in liquid nitrogen until use.
  • TAPA-pulsed DCs containing no less than 1 X 10 7 DCs each
  • TAPA- pulsed DC vaccine will be frozen in DC medium plus 90% heat-inactivated autologous plasma (or AB human serum) and 10% dimethyl sulfoxide.
  • 5/6 th of the original pool of PBMCs will be cryopreserved, as described above, for subsequent thawing and generation of fresh DCs prior to each vaccination schedule. This process may improve the viability of DCs.
  • DCs Tumor Associated Peptide Antigen-Pulsed Dendritic Cells
  • PBMC Peripheral Blood Mononuclear Cells
  • the cells are manually separated over Ficoll-HyPaque density gradient
  • PBMC peripheral blood mononuclear cells
  • the PBMCs are counted with a hemacytometer and viability determined using trypan blue 1 : 1.
  • DCs are generated either as a total vaccine bank prior to patient administration or individually prior to each administration.
  • all PBMCs isolated from phlebotomy and/or leukapheresis are processed and the final DC vaccine product cryopreserved until use.
  • excess PBMCs that will not be used for the generation of the first vaccine dose are cryopreserved in 5 or more 2 ml NUNC vials.
  • the remaining Ficoll-purified PBMC will be utilized for generation of fresh DCs, for the first DC vaccine injection.
  • the subsequent five injections/doses of DCs will be prepared from frozen PBMC.
  • PBMCs are harvested by Ficoll Hypaque density gradient centrifugation.
  • the PBMCs are washed and resuspended in DC-medium and transferred in T-150 tissue culture flasks in CellGro DC serum free media (CellGenix, NH, USA) with L-glutamine.
  • the cells are incubated at 37 C for 2 to 4 hours in a 5% C0 2 incubator.
  • non-adherent cells are removed by one to four gentle washes with DPBS and adherent cells are cultured in CellGro DC medium plus 1% to 10% autologous (patient) plasma or 1% to 10% heat inactivated normal human AB serum, 800 U/ml of GM-CSF and 1000 U/ml of IL-4, and incubated at 37 °C and 5% C0 2 for 4 to 7 days.
  • Fresh IL-4/GM-CSF are added on days two (2), four (4), and six (6).
  • Human AB serum (Sigma-Aldrich, USA) will be used only when patients' autologous plasma is unavailable.
  • 35 mL of peripheral blood obtained from a healthy individual is purified using Ficoll.
  • 70 x 10 6 cells were left to adhere in a T-150 flask as indicated above (DC medium +1% autologous plasma) for 3 hours in a cell culture incubator. Viability after Ficoll purification was 98%.
  • the non-adherent cells were collected and frozen in 90% normal human AB serum + 10% DMSO to be used in the cytotoxicity assay.
  • the adherent fraction represented about 40% of the total amount of PBMCs isolated.
  • the blood may be from a subject having solid malignancy or hematologic malignancy.
  • the malignancy is lymphoma.
  • the malignancy is multiple myeloma.
  • the malignancy is breast cancer.
  • TVC Total Volume Count
  • DCs with supernatant are removed for gram stain, aerobic, anaerobic and fungal culture, mycoplasma testing and mycoplasma testing on days four (4), five (5), or six (6) (prior to peptide loading/maturation cytokine cocktail pulsing).
  • QC samples will be removed after the cells have been washed and the TVC determined. Remove a 100 ⁇ aliquot for cell counting on the hemacytometer with Trypan blue staining.
  • iDCs wash non-adherent iDCs from each flask by gently flushing the flask with the cell suspension 5 to 10 times, then transfer the cell suspension to a 50 mL tube. Take an aliquot for trypan-blue counting. Keep iDC at a density of approximately 2 to 10 X 10 6 cells/ml. If necessary, concentrate the cells by centrifuging at 100 to 300 X g for 5 to 10 minutes at 10-20 °C and discard the excess medium before resuspending the pellet.
  • iDC a density of approximately 2 to 10 X 10 6 cells/ml. If necessary, concentrate the cells by centrifuging at 100 to 300 X g for 5 to 10 minutes at 10-20 °C and discard the excess medium before resuspending the pellet.
  • the maturation cytokine cocktail contains IL- ⁇ and T Fa at 50 ng/ml, INF-a at 1,000 U/ml and poly (I:C) at 20 igj ⁇ .
  • DC culture is then incubated at 37 °C and 5% C0 2 for 16 to 72 hours.
  • DC culture is then harvested (the adherent cells, if present, will be harvested by washing with PBS and by the use of a cell scraper), and re-adjusted at a density of 2 to 10 X 10 6 cells/mL.
  • DCs are pulsed with 20 ⁇ g/mL of one or more of the relevant tumor associated peptide antigens (TAP As) (i.e., peptides derived from Spl7, AKAP-4, Ropporin, PTTG-1, HMI.24, Her- 2/neu, NY-ESO-1, MAGE-1, and/or SPAN-Xb. See SEQ ID Nos. 7-15 for the peptide sequences) for two (2) to four (4) hours.
  • Working stock for the above TAP As is 1 to 10 mg/ml, depending on the solubility of each TAPA.
  • the pulsing is stopped by centrifuging the DC in the tubes at 100 to 300 X g for 5 to 10 minutes at 10-20 °C and eliminating the
  • iDCs are pulsed and subsequently matured, as follows. Keep iDCs (derived from the GM-CSF/IL-4 culture) at a density of approximately 2 to 10 X 10 6 cells/ml. If necessary, concentrate the cells by centrifuging at 100 to 300 X g for 5 to 10 minutes at 10-20 °C and discard the excess medium before resuspending the pellet.
  • DC is pulsed as described above. After two (2) to four (4) hours of incubation, the pulsing is stopped as described above. Pulsed DC are then resuspended at 2 to 10 X 10 6 cells/mL in CellGro DC medium plus 1% to 10% autologous (patient) plasma or 1% to 10% heat inactivated normal human AB serum, 800 U/ml of GM-CSF and 1000 U/ml of IL-4. Then, the maturation cocktail is added as described above and incubated at 37 °C and 5% C0 2 for 16 to 72 hours.
  • Matured DC are then centrifuged at 100 to 300 X g for 5 to 10 minutes at 10-20 °C, the supernatant is discarded and the DC are resuspended in 1 to 10 mL with fresh DC-medium 1% to 10%) autologous (patient) plasma or 1%> to 10%> heat inactivated normal human AB serum.
  • a passing result for the phenotype release assay is defined as cells expressing> 70% CD86, CD80, CD83, CD58, HLA-DR and ⁇ 10% CD 14, within the DC gate. Viability for fresh cells are determined by Trypan blue exclusion. A viability of more than 80% is required for release.
  • the DC population is understood to be larger and more internally granular than the lymphocyte population. Therefore, the DC population lies above and over from the lymphocyte population in a FS/SS scattergram.
  • the release assay has two sections; the first determines the percentage of live cells that are DCs, and the second determines the percentage of DCs that are positive for certain cell surface markers.
  • non-adherent, immature DC (20 x 10 6 were harvested as described above and concentrated to 2 x 10 6 /mL in the same medium. Then, the maturation cocktail was added, and the DC suspension was transferred to a T-75 flask and incubated for 24 hours in 5% C0 2 at 37 °C. Then, suspension and adherent cells were collected and pulsed with TAPAs as described above, for 2 hours in 14-mL polypropylene tubes (2 mL/tube with 2 x 10 6 cells/tube). Then, an aliquot of 0.4 x 10 6 cells was removed for flow- cytometry quality control.
  • Isotype control FITC Isotype control PE
  • CD86 FITC
  • CD58 PE
  • HLA-DR FITC
  • CD83 PE
  • CD14 FITC
  • CD80 PE
  • Cells will be stained according to standard protocol. Approximately 0.9 X 10 6 cells will be required for the assay.
  • the percent DC is the percentage of cells within the DC only bitmap, as opposed to all of the cells in the FS/SS scattergram.
  • the % DC is used in various sections of the DC process to determine the total number of DC in culture.
  • acceptance criteria are: CD86 greater than or equal to 70% positive; CD80 greater than or equal to 70% positive; CD83 greater than or equal to 70% positive; CD58 greater than or equal to 70% positive; HLA-DR greater than or equal to 70% positive; and CD 14 less than or equal to 10% positive.
  • the DC population increased in dimensions, as depicted by the FSC/FSC dot-plot, and that the maturation successfully induced the expected up-regulation of the maturation markers, CD80, CD83, CD86, CD58, and HLA-DR, while reduced the expression of the monocyte marker, CD 14.
  • Endotoxin test 0.5 X 10 6 cells with supernatant are removed for the endotoxin Limulus Amoebolysate (LAL) testing.
  • the LAL test is performed using the QCL-1000 kit by the chromogenic method. A passing result of less than or equal to 1.0 IU/mL of treatment aliquot tested is required for release of the fresh DCs and administration to patients.
  • Mycoplasma test 0.5 X 10 6 cells with supernatant are removed for the mycoplasma assay. A mycoplasma culture is done. A 96-hour DNA fluorochrome results (Hoechst) is optional and is not required for administration of the fresh DC infusion. If performed, a passing result for the 96 hour Hoechst assay is "negative.”
  • Sterility Test 0.5 X 10 6 cells with supernatant are removed for the fungal, aerobic and anaerobic bacterial culture, sensitivity and stat gram stain. Samples are observed on a continuous basis for 14 days. A negative gram stain on the day of harvest and negative culture at 24 hours (removed prior to peptide pulsing) is required for release of the initial fresh DC culture. A passing result for sterility testing is "negative" for the presence of microbial contamination in fungal and aerobic and anaerobic bacterial canisters. Final record
  • CTL autologous cytotoxic lymphocytes
  • PBMCs Frozen PBMCs are thawed in the 37 °C water bath for 2 to 5 minutes. The product is then diluted in 9 volumes of DC medium (pre-warmed at 37 °C) supplemented with 2% autologous plasma, centrifuged at 100 to 300 X g for 5 to 10 minutes at 10-20 °C, and then transferred to the appropriate number of T- 150 flasks.
  • DC medium pre-warmed at 37 °C
  • autologous plasma centrifuged at 100 to 300 X g for 5 to 10 minutes at 10-20 °C, and then transferred to the appropriate number of T- 150 flasks.
  • Frozen mature DCs is thawed in the 37 °C water for 2 to 5 minutes.
  • the product is then diluted in 9 volumes of DC medium (pre-warmed at 37 °C) supplemented with 2% autologous plasma Diluted in DC-medium and counted by Trypan blue exclusion method.
  • a DC viability of more than 80% is required for release of vaccine dose.
  • the product is then centrifuged at 100 to 300 X g for 5 to 10 minutes at 10-20 °C, resuspended in sterile PBS at the concentration of up tolO cells/mL, then transferred to one or more syringe(s) with a 23-gauge needle, each one to a volume of 1 ml for patient administration.
  • Patients will be treated with CYP orally at a dose of 100 mg/day for 5 days, beginning seven (7) days prior to each TAPA-pulsed DC vaccine dose (day -7 though day -3, days 7-11, days 21-25, days 35-39, days 49-53, days 63-67 corresponding to 6 treatments).
  • a phase I dose escalation clinical trial of DC vaccination in patients with cervical cancer indicated optimal stimulation of tumor antigen-specific cytotoxic T cell responses with a dose of 1.0 x 10 7 DCs, in injection-grade saline containing 30% heat-inactivated autologous serum, and delivered SC and ID at 21 day intervals [10].
  • a dose of 1.0 x 10 7 DCs in injection-grade saline containing 30% heat-inactivated autologous serum, and delivered SC and ID at 21 day intervals [10].
  • TAPA-pulsed DC vaccination (1 X 10 7 DCs) and determine the toxicity, immune efficacy (IE) and clinical response in patients with progressive and /or refractory SM.
  • TAPA-pulsed DCs will be thawed out, washed once with sterile saline and resuspended in up to 1 ml injection -grade saline containing 10% autologous human serum.
  • the vaccine volume will be up to 1.0 ml and half the volume (0.5 ml) will be administered SC and ID in the patient's inguinal or axillary fold, in order to increase proximity to local lymph node draining basins and optimize access of the TAPA-pulsed DCs to secondary lymphoid organs and propagation of the immune response.
  • a maximum of 1.0 ml will be injected in a single site.
  • Approximately half the volume per injection (0.5 ml) will be delivered SC and half ID, on a single site. The same site(s) will be used for repeated vaccinations unless a grade 2 or greater injection site reaction occurs, in which case a new site in the inguinal fold will be selected.
  • Six DC vaccines will be administered at 14 day intervals, plus or minus 3 days, to maximize patient convenience and protocol adherence.
  • TAPA-pulsed DCs will be generated prior to each vaccination and administered to patients every two (2) weeks, as planned. Patients will be observed for up to six (6) hours following each vaccine dose administration.
  • the first six (6) patients will receive 1 x 10 7 DCs divided in a subcutaneous (SC) and intradermal (ID) administration, every fourteen (14) days, for up to a maximum of six (6) treatments.
  • SC and ID DC vaccinations will be administered in normal saline with a total volume of 0.5 ml per injection (total vaccination dose- volume 1.0 ml).
  • total vaccination dose- volume 1.0 ml Prior to receiving the DC vaccination, all patients will receive premedication with diphenhydramine (50 mg) intravenously and acetaminophen (1000 mg) orally.
  • Phase II/efficacy level will proceed. If one (1) or less than six (6) patients develops DLT, the Phase II/efficacy level will proceed. If two or more (> 2) of the first six (6) patients develop DLTs, the study will be terminated. A minimum of six (6) patients will be treated for evaluation of safety/toxicity (Phase I level). A maximum of seventeen (17) patients will be treated in the study for evaluation of immune efficacy and clinical response (Phase II level).
  • each patient will receive SC injections of low dose GM- CSF (50 meg) daily for five (5) consecutive days, beginning six hours after the DC
  • TAPA-pulsed DCs will be administered SC and ID at 14 day intervals plus or minus 3 days.
  • Safety tests before cryopreservation or release of TAPA-pulsed DCs including, Agar sterility test; mycoplasma test by approved kit; and/or endotoxin test by an approved independent testing laboratory. Endotoxin must be less than 1 IU/ml by the LAL method.
  • Safety tests before administration of TAPA-pulsed DCs including, Gram stain prior to administration; cell viability by trypan blue exclusion; and/or broth culture sterility test.
  • Immunosuppressive or anti-inflammatory drugs including hydrocortisone
  • Chiriva-Internati M Wang Z, Pochopien S, et al. Identification of a sperm protein 17 CTL epitope restricted by HLA-A1. Int J Cancer 107:863-865, 2003.
  • Chiriva-Internati M Wang Z, Salati E, et al. Tumor vaccine for ovarian carcinoma targeting sperm protein 17. Cancer, 94(9), 2447-2453.32, 2002.
  • Wang Z, Lu QY, Chen P, Zhang P, Cong YQ Expression of pituitary tumor- transforming gene in patients with multiple myeloma.
  • Sperm-derived SPANX-B is a clinically relevant tumor antigen that is expressed in human tumors and readily recognized by human CD4+ and CD8+ T cells.
  • the cancer-testis antigens CT7 (MAGE-C1) and MAGE-A3/6 are commonly expressed in multiple myeloma and correlate with plasma-cell proliferation.
  • a nonapeptide encoded by human gene MAGE-1 is recognized on HLA-A1 by cytolytic T lymphocytes directed against tumor antigen MZ2-E. J Exp Med 176: 1453-1457, 1992.

Abstract

La présente invention concerne des méthodes et des compositions pour traiter et/ou prévenir le cancer, y compris le cancer des ovaires. En particulier, la présente invention concerne une immunothérapie utilisant des cellules présentatrices d'antigène (par exemple des cellules dendritiques) comprenant au moins un antigène associé à une tumeur, les cellules présentatrices d'antigène étant également traitées avec au moins un inhibiteur de la voie de signalisation de la protéine kinase activée par mitogène (MAPK). Cette immunothérapie améliore les réponses immunitaires contre des cellules cancéreuses.
PCT/US2016/027235 2015-04-13 2016-04-13 Méthodes et compositions pour traiter un cancer avec des cellules dendritiques WO2016168264A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201562146502P 2015-04-13 2015-04-13
US62/146,502 2015-04-13

Publications (1)

Publication Number Publication Date
WO2016168264A1 true WO2016168264A1 (fr) 2016-10-20

Family

ID=57126682

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2016/027235 WO2016168264A1 (fr) 2015-04-13 2016-04-13 Méthodes et compositions pour traiter un cancer avec des cellules dendritiques

Country Status (1)

Country Link
WO (1) WO2016168264A1 (fr)

Cited By (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2018081830A1 (fr) * 2016-10-31 2018-05-03 Oregon Health & Science University Combinaisons d'agents servant à traiter les hémopathies malignes
CN109679909A (zh) * 2019-02-15 2019-04-26 妙顺（上海）生物科技有限公司 一种诱导单核细胞向巨噬细胞分化的方法
CN112852732A (zh) * 2021-03-09 2021-05-28 四川省人民医院 Dc细胞培养方法、培养基和基于dc治疗策略的药物及酪氨酸激酶抑制剂在制备其的应用
US11040027B2 (en) 2017-01-17 2021-06-22 Heparegenix Gmbh Protein kinase inhibitors for promoting liver regeneration or reducing or preventing hepatocyte death
EP3706765A4 (fr) * 2017-11-07 2021-07-14 Coimmune, Inc. Procédés et utilisations pour une thérapie cellulaire dendritique
US20220119842A1 (en) * 2020-10-15 2022-04-21 Aavocyte, Inc. Recombinant adeno-associated virus vectors with cd14 promoter and use thereof
CN117050177A (zh) * 2023-08-25 2023-11-14 遵义北科融汇生命科技有限公司 血液分离的免疫细胞联合药物治疗癌症的用途

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2004087941A1 (fr) * 2002-02-15 2004-10-14 The General Hospital Corporation Inhibiteurs de la proteine kinase associee aux membranes en tant que regulateurs de l'expression de l'antigene specifique de tumeurs
US20050197314A1 (en) * 1998-04-03 2005-09-08 University Of Iowa Research Foundation Methods and products for stimulating the immune system using immunotherapeutic oligonucleotides and cytokines
US20150056252A1 (en) * 2013-02-12 2015-02-26 Texas Tech University System Composition and Method for Diagnosis and Immunotherapy of Lung Cancer

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20050197314A1 (en) * 1998-04-03 2005-09-08 University Of Iowa Research Foundation Methods and products for stimulating the immune system using immunotherapeutic oligonucleotides and cytokines
WO2004087941A1 (fr) * 2002-02-15 2004-10-14 The General Hospital Corporation Inhibiteurs de la proteine kinase associee aux membranes en tant que regulateurs de l'expression de l'antigene specifique de tumeurs
US20150056252A1 (en) * 2013-02-12 2015-02-26 Texas Tech University System Composition and Method for Diagnosis and Immunotherapy of Lung Cancer

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
CANNON ET AL.: "Modulation Of p38 MAPK Signaling Enhances Dendritic Cell Activation Of Human CD 4+ Th17 Responses To Ovarian Tumor Antigen.", CANCER IMMUNOL IMMUNOTHER., vol. 62, no. 5, 25 January 2013 (2013-01-25), pages 839 - 849, XP055322830 *
CHIRIVA-INTERNATI ET AL.: "Efficient Generation Of Cytotoxic T Lymphocytes Against Cervical Cancer Cells By Adeno-Associated Virus/Human Papillomavirus Type 16 E7 Antigen Gene Transduction Into Dendritic Cells.", EUR. J. IMMUNOL., vol. 32, no. 1, 2002, pages 30 - 38, XP055322834 *
MAILLIARD ET AL.: "Alpha-Type-1 Polarized Dendritic Cells: A Novel Immunization Tool With Optimized CTL-Inducing Activity.", CANCER RESEARCH, vol. 64, no. 17, 1 September 2004 (2004-09-01), pages 5934 - 5937, XP002505994 *
WALTER ET AL.: "Multipeptide Immune Response To Cancer Vaccine IMA901 After Single-Dose Cyclophosphamide Associates With Longer Patient Survival.", NATURE MEDICINE., vol. 18, no. 8, August 2012 (2012-08-01), pages 1254 - 1265, XP055175088 *

Cited By (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2018081830A1 (fr) * 2016-10-31 2018-05-03 Oregon Health & Science University Combinaisons d'agents servant à traiter les hémopathies malignes
US11040027B2 (en) 2017-01-17 2021-06-22 Heparegenix Gmbh Protein kinase inhibitors for promoting liver regeneration or reducing or preventing hepatocyte death
EP3706765A4 (fr) * 2017-11-07 2021-07-14 Coimmune, Inc. Procédés et utilisations pour une thérapie cellulaire dendritique
US11779599B2 (en) 2017-11-07 2023-10-10 Coimmune, Inc. Methods and uses for dendritic cell therapy
CN109679909A (zh) * 2019-02-15 2019-04-26 妙顺（上海）生物科技有限公司 一种诱导单核细胞向巨噬细胞分化的方法
CN109679909B (zh) * 2019-02-15 2020-08-28 妙顺（上海）生物科技有限公司 一种诱导单核细胞向巨噬细胞分化的方法
US20220119842A1 (en) * 2020-10-15 2022-04-21 Aavocyte, Inc. Recombinant adeno-associated virus vectors with cd14 promoter and use thereof
US11761020B2 (en) * 2020-10-15 2023-09-19 Aavocyte, Inc. Recombinant adeno-associated virus vectors with CD14 promoter and use thereof
CN112852732A (zh) * 2021-03-09 2021-05-28 四川省人民医院 Dc细胞培养方法、培养基和基于dc治疗策略的药物及酪氨酸激酶抑制剂在制备其的应用
CN117050177A (zh) * 2023-08-25 2023-11-14 遵义北科融汇生命科技有限公司 血液分离的免疫细胞联合药物治疗癌症的用途
CN117050177B (zh) * 2023-08-25 2024-03-08 遵义北科融汇生命科技有限公司 血液分离的免疫细胞联合药物治疗癌症的用途

Similar Documents

Publication Publication Date Title
Pai et al. Clonal deletion of tumor-specific T cells by interferon-γ confers therapeutic resistance to combination immune checkpoint blockade
US11717539B2 (en) Combination immune therapy and cytokine control therapy for cancer treatment
WO2016168264A1 (fr) Méthodes et compositions pour traiter un cancer avec des cellules dendritiques
JP2021105052A (ja) 併用療法による固形腫瘍又はリンパ系腫瘍の治療方法
US11684659B2 (en) Tumor cell vaccines
US20220133799A1 (en) Combination immune therapy and cytokine control therapy for cancer treatment
US20150335679A1 (en) Methods and Compositions for Treating Malignancies with Dendritic Cells
AU2020350221A1 (en) Combination cancer therapy and cytokine control therapy for cancer treatment
CN111849905B (zh) 间充质干细胞靶向运输趋化因子和细胞因子的免疫疗法
US20230000963A1 (en) Tumor cell vaccines
US20110236345A1 (en) Composition and methods for eliciting an immune response
US20220152169A1 (en) Colorectal cancer tumor cell vaccines
WO2022011651A1 (fr) Procédé d'immunothérapie par administration ciblée de chimiokines et de cytokines par une cellule souche mésenchymateuse
Morita et al. Combined blockade of CXCR4 and PD-1 enhances intratumoral dendritic cell activation and immune responses against HCC
JP2023539436A (ja) 膵臓癌の評価および処置のための方法および組成物
CN114729314A (zh) 用于癌症治疗的组合癌症疗法和细胞因子控制疗法
Immunother International Society for Biological Therapy of Cancer 23rd Annual Meeting Abstracts
Andersen The role of oxygen in the immunogenicity of brain tumor cell vaccines
Immunother International Society for Biological Therapy of Cancer 24th Annual Meeting Abstracts

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 16780600

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 16780600

Country of ref document: EP

Kind code of ref document: A1