WO2016165301A1

WO2016165301A1 - Muc1-fc polypeptide vaccine and preparation method and application thereof

Info

Publication number: WO2016165301A1
Application number: PCT/CN2015/092338
Authority: WO
Inventors: 苏静; 于浩洋; 李正成
Original assignee: 苏静
Priority date: 2015-04-14
Filing date: 2015-10-20
Publication date: 2016-10-20
Also published as: CN104800838A; CN104800838B

Abstract

Provided in the present invention are an MUC1-Fc polypeptide vaccine and a preparation method and an application thereof, the polypeptide vaccine set forth in the present invention comprising MUC1 antigenic polypeptides containing immunoglobulin Fc segments, the sequence of the polypeptides being shown in SEQ ID NO:1; by means of genetic engineering technology, the MUC1 antigenic polypeptides containing immunoglobulin Fc segments are built into a carrier, are expressed and purified in E. coli, and then undergo coating with carriers such as lipidosomes in order to obtain the MUC1-Fc polypeptide vaccine of the present invention.

Description

MUC1-Fc polypeptide vaccine and preparation method and application thereof

Technical field

The invention relates to the field of tumor DNA vaccines and viral vector vaccines, in particular to a MUCl-Fc polypeptide vaccine and a preparation method and application thereof.

Background technique

In the process of its occurrence and development, tumor cells may express some new antigens or overexpress some antigens due to gene mutation or expression regulation of cells, and these new antigens may be recognized as "non-self substances" and can be recognized and killed by the body's immune system. The body can resist tumors through natural and acquired immunity. However, tumors can still develop and metastasize under the action of human immune function, indicating that tumors also have their own protective mechanisms. Tumor cells can evade immune recognition and attack by the body by indicating the modification of the antigen and changing the microenvironment around the tumor, that is, the immune escape of the tumor. The tumor vaccine can break the tolerance of the autoimmune system to tumor antigens, activate tumor-specific T cells or induce tumor-specific antibodies, activate immune recognition, and achieve the purpose of killing tumors.

Many studies have shown that antigenic peptides on the surface of tumor cells can effectively stimulate the immune response of tumor cells. Some scholars have prepared peptide vaccines by antigen peptides eluting from the surface of tumors and proteins specific from tumors, which can be raised by DC cells. It acts to trigger CTL reaction. In addition, heat shock protein-peptide complex has good immunogenicity and can induce anti-tumor immune response. In addition, HSP70 can induce T cells to enter tumor and induce cytokines such as TFA-α and IL-2. expression. Since the first human-specific antigen was reported in 1989, many tumor antigens have been discovered. Compared with other types of antigens (proteins, DNA vaccines, viral vector antigens, etc.), antigenic peptides derived from tumor-associated antigens have advantages such as high specificity and safety, and can also change amino acid substitutions, change peptide conformation, and modify amino acids. Methods such as residues increase the immunogenicity of the peptide. However, tumor cells express presented antigenic peptides, which have dominant epitopes, weak or even inhibitory epitopes, and the surface antigen peptides are expressed at low levels, and must be immunized by a large number of tumor cells to provide sufficient antigen. Therefore, it is necessary to explore how to find a high-purity and high-efficiency specific tumor antigen polypeptide to prepare a vaccine.

MUC1 is a high glycosylation (glycosylation greater than 50%), high molecular weight (Mr>200×103) protein, also known as a membrane-attached protein, which is a transmembrane molecule expressed by the muc1 gene. It plays an important role in epithelial renewal and differentiation, maintaining epithelial integrity and the occurrence and metastasis of cancer. The polypeptide backbone of MUC1 contains a variable number of repeating sequences (VNTR) with a stable spatial structure, and the antigenic determinants are mainly concentrated in this An area. The core peptide of MUC1 on the surface of normal cells is covered by peripheral sugar chains. On the surface of cancerous cells, MUC1 of tumor cells changes on the sugar chain due to incomplete glycosylation and incomplete glycosylation, resulting in protein core peptide. Partial exposure exposes new tumor-associated epitopes and glycogen epitopes. MMC1 with incomplete glycosylation is widely distributed (90% solid tumors and multiple non-solid tumors) and is abnormally abundantly expressed on the surface of cancer cells. Therefore, MUC1 has become a very promising therapeutic tumor vaccine target.

However, the MUC1 polypeptide vaccine currently used has only a small epitope, so it can only target MHC I or MHC II, has MHC restriction factors, and cannot effectively activate CTL response. In 2011, Israeli researchers developed a relatively long MUC1 polypeptide tumor vaccine that contained both MHC I and MHC II binding epitopes and was tested with CD4+ and CD8 in over 50% of Caucasian populations. HLA binding of +T cells. In vitro and in vivo experiments in mice have shown that it can effectively activate CTL responses of CD4+ cells and CD8+ cells.

Summary of the invention

The invention provides a MUCl-Fc polypeptide vaccine and a preparation method and application thereof, in particular to a polypeptide vaccine capable of containing MHC1+ immunoglobulin Fc segment of MHC I and MHC II binding epitopes, and a preparation method and application thereof.

To achieve the object of the present invention, the present invention adopts the following technical solutions:

In a first aspect, the invention provides a MUCl-Fc polypeptide vaccine comprising a MUC1 antigen polypeptide having an immunoglobulin Fc segment.

The invention firstly uses the bioinformatics method to predict the binding of the MUC1 tumor polypeptide and the human leukocyte antigen (HLA) based on the original sequence of the MUC1 protein, and then chemically synthesizes the polypeptide to the predicted sequence, optimizes and improves the peptide with the best effect. After the fragment, the expression sequence was fused to the immunoglobulin Fc fragment, and finally the MUCl antigen polypeptide sequence of the immunoglobulin Fc fragment of the present invention was purified.

In the present invention, the MUCl antigen polypeptide sequence carrying the immunoglobulin Fc segment is as shown in SEQ ID NO: 1:

SEQ ID NO: 1: Kosak sequence + MUC1 + linker + Fc segment, the sequence of which is as follows:

The MUC1 antigen polypeptide with immunoglobulin Fc segment obtained by the invention comprises MHC I and MHC II binding epitopes at the same time, compared with the prior polypeptide vaccine which can only target MHC I or MHC II single binding epitope, prepared by the invention The polypeptide vaccine can break through the MHC restriction factors and effectively activate the cytotoxic T lymphocyte (CTL) response of CD4+ cells and CD8+ cells, thus achieving better prevention and treatment effects.

In the present invention, the vaccine further comprises a carrier; the carrier is a biodegradable material which has good sustained release and biocompatibility.

The carrier in the present invention may be polylactic acid-glycolic acid copolymer (PLGA), polyethylene glycol (PEG), water-soluble vitamin E derivative (TPGS), polylactic acid (PLA), polycaprolactone (PCL). Or a combination of any one or at least two of 1,2-dioleoyl-3-trimethylaminolacane (DOTAP), but is not limited thereto.

The present invention may employ a liposome as a carrier, and particularly a cationic liposome carrier, for example, 1,2-dioleoyl-3-trimethylaminolacane (DOTAP) may be employed.

The invention utilizes a nano-scale biodegradable material to coat the MUC1 antigen polypeptide with the immunoglobulin Fc segment to make a vaccine, can protect the vaccine from degradation, realize sustained release and improve the bioavailability of the antigen.

In a second aspect, the present invention provides a method for preparing a vaccine according to the first aspect of the present invention, which comprises the steps of:

(1) Fusion of the immunoglobulin Fc fragment to the MUC1 polypeptide fragment, obtaining the MUC1 antigen polypeptide sequence with the immunoglobulin Fc segment, and preparing the corresponding expression vector by Red/ET homologous recombination or restriction enzyme ligase, and then passing Biological expression and purification to obtain the MUC1 antigen polypeptide having an immunoglobulin Fc segment;

(2) The described MUC1 antigen polypeptide having an immunoglobulin Fc fragment is coated with a vector.

In the step (1) of the preparation method of the present invention, the upstream homology arm can be designed by using the Red/ET homologous recombination method:

Downstream homology arm:

The MUCl antigen polypeptide sequence carrying the immunoglobulin Fc fragment was constructed into a vector and then expressed and purified in E. coli.

The step (1) in the present invention is not limited to the above Red/ET homologous recombination method or restriction enzyme ligation method, and the construction and expression and purification of the vector can be carried out by using a common genetic engineering technique well known in the art.

The vector described in the present invention is preferably, but not limited to, an E. coli vector, and for example, the vector may be any one of pET32a, pET22b, pET28a, pET29a, pET9a or pET3a.

In the step (2) of the preparation method of the present invention, the carrier is polylactic acid-glycolic acid copolymer (PLGA), polyethylene glycol (PEG), water-soluble vitamin E derivative (TPGS), polylactic acid (PLA). Any one or a combination of at least two of polycaprolactone (PCL) or 1,2-dioleoyl-3-trimethylaminolacane (DOTAP).

Preferably, the carrier is 1,2-dioleoyl-3-trimethylaminolacane (DOTAP).

The carrier in the present invention is a pharmaceutically acceptable adjuvant, preferably, but not limited to, the above carrier.

In the step (2) of the preparation method of the present invention, the coating comprises the following steps:

1) The carrier is dissolved in an organic solvent to a concentration of 1 μM/mL;

2) drying the organic solvent with a constant flow of nitrogen to form a uniform film structure and drying it overnight;

3) The immunoglobulin Fc-segmented MUC1 antigen polypeptide diluted with PBS was added, the vector was sufficiently hydrated, sonicated for 10-15 min, filtered, and stored at 4 ° C until use.

Preferably, the organic solvent is chloroform:methanol = 2:1 (volume ratio).

In the present invention, the preparation method of the MUCl-Fc polypeptide vaccine specifically comprises the following steps:

(1) Fusion of the immunoglobulin Fc fragment to the MUC1 polypeptide fragment, obtaining the MUC1 antigen polypeptide sequence with the immunoglobulin Fc segment, and designing the upstream homology arm by Red/ET homologous recombination method:

Downstream homology arm:

The MUC1 antigen polypeptide sequence carrying the immunoglobulin Fc fragment was constructed on the pET32a vector, and then expressed and purified in E. coli to obtain the MUC1 antigen polypeptide having the immunoglobulin Fc segment;

(2) Dissolving 1,2-dioleoyl-3-trimethylaminolacane (DOTAP) in an organic solvent to a concentration of 1 μM/mL, wherein the organic solvent is chloroform:methanol=2:1 (volume The organic solvent was blown dry with a constant flow of nitrogen to form a uniform membrane structure of 1,2-dioleoyl-3-trimethylaminopropane, which was dried overnight; the strip diluted with PBS was added. The MUC1 antigen polypeptide of the immunoglobulin Fc segment, the 1,2-dioleoyl-3-trimethylaminolacane (DOTAP) is sufficiently hydrated, and after hydration, in an ultrasonic washing tank precooled by ice, Ultrasound 10-15 min, filter 3 times with 0.22 μM filter, and store at 4 ° C for use.

In a third aspect, the present invention also provides the use of a vaccine according to the first aspect of the invention for the preparation of a medicament for the treatment or prevention of cancer.

The cancer in the present invention may be any one or a combination of at least two of breast cancer, gastric cancer, pancreatic cancer, colon cancer, prostate cancer, cervical cancer or esophageal cancer, and is preferably, but not limited thereto.

Compared with the prior art, the present invention has at least the following beneficial effects:

(1) The immunoglobulin Fc-segment-containing MUC1 antigen polypeptide of the present invention comprises both MHC I and MHC II binding epitopes, and the present invention is compared to a conventional polypeptide vaccine which can only target MHC I or MHC II single binding epitopes. The prepared polypeptide vaccine can effectively activate the cytotoxic T lymphocyte (CTL) reaction of CD4+ cells and CD8+ cells by breaking the MHC restriction factor, and achieve better prevention and treatment effects;

(2) coating the MUC1 polypeptide vaccine of the present invention by using nano material technology, which can protect the vaccine from degradation and achieve sustained release, and improve antigen bioavailability;

(3) The killing rate of the target cells by the T cells stimulated by the DC cells loaded with the antigen polypeptide of the present invention can reach 71.6%, and the killing rate can be increased by 55% compared with the cells without the antigen loading of the polypeptide.

DRAWINGS

BRIEF DESCRIPTION OF THE DRAWINGS Fig. 1 is a schematic view showing the preparation process of the MUCl-Fc polypeptide vaccine of the present invention.

Fig. 2 is a result of evaluation of a cell killing experiment of the MUCl-Fc polypeptide vaccine of the present invention.

detailed description

The invention will be described in detail below with reference to the accompanying drawings.

Example 1

The preparation method of the MUC1 antigen polypeptide with immunoglobulin Fc segment specifically includes the following steps:

The immunoglobulin Fc fragment was fused to the MUC1 polypeptide fragment to obtain a MUCl antigen polypeptide sequence carrying an immunoglobulin Fc fragment, the sequence of which is shown in SEQ ID NO: 1, and the upstream homology arm was designed by Red/ET homologous recombination method:

Downstream homology arm:

The MUC1 antigen polypeptide sequence carrying the immunoglobulin Fc fragment was constructed on the pET32a vector, and then expressed and purified in E. coli to obtain the MUC1 antigen polypeptide having the immunoglobulin Fc fragment.

Example 2

Fusion of the immunoglobulin Fc fragment to the MUC1 polypeptide fragment to obtain the MUC1 antigen polypeptide sequence carrying the immunoglobulin Fc segment, the sequence of which is shown in SEQ ID NO: 1, using a restriction enzyme ligase method, the enzyme cleavage site

The MUC1 antigen polypeptide sequence carrying the immunoglobulin Fc fragment was constructed on the pET29a vector, and then expressed and purified in E. coli to obtain the MUC1 antigen polypeptide having the immunoglobulin Fc fragment.

Example 3

The polypeptide vaccine with the immunoglobulin Fc segment-containing MUC1 antigen polypeptide of Example 1 was coated with 1,2-dioleoyl-3-trimethylaminolacane (DOTAP), and the preparation method thereof comprises the following steps:

1) Solvent preparation: preparing a mixture of chloroform and methanol, wherein the volume ratio of chloroform to methanol is 2:1;

2) Dissolve 1,2-dioleoyl-3-trimethylaminolacane (DOTAP): dissolve DOTAP in a round bottom flask with the solvent in step 1), and dissolve to a concentration of 1 μM/mL;

3) Drying the solvent with a constant flow of nitrogen to form a uniform film structure on the container wall;

4) After the solvent is blown dry, it is dried in a vacuum drying oven overnight to remove the solvent as much as possible;

5) Adding the MUC1 antigen polypeptide with immunoglobulin Fc fragment of Example 1 diluted with PBS, the volume of which is suitable for infiltrating the DOTAP membrane, in order to maintain protein activity, the round bottom bottle is placed in the ice box. Inside, the ice box was placed on a horizontal swing shaker overnight to allow the DOTAP to be fully hydrated;

6) After the hydration is finished, the round bottom bottle is placed in an ultrasonic washing tank pre-cooled by ice, and ultrasonic for 10 min;

7) The resulting solution was then filtered in a clean bench using a 0.22 μM filter for 3 times and then stored at 4 ° C until use.

Example 4

The immunoglobulin Fc segment-containing MUC1 of Example 1 was coated with a PLGA-TPGS nanoparticle carrier. The antigenic polypeptide obtains a polypeptide vaccine, and the preparation method thereof comprises the following steps:

1) Dissolution of the nano material: a mixture of the nano material PLGA and Vitamin E TPGS (TPGS) (the mass ratio of TPGS is 20 to 50%) is completely dissolved by acetone, and dissolved to a concentration of 5 to 30 mg/mL;

2) adding the immunoglobulin Fc segment-containing MUC1 antigen polypeptide of Example 1 to the solution of step 1) while stirring;

3) According to the step 2), the volume ratio of the solution to the deionized water is 1:4, and the solution of the nano material and the acetone is added to the deionized water under magnetic stirring at 500 to 1500 rpm/min to form a uniform emulsion. Then continue to stir until the acetone is evaporated;

4) Collection of nanoparticles: The prepared nanomaterials were collected by centrifugation at 8000 to 15000 rpm/min, then resuspended in deionized water, and the nanomaterials were washed twice in repeated operations;

5) The resulting solution was then filtered in a clean bench using a 0.22 μM filter for 3 times and then stored at 4 ° C until use.

Example 5

The polypeptide vaccine of Example 3 was used to stimulate the induction of DC cells cultured on day 5, and then the T cells were stimulated by culturing mature DC cells, and the increase in the ability of the polypeptide antigen to kill cancer cells by T cells was detected. Breast cancer cells MCF, T cells: MCF-7 = 4:1, reaction time was 8h.

A control group was set up in a 3 mL DC cell culture system, in which the polypeptide vaccine of Example 3 was not added; and 10 μL, 50 μL, 100 μL, 200 μL, and 400 μL of the polypeptide vaccine solution of Example 3 were separately added, and the test results were used 3 times. The mean repeat value of the independent repeated test results showed that the killing results are shown in Fig. 2, where * represents a significant difference from the control group T test.

As can be seen from Fig. 2, using 3 mL of the control group and adding 10 μL, 50 μL, 100 μL, 200 μL, 400 μL of the polypeptide vaccine solution of Example 3, the killing rates were 46.2%, 52.8%, 65.2%, 71.6%, respectively. 66.9%, 65.4%, which showed that after adding 50 μL, 100 μL, 200 μL, 400 μL of the polypeptide vaccine solution of Example 3, the killing rate was significantly different from that of the control group, and the polypeptide vaccine solution concentration was 100 μL. The optimal killing effect increased the killing rate of T cells generated by stimulation by 55% compared with the control group for MCF-7.

It can be seen from the above examples that the polypeptide vaccine of the present invention has an improved ability to kill cancer cells by T cells, and has better prevention and treatment effects, less side effects, high safety, and low cost compared with other MUC1 polypeptide vaccines. Easy to use and other features.

The Applicant declares that the present invention illustrates the process of the present invention by the above embodiments, but the present invention It is not limited to the above process steps, that is, it does not mean that the invention must rely on the above process steps to be implemented. It will be apparent to those skilled in the art that any modifications of the present invention, equivalent substitutions of the materials selected for the present invention, and the addition of the auxiliary ingredients, the selection of the specific means, etc., are all within the scope of the present invention.

Claims

A MUCl-Fc polypeptide vaccine comprising a MUCl antigen polypeptide having an immunoglobulin Fc fragment.
The vaccine according to claim 1, wherein the sequence of the MUC1 antigen polypeptide having an immunoglobulin Fc segment is as shown in SEQ ID NO: 1.
The vaccine according to claim 1 or 2, wherein the vaccine further comprises a carrier;

Preferably, the carrier is a biodegradable material;

Preferably, the carrier is a polylactic acid-glycolic acid copolymer, polyethylene glycol, a water-soluble vitamin E derivative, polylactic acid, polycaprolactone or 1,2-dioleoyl-3-trimethylamino Any one or a combination of at least two of the alkane;

Preferably, the carrier is 1,2-dioleoyl-3-trimethylaminolacane.
A method of preparing a vaccine according to any one of claims 1 to 3, which comprises the steps of:

(1) Fusion of the immunoglobulin Fc fragment to the MUC1 polypeptide fragment, obtaining the MUC1 antigen polypeptide sequence with the immunoglobulin Fc segment, and preparing the corresponding expression vector by Red/ET homologous recombination or restriction enzyme ligase, and then passing Biological expression and purification to obtain a MUC1 antigen polypeptide having an immunoglobulin Fc segment;

(2) The described MUC1 antigen polypeptide having an immunoglobulin Fc fragment is coated with a vector.
The preparation method according to claim 4, wherein in the step (1), the upstream homology arm is designed by using the Red/ET homologous recombination method: (HindIII) CTCTAGCGTTTAAACTTAAGCTT; the downstream homology arm: (BamHI) GGATCCACTAGTCCAGTGTGGTGGA, The MUC1 antigen polypeptide sequence carrying the immunoglobulin Fc segment is constructed on a vector and then expressed and purified in E. coli;

Preferably, the vector is any one of pET32a, pET22b, pET28a, pET29a, pET9a or pET3a.
The preparation method according to claim 4 or 5, wherein in the step (2), the carrier is a biodegradable material;

Preferably, the carrier is a polylactic acid-glycolic acid copolymer, polyethylene glycol, a water-soluble vitamin E derivative, polylactic acid, polycaprolactone or 1,2-dioleoyl-3-trimethylamino Any one or a combination of at least two of the alkane;

Preferably, the carrier is 1,2-dioleoyl-3-trimethylaminolacane.
The preparation method according to any one of claims 4 to 6, wherein in the step (2), the coating comprises the following steps:

1) The carrier is dissolved in an organic solvent to a concentration of 1 μM/mL;

2) drying the organic solvent with a constant flow of nitrogen to form a uniform film structure and drying it overnight;

3) adding the immunoglobulin Fc-segmented MUC1 antigen polypeptide diluted with PBS, allowing the carrier to be fully hydrated, sonicating for 10-15 min, filtering, and storing at 4 ° C for use;

Preferably, the organic solvent has a volume ratio of chloroform to methanol of 2:1.
The preparation method according to any one of claims 4 to 7, wherein the method comprises the following steps:

(1) Fusion of the immunoglobulin Fc fragment to the MUC1 polypeptide fragment, obtaining the MUC1 antigen polypeptide sequence with the immunoglobulin Fc segment, and designing the upstream homology arm by using the Red/ET homologous recombination method: (HindIII) CTCTAGCGTTTAAACTTAAGCTT; Arm: (BamHI) GGATCCACTAGTCCAGTGTGGTGGA, the MUC1 antigen polypeptide sequence carrying the immunoglobulin Fc segment was constructed on pET32a vector, and then expressed and purified in E. coli to obtain the MUC1 antigen polypeptide with immunoglobulin Fc segment;

(2) The 1,2-dioleoyl-3-trimethylaminolacane is dissolved in an organic solvent to a concentration of 1 μM/mL, wherein the organic solvent is a volume ratio of chloroform to methanol of 2:1; The organic solvent was blown dry under a constant nitrogen flow to form a uniform membrane structure of 1,2-dioleoyl-3-trimethylaminolacane and dried overnight; the immunoglobulin Fc diluted with PBS was added. The MUC1 antigen polypeptide of the segment, the 1,2-dioleoyl-3-trimethylaminolacane is fully hydrated, and after hydration, in the ultrasonic washing tank pre-cooled by ice, ultrasonic for 10-15 min, using 0.22 The μM filter was filtered 3 times and stored at 4 ° C for later use.
Use of the vaccine according to any one of claims 1 to 3 for the preparation of a medicament for treating or preventing cancer.
The use according to claim 9, wherein the cancer is any one or a combination of at least two of breast cancer, gastric cancer, pancreatic cancer, colon cancer, prostate cancer, cervical cancer or esophageal cancer.