WO2016166716A1

WO2016166716A1 - Antineoplastic activity of nanovesicles isolated by citrus limon

Info

Publication number: WO2016166716A1
Application number: PCT/IB2016/052160
Authority: WO
Inventors: Riccardo Alessandro; Simona FONTANA; Giacomo De Leo; Francesca MONTELEONE; Flores NASELLI; Stefania RAIMONDO
Original assignee: Universita' Degli Studi Di Palermo
Priority date: 2015-04-16
Filing date: 2016-04-15
Publication date: 2016-10-20
Also published as: ITRM20150162A1

Abstract

The present invention relates to the obtainment of vegetable products showing pharmacological activity and their therapeutic use. In particular the invention refers to vesicles of nanometric dimensions obtained from the juice of plants of the family Rutaceae.

Description

ANTINEOPLASTIC ACTIVITIES OF NANOVESICLES ISOLATED FROM CITRUS LIMON

Technical field of the invention

The present invention relates to the obtaining of vegetable products with pharmacological activity and their therapeutic use. In particular the invention refers to vesicles of nanometric dimensions obtained from the juice of plants of the family Rutaceae. State of prior Art

Cancer is, after diseases of the cardiovascular system, the second leading cause of death in industrialized countries. There are more than 100 different cancer istotypes including lung, colon, breast, pancreas, liver and leukemia. Surgery, chemotherapy and radiation therapy are the most common chemotherapeutic approaches for the treatment of cancer patients. World Health Organization estimates that the average 5-year survival after diagnosis is around 60% despite the progress made in treatment and the considerable investments made in the pharmaceutical field. The conventional treatment with chemotherapy often causes toxic effects on normal cells.

Therefore, there is an urgent need to identify new compounds and/or more effective treatments in order to 1) inhibit the growth and progression of cancer and 2) to have few side effects on normal cells.

Exosomes are small vesicles released extracellularly by animal cells. The exosomes have a size of 30-100 nm and are present in many biological fluids. It is well known that these vesicles contain molecular products of the cell that produces them, including proteins, lipids, mRNA and microRNA (miRNA). Numerous data show that exosomes play an important role in cell-cell communication influencing physiological and pathological processes. Previous studies suggest that the nanovesicle released from plant cells are similar to exosomes (1). Zhang and colleagues reported that the nanovesicle derived from edible plants such as grapes, grapefruit, ginger and carrots show antiinflammatory properties in chronic inflammatory bowel disease (2, 3). Zhang et al. have also reported in U.S. patent application US2014 / 0308212, the use of plant vesicles as carrier for medical compounds, also anticancer drugs, contained in the same vesicles or as carrier able to incorporate tracers to be used for diagnosis. However, the potential antineoplastic role of such nanovesicle of plant origin in influencing the progression of cancer has never been investigated until now.

Data in the literature have shown that compounds and/or aqueous extracts from various plant varieties, including Citrus limon L. (Rutaceae family), exert an anti-proliferative and anti-tumor activity (4, 5) essentially linked to the presence of flavonoids.

Therefore, an alternative approach to overcome the side effects of chemical compounds could be the use of natural agents, which provide an excellent contribution to modern therapies. Furthermore, it is known that some natural compounds are able to inhibit the development of cancer in animal models of carcinogenesis (6). It is also known that the protein TNF-related apoptosis- inducing ligand (TRAIL) induces apoptosis by binding to specific receptors (TRAIL-R). This family has emerged as a key mediator of cell survival by pushing the cells toward the extrinsic pathway of apoptosis (7). It is important to emphasize that, unlike many chemotherapy drugs, TRAIL has the ability to induce apoptosis in tumor cells but not in normal cells (8).

Aim of the present invention is therefore to provide new pharmacological tools that provide a greater effectiveness in the inhibition of the development and progression of neoplasia and that at the same time have few side effects for the subject.

Summary of the Invention

The use of natural substances in the treatment of neoplasms is today a therapeutic alternative to the use of the common chemotherapy.

The present invention is based on the discovery that nanovesicles of plant origin obtained from the juice of plants of the Rutaceae family, specifically the subfamily Aurantioideae, especially of the genus Citrus, exert a cytotoxic effect and/or cytostatic and/or sensitizer in the treatment of various malignancies. Moreover, the presence of these vesicles in the juice of plants of the Citrus genus has never been previously demonstrated.

Therefore objects of the present invention are:

A process for obtaining nanovesicles from the juice of fruits of the Citrus plant comprising the following steps:

a) Centrifuge and filter the juice in one or more consecutive cycles;

b) ultracentrifuge the juice obtained in step (a) obtaining a supernatant liquid and a sedimentation pellet containing the nanovesicle and the vesicles are recovered. The process may also include the following additional steps:

c) the pellet is recovered through a sucrose gradient ultracentrifugation;

d) isolate the fraction having a density of between 1.12 and 1.19g / ml;

e) optionally the fraction is ultracentrifuged; and

f) optionally the fraction is washed with saline buffer.

A process in which the ultracentrifugation in step (b) and/or (e) is performed at a value of g (i.e. acceleration of gravity) between lOO.OOOxg and 150.000xg for a time between 60 and 120 min.

A procedure in which the ultracentrifugation in sucrose gradient in step (c) is performed at a value of g (the acceleration of gravity) between lOO.OOOxg and 150.000xg for a time comprised between 60 min and 120 min to a density gradient between 30% and 45%.

A process in which step (a) comprises at least a centrifugation at a g value between 15.000x g and 20.000x g for a time of between 60 and 180 min and a filtration step with pores not smaller of about 0.45 μ (microns).

A process in which step (a) comprises a first centrifugation cycle from 3000xg at 10,000xg for a time between 30 and 90 min / centrifugation followed by a first filtration step with pores not smaller than 0.8 microns, and a second cycle of by centrifugations at 15000xg 17000xg for a time between 70 and 100 min / centrifugation followed by a filtration step with pores not smaller than about a 0.45 micron.

Are further objects of the invention:

Nanovesicles having a density of between 1.12 and 1.19g / ml and size between 50 and 70 nm obtained by the process of the invention for their use in a therapeutic treatment as unique active ingredient or in combination with one or more additional active ingredients, provided that the said one or more additional active ingredients are not encapsulated in the same nanovesicles. The above described nanovesicles of the invention for use in a therapeutic preventive or curative treatment of solid or haematological tumors, in particular for use in a treatment in which the tumor is a colorectal cancer, pancreas, lung, kidney, ovaries, liver, thyroid, bladder, breast, esophagus, skin, acute leukemia, chronic myeloid leukemia or multiple myeloma; advantageously for use in a treatment in which the cancer is resistant to common chemotherapeutics.

Represent further object of the invention:

The nanovesicles of the invention for use in a treatment of sensitization of tumor cells to a subsequent or concurrent treatment with one or more chemotherapeutics, advantageously for the sensitization of tumor cells resistant to common chemotherapeutics.

Further object of the invention is a pharmaceutical composition containing the invented nanovesicles and a pharmaceutically acceptable excipient.

The invention described here is based on the identification in the juice of plants, preferably of the genus Citrus, for example of Citrus limon L., of a selected population of vesicles obtained after subsequent passages of centrifugation and filtration, which has a high in vitro antitumor activity against tumor cell lines both sensitive and resistant to common chemotherapy drugs used today.

To date, the anticancer therapies in use for the treatment of different solid and haematological malignancies involve the use of compounds (chemotherapy) that induce cytotoxicity not only in cancer cells but also in normal cells. In addition, although the treatment with chemotherapy has had high success rates for treatment of various cancers, the acquisition of drug resistance is nowday one of the crucial aspects in cancer treatment. For example the acquisition of drug resistance in patients with chronic myeloid leukemia, observed with an annual rate of 4%, has placed in recent years the need to develop new therapeutic strategies.

The main advantage provided by the object of the present invention is the use of nanovesicles of vegetable nature, the content of which is not toxic to normal cells while inducing the arrest of the proliferation of cancer cells, pushing them towards death.

The nanovesicle isolated from the vegetable juice may be used as single therapeutic agents, or in combination with other chemotherapeutics or to sensitize cancer cells to treatment with the common chemotherapy. However, it is important to note that the invented nanovesicles exert themselves antitumor activity and even if they are administered in combination therapy with other drugs, their therapeutic function is not that one of the carrier that contains or encapsulates these additional drugs, but it is an active autonomous principle, which exerts additional or synergistic therapeutic functions.

Description of the Figures

Figure 1: The figure shows the characterization of nanovesicles by electron microscope (Figure la), the analysis by DLS (dynamic light scattering, Figure lb) and by means of a proteomic approach (Figure lc) and the internalisation of the vesicles in human cancer cells A549 and LAMA84 (figure Id).

Figure 2: The figure shows the antiproliferative activity of nanovesicles in colon (SW480) cancer cells, lung cancer cells (A549, CRL2868, CRL5908 resistant to erlotinib and gefitinib) and chronic myelogenous leukemia cells both sensitive and resistant to imatinib (LAMA84S, LAMA84R).

Figure 3: The figure shows the expression of different molecules involved in the apoptotic pathway. As shown in Figure 3a, the A549 cells, SW480 and LAMA84 cells treated with nanovesicles, show an increased expression of pro-apoptotic genes, Bad and Bax, and a reduction of mRNA levels of anti-apoptotic genes, Survivin and Bcl-XL. The increase of expression of BAX protein and the reduction of BCL-xL were also confirmed by western blot analysis (Figure 3b). Figure 4: The figure shows the increased gene expression of TRAIL (Figure 4a, upper panel) and DR5 (Figure 4a, bottom panel) induced by the invented nanovesicles. The increase of the TRAIL protein release was also confirmed by ELISA, as shown in Figure 4b.

Figure 5: The figure illustrates the ability of nanovesicle to inhibit tumor growth in an in vivo model of chronic myeloid leukemia.

Figure 5a shows that the tumor growth is delayed in mice treated, either locally or intraperitoneally (left panel), with the nanovesicles, leading to the formation of smaller tumors compared to control mice (right panel).

Figure 5b illustrates the increase of the proapoptotic Bad and Bax genes and the decrease in the anti-apoptotic genes, Survivin and Bcl-XL as well as the increase of TRAIL and DR5 in mice treated with nanovesicles. Figure 5c shows the increase in the number of positive cells to TRAIL (indicated by arrows) in the tumors of the mice treated locally or intraperitoneally with the nanovesicles compared to control mice.

Figure 6: The figure shows the biodistribution of marked nanovesicles in the tumor site (Figure 6a- arrows indicate marked nanovesicle that are located around the tumor). The analysis of the tumors shows that the nanovesicles are internalized into the tumor mass and remain in the site, while no accumulation of fluorescence is observed in the tumor removed from mice treated with the free probe (Figure 6b).

DETAILED DESCRIPTION OF THE INVENTION

The plant vesicles described in the invention are obtained from the juice of fruits of plants of the family Rutaceae, specifically of the subfamily Aurantioideae, and particularly of the Citrus genus, for example, Citrus limon L. (lemon), Citrus medica (citron), Citrus reticulata ( tangerine), Citrus paradisi (grapefruit), Citrus sinensis (sweet orange) .

The process The process to obtain the invented nanovesicles consists of subsequent steps of selection and isolation by means of centrifugation and filtration techniques, to obtain a specific selected fraction. This isolated population is characterized by a density between 1.12 and 1.19 g /ml and a proteomic profile that, for about 56.7% of the identifications, consists of proteins previously described in mammalian exosomes.

The method includes a preparatory step (a) in which the juice is subjected to one or more consecutive cycles of centrifugation and filtration. This stage is aimed at removing from the juice, by sedimentation and / or filtration, each solid component and each element of the high density juice.

The process then includes the following step (b) and optionally the steps (c) and (d) performed on the treated juice of the preparatory phase:

b) the juice obtained in step (a) is ultracentrifuged thus obtaining a liquid supernatant and a sedimentation pellet containing the nanovesicles.

The step of ultracentrifugation (b) is performed at a value of g (the acceleration of gravity) between lOO.OOOxg and 150.000xg for example in llO.OOOxg, 120.000xg, 130.000xg, 140.000xg and for a time that is inversely proportional to the value g, that is, between 120 and 60 min. In a specific procedure it has been chosen for example 120.000xg for 90 minutes or 130.000xg for 80 min. The ultracentrifugation steps are performed at refrigerated temperature, preferably below 10 ° C for example at 4 ° C. The supernatant liquid is discarded and the sedimented pellet is recovered. The sedimented pellet containing the nanovesicle can be used for therapeutic purposes here described. As a not limiting example, the ultracentrifugation stepcan be carried out using the ultracentrifuge Optima™ L-80 XP - Beckman Coulter Tl with Type 70 rotor. c) For the purpose of obtaining the nanovesicles in a purified form and with a greater biological activity, it is possible to ultracentrifuge the recovered pellet in sucrose gradient.

Such ultracentrifugation in sucrose gradient is performed at a g value between lOO.OOOxg and 150.000xg for example at llO.OOOxg, 120.000xg, 130.000xg, 140.000xg and for a time inversely proportional to the g-value, that is, between 120 and 60 min in a sucrose gradient with a density between 30% and 45%. In particular, the 30% to 45% sucrose solutions are positioned at the bottom of an ultracentrifugation tube and the pellet of step b) containing the vesicles, is layered on the sucrose solution. As a not limiting example, the ultracentrifugation can be carried out using the ultracentrifuge Optima™ L-80 XP - Beckman Coulter with SW28 rotor. After the ultracentrifugation step, a layer of sucrose is formed r that contain the nanovesicles having densities between 1:12 and 1.19g / ml. d) Finally, a fraction having preferably a density between 1.12 and 1.19g / ml and containing the invented nanovesicles, is isolated from the sucrose gradient. Subsequently, in order to eliminate the residues of sucrose from the preparation, the isolated fraction can be subjected to a step (e) of ultracentrifugation under the same conditions described for the step (b). Preferably, ultracentrifugation is effected at lOO.OOOxg for about 90 minutes at low temperature: e.g. 4 ° C.

Finally, the pellet sedimented in step (e) may be washed one or more times with saline buffer.

As regards the preparatory or preliminary stage (a) it is evident that this can include any combination of centrifugations and filtrations, of "g" values, of centrifugation time and porosity of the filter, to the extent that it is this combination allows to remove from the juice each solid component and each element of the high density juice.

In particular, this stage necessarily includes one or more steps of centrifugation at a g value between 15,000 and 20,000 followed or alternated to one or more filtrations steps. Each spin can be performed for example 15.500xg, 16.000xg, 16.500xg, 17.000xg, 17.500xg, 18.000xg, 19.000xg, for a time inversely proportional to the "g" value, between 240 and 60 min for each centrifugation step. The centrifugation steps are alternated with filtration steps with filters of porosity between about 0.80 μ (microns) and about 0.45 μ (microns). In one embodiment of the invention , the step (a) will include a first centrifugation at 16500xg for example for a time of 60-90 minutes, followed by a filtration with a pore size of not less than approximately 0.45 micron followed by a second centrifugation with the same value of "g" for a longer time, for example 180-240 minutes.

The preparatory stage (a) may still include one or more preliminary rounds of centrifugation at low value of "g" to remove from the juice the coarser solid materials or those elements of higher density found in juice. This phase can also include one or more filtration steps. The centrifugation is carried out to a "g" value between 2500xg and ll.OOOxg. In a specific embodiment, it is possible to consider more consecutive steps of centrifugation with a "g" growing, for a period of time between 20 and 90 minutes. For example you may run a first centrifugation at 2500xg, 3000xg or 3500xg for 20-30 minutes followed by a second centrifugation at 9500g, or 10.500g 10,000g for 55-70 minutes. The centrifugation cycles may be followed by a filtration on a filter with a porosity not less than 0.80 microns.

It is clear that after each step of centrifugation in step (a), the supernatant will be harvested and subjected to the next steps, while the materials or sedimented fractions will be discarded.

An exemplary embodiment of the invention process in its entirety is described in the experimental part to the chapter entitled "Preparation of nanovesicles". The quantification of nanovesicles was determined by Bradford assay.

The vesicles

The nanovesicles of the invention, obtained through the above described procedure, are characterized by a density in sucrose gradient, between 1.12 and 1.19 g / ml and a specific proteomic profile. The plant nanovesicles described in the invention are similar to the typical exosomes of mammalian cells. They also have a diameter ranging from about 30 to about 100 nm, more often between 40 nm and 70 nm, for example 50 nm or 60 nm. (The dimensions are determined by dynamic light scattering (DLS analysis) as described in Viktoriya Sokolova et al (9).

The plant nanovesicles have also a morphology similar to that one of mammalian exosomes: namely, they are small extracellular vesicles consisting of a lipid bilayer with proteins and containing nucleic acids inside. By proteomic characterization it is revealed that about 56.7% of the identifications, consists of proteins already described in mammalian exosomes and belonging to the following protein functional groups: proteasome, heat shock protein, cytoskeleton, ubiquitin system, transporters, enzymes related amino acids, biogenesis of transfer RNA, ribosomal proteins, translation factors, metabolic enzymes, phosphatases and associated proteins, kinases, GTP binding proteins, proteins involved in the biogenesis of vesicles and membrane traffic. They are also characterized by a specific protein profile that was analyzed by two different proteomic approaches: gel-free and gel-based. Analyses were conducted using the Triple-TOF 5600 Plus mass spectrometer and they showed that the proteins contained in the invented vesicles are homologous to those contained in mammals exosomes. In particular, the most common protein in nanovesicles herein described are included in the group including the non - ATPase 5 regulatory subunit of the 26S proteasome (K06692); protein ARFl (K07937); Annexin A7 / 11 (K17095), aquaporin PIP (K09872), subunit alpha/ATPl of ATP synthase (E5DK62); beta subunit of ATP synthase H + transporter type F (K02133); protein ABCF1 (K06184); Citrate synthase (K01647); the translation factor 4G (K03260); the elongation factorl-beta (K03232); elongation factor 1-gamma (K032339; elongation factor 2 (K03234); TSG101 of the ESCRT-I complex subunits (K12183); VPS28 of ESCRT-I complex subunits (K12184); VPS37 subunit of ESCRT-I complex (K12185); the initiation translation factor 2C (K11593); exportin-1 (K14290); exportin-2 (K18423); HSP70 protein (K03283); HSP90 protein (F1CGQ9); HSP20 protein (K13993); ribosomal protein LlOe (K02866); protein ribosomal L13A (K02872); lisophospholipasi II (K06130), vegetal SNARE (K08494); phospholipase C (K01114); SEC31 protein (K14005); Rab-llA protein (K07904); Rab-7a protein (K07897); serpin B ( K13963); ribosomal protein S12E (K02951); ribosomal protein s5e (K02989); ribosomal protein S7e (K02993); ribosomal protein S9e (K02997); subunits of succinate dehydrogenase ((K00234); translation initiation factor 4A (K03257); trasportin-1 (K18752); ubiquitin-C (K08770); ubiquitin activating (El) (K03178); VPS35 protein (K18468); VPS4 protein (K12196); protein interaction with t-SNAREs 1 (K08493); protein associated with the vesicle membrane 7 (K08515).

Therapeutic activity

The following data show that nanovesicles isolated from the juice of the fruit of plants of the genus Citrus, for example the Citrus Limon L. (Rutaceae family) have antineoplastic activity in vivo in animal models and in vitro, against a panel of different cell lines of solid and hematological cancers, such as (adenocarcinoma) colorectal cancer, pancreatic, lung, kidney, ovarian, liver, thyroid, bladder, breast, esophagus, skin; leukemia; chronic myeloid leukemia and multiple myeloma.

Surprisingly, the vesicles have proved active not only on sensitive tumor cell lines, but also on cell lines resistant to common chemotherapeutic agents, such as erlotinib or gefitinib, and in an in vivo model of chronic myelogenous leukemia (CML ) sensitive or resistant to imatinib.

Therefore, the nanovesicles described in the invention, find application in the preventive and curative treatment of a broad spectrum of malignancies either as individual therapeutic agents able to show a therapeutic effect, or in combination with other chemotherapeutics, in order to receive an additional effect or synergistic, either in a sensitization pre-treatment of tumor cells to a subsequent treatment with chemotherapy, especially for cancer cells resistant to the chemotherapeutic.

Without limiting the invention to specific theories, the results obtained demonstrate that the invented nanovesicles induce the arrest of proliferation of cancer cells by activation of the extrinsic apoptosis mediated by TRAIL protein, both in vitro and in vivo. TRAIL induces apoptosis in target cells that express the death receptor DR5, without affecting the viability of normal cells. The activation of the pathway mediated by TRAIL leads to the increased expression of the of pro-apoptotic genes (Bad, Bax) and the decrease of anti-apoptotic genes (Bcl-xl, survivin). TRAIL induces apoptosis preferentially in tumor cells, but not in normal cells. It was initially proposed that the induction of apoptosis mediated by TRAIL, preferentially in tumor cells, is due to the fact that the death receptors TRAIL-Rl and TRAIL-R2 are especially expressed in these cells, thefore the TRAIL-induced apoptosis could, at least in part, be determined by the expression of these receptors.

[All together, these results show that the use of nanovesicles from Citrus limon is an alternative approach for the treatment of cancer. The natural origin of their content is not toxic to normal cells while induce the arrest of the proliferative process of cancer cells, pushing them towards death.

EXPERIMENTAL PROCEDURES

Preparation of nanovesicles

As an example, the nanovesicles have been isolated from Citrus limon L. juice. The juice was initially centrifuged at 3000g for 30 minutes, then at lOOOOg for 1 hour. The supernatant was then subjected to filtration using filters with a pore size of 0.8 μΜ and centrifuged at 16500xg for 1 hour. The supernatant was again subjected to filtration with a filter with pores 0.45 μΜ and centrifuged at 16500xg for three hours. The supernatant was then ultracentrifuged for 90 minutes at 120,000xg. The pellet containing the nanovesicles was collected and subjected to ultracentrifugation at 100,000 g in a 30-45% sucrose gradient, for 90 minutes. Subsequently, the fraction with a density between 1.12 and 1.19g /ml was recovered and subjected to ultracentrifugation and then washed several times in PBS. The quantification of nanovesicles was determined by Bradford assay as described below.

Essentially identical vesicles were obtained by eliminating the centrifugation step at 3000xg, and centrifuging at 10,000xg for 90 minutes; or by performing the first centrifugation at 2500xg for 40 minutes or at 3500xg for 20 min; or by performing the second centrifugation at 9500xg for 80 minutes or at 10500xg for 50 minutes; or the third centrifugation at 15500xg or at 17500xg respectively for 70 and 50 minutes; or the fourth centrifugation at 15500xg equally or at 17500xg for 200 minutes and 150 minutes respectively.

Essentially identical vesicles were obtained by conducting the ultracentrifugation step at llO.OOOxg or to 130.000xg respectively for 110 and 80 minutes.

Quantification of nanovesicles by Bradford assay

In particular, this assay allows to know the protein concentration of the extract through a colorimetric reaction due to the interaction of the Coomassie solution with specific amino acids (histidine, arginine and aromatic amino acids); this binding produces a change of the color, from brown to blue, in proportion to the amount of protein present in the extract.

This assay is performed by diluting the selected population of vesicles in PBS, adding the Coomassie solution and evaluating the absorbance at a wavelength of 595 nm. Preferably, vesicles are diluted 1: 5 with PBS. About 50 μΐ of the dilution is then added to 1.5 ml of Coomassie protein solution assay kit (Pierce, Rockford, IL, USA) and the absorbance measured at the biophotometer at a wavelength of 595 nm. The values obtained are referred against the blank (1.5 ml of Coomassie protein solution assay kit, and 50 μΐ of PBS). The final concentration in μg / μΐ is obtained by dividing the mean absorbance of each sample by the slope value of a curve of BSA (bovine serum albumin), previously built by serial dilutions of a known concentration of the protein; the value obtained is multiplied by the dilution factor.

The vesicles were characterized by electron microscopy (Figure la): the nanovesicles resuspended in PBS were plated on carbon-coated grids and stained with 2% phosphotungstic acid. The resulting preparation was visualized by JEOL JEM-1400 transmission electron microscope Plus, at HOkV.

The size of the vesicles (50-70 nm) were tested by DLS (dynamic light scattering, Figure lb) and by means of a proteomic approach (Figure lc). As shown in Figure 1, the isolated nanovesicles represent a homogeneous population size; moreover the analysis of the protein composition of the vesicles reveals the presence of homologous proteins to the protein characteristics of mammals exosomes. Same type of vesicles were obtained through the same procedure performed on Citrus medica (citron), Citrus paradisi (grapefruit).

Internalization of test in cancer cells

Cell lines:

The cells of chronic myelogenous leukemia and LAMA84 LAMA84R (resistant to imatinib), adenocarcinoma colon SW480 and A549 adenocarcinoma lung, CRL2868, CRL5908 (resistant to erlotinib and gefitinib), were cultured in RPMI 10% FBS. The HS5 stromal cells were cultured in DMEM 10% FBS, HUVEC endothelial cells in Endothelial Growth Medium (EGM). The PBMC cells were isolated using Ficoll Paque separation technique.

Assessment of the internalisation of Citrus nanovesicles in A549 and LAMA84 cells

In order to determine whether the lemon vesicles are internalized by human tumor cells, the nanovesicles were labeled with the lipophilic dye PKH26 (red) for 10 minutes at room temperatures. The A549 and LAMA84 cells were seeded in collagen coated slides and treated with 20 μg /ml of marked nanovesicles for 3 and 6 hours. Cells were then labeled with Actin green (green-actin) and Hoechst (blue nuclei) and analyzed by confocal microscopy. As shown in Figure Id, the A549 cells (human epithelial cells of lung adenocarcinoma) and chronic myelogenous leukemia cells LAMA84, treated for 3 and 6 hours with lemon vesicles internalize the lemon vesicles (the arrows indicate the cells that internalized the marked vesicles) with time dependent efficacy.

Tests of antiproliferative activity

Cell viability MTT assay

Cell viability was assessed by MTT assay. The cells were seeded in 96-well plates and treated for 24,48 and 72h with 5-20 micrograms/ml of nanovesicles. The MTT is a vital dye which, penetrating into the cells, is reduced by mitochondrial dehydrogenase. To each well containing 100 μί, of cell suspension were added 10 μΐ of MTT and the plates maintained for 4 hours in an incubator at 37 ° C. After incubation, the cells were lysed by addition of 150 μΐ of the isopropanole-0.05M HC1 per well resulting in leakage of the dye from the same cells. The mitochondrial enzyme is active only in living cells, and its function is to cut off the tetrazolium ring of MTT (yellow substance) with the formation, accordingly, of formazan (a blue salt). Therefore, the intensity of the coloration is proportional to the number of live cells, and is evaluated using an ELISA plate reader at a wavelength of 540 nm; the optical density (O.D.) were compared against white (100 μί, of cell culture medium, 10 μΐ of MTT and 150 μί, of isopropanol-HCl). As shown in Figure 2, the treatment of colon cancer cells (SW480), lung (A549, CRL2868, CRL5908 resistant to erlotinib and gefitinib) and chronic myelogenous leukemia cells sensitive and resistant to imatinib (LAMA84S, LAMA84R) with lemon nanovesicles , leads to a dose and time dependent decrease of cell viability. The same effect is not observed in non- tumor cells (endothelial cells, stromal cells, mononuclear cells from peripheral blood).

Test of apoptotic activity

RNA extraction and Real time PCR

LAMA84, A549 and SW480 cells were plated into 12-well plates and treated with 5 and 20 μg/ml of nanovesicles for 24 and 48 hours. Tumor biopsies were stored in RNAlater (Applied Biosystems, Foster City, California, USA). RNA was isolated by the use of a commercial kit (RNA, Isolation Mini Spin Kit; GE Healthcare). The total RNA was then reverse transcribed into cDNA (High Capacity cDNA Reverse Transcription Kit, Applied Biosystems). The cDNA thus obtained was subjected to real time quantitative PCR using plates with 48 wells (One-Step Real-Time PCR System; Applied Biosystem) by means of specific primers used for the following genes:

GAPDH: 5'ATGGGGAAGGTGAAGGTCG3 '(SEQ ID NO: 1),

5'GGGTCATTGAT GGCAACAATAT3 '(SEQ ID NO: 2);

Bad: 5'CCGAGGAGCAG GAAG AC TC ' 3 (SEQ

5'GGTAGGAGCTGTGGCGACT'3, (SEQ ID NO: 4)

Bax: 5'CCTGTGCACCAAGGTGCCGGAACT3 '(SEQ

5'CCACCCTGGTCTTGGATCCAG CCC3' (SEQ ID NO: 6);

Survivin: 5'CTCAAGGACCACCGCATCTC'3 (SEQ

5'CAGCCTTCCAGCTCCTTGAA'3 (SEQ ID NO: 8);

Bcl-xl: 5 ' C TGAATC GGAGATGGAGAC C ' 3

5'TGGGATGTCAGGTCACTGAA'3 (SEQ ID NO: 10);

TRAIL: 5'GCTCTGGGCCGCAAAAT'3 (SEQ

5 'TGCAAGTTGCTCAGGAATGAA' 3 (SEQ ID NO: 12);

DR5: 5 'GGGCCACAGGGACACCTT' 3 (SEQ ID NO: 13), 5 'GCATCTCGCCCGGTTTT'3 (SEQ ID NO: 14);

The variations of the gene of interest have been normalized with respect to the content of GAPDH using the Δ Δ Ct comparative method to calculate the changes of expression levels that were then expressed as fold of induction.

To evaluate the mechanism by which the nanovesicles are able to affect tumor growth, we tested the expression of different molecules involved in the apoptotic pathway. As shown in Figure 3, the A549, SW480 and LAMA84 cells treated for 24 or 48 hours with the nanovesicles, show an increased expression of pro-apoptotic genes, Bad and Bax, and a reduction of mRNA levels of anti- apoptotic genes Survivin and Bcl-XL, in particular after 48h of treatment.

Western Blot

The A549, SW480, LAMA84 cells were treated for 48 h with 20 μg /ml of nanovesicles. The protein lysate obtained was analyzed by SDS-PAGE and Western Blotting. The antibodies used in the experiments are: anti-BAX, BCL-xL and β -actin (Santa Cruz Biotechnology, CA, USA).

The increase in expression of the BAX protein (A549 4.5 fold, SW480 1.65 fold, 3.6 fold in LAMA84) and the decrease in BCL-xL (0.7 fold decrease in A549, 0.88 times SW480, 0.82 times in LAMA84) were also confirmed by western blot analysis (Figure 3b).

Activation of TRAIL gene expression

The results reported here also show that treatment with nanovesicles induces an increased gene expression of TRAIL (Figure 4a, upper panel) and DR5 (Figure 4a, bottom panel). The increased release of TRAIL protein was also confirmed by ELISA, as shown in Figure 4b. The TRAIL protein concentration was determined by ELISA kit (Uscn Life Science Inc., Houston, TX, USA). Overall, these data suggest that nanovesicles induce cell death in cancer cells by activating the apoptotic pathway dependent on TRAIL/DR5.

Antitumor activity in a in vivo model of chronic myeloid leukemia

In vivo xenograft model of CML

NOD/ SCID mice (Charles River Laboratories International, Inc, MA, USA) were inoculated in the right flank with LAMA84chronic myeloid leukemia cells (2 x 107 cells in 0.2 ml of PBS). Seven days after inoculation, the mice were treated with the lemon nanovesicles (50 μg/mouse, 3 times a week for 2 weeks) either intraperitoneally (IP) that intramass (EN). The tumors were measured three times a week. At the end of treatment, the mice were sacrificed and the tumors removed for analysis of gene expression and immunofluorescence. Immunofluorescence

Tumors were fixed in 10% formalin and embedded in paraffin. Sections of 5 μηι were used for immunofluorescence analysis. The sections were incubated with anti-TRAIL antibody (Abeam) and analyzed by confocal microscopy.

In vivo test

The ability of nanovesicles to inhibit tumor growth was also tested in vivo in a model of chronic myeloid leukemia. The LAMA84 cells were subcutaneously inoculated in NOD/SCID mice; one week after inoculation, the mice were treated locally (intra tumor, EN) or intraperitoneally (IP) three times per week with vehicle (PBS) or with lemon nanovesicles. At the end of the treatment, the mice were sacrificed and the tumors removed. Figure 5a shows that the tumor growth is delayed in mice treated with the nanovesicles, either locally or intraperitoneally (left panel), leading to the formation of smaller tumors compared to control mice (right panel). Real-time PCR analysis in isolated tumors in vivo confirm the in vitro data; as shown in Figure 5b, in mice treated with nanovesicles, is observed the increase of proapoptotic genes Bad and Bax and the decrease in anti-apoptotic genes, Survivin and Bcl-XL. Also we observe the increase of TRAIL and DR5. The results were confirmed by immunofluorescence analysis for TRAIL; it was observed an increase in the number of positive cells to TRAIL (indicated by arrows) in the tumors of mice treated locally or intraperitoneally with citrus nanovesicles compared to control mice (Figure 5c). These data suggest that the nanovesicle are able to reduce tumor growth by activating the TRAIL-mediated apoptotic pathway.

Study of nanovesicles ability for tumor targeting

In vivo biodistribution of nanovesicles

The nanovesicles were labeled with the lipophilic dye DiR for 30 minutes at room temperatures. The marked nanovesicles were injected intraperitoneally in mice bearing the CML xenografts. Mice were anesthetized and the acquisition of fluorescence was performed using IVIS (Living Image Software; PerkinElmer LifeSciences) after 15 minutes, 1 hour or 24 hours after inoculation. After 24 hours the mice were sacrificed, the organs and the tumor removed and fluorescence measured.

In vivo test

In order to assess whether the lemon nanovesicles reduce in vivo tumor growth reaching the tumor site, the nanovesicles were labeled with the lipophilic dye DiR (1.10-Dioctadecyl-3,3,30,30-tetramethylindotricarbocyanine). The biodistribution of nanovesicles was evaluated after 15 minutes, 1 hour and 24 hours after intraperitoneal injection of labeled vesicles. As shown in Figure 6a, the vesicles quickly reach the tumor site (already after 15 minutes), remaining associated to the tumor up to 24 hours (the arrows indicate the distribution of marked nanovesicles in the tumor site). The analysis of the extracted organs 24 hours after the inoculation of nanovesicles shows that these, as well as the free probe, accumulate in the liver, spleen and kidneys. In addition, analysis of the tumors shows that the nanovesicles are internalized into the tumor mass and remain in the site, while no accumulation of fluorescence is observed in the tumor taken from mice treated with the free probe (Figure 6b).

Statistical analysis

All in vitro experiments were repeated at least three times in order to obtain a reproducible result. Data are expressed as mean values ± standard deviation of three independent experiments. The statistical analysis was performed using t- test. Differences were considered significant when p< 0.05.

LITERATURE REFERENCES

Bibliography:

1. Regente M, Short-Monzon G, Maldonado AM, Pinedo M, Jorrin J, de la Canal L. Vesicular fractions of sunflower apoplastic fluids are associated with potential exosome marker proteins. FEBS Lett 583, 3363-3366 (2009).

2. Wang B, et al. Targeted drug delivery to intestinal macrophages by bioactive nanovesicles released from grapefruit. Mol Ther 22, 522-534 (2014).

3. Ju S, et al. Grape exosome-like nanoparticles induces intestinal stem cells and protect mice from DSS-induced colitis. Mol Ther 21, 1345-1357 (2013).

4. Manthey JA, Grohmann K, Guthrie N. Biological properties of citrus flavonoids Pertaining to cancer and inflammation. Curr Med Chem 8, 135-153 (2001).

5. Benavente-Garcia O, Castillo J. Update on the uses and properties of citrus flavonoids: new findings in anticancer, cardiovascular, and anti-inflammatory activity. J Agric Food Chem 56 6185-6205 (2008).

6. Wang L, et al. Anticancer activities of citrus peel polymethoxyflavones related to angiogenesis and others. Biomed Res Int 2014, 453 972 (2014).

7. Johnstone RW, Frew AJ, Smyth MJ. The TRAIL apoptotic pathway in cancer onset, progression and therapy. Nat Rev Cancer 8, 782-798 (2008).

8. A Nesterov, Nikrad M, Johnson T, Kraft AS. Oncogenic Ras sensitizes normal human cells to tumor necrosis factor-alpha-related apoptosis-inducing ligand- induced apoptosis. Cancer Res 64, 3922-3927 (2004).

9. Viktoriya Sokolova et al. Characterisation of exosomes derived from human cells by nanoparticle tracking analysis and scanning electron microscopy. Colloids and Surfaces B: Biointerfaces 87 (2011) 146- 150.

Claims

1. A process for obtaining nanovesicles from the juice of fruits of the genus Citrus comprising the following steps:

a) centrifuging and filtering the juice in one or more consecutive cycles;

b) ultracentrifuging the juice obtained in step (a) thus obtaining a supernatant and a sedimentation pellet containing the nanovesicles and recovering the vesicles.

2. The process according to claim 1 comprising the following additional steps: c) subjecting the recovered pellet to a sucrose gradient ultracentrifugation; d) isolating the fraction having a density between 1.12 and 1.19g / ml;

e) optionally subjecting the fraction to ultracentrifugation;

f) optionally washing the pellet with physiological solution.

3. The process according to claim 1 or 2, wherein the ultrafiltration in step (b) and/or (e) is carried out at a value between 100,000xg 150,000xg and for a time between 60 and 120 min.

4. The process according to any one of claims 2 or 3 wherein the sucrose gradient ultrafiltration in step (c) is carried out at a value between lOOOOOxg 150000xg and for a time ranging from 60 min to 120 min and a % gradient of sucrose between 45% and 30%.

5. The process according to any one of the preceding claims in which step (a) comprises at least one centrifugation at a value between 15000xg and 20000xg for a time between 60 and 180 min and a filtration filter with pores not less than about 45 μηι (microns).

6. The process according to claim 5 in which step (a) comprises a first centrifugation cycle from 3000xg to 10,000xg for a time between 30 and 90 min/centrifugation followed by first filtration with a filter having pores not smaller than 0.8 microns, and a second centrifugation cycle from 15000xg 17000xg for a time between 70 and 100 min/centrifugation followed or intercalated by filtrations with filter having pores not smaller than about a 0.45 micron.

7. The process according to any one of the preceding claims comprising the following cycles:

a) centrifuging the juice at 3000xg for about 30 minutes, then at lOOOOxg for about 60 minutes and subjecting the supernatant to a filtration using filter with pores of 0.8 μηι;

b) centrifuging the filtrate from the previous step at a value of 16500xg for about 60 minutes, subjecting the supernatant to a filtration using filters with pores 0.45 μηι and then centrifuging again the filtrate at 16500xg for about 180 minutes;

c) ultracentrifuging the supernatant of the previous step at 120000xg for about 90 minutes thus obtaining a supernatant and a pellet containing the sedimentation nanovesicles;

d) optionally recovering and ultracentrifuging the pellet in a sucrose gradient between 45% and 30% sucrose ultracentrifuging at a value of about lOOOOOxg for 90 minutes at 4 ° C,

e) isolating the fraction having a density between 1.12 and 1.19g / ml, f) ultracentrifuging the fraction in step (e) at the same conditions as in step (c), g) optionally washing with physiological solution.

8. The process according to any one of the preceding claims in which the juice is obtained from Citrus limon L.

9. Nanovesicles having a density of between 1.12 and 1.19 g/ml and sizes between 50 and 70 nm obtained by the process according to any one of claims 1 to 8 for use in a therapeutic treatment as active ingredient alone or in combination with one or more additional active ingredients, provided that said one or more additional active ingredients are not encapsulated in sadi nanovesicles

10. Nanovesicles for use in a treatment according to claim 9 in which the treatment is a preventive or curative treatment of solid or hematologic tumours.

11. Nanovesicles for use in a treatment according to claim 10 wherein the tumour is a cancer of the colon-rectum, pancreas, lung, kidney, ovary, liver, thyroid, bladder, breast, esophagus, skin, acute leukemia, chronic myelogenous leukemia and multiple myeloma.

12. Nanovesicles for use in a treatment according to claims 10 or 11 wherein the cancer is resistant to common chemotherapeutic drugs, such as erlotinib, gefitinib, or imatinib.

13. Nanovesicles for use in a treatment according to claim 9 wherein the treatment using nanovesicles is a sensitization treatment of tumour cells to a subsequent or concurrent treatment with one or more chemotherapeutic agents.

14. Nanovesicles for use in a treatment according to claim 13 wherein the treatment using nanovesicles is a sensitization treatment of tumour cells resistant to common chemotherapeutic.

15. A pharmaceutical composition containing the nanovesicles according to any one of claims 9 to 14 and a pharmaceutically acceptable excipient