WO2016130087A1 - Controlling timing of plant flowering - Google Patents

Abstract

The present invention relates to the field of plant flowering and more particularly to controlling the timing of plant flowering. More specifically, the present invention relates to devernalization of plants for controlling the timing of plant flowering.

Description

CONTROLLING TIMING OF PLANT FLOWERING CROSS-REFERENCE TO RELATED APPLICATIONS

[0001] The present application is related to and claims priority to U.S. provisional patent application Serial No. 62/1 14,870 filed 1 1 February 2015. Each application is incorporated herein by reference in its entirety.

SEQUENCE SUBMISSION

[0002] The present application is being filed along with a Sequence Listing in electronic format. The Sequence Listing is entitled 2577245PCTSequenceListing.txt, created on 10 February 2016 and is 27 kb in size. The information in the electronic format of the Sequence Listing is incorporated herein by reference in their entirety.

BACKGROUND OF THE INVENTION

[0003] The present invention relates to the field of plant flowering and more particularly to controlling the timing of plant flowering. More specifically, the present invention relates to devernalization of plants for controlling the timing of plant flowering.

[0004] The publications and other materials used herein to illuminate the background of the invention, and in particular, cases to provide additional details respecting the practice, are incorporated by reference, and for convenience are referenced in the following text by author and date and are listed alphabetically by author in the appended bibliography.

[0005] Plants have evolved a complex regulatory network that ensures that flowering occurs at the correct time of year. They therefore rely on environmental cues such as photoperiod, that is the relative duration of day and night. Many plants in temperate climates also use prolonged exposure to cold, which increases the ability to flower in winter annuals, biennials and perennials (Chouard, 1960; Bernier et al., 1981). Distinguishing features of this process, known as vernalization, are its quantitative nature, and, in most cases, the temporal uncoupling between stimulus and effect. Vernalization is often combined with a long-day (LD) requirement, so that flowering occurs after winter, that is in spring or early summer. Adverse conditions encountered after vernalization, for example short days (SD) or high temperature, may reduce the promotive effect of cold, and hence the vernalized state is a reversible process.

[0006] The vernalization requirement is an important trait in agriculture, and determines the adaptation range of domesticated species. For example, the vernalization requirement of winter cereals allows them to start growing in the fall/autumn, take maximum advantage of the spring before flowering, and reach early maturity to avoid yield-limiting summer heat. Another type of crop with a strong vernalization requirement are biennials that are harvested at the end of the first growing season for their vegetative parts, for example fleshy roots that store food reserves before winter. Root chicory (Cichorium intybus L. var. sativum) is one such plant. It is cultivated mainly in Western Europe for its tap root, which accumulates inulin-type fructans. It was used in the past for production of an ersatz coffee, and is presently used in functional foods as a source of pre-biotic fibers. Other varieties of chicory are grown for their foliage: radicchio (C intybus L. var. silvestre) is cultivated for its colored leaves, and witloof (C. intybus L. var. foliosum) is cultivated for its etiolated leaves, produced by forcing the roots. All these chicory crops are biennials, requiring cold and LD conditions for flower induction (Paulet, 1985; Pimpini and Gianquinto, 1988; Gianquinto, 1997; Demeulemeester and De Proft, 1999; Dielen et al., 2005). They normally remain vegetative during the first growing season, but there is a risk that the plants will experience cold and become vernalized if sown too early. This is especially critical for root chicory, which is prone to spring vernalization (Dielen et al., 2005). A low sensitivity to vernalization - commonly referred to as 'resistance to bolting' - is therefore a major trait used in breeding programs. Such breeding programs would be greatly facilitated by a better understanding of the molecular mechanisms involved.

[0007] The molecular basis of vernalization has been investigated in depth in the annual plant Arabidopsis thaliana, for which the vernalization requirement of winter accessions was found to correlate with the level of expression of a gene encoding a potent inhibitor of flowering, FLOWERING LOCUS C (FLC) (Michaels and Amasino, 1999; Sheldon et al, 1999). The FLC protein, a MADS domain transcription factor, blocks at multiple points the activation cascade that normally triggers flowering via up-regulation of the FLOWERING LOCUS T (FT) gene under favorable LD conditions. The FT protein is synthesized in the leaves, moves to the shoot apical meristem and triggers changes in gene expression that initiate the switch from vegetative to reproductive growth (Turck et al., 2008). FLC not only inhibits production of FT in the leaves, but also impairs the response to the FT signal in the shoot meristem (Michaels and Amasino, 2001 ; Helliwell et al., 2006; Searle et al., 2006). Two pathways promote transition to flowering through repression of FLC expression: the so-called 'autonomous pathway', which involves constitutive repressors of FLC, and the vernalization pathway, which down-regulates FLC via a complex series of mechanisms including synthesis of long non-coding transcripts and epigenetic chromatin modifications (Ietswaart et al., 2012). [0008] Allelic variation at the FLC locus is associated with flowering time variation in Arabidopsis, but only in epistatic interaction with the upstream regulatory gene FRIGIDA (FRT), which activates FLC. Late-flowering ecotypes contain functional alleles of FRI and FLC, whereas rapid-cycling accessions have evolved through loss of FRI function and/or attenuation of FLC activity (Johanson et al., 2000; Gazzani et al., 2003; Michaels et al., 2003). This is the case in Columbia, which lacks a functional FRI (and hence is hereafter referred to as Col fri), and is therefore fast-flowering independently of vernalization because of low FLC expression. However, introgression of an active FRI allele causes an increase in FLC expression and so confers a vernalization requirement to the resulting Col FRI line (Lee and Amasino, 1995). Naturally occurring weak alleles of FLC are not usually caused by a difference in their coding region but by a difference in the regulatory elements contained in their promoter (or 5' untranslated) region or the first intron (Sheldon et al, 2000; Michaels et al., 2003; Liu et al., 2004). An flc null mutant eliminates the FRI late-flowering phenotype, but retains some sensitivity to vernalization, indicating that vernalization is able to promote flowering via FLC- independent mechanisms (Michaels and Amasino, 2001). These alternative routes involve other MADS box genes such as the MADS AFFECTING FLOWERING genes (MAF1-5) that belong to the FLC clade, and A GAMO US-LIKE 19 and 24 (AGL19 and AGL24) (Alexandre and Hennig, 2008).

[0009] Orthologs of Arabidopsis FLC (hereafter AtFLC) have been found in other Brassicaceae, such as Arabis alpina, Arabidopsis halleri, Brassica napus, B. oleracea, B. rapa, Capsella rubella and Sinapis alba (Schranz et al., 2002; DAloia et al., 2008; Wang et al., 2009; Aikawa et al, 2010; Guo et al, 2012). Identification of the AtFLC ortholog PERPETUAL FLOWERING 1 {PEPl) in Arabis alpina highlighted a criticial mechanism by which the regulation of flowering differs between related annual and perennial plants. In contrast to AtFLC, which is stably repressed by cold in annual A. thaliana, re-activation of PEPl after a return to warm temperature blocks flowering of all meristems that did not undergo flowering during the vernalization treatment, and confers perenniality to Arabis alpina (Wang et al, 2009).

[0010] FLC orthologs initially appeared to be restricted to the Brassicaceae family (Becker and Theissen, 2003). For example, in winter cereals, vernalization down-regulates an inhibitor of FT as in Arabidopsis, but this inhibitor, called VERNALIZATION 2 (VRN2), is not orthologous to AtFLC and is not directly repressed by cold (Dennis and Peacock, 2009). In sugar beet (Beta vulgaris), the obligate vernalization requirement of biennial cultivated sub-species is due to a homozygous recessive mutation at the long-sought 'bolting gene 5'. This was recently shown to be due to partial loss of function of an activator of FT that causes reduced sensitivity to photoperiod that is restored by vernalization (Pin et al., 2012). Sugar beet was the first case in which an AtFLC homolog has been characterized outside the plant family Brassicaceae (Reeves et al, 2007), but, although BvFLl repressed flowering in transgenic Arabidopsis and was down- regulated in response to cold, how this integrates with the action of the 'bolting gene B' remains to be investigated. Interestingly, the phylogenetic approach used by Reeves et al. (2007) indicated evolutionary conservation of FLC-Uke genes in the three major eudicot lineages: rosids (including Brassicales such as Arabidopsis), caryophyllids (including Caryophyllales such as sugar beet) and asterids. The latter clade includes Asterales species such as root chicory, and evidence supporting this prediction has been reported (Perilleux et al., 2013). The root chicory CiFLl sequence, which falls in the FLCIMAF clade of MADS box genes and functions like AtFLC as a repressor of flowering in transgenic Arabidopsis. CiFLl is down-regulated in response to cold in root chicory and reactivated at devernalizing temperature. It was shown that this devernalization response is also correlated with resumption of AtFLC activity in Arabidopsis, and hence may be a common feature of the flowering response to temperature in distant species.

[0011] As previously discussed, the FLOWERING LOCUS C (FLQ gene is an important component of flowering time control because both the autonomous pathway (in response to the endogenous developmental programs) and vernalization pathway (in response to prolonged winter-cold temperature) converge on FLC (He & Amasino, 2005). FLC encodes a MADS domain transcription factor. Due to its central role in governing floral transition, many regulatory mechanisms have evolved to control its expression, one of which is the deposition and removal of the repressive histone modification, trimethylation of lysine 27 of histone H3 (H3K27me3). The Polycomb Repressive Complex 2 (PRC2) has been previously reported to be an important catalytic complex targeting FLC for H3K27me3-mediated repression (Gendall et al, 2001 ; Jiang et al, 2008). Moreover, it has recently been shown that, antagonizing the effect of PRC2, JUMONJI 30 (JMJ30) and JMJ32, which are Jumonji-C (JmjC) domain-containing proteins, function as H3K27me3 histone demethylases and regulate FLC expression in the thermosensory pathway (Gan et al., 2014).

[0012] In Arabidopsis ecotypes with a functional activator of FLC, FRIGIDA (FRI), FLC expression is high in the young seedling. In the natural environment, this winter-annual plant needs to be exposed to a long period of cold during winter (the vernalization process) to allow it to flower in the next season in spring. This requirement for vernalization is evolutionarily favorable because, at one hand, it would ensure that Arabidopsis plant will not flower in the middle of winter, while on the other hand, it ensures the plant could flower immediately once returned to a suitable growth environment in spring. FLC is known to be a key player in this vernalization pathway, in which FLC is gradually repressed by the PRC2-mediated H3K27me3 histone modification during vernalization (induction of flowering after long exposure to cold) (Angel et al, 201 1). However, whether the histone demethylases play a role in this pathway is yet unknown.

[0013] Furthermore, in the agriculture industry, it is empirically known that the effect of vernalization can be reversed by exposing the seeds or plantlets to a short period of high temperature, a process termed devernalization (Gregory & Purvis, 1937; Purvis & Gregory, 1945). The similar phenomenon can be observed in the model organism of Brassicaceae, Arabidopsis, and a recent paper highlights that FLC is involved in this pathway (Perilleux et al, 2013). Reversal of the floral induction is important for certain crop plants that are harvested for their leaves (e.g. cabbage) or roots (e.g. root chicory). Thus, farmers control the timing of flowering of crops by treating the plants under a certain temperature. However, this empirical practice of flowering control is labor-intensive and does not always work as expected.

[0014] Thus, there is a need to further understand the devernalization process and to develop a molecular-based technology to control flowering timing in plants, including crop plants.

SUMMARY OF THE INVENTION

[0015] The present invention relates to the field of plant flowering and more particularly to controlling the timing of plant flowering. More specifically, the present invention relates to devernalization of plants for controlling the timing of plant flowering.

[0016] Thus, the present invention provides methods and compositions for devernalization or controlled timing of flowering in plants. This invention relates to compositions and methods for overexpressing the level and/or activity of JMJ30 and/or JMJ32 in plants for creation of plants with modulated timing of flowering. Thus, in one aspect, the present invention provides an isolated nucleic acid comprising a polynucleotide sequence for use in a recombinant DNA construct for modulating JMJ30 and/or JMJ32 expression.

[0017] In one embodiment, the present invention provides a plant comprising in its genome a recombinant DNA construct comprising at least one inducible regulatory element operably linked to a polynucleotide comprising (i) a nucleic acid sequence encoding a polypeptide having an amino acid sequence of at least 90% sequence identity, based on the Clustal V or Clustal W method of alignment, when compared to SEQ ID NO:2 or (ii) a full complement of the nucleic acid sequence of (i), wherein the full complement and the nucleic acid sequence of (i) consist of the same number of nucleotides and are 100% complementary. The polypeptide is preferably a JMJ30 or JMJ30-like polypeptide. Overexpression of a JMJ30 or JMJ30-like polypeptide in a plant preferably conveys delayed flowering or devernalization to the plant. In some embodiments, the at least one inducible regulatory element can be replaced by a constitutive promoter for the overexpression of a JMJ30 or JMJ30-like polypeptide in a plant.

[0018] In another embodiment, the present invention provides a plant comprising in its genome a recombinant DNA construct comprising at least one inducible regulatory element operably linked to a polynucleotide comprising (i) a nucleic acid sequence encoding a polypeptide having an amino acid sequence of at least 90% sequence identity, based on the Clustal V or Clustal W method of alignment, when compared to SEQ ID NO:4 or (ii) a full complement of the nucleic acid sequence of (i), wherein the full complement and the nucleic acid sequence of (i) consist of the same number of nucleotides and are 100% complementary. The polypeptide is preferably a JMJ32 or JMJ32-like polypeptide. Overexpression of a JMJ32 or JMJ32-like polypeptide in a plant preferably conveys delayed flowering or devernalization to the plant. In some embodiments, the at least one inducible regulatory element can be replaced by a constitutive promoter for the overexpression of a JMJ32 or JMJ32-like polypeptide in a plant.

[0019] In one embodiment, the present invention provides a plant comprising in its genome a recombinant DNA construct comprising at least one inducible regulatory element operably linked to a polynucleotide comprising (i) a nucleic acid sequence of at least 90% sequence identity, based on the Clustal V or Clustal W method of alignment, when compared to SEQ ID NO: l or (ii) a full complement of the nucleic acid sequence of (i). The isolatedjjolynucleotide preferably encodes a JMJ30 or JMJ30-like polypeptide. Overexpression of a JMJ30 or JMJ30- like polypeptide in a plant preferably conveys delayed flowering or devernalization to the plant. In some embodiments, the at least one inducible regulatory element can be replaced by a constitutive promoter for the overexpression of a JMJ30 or JMJ30-like polypeptide in a plant.

[0020] In one embodiment, the present invention provides a plant comprising in its genome a recombinant DNA construct comprising at least one inducible regulatory element operably linked to a polynucleotide comprising (i) a nucleic acid sequence of at least 90% sequence identity, based on the Clustal V or Clustal W method of alignment, when compared to SEQ ID NO:3 or (ii) a full complement of the nucleic acid sequence of (i). The isolated polynucleotide preferably encodes a JMJ32 or JMJ32-like polypeptide. Overexpression of a JMJ32 or JMJ32- like polypeptide in a plant preferably conveys delayed flowering or devernalization to the plant. In some embodiments, the at least one inducible regulatory element can be replaced by a constitutive promoter for the overexpression of a JMJ32 or JMJ32-like polypeptide in a plant.

[0021] In one embodiment, the present invention provides a plant comprising in its genome a recombinant DNA construct comprising at least one inducible regulatory element operably linked to a polynucleotide comprises a nucleotide sequence, wherein the nucleotide sequence is hybridizable under stringent conditions with a DNA molecule comprising the full complement of SEQ ID NO:l . The isolated polynucleotide preferably encodes a JMJ30 or JMJ30-like polypeptide. Overexpression of a JMJ30 or JMJ30-like polypeptide in a plant preferably conveys delayed flowering or devernalization to the plant. In some embodiments, the at least one inducible regulatory element can be replaced by a constitutive promoter for the overexpression of a JMJ30 or JMJ30-like polypeptide in a plant.

[0022] In one embodiment, the present invention provides a plant comprising in its genome a recombinant DNA construct comprising at least one inducible regulatory element operably linked to a polynucleotide comprises a nucleotide sequence, wherein the nucleotide sequence is hybridizable under stringent conditions with a DNA molecule comprising the full complement of SEQ ID NO:3. The isolated polynucleotide preferably encodes a JMJ32 or JMJ32-like polypeptide. Overexpression of a JMJ32 or JMJ32-like polypeptide in a plant preferably conveys delayed flowering or devernalization to the plant. In some embodiments, the at least one inducible regulatory element can be replaced by a constitutive promoter for the overexpression of a JMJ32 or JMJ32-like polypeptide in a plant.

[0023] In another embodiment, the present invention includes seed, fruit or tuber of any of the plants of the present invention, wherein said seed, fruit or tuber comprises in its genome a recombinant DNA construct described herein and wherein a plant produced from said seed exhibits devernalization or controlled timing of flowering when compared to a control plant not comprising said recombinant DNA construct.

[0024] In a further embodiment, the present invention provides a method of devernalization or controlling timing of flowering in a plant, comprising: (a) introducing into a regenerable plant cell a recombinant DNA construct described herein and (b) regenerating a transgenic plant from the regenerable plant cell after step (a), wherein the transgenic plant comprises in its genome the recombinant DNA construct and exhibits devernalization or controlled flowering timing when compared to a control plant not comprising the recombinant DNA construct. The method may further comprise (c) obtaining a progeny plant derived from the transgenic plant, wherein said progeny plant comprises in its genome the recombinant DNA construct and exhibits devernalization or controlled flowering timing when compared to a control plant not comprising the recombinant DNA construct.

[0025] In an additional embodiment, the present invention provides a method of selecting for (or identifying) devernalization or controlled flowering timing in a plant, comprising (a) obtaining a transgenic plant, wherein the transgenic plant comprises in its genome a recombinant DNA construct described herein; (b) obtaining a progeny plant derived from the transgenic plant, wherein the progeny plant comprises in its genome the recombinant DNA construct; and (c) selecting (or identifying) the progeny plant with devernalization or controlled flowering timing compared to a control plant not comprising the recombinant DNA construct.

BRIEF DESCRIPTION OF THE FIGURES

[0026] Figures la and lb show that Arabidopsis plants with jmj30 jmj32 mutation are sensitized for vernalization. Figure l a: Primary rosette leaves were counted for FRI and FRI jmj30 jmj32 plants with either no treatment (Non-vernalized, NV) or exposure to different period of vernalization treatment (vernalized 2-weeks, V2W; vernalized 4-weeks, V4W; vernalized 6-weeks, V6W). Flowering time was initially comparable between untreated FRI and FRI jmj30 jmj32. However, V2W- and V4W -treated FRI jmj30 jmj32 flowered earlier than their FRI counterpart, suggesting that FRI jmj30 jmj32 reached the vernalized threshold faster. With V6W-treatment, both FRI and FRI jmj30 jmj32 were fully vernalized, hence they showed similar flowering time. Figure lb: FLC relative expression in FRI and FRI jmj30 jmj32. The phenotypic difference was similarly reflected in the expression of the floral repressor FLC, whereby FLC expression showed the largest difference in V2W- and V4W-treated seedlings.

[0027] Figures 2a and 2b show devernalization of FRI and FRI jmj30 jmj32 seeds and seedlings. FRI and FRI jmj30 jmj32 seeds were sterilized, sowed on MS plates, and stratified for 3 days in the dark at 4° C. After which one batch of the plates (seed) were subjected to vernalization treatment directly (Figure 2a), while the remaining plates were placed in a standard growth environment of LD 22°C to grow until 3 days-after-germination (3DAG) before vernalization treatment (Figure 2b). Samples were then exposed to 3, 4, or 5 weeks (V3W, V4W, V5W) of SD 4° C cold treatment. After vernalization, the seedlings are either shifted to standard LD 22° C growth environment directly and collected after 3 days (VXW+22⁰ C, where X: 3,4,5), or subjected to an additional 1 week of LD 30° C devernalization before sample collection (VXW+30° C+22° C, where X: 3,4,5). Downward-pointing arrows indicate sample collection points.

[0028] Figure 3 shows the effect of devernalization on FRI and FRI jmj30 jmj32 seedlings after 3 weeks of vernalization.

[0029] Figure 4 shows that the β-estradiol-treated pER8-JMJ30 in FRI^sf2 (Col) plants show a late-flowering phenotype compared to the WT and mock-treated pER8-JMJ30 in FRI^sf2 (Col) plants.

DETAILED DESCRIPTION OF THE INVENTION

[0030] The present invention relates to the field of plant flowering and more particularly to controlling the timing of plant flowering. More specifically, the present invention relates to devernalization of plants for controlling the timing of plant flowering.

[0031] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as is commonly understood by one of skill in the art to which the invention belongs.

[0032] "Abiotic stress" may be at least one condition selected from the group consisting of: drought, water deprivation, flood, high light intensity, high temperature, low temperature, salinity, etiolation, defoliation, heavy metal toxicity, anaerobiosis, nutrient deficiency, nutrient excess, UV irradiation, atmospheric pollution (e.g., ozone) and exposure to chemicals (e.g., paraquat) that induce production of reactive oxygen species (ROS).

[0033] The term "about" or "approximately" means within a statistically meaningful range of a value. Such a range can be within an order of magnitude, preferably within 50%, more preferably within 20%, more preferably still within 10%, and even more preferably within 5% of a given value or range. The allowable variation encompassed by the term "about" or "approximately" depends on the particular system under study, and can be readily appreciated by one of ordinary skill in the art.

[0034] "Agronomic characteristic" is a measurable parameter including but not limited to, abiotic stress tolerance, greenness, stay-green, yield, growth rate, biomass, fresh weight at maturation, dry weight at maturation, fruit yield, seed yield, total plant nitrogen content, fruit nitrogen content, seed nitrogen content, nitrogen content in a vegetative tissue, total plant free amino acid content, fruit free amino acid content, seed free amino acid content, free amino acid content in a vegetative tissue, total plant protein content, fruit protein content, seed protein content, protein content in a vegetative tissue, drought tolerance, nitrogen stress tolerance, nitrogen uptake, root lodging, root mass, harvest index, stalk lodging, plant height, ear height, ear length, salt tolerance, early seedling vigor and seedling emergence under low temperature stress.

[0035] As used herein, "allele" refers to any of one or more alternative forms of a gene locus, all of which alleles relate to a trait or characteristic. In a diploid cell or organism, the two alleles of a given gene occupy corresponding loci on a pair of homologous chromosomes.

[0036] "Altered levels" refers to the production of gene product(s) in transgenic organisms in amounts or proportions that differ from that of normal, control or non-transformed organisms.

[0037] The term "bolting" refers to the transition in a plant from a vegetative stage to a reproductive stage.

[0038] "Coding sequence" refers to a nucleotide sequence that codes for a specific amino acid sequence.

[0039] A "control" or "control plant" or "control plant cell" provides a reference point for measuring changes in phenotype of a subject plant or plant cell in which genetic alteration, such as transformation, has been effected as to a polynucleotide of interest. A subject plant or plant cell may be descended from a plant or cell so altered and will comprise the alteration.

[0040] A control plant or plant cell may comprise, for example: (a) a wild-type plant or cell, i.e., of the same genotype as the starting material for the genetic alteration which resulted in the subject plant or cell; (b) a plant or plant cell of the same genotype as the starting material but which has been transformed with a null construct (i.e., with a construct which has no known effect on the trait of interest, such as a construct comprising a marker gene); (c) a plant or plant cell which is a non-transformed segregant among progeny of a subject plant or plant cell; (d) a plant or plant cell genetically identical to the subject plant or plant cell but which is not exposed to conditions or stimuli that would induce expression of the polynucleotide of interest or (e) the subject plant or plant cell itself, under conditions in which the polynucleotide of interest is not expressed.

[0041] As used herein, "delayed flowering" refers to a delay in flowering by the plant. The delay may be measured in days or it may be measured by the number of rosette leaves before bolting. Accordingly, "delayed flowering" refers to a delay in flowering by the plant of at least about 3 days, or by at least 3 rosette leaves, or by at least a statistically significantly delay when compared to a control plant as determined by a two-tailed Student's t-test, P-value < 0.1. Alternatively, delayed flowering refers to a delay in flowering caused by an induced overexpression or a constitutive overexpression of JMJ30, JMJ30-like, JMJ32 or JMJ-32 like polypeptide in a transgenic plant. [0042] As used herein, "devernalization" refers to a process by which flowering is reversed or delayed in vernalized plants by exposure of such plants to high temperatures or an artificial equivalent. In one embodiment, an artificial equivalent is the induced overexpression or constitutive overexpression of a JMJ30, JMJ30-like, JMJ32 or JMJ-32 like polypeptide in a transgenic plant. The overexpression of such a polypeptide in the transgenic plant demethylates a histone associated with an FLC or FLC-like gene in the transgenic plant which results in the repression of flowering in the transgenic plant.

[0043] "Expression" refers to the production of a functional product. For example, expression of a nucleic acid fragment may refer to transcription of the nucleic acid fragment (e.g., transcription resulting in mRNA or functional RNA) and/or translation of mRNA into a precursor or mature protein.

[0044] "Heterologous" with respect to sequence means a sequence that originates from a foreign species, or, if from the same species, is substantially modified from its native form in composition and/or genomic locus by deliberate human intervention.

[0045] "Introduced" in the context of inserting a nucleic acid fragment (e.g., a recombinant DNA construct) into a cell, means "transfection" or "transformation" or "transduction" and includes reference to the incorporation of a nucleic acid fragment into a eukaryotic or prokaryotic cell where the nucleic acid fragment may be incorporated into the genome of the cell (e.g., chromosome, plasmid, plastid or mitochondrial DNA), converted into an autonomous replicon, or transiently expressed (e.g., transfected mRNA).

[0046] "JMJ30 polypeptide" refers to an Arabidopsis thaliana polypeptide encoded by the Arabidopsis thaliana locus At3g20810. The terms "JMJ30 polypeptide", "JMJ30 protein" and "JMJ30" are used interchangeably herein. The protein (SEQ ID NO:2) encoded by the gene At3g20810 is a member of the Jumonji-C (JmjC) domain containing proteins which have the ability to demethylate trimethylated histones (Gan et al., 2014). In one embodiment, a nucleotide sequence encoding mRNA for JMJ30 is set forth in SEQ ID NO: l . In another embodiment, a JMJ30 coding sequence is nucleotides 98-1354 or nucleotides 98-1351 of SEQ ID NO.l . Over- expressing the JMJ30 gene conveys a delayed flowering phenotype or a devernalized phenotype. The term "JMJ30" may also be used herein to refer to "JMJ30", "JMJ30-like", "JMJ30 homolog" or "JMJ30 ortholog" unless the context dictates otherwise.

[0047] "JMJ32 polypeptide" refers to an Arabidopsis thaliana polypeptide encoded by the Arabidopsis thaliana locus At3g45880. The terms "JMJ32 polypeptide", "JMJ32 protein" and "JMJ32" are used interchangeably herein. The protein (SEQ ID NO:4) encoded by the gene At3g45880 is a member of the Jumonji-C (JmjC) domain containing proteins which have the ability to demethylate tnmethylated histones (Gan et al., 2014). In one embodiment, a nucleotide sequence encoding mRNA for JMJ32 is set forth in SEQ ID NO:3. In another embodiment, a JMJ32 coding sequence is nucleotides 5-1042 or nucleotides 5-1039 of SEQ ID NO:3. Over- expressing the JMJ30 gene conveys a delayed flowering phenotype or a devernalized phenotype. The term "JMJ32" may also be used herein to refer to "JMJ32", "JMJ32-like", "JMJ32 homolog" or "JMJ32 ortholog" unless the context dictates otherwise.

[0048] "JMJ30-like polypeptide" refers to a polypeptide having sequence homology to JMJ30 and over-expressing the JMJ30-like gene conveys a delayed flowering phenotype or a devernalized phenotype. The terms "JMJ30-like polypeptide", "JMJ30-like protein" and "JMJ30-like" are used interchangeably herein.

[0049] "JMJ32-like polypeptide" refers to a polypeptide having sequence homology to JMJ30 and over-expressing the JMJ32-like gene conveys a delayed flowering phenotype or a devernalized phenotype. The terms "JMJ32-like polypeptide", "JMJ32-like protein" and "JMJ32-like" are used interchangeably herein.

[0050] "Operably linked" refers to the association of nucleic acid fragments in a single fragment so that the function of one is regulated by the other. For example, a promoter is operably linked with a nucleic acid fragment when it is capable of regulating the transcription of that nucleic acid fragment.

[0051] "Over-expression" or "overexpression" refers to the production of a gene product in transgenic organisms that exceeds levels of production in normal, control or non-transformed organisms.

[0052] "Phenotype" means the detectable characteristics of a cell or organism.

[0053] "Plant" includes reference to whole plants, plant organs, plant tissues, plant propagules, seeds and plant cells and progeny of same. Plant cells include, without limitation, cells from seeds, suspension cultures, embryos, meristematic regions, callus tissue, leaves, roots, shoots, gametophytes, sporophytes, pollen, and microspores.

[0054] "Propagule" includes all products of meiosis and mitosis able to propagate a new plant, including but not limited to, seeds, spores and parts of a plant that serve as a means of vegetative reproduction, such as corms, tubers, offsets, or runners. Propagule also includes grafts where one portion of a plant is grafted to another portion of a different plant (even one of a different species) to create a living organism. Propagule also includes all plants and seeds produced by cloning or by bringing together meiotic products, or allowing meiotic products to come together to form an embryo or fertilized egg (naturally or with human intervention).

[0055] "Progeny" comprises any subsequent generation of a plant.

[0056] "Promoter" refers to a nucleic acid fragment capable of controlling transcription of another nucleic acid fragment.

[0057] "Promoter functional in a plant" is a promoter capable of controlling transcription in plant cells whether or not its origin is from a plant cell.

[0058] "Inducible promoter" refers to a promoter which is capable of directly or indirectly activating transcription of one or more DNA sequences or genes in response to an inducer. The inducer can be a chemical agent such as a protein, metabolite, growth regulator, herbicide or phenolic compound or a physiological stress, such as that imposed directly by heat, cold, salt or toxic elements or indirectly through the action of a pathogen or disease agent such as a virus or other biological or physical agent or environmental condition.

[0059] "Constitutive promoter" refers to a promoter which is capable of causing a gene to be expressed in most cell types at most.

[0060] "Recombinant" refers to an artificial combination of two otherwise separated segments of sequence, e.g., by chemical synthesis or by the manipulation of isolated segments of nucleic acids by genetic engineering techniques. "Recombinant" also includes reference to a cell or vector, that has been modified by the introduction of a heterologous nucleic acid or a cell derived from a cell so modified, but does not encompass the alteration of the cell or vector by naturally occurring events (e.g., spontaneous mutation, natural transformation/ transduction/transposition) such as those occurring without deliberate human intervention.

[0061] "Recombinant DNA construct" refers to a combination of nucleic acid fragments that are not normally found together in nature. Accordingly, a recombinant DNA construct may comprise regulatory sequences and coding sequences that are derived from different sources, or regulatory sequences and coding sequences derived from the same source, but arranged in a manner different than that normally found in nature. The terms "recombinant DNA construct" and "recombinant construct" are used interchangeably herein.

[0062] "Regulatory sequences" refer to nucleotide sequences located upstream (5' non- coding sequences), within, or downstream (3' non-coding sequences) of a coding sequence, and which influence the transcription, RNA processing or stability, or translation of the associated coding sequence. Regulatory sequences may include, but are not limited to, promoters, translation leader sequences, introns, and polyadenylation recognition sequences. The terms "regulatory sequence" and "regulatory element" are used interchangeably herein.

[0063] A "trait" refers to a physiological, morphological, biochemical, or physical characteristic of a plant or a particular plant material or cell. In some instances, this characteristic is visible to the human eye, such as seed or plant size, or can be measured by biochemical techniques, such as detecting the protein, starch, or oil content of seed or leaves, or by observation of a metabolic or physiological process, e.g., by measuring flowering time, or by the observation of the expression level of a gene or genes, or by agricultural observations such as delayed flowering time.

[0064] A "transformed cell" is any cell into which a nucleic acid fragment (e.g., a recombinant DNA construct) has been introduced.

[0065] "Transformation" as used herein refers to both stable transformation and transient transformation.

[0066] "Stable transformation" refers to the introduction of a nucleic acid fragment into a genome of a host organism resulting in genetically stable inheritance. Once stably transformed, the nucleic acid fragment is stably integrated in the genome of the host organism and any subsequent generation.

[0067] "Transient transformation" refers to the introduction of a nucleic acid fragment into the nucleus, or DNA-containing organelle, of a host organism resulting in gene expression without genetically stable inheritance.

[0068] "Transgenic plant" includes reference to a plant which comprises within its genome a heterologous polynucleotide. For example, the heterologous polynucleotide is stably integrated within the genome such that the polynucleotide is passed on to successive generations. The heterologous polynucleotide may be integrated into the genome alone or as part of a recombinant DNA construct.

[0069] As used herein, "vernalization" refers to a process by which prolonged exposure to cold temperatures or an artificial equivalent promotes flowering in plants.

[0070] Yield can be measured in many ways, including, for example, test weight, seed weight, seed number per plant, seed number per unit area (i.e. seeds, or weight of seeds, per acre), fruit weight, fruit number, bushels per acre, tonnes per hectare, tonnes per acre, tons per acre and kilograms per hectare.

[0071] Sequence alignments and percent identity calculations may be determined using a variety of comparison methods designed to detect homologous sequences including, but not limited to, the Megalign® program of the LASERGENE® bioinformatics computing suite (DNASTAR® Inc., Madison, WI). Unless stated otherwise, multiple alignment of the sequences provided herein were performed using the Clustal V method of alignment (Higgins and Sharp (1989) CABIOS. 5: 151 -153) with the default parameters (GAP PENALTY=10, GAP LENGTH PENALTY=10). Default parameters for pairwise alignments and calculation of percent identity of protein sequences using the Clustal V method are KTUPLE=1, GAP PENALTY=3, WINDOW=5 and DIAGONALS SAVED=5. For nucleic acids these parameters are KTUPLE=2, GAP PENALTY=5, WINDOW=4 and DIAGONALS SAVED=4. After alignment of the sequences, using the Clustal V program, it is possible to obtain "percent identity" and "divergence" values by viewing the "sequence distances" table on the same program; unless stated otherwise, percent identities and divergences provided and claimed herein were calculated in this manner.

[0072] Alternatively, the Clustal W method of alignment may be used. The Clustal W method of alignment (described by Higgins and Sharp, CABIOS. 5:151-153 (1989); Higgins, D. G. et al., Comput. Appl. Biosci. 8:189-191 (1992)) can be found in the MegAlign™ v6.1 program of the LASERGENE® bioinformatics computing suite (DNASTAR® Inc., Madison, Wis.). Default parameters for multiple alignment correspond to GAP PENALTY=10, GAP LENGTH PENALTY=0.2, Delay Divergent Sequences=30%, DNA Transition Weight=0.5, Protein Weight Matrix=Gonnet Series, DNA Weight Matrix=IUB. For pairwise alignments the default parameters are Alignment=Slow- Accurate, Gap Penalty=10.0, Gap Length=0.10, Protein Weight Matrix=Gonnet 250 and DNA Weight Matrix=IUB. After alignment of the sequences using the Clustal W program, it is possible to obtain "percent identity" and "divergence" values by viewing the "sequence distances" table in the same program.

[0073] Embodiments of the present invention which include isolated polynucleotides and polypeptides, recombinant DNA constructs useful for conferring delayed flowering or reversing vernalization, compositions (such as plants or seeds) comprising these recombinant DNA constructs, and methods utilizing these recombinant DNA constructs are now described.

[0074] In one embodiment, an isolated polynucleotide comprises (i) a nucleic acid sequence encoding a polypeptide having an amino acid sequence of at least 50%, 51 %, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71 %, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity, based on the Clustal V or Clustal W method of alignment, when compared to SEQ ID NO:2 or (ii) a full complement of the nucleic acid sequence of (i), wherein the full complement and the nucleic acid sequence of (i) consist of the same number of nucleotides and are 100% complementary. Any of the foregoing isolated polynucleotides may be utilized in any recombinant DNA constructs of the present disclosure. The polypeptide is preferably a JMJ30 or JMJ30-like polypeptide. Overexpression of a JMJ30 or JMJ30-like polypeptide in a plant preferably conveys delayed flowering or devernalization to the plant.

[0075] In another embodiment, an isolated polynucleotide comprises (i (i) a nucleic acid sequence encoding a polypeptide having an amino acid sequence of at least 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity, based on the Clustal V or Clustal W method of alignment, when compared to SEQ ID NO:4 or (ii) a full complement of the nucleic acid sequence of (i), wherein the full complement and the nucleic acid sequence of (i) consist of the same number of nucleotides and are 100% complementary. Any of the foregoing isolated polynucleotides may be utilized in any recombinant DNA constructs of the present disclosure. The polypeptide is preferably a JMJ32 or JMJ32-like polypeptide. Overexpression of a JMJ32 or JMJ32-like polypeptide in a plant preferably conveys delayed flowering or devernalization to the plant.

[0076] In one embodiment, an isolated polypeptide has an amino acid sequence of at least 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity, based on the Clustal V or Clustal W method of alignment, when compared to SEQ ID NO:2. The polypeptide is preferably a JMJ30 or JMJ30- like polypeptide. Overexpression of a JMJ30 or JMJ30-like polypeptide in a plant preferably conveys delayed flowering or devernalization to the plant.

[0077] In another embodiment, an isolated polypeptide has an amino acid sequence of at least 50%, 51 %, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity, based on the Clustal V or Clustal W method of alignment, when compared to SEQ ID NO:4. The polypeptide is preferably a JMJ32 or JMJ32- like polypeptide. Overexpression of a JMJ32 or JMJ32-like polypeptide in a plant preferably conveys delayed flowering or devenialization to the plant.

[0078] In one embodiment, an isolated polynucleotide comprises (i) a nucleic acid sequence of at least 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61 %, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71 %, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%o, 99%, or 100% sequence identity, based on the Clustal V or Clustal W method of alignment, when compared to SEQ ID NO:l or (ii) a full complement of the nucleic acid sequence of (i). Any of the foregoing isolated polynucleotides may be utilized in any recombinant DNA constructs of the present disclosure. The isolated polynucleotide preferably encodes a JMJ30 or JMJ30-like polypeptide. Overexpression of a JMJ30 or JMJ30-like polypeptide in a plant preferably conveys delayed flowering or devernalization to the plant.

[0079] In another embodiment, an isolated polynucleotide comprises (i) a nucleic acid sequence of at least 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61 %, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71 %, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity, based on the Clustal V or Clustal W method of alignment, when compared to SEQ ID NO:3 or (ii) a full complement of the nucleic acid sequence of (i). Any of the foregoing isolated polynucleotides may be utilized in any recombinant DNA constructs of the present disclosure. The isolated polynucleotide preferably encodes a JMJ32 or JMJ32-like polypeptide. Overexpression of a JMJ32 or JMJ32-like polypeptide in a plant preferably conveys delayed flowering or devernalization to the plant.

[0080] In one embodiment, an isolated polynucleotide comprises a nucleotide sequence, wherein the nucleotide sequence is hybridizable under stringent conditions with a DNA molecule comprising the full complement of SEQ ID NO: l . The isolated polynucleotide preferably encodes a JMJ30 or JMJ30-like polypeptide. Overexpression of a JMJ30 or JMJ30- like polypeptide in a plant preferably conveys delayed flowering or devernalization to the plant.

[0081] In another embodiment, an isolated polynucleotide comprises a nucleotide sequence, wherein the nucleotide sequence is hybridizable under stringent conditions with a DNA molecule comprising the full complement of SEQ ID NO:3. The isolated polynucleotide preferably encodes a JMJ32 or JMJ32-like polypeptide. Overexpression of a JMJ32 or JMJ32- like polypeptide in a plant preferably conveys delayed flowering or devernalization to the plant. [0082] It is understood, as those skilled in the art will appreciate, that the disclosure encompasses more than the specific exemplary sequences. Alterations in a nucleic acid fragment which result in the production of a chemically equivalent amino acid at a given site, but do not affect the functional properties of the encoded polypeptide, are well known in the art. For example, a codon for the amino acid alanine, a hydrophobic amino acid, may be substituted by a codon encoding another less hydrophobic residue, such as glycine, or a more hydrophobic residue, such as valine, leucine, or isoleucine. Similarly, changes which result in substitution of one negatively charged residue for another, such as aspartic acid for glutamic acid, or one positively charged residue for another, such as lysine for arginine, can also be expected to produce a functionally equivalent product. Nucleotide changes which result in alteration of the N-terminal and C-terminal portions of the polypeptide molecule would also not be expected to alter the activity of the polypeptide. Each of the proposed modifications is well within the routine skill in the art, as is determination of retention of biological activity of the encoded products.

[0083] The protein of the current disclosure may also be a protein which comprises an amino acid sequence comprising deletion, substitution, insertion and/or addition of one or more amino acids in an amino acid sequence presented in SEQ ID NO:2 or 4. The substitution may be conservative, which means the replacement of a certain amino acid residue by another residue having similar physical and chemical characteristics. Non-limiting examples of conservative substitution include replacement between aliphatic group-containing amino acid residues such as He, Val, Leu or Ala, and replacement between polar residues such as Lys-Arg, Glu-Asp or Gln- Asn replacement.

[0084] The protein of the present disclosure may also be a protein which is encoded by a nucleic acid comprising a nucleotide sequence comprising deletion, substitution, insertion and/or addition of one or more nucleotides in the nucleotide sequence of SEQ ID NO: 1 or 3. Nucleotide deletion, substitution, insertion and/or addition may be accomplished by site-directed mutagenesis or other techniques well known in the art.

[0085] The protein of the present disclosure may also be a protein which is encoded by a nucleic acid comprising a nucleotide sequence hybridizable under stringent conditions with the complementary strand of the nucleotide sequence of SEQ ID NO:l or 3.

[0086] The term "under stringent conditions" means that two sequences hybridize under moderately or highly stringent conditions. More specifically, moderately stringent conditions can be readily determined by those having ordinary skill in the art, e.g., depending on the length of DNA. The basic conditions are set forth by Sambrook et al., Molecular Cloning: A Laboratory Manual, third edition, chapters 6 and 7, Cold Spring Harbor Laboratory Press, 2001 and include the use of a prewashing solution for nitrocellulose filters 5xSSC, 0.5% SDS, 1.0 mM EDTA (pH 8.0), hybridization conditions of about 50% formamide, 2xSSC to 6xSSC at about 40-50° C (or other similar hybridization solutions, such as Stark's solution, in about 50% formamide at about 42° C) and washing conditions of, for example, about 40-60° C, 0.5-6xSSC, 0.1 % SDS. Preferably, moderately stringent conditions include hybridization (and washing) at about 50° C and 6xSSC. Highly stringent conditions can also be readily determined by those skilled in the art, e.g., depending on the length of DNA.

[0087] Generally, such conditions include hybridization and/or washing at higher temperature and/or lower salt concentration (such as hybridization at about 65° C, 6xSSC to 0.2xSSC, preferably 6xSSC, more preferably 2xSSC, most preferably 0.2xSSC), compared to the moderately stringent conditions. For example, highly stringent conditions may include hybridization as defined above, and washing at approximately 65-68° C, 0.2xSSC, 0.1 % SDS. SSPE (l xSSPE is 0.15 M NaCl, 10 mM NaH₂P0₄, and 1.25 mM EDTA, pH 7.4) can be substituted for SSC (lxSSC is 0.15 M NaCl and 15 mM sodium citrate) in the hybridization and washing buffers; washing is performed for 15 minutes after hybridization is completed.

[0088] It is also possible to use a commercially available hybridization kit which uses no radioactive substance as a probe. Specific examples include hybridization with an ECL direct labeling & detection system (Amersham). Stringent conditions include, for example, hybridization at 42° C for 4 hours using the hybridization buffer included in the kit, which is supplemented with 5% (w/v) Blocking reagent and 0.5 M NaCl, and washing twice in 0.4% SDS, 0.5xSSC at 55° C for 20 minutes and once in 2xSSC at room temperature for 5 minutes.

[0089] In one embodiment, a recombinant DNA construct comprises a polynucleotide described herein operably linked to at least one inducible regulatory sequence (e.g., an inducible promoter functional in a plant). The recombinant DNA construct, when introduced into a plant, preferably conveys delayed flowering or devemalization to the plant. In some embodiments, the at least one inducible regulatory element can be replaced by a constitutive promoter for the overexpression of a polypeptide in a plant.

[0090] An inducible regulatory element is one that is capable of directly or indirectly activating transcription of one or more DNA sequences or genes in response to an inducer. The inducer can be a chemical agent such as a protein, metabolite, growth regulator, herbicide or phenolic compound or a physiological stress, such as that imposed directly by heat, cold, salt or toxic elements or indirectly through the action of a pathogen or disease agent such as a virus or other biological or physical agent or environmental condition. A plant cell containing an inducible regulatory element may be exposed to an inducer by externally applying the inducer to the cell or plant such as by spraying, watering, heating or similar methods. An inducing agent useful for inducing expression from an inducible promoter is selected based on the particular inducible regulatory element. In response to exposure to an inducing agent, transcription from the inducible regulatory element generally is initiated de novo or is increased above a basal or constitutive level of expression. Typically the protein factor that binds specifically to an inducible regulatory element to activate transcription is present in an inactive form which is then directly or indirectly converted to the active form by the inducer. Any inducible promoter can be used in the instant invention (See, e.g., Ward et al., 1993).

[0091] In one embodiment, the inducible regulatory element is a chemical-inducible promoter which is used to induce the expression of a gene in a plant through the application of an exogenous chemical regulator. Chemical-inducible promoters are known in the art and include, but are not limited to, the maize In2-2 promoter, which is activated by benzenesulfonamide herbicide safeners (De Veylder et al., 1997), the maize GST promoter (GST-II-27, WO 93/01294), which is activated by hydrophobic electrophilic compounds that are used as pre-emergent herbicides, the PR-1 promoter (Cao et al., 2006), which is activated by BTH or benxo(l,2,3)thiaidazole-7-carbothioic acid s-methyl ester, the tobacco PR-la promoter (Ono et al., 2004), which is activated by salicylic acid, the copper inducible ACE1 promoter (Mett et al., 1993), the ethanol-inducible promoter AlcA (Caddick et al., 1988) an estradiol- inducible promoter (Bruce et al., 2000), the XVE estradiol-inducible promoter (Zuo et al., 2000), the VGE methoxyfenozide inducible promoter (Padidam et al., 2003) and the TGV dexamethasone-inducible promoter (Bohner et al., 1999). Other chemical-regulated promoters of interest include steroid-responsive promoters (see, for example, the glucocorticoid-inducible promoter in Schena et al., 1991 and McNellis et al., 1998).

[0092] Suitable constitutive promoters for use in a plant host cell include, for example, the core promoter of the Rsyn7 promoter and other constitutive promoters disclosed in WO 99/43838 and U.S. Patent No. 6,072,050; the core CaMV 35S promoter (Odell et al., 1985); rice actin (McElroy et al., 1990); ubiquitin (Christensen et al., 1989 and Christensen et al., 1992); pEMU (Last et al., 1991); MAS (Velten et al., 1984); ALS promoter (U.S. Patent No. 5,659,026), the constitutive synthetic core promoter SCP1 (International Publication No. 03/033651) and the like. Other constitutive promoters include, for example, those discussed in U.S. Patent Nos. 5,608,149; 5,608,144; 5,604,121 ; 5,569,597; 5,466,785; 5,399,680; 5,268,463; 5,608,142; and 6,177,61 1.

[0093] Recombinant DNA constructs of the present disclosure may also include other regulatory sequences, including but not limited to, translation leader sequences, introns, and polyadenylation recognition sequences. In another embodiment of the present disclosure, a recombinant DNA construct of the present disclosure further comprises an enhancer or silencer.

[0094] An intron sequence can be added to the 5' untranslated region, the protein-coding region or the 3' untranslated region to increase the amount of the mature message that accumulates in the cytosol. Inclusion of a spliceable intron in the transcription unit in both plant and animal expression constructs has been shown to increase gene expression at both the mRNA and protein levels up to 1000-fold (Buchman and Berg, 1988; Callis et al., 1987).

[0095] Any plant can be selected for the identification of regulatory sequences and JMJ30, JMJ30-like, JMJ32 or JNJ32-like polypeptide genes to be used in recombinant DNA constructs and other compositions (e.g. transgenic plants, seeds and cells) and methods of the present disclosure. Examples of suitable plants for the isolation of genes and regulatory sequences and for compositions and methods of the present disclosure would include but are not limited to alfalfa, apple, apricot, Arabidopsis, artichoke, arugula, asparagus, avocado, banana, barley, beans, beet, blackberry, blueberry, broccoli, brussels sprouts, cabbage, canola, cantaloupe, carrot, cassava, castorbean, cauliflower, celery, cherry, chicory, cilantro, citrus, Clementines, clover, coconut, coffee, corn, cotton, cranberry, cucumber, Douglas fir, eggplant, endive, escarole, eucalyptus, fennel, figs, garlic, gourd, grape, grapefruit, honey dew, jicama, kiwifruit, lettuce, leeks, lemon, lime, Loblolly pine, linseed, mango, melon, mushroom, nectarine, nut, oat, oil palm, oil seed rape, okra, olive, onion, orange, an ornamental plant, palm, papaya, parsley, parsnip, pea, peach, peanut, pear, pepper, persimmon, pine, pineapple, plantain, plum, pomegranate, poplar, potato, pumpkin, quince, radiata pine, radicchio, radish, rapeseed, raspberry, rice, rye, sorghum, Southern pine, soybean, spinach, squash, Stevia, strawberry, sugarbeet, sugarcane, sunflower, sweet potato, sweetgum, switchgrass, tangerine, tea, tobacco, tomato, triticale, turf, turnip, a vine, watermelon, wheat, yams, and zucchini.

[0096] In one embodiment, a composition of the present disclosure is a plant comprising in its genome any of the recombinant DNA constructs of the present disclosure (such as any of the constructs discussed above). Compositions also include any progeny of the plant, any seed obtained from the plant or its progeny or any fruit, bulb or tuber obtained from the plant or its progeny, wherein the plant, progeny, seed, fruit, bulb or tuber comprises within its genome the recombinant DNA construct. Progeny includes subsequent generations obtained by self- pollination or out-crossing of a plant. Progeny also includes hybrids and inbreds. The plant may be a monocotyledonous or dicotyledonous plant. Particular embodiments of plants include any plant comprising in its genome a recombinant DNA construct comprising at least one inducible regulatory element (e.g., any inducible regulatory element described herein or any constitutive promoter described herein) operably linked to a polynucleotide (e.g., any isolated polynucleotide described herein) and wherein said plant exhibits delayed flowering or devernalization when compared to a control plant not comprising said recombinant DNA construct. The plant may further exhibit an alteration of at least one agronomic characteristic when compared to the control plant.

[0097] In any of the embodiments described herein or any other embodiments of the present disclosure, the alteration of at least one agronomic characteristic is either an increase or decrease.

[0098] Typically, when a transgenic plant comprising a recombinant DNA construct in its genome exhibits delayed flowering or devernalization relative to a reference or control plant, the reference or control plant does not comprise in its genome the recombinant DNA construct.

[0099] One of ordinary skill in the art would readily recognize a suitable control or reference plant to be utilized when assessing or measuring an agronomic characteristic or phenotype of a transgenic plant in any embodiment of the present disclosure in which a control plant is utilized (e.g., compositions or methods as described herein). Furthermore, one of ordinary skill in the art would readily recognize that a suitable control or reference plant to be utilized when assessing or measuring an agronomic characteristic or phenotype of a transgenic plant would not include a plant that had been previously selected, via mutagenesis or transformation, for the desired agronomic characteristic or phenotype.

[0100] In one embodiment, methods include but are not limited to methods for controlling timing of flowering in a plant, methods for devernalization of plants and methods for producing seed, fruit or tuber of a plant. The plant may be a monocotyledonous or dicotyledonous plant. The seed, fruit or tuber may be of a monocotyledonous or dicotyledonous plant.

[0101] A method for transforming a cell (or microorganism) comprising transforming a cell (or microorganism) with any of the isolated polynucleotides or recombinant DNA constructs of the present disclosure. The cell (or microorganism) transformed by this method is also included. In particular embodiments, the cell is eukaryotic cell, e.g., a yeast, insect or plant cell, or prokaryotic, e.g., a bacterial cell. The microorganism may be Agrobacterium, e.g. Agrobacterium tumefaciens or Agrobacterium rhizogenes.

[0102] A method for producing a transgenic plant comprising transforming a plant cell with any of the isolated polynucleotides or recombinant DNA constructs of the present disclosure and regenerating a transgenic plant from the transformed plant cell. The disclosure is also directed to the transgenic plant produced by this method, and transgenic seed, fruit or tuber obtained from this transgenic plant. The transgenic plant obtained by this method may be used in other methods of the present disclosure.

[0103] A method for isolating a polypeptide of the disclosure from a cell or culture medium of the cell, wherein the cell comprises a recombinant DNA construct comprising a polynucleotide of the disclosure operably linked to at least one regulatory sequence, and wherein the transformed host cell is grown under conditions that are suitable for expression of the recombinant DNA construct.

[0104] A method of altering the level of expression of a polypeptide of the disclosure in a host cell comprising: (a) transforming a host cell with a recombinant DNA construct of the present disclosure; and (b) growing the transformed host cell under conditions that are suitable for expression of the recombinant DNA construct wherein expression of the recombinant DNA construct results in production of altered levels of the polypeptide of the disclosure in the transformed host cell.

[0105] A method of devernalizing a plant, comprising: (a) introducing into a regenerable plant cell a recombinant DNA construct as described herein and (b) regenerating a transgenic plant from the regenerable plant cell after step (a), wherein the transgenic plant comprises in its genome the recombinant DNA construct and exhibits devernalization when compared to a control plant not comprising the recombinant DNA construct. The method may further comprise (c) obtaining a progeny plant derived from the transgenic plant, wherein said progeny plant comprises in its genome the recombinant DNA construct and exhibits devernalization when compared to a control plant not comprising the recombinant DNA construct.

[0106] A method of controlling timing of flowering in a plant, comprising: (a) introducing into a regenerable plant cell a recombinant DNA construct as described herein and (b) regenerating a transgenic plant from the regenerable plant cell after step (a), wherein the transgenic plant comprises in its genome the recombinant DNA construct and exhibits controlled flowering when compared to a control plant not comprising the recombinant DNA construct. The method may further comprise (c) obtaining a progeny plant derived from the transgenic plant, wherein said progeny plant comprises in its genome the recombinant DNA construct and exhibits controlled flowering when compared to a control plant not comprising the recombinant DNA construct.

[0107] A method of selecting for (or identifying) devernalization in a plant, comprising (a) obtaining a transgenic plant, wherein the transgenic plant comprises in its genome a recombinant DNA construct as described herein; (b) obtaining a progeny plant derived from said transgenic plant, wherein the progeny plant comprises in its genome the recombinant DNA construct; and (c) selecting (or identifying) the progeny plant with devernalization compared to a control plant not comprising the recombinant DNA construct.

[0108] A method of selecting for (or identifying) controlled timing of flowering in a plant, comprising (a) obtaining a transgenic plant, wherein the transgenic plant comprises in its genome a recombinant DNA construct as described herein; (b) obtaining a progeny plant derived from said transgenic plant, wherein the progeny plant comprises in its genome the recombinant DNA construct; and (c) selecting (or identifying) the progeny plant with controlled timing of flowering compared to a control plant not comprising the recombinant DNA construct.

[0109] A method of producing a seed, fruit or tuber, the method comprising: (a) crossing a first plant with a second plant, wherein at least one of the first plant and the second plant comprises a recombinant DNA construct as described herein and (b) selecting a seed, fruit or tuber of the crossing of step (a), wherein the seed, fruit or tuber comprises the recombinant DNA construct. A plant grown from the seed, fruit or tuber may exhibit at least one trait selected from the group consisting of: devernalization and controlled timing of flowering when compared to a control plant not comprising the recombinant DNA construct. The polynucleotide of the recombinant DNA construct may be expressed in at least one tissue of the plant, or during at least one environmental or inducing condition, or both.

[0110] A method of producing seed, fruit or tuber (for example, seed, fruit or tuber that can be sold as a devernalized or controlled flowering timing offering) comprising any of the preceding methods, and further comprising obtaining seeds, fruits or tubers from said progeny plant, wherein said seeds, fruits, or tubers comprise in their genome said recombinant DNA construct.

[0111] The use of a recombinant DNA construct as described herein for producing a plant that exhibits at least one trait selected from the group consisting of: devernalization and controlled timing of flowering, when compared to a control plant not comprising said recombinant DNA construct. The polynucleotide may be expressed in at least one tissue of the plant, or during at least one environmental or inducing condition, or both.

[0112] In any of the preceding methods or any other embodiments of methods of the present disclosure, in said introducing step said regenerable plant cell may comprise a callus cell, an embryogenic callus cell, a gametic cell, a meristematic cell, or a cell of an immature embryo.

[0113] In any of the preceding methods or any other embodiments of methods of the present disclosure, said regenerating step may comprise the following: (i) culturing said transformed plant cells in a media comprising an embryogenic promoting hormone until callus organization is observed; (ii) transferring said transformed plant cells of step (i) to a first media which includes a tissue organization promoting hormone; and (iii) subculturing said transformed plant cells after step (ii) onto a second media, to allow for shoot elongation, root development or both.

[0114] In any of the preceding methods or any other embodiments of methods of the present disclosure, alternatives exist for introducing into a regenerable plant cell a recombinant DNA construct comprising a polynucleotide operably linked to at least one regulatory sequence. For example, one may introduce into a regenerable plant cell a regulatory sequence (such as one or more enhancers, optionally as part of a transposable element), and then screen for an event in which the regulatory sequence is operably linked to an endogenous gene encoding a polypeptide of the instant disclosure.

[0115] In any of the preceding methods or any other embodiments of methods of the present disclosure, alternatives exist for introducing into a regenerable plant cell a recombinant DNA construct comprising a polynucleotide operably linked to at least one regulatory sequence. For example, one may introduce into a regenerable plant cell a regulatory sequence (such as one or more enhancers, optionally as part of a transposable element), and then screen for an event in which the regulatory sequence is operably linked to an endogenous gene encoding a polypeptide of the instant disclosure.

[0116] The introduction of recombinant DNA constructs of the present disclosure into plants may be carried out by any suitable technique, including but not limited to direct DNA uptake, chemical treatment, electroporation, microinjection, cell fusion, infection, vector-mediated DNA transfer, bombardment, or Agrobacterium-mediated transformation. Techniques for plant transformation and regeneration have been described in International Patent Publication WO 2009/006276.

[0117] The development or regeneration of plants containing the foreign, exogenous isolated nucleic acid fragment that encodes a protein of interest is well known in the art. The regenerated plants may be self-pollinated to provide homozygous transgenic plants. Otherwise, pollen obtained from the regenerated plants is crossed to seed-grown plants of agronomically important lines. Conversely, pollen from plants of these important lines is used to pollinate regenerated plants. A transgenic plant of the present disclosure containing a desired polypeptide is cultivated using methods well known to one skilled in the art.

[0118] As shown herein, it was found that JMJ32 and particularly JMJ30 function not only in the vernalization process but is also important for the devernalization process. During vernalization, the PRC-mediated deposition of H3 27me3 on FLC locus gradually represses its expression (Angel et al., 2011 ; Yang et al., 2014). This phenomenon is important for the plant's reproductive success as it ensures timely switch from vegetative to reproductive development upon the arrival of the spring season. However, plants have to differentiate between true long cold exposure during winter and short cold temperature fluctuation in the other seasons. Previous study showed that the accumulation of H3K27me3 is responsive as early as 2 weeks of cold exposure (Angel et al., 201 1 ; Yang et al., 2014). In the results described herein, it was observed that in the mutant of the H3K27me3 demethylases, FRI jmj30 jmj32 reached a vernalized state faster. The H3K27me3 demethylases may antagonize the PRC2 complex, by removing the marks while PRC2 complex are depositing them. It is postulated that this competition of H3K27me3 deposition and removal may serve as a braking system thus allowing the plant to revert back to a non-vernalized state if the cold exposure did not persist.

[0119] Moreover, it was found that the heat-stabilized JMJ30 might be responsible for the devernalization process, a treatment used by farmers to control the flowering of crop plants since early farming days. 1 week of 30°C treatment is able to reverse the effect of vernalization in the FRI plants. However this effect is lost in the FRI jmj30 jmj32 mutant plants, suggesting the importance of the H3K27me3 demethylases in the devernalization treatment. Furthermore, by regulating the expression of JMJ30 with a chemical inducible system, we were able to induce the reversal of vernalization, and upregulate FLC expression by removing the repressive H3K27me3 marks from the locus (Figure 3a-g). The fact that overexpression of JMJ30 was able to reactivates a vernalized FLC shows that JMJ30 was not only necessary but also sufficient to confer the devernalization effect.

[0120] Devernalization or controlled flower timing in accordance with the present invention can be applied to any plant, including without limitation crop plants. The seeds of crop plants are frequently stored at a lower temperature to prevent spoilage, and prolong their lifespan and viability. However this storage temperature will induce the crop plant to flower early when planted, which may not be favorable phenomenon from the agricultural view for some crop plants, such as onion sets planted for the bulbs with fleshy leaves, or sugar beets planted for their fleshy root. Thus, a devernalization treatment would reverse this effect and allow optimum production of crops. Moreover, the ability to control flowering time can also be utilized to increase the yield and prevent the loss of crops. When the growth condition is conducive, prolonging the fruit-bearing growth period would increase the final yield. On the other hand, if harsh growth conditions (e.g. droughts, heat waves) are to be expected ahead, inducing flowering and fruiting of crops may prevent unrecoverable losses. To achieve these results, an inducible overexpression of JMJ30 would aid in controlling the flowering time of the plants.

[0121] The practice of the present invention employs, unless otherwise indicated, conventional techniques of chemistry, molecular biology, microbiology, recombinant DNA, genetics, immunology, cell biology, cell culture and transgenic biology, which are within the skill of the art. See, e.g., Maniatis et al, 1982, Molecular Cloning (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York); Sambrook et al, 1989, Molecular Cloning, 2nd Ed. (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York); Sambrook and Russell, 2001 , Molecular Cloning, 3rd Ed. (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York); Ausubel et al, 1992), Current Protocols in Molecular Biology (John Wiley & Sons, including periodic updates); Glover, 1985, DNA Cloning (IRL Press, Oxford); Russell, 1984, Molecular biology of plants: a laboratory course manual (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.); Anand, Techniques for the Analysis of Complex Genomes, (Academic Press, New York, 1992); Guthrie and Fink, Guide to Yeast Genetics and Molecular Biology (Academic Press, New York, 1991); Harlow and Lane, 1988, Antibodies, (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York); Nucleic Acid Hybridization (B. D. Hames & S. J. Higgins eds. 1984); Transcription And Translation (B. D. Hames & S. J. Higgins eds. 1984); Culture Of Animal Cells (R. I. Freshney, Alan R. Liss, Inc., 1987); Immobilized Cells And Enzymes (IRL Press, 1986); B. Perbal, A Practical Guide To Molecular Cloning (1984); the treatise, Methods In Enzymology (Academic Press, Inc., N.Y.); Methods In Enzymology, Vols. 154 and 155 (Wu et al. eds.), Immunochemical Methods In Cell And Molecular Biology (Mayer and Walker, eds., Academic Press, London, 1987); Handbook Of Experimental Immunology, Volumes I-IV (D. M. Weir and C. C. Blackwell, eds., 1986); Riott, Essential Immunology, 6th Edition, Blackwell Scientific Publications, Oxford, 1988; Fire et al., RNA Interference Technology: From Basic Science to Drug Development, Cambridge University Press, Cambridge, 2005; Schepers, RNA Interference in Practice, Wiley-VCH, 2005; Engelke, RNA Interference (RNAi): The Nuts & Bolts ofsiRNA Technology, DNA Press, 2003; Gott, RNA Interference, Editing, and Modification: Methods and Protocols (Methods in Molecular Biology), Human Press, Totowa, NJ, 2004; Sohail, Gene Silencing by RNA Interference: Technology and Application, CRC, 2004.

EXAMPLES

[0122] The present invention is described by reference to the following Examples, which are offered by way of illustration and are not intended to limit the invention in any manner. Standard techniques well known in the art or the techniques specifically described below were utilized.

EXAMPLE 1

Materials and Methods

[0123] Plant materials and growth conditions: All Arabidopsis thaliana plants used were in the background of the ecotype Columbia (Col). The jmj32-I (SALK_003313) allele was isolated from the SALK collections from ABRC. The alleles of jmj30-l (SAILJl 1_H12) and jmj30-2 (G -454C10) were described previously (Lu et al., 201 1 ; Jones et al., 2010). Genotyping primer sequences (Gan et al., 2014) are shown in Table 1. Plants were grown in LDs (16-h light/8-h dark) at 22° C. Plants were vernalized in SDs (8-h light/16-h dark) at 4° C. Devemalization treatment was performed in LDs at 30° C. Total primary rosette leaves before bolting were counted to measure flowering time.

TABLE 1

Primer Sequences

Primer Name Primer Sequence (SEQ ID NO:) Description

jmj30-l_GT F tgttgtctcctctgaagctc (5) Genotyping primers for jmj30-l jmj30-l_GT_R gttcatttatctgcccattcg (6) (SAIL_811_ H12)

jmj30-2_GT_F caaactctgctgcaatcgatttc (7) Genotyping primers for jmj30-2 jmj30-2_GT_R gaaaatgtcacaagctcttgcttc (8) (GK-454C10)

jmj32-l_GT_F gactgagaaaacctgaactcagc (9) Genotyping primers for jmj32-l jmj32-l_GT_ R gtcgtgtaaaggactgaaggttg (10) (SALK_003313)

flc-3_GT F tagaaagaaataaagcgagaaa (11) Genotyping primers for flc-3 flc-3_GT_R tatcgccggaggagaagc (12)

JMJ30-sqRT_F acttggactacctcaatgctgttg (13) Semi qPCR primer for JMJ30 JMJ30-sqRT_R tcatggtgtaacggagtaactgtc (14)

JMJ32-sqRT_F gttaggcatgtaccttggtctagtg (15) Semi qPCR primer for JMJ32 JMJ32-sqRT_R tccaagaaagaactggattgagtg (16)

Tip41-sqRT_F cattataggtttggcgaagatgag (17) Semi qPCR primer for Tip41- Tip41-sqRT_R tgaaaccaccacaataagtcagtg (18) like (AT4G34270)

JMJ30-RT-P1_F gattctgttttgttggtctcctc (19) RT-qPCR primers for JMJ30 JMJ30-RT-P1_R gattagccaaaacatgtctcacc (20) PI

JMJ30-RT-P2_F gaatcacttggactacctcaatgc (21) RT-qPCR primers for JMJ30 JMJ30-RT-P2 R cattggagacgatttattggtcc (22) P2

JMJ30-RT-P3_F caagacgaactttacccttactctg (23) RT-qPCR primers for JMJ30 JMJ30-RT-P3_R ggatgtacaacatttcaccttcttc (24) P3

JMJ32-RT-P1 F ctccaaagctattactcattggc (25) RT-qPCR primers for JMJ32 JMJ32-RT-P1_R gaaacaaagatcactatctccgg (26) PI

JMJ32-RT-P2 F gtttcattgtactgtcaaggctcc (27) RT-qPCR primers for JMJ32 JMJ32-RT-P2_R catacttgatgtcaaactgcatgtc (28) P2

JMJ32-RT-P3_F cttcactcaatccagttctttcttg (29) RT-qPCR primers for JMJ32 JMJ32-RT-P3_R gaacatattgaaccaaacacagcc (30) P3

FLC-RT F ccgaactcatgttgaagcttgttgag (31) RT-qPCR primers for FLC FLC-RTJR cggagatttgtccagcaggtg (32)

FT-RTJF cttggcaggcaaacagtgtatgcac (33) RT-qPCR primers for FT FT-RT R gccactctccctctgacaattgtaga (34)

S0C1-RT_F agctgcagaaaacgagaagctctctg (35) RT-qPCR primers for SOC1 S0C1 -RT_ R gggctactctcttcatcacctcttcc (36)

SVP-RT F caaggacttgacattgaagagcttca (37) RT-qPCR primers for SVP SVP-RT_R ctgatctcactcataatcttgtcac (38)

CO-RT_F tcagggactcactacaacgacaatgg (39) RT-qPCR primers for CO CO-RT_R ttgggtgtgaagctgttgtgacacat (40)

AGL24-RT F gaggctttggagacagagtcggtga (41) RT-qPCR primers for AGL24 AGL24-RT R agatggaagcccaagcttcagggaa (42)

Tip41-RT_F gtgaaaactgttggagagaagcaa (43) RT-qPCR primers for ΊΊΡ-41- Tip41-RT_R tcaactggataccctttcgca (44) like (AT4G34270)

XhoI-JMJ30_F ggctcgagactttccccaactcatcatcac (45) Primers used for amplifying Bspl20I-JMJ30_R ccgggccccgagctagaagattctgcttca (46) JMJSO

XhoI-JMJ32_F ggctcgaggtcaatggctaaagagatagagaatttatgg (47) Primers used for amplifying Bspl20I-JMJ32_R ccgggcccgggagcaatctctgcatcactg (48) JMJ32

[0124] Plant transformation: Transgenic plants were generated by floral dipping with Agrobacterium tumefaciens (strain C58C1 ) (Clough and Bent, 1998).

[0125] RNA extraction and expression analysis: For the tissue expression analysis of JMJSO and JMJ32, total RNA was isolated from young seedlings, rosette leaves, cauline leaves, stems and inflorescences. For the tissue expression analysis of FLC, total RNA was isolated from aerial parts of seedlings of FRI and FRI jmj30 jmj32 (collected at the end of the light photoperiod). For the time course flowering time gene expression analysis, samples were harvested from aerial parts of 5 DAG to 13 DAG seedlings for WT, jmj30, jmj32 and jmj30 jmj32, and 1 to 3-week old seedlings for FRI and FRI jmj^'30 jmj32 (collected at the end of the light photoperiod). Gene-specific primers were previously described (Gan et al, 2014) and are shown in Table 1. Total RNA was extracted using the RNeasy plant mini kit (Qiagen) according to the manufacturer's instructions. 2 μg total RNA was used for reverse transcription using the Superscript III RT-PCR system (Invitrogen). Real-time qPCR was performed on an ABI PRISM 7900HT sequence detection system (Applied Biosystems) using the KAPA SYBR FAST ABI Prism qPCR Master Mix (KAPA Biosystems). Tip41-like (AT4G34270) was used as an internal reference gene (Czechowski et al., 2005). The relative expression of a gene of interest is calculated as 2^"AACT [AACj = ACT (experimental sample) - ACT (control sample); ACj = Cj (gene of interest) - C (Tip41-like)].

EXAMPLE 2

Mutation of jmj30 and jmj32 Promotes Flowering

[0126] Among the five groups of Arabidopsis JMJ proteins, four of them (KDM5/JARID1 , KDM4/JHDM3/JM JD2 , KDM3/JHDM2, and JMJD6) have been implicated as histone demethylases specific for other histone modifications, such as H3K.4 and H3K9 (see references cited in Gan et al., 2014). Little is known about the enzymatic function of the JmjC domain-only group that contains no other known functional protein domains but the catalytic JmjC domain, except their role in circadian regulation (Lu et al., 201 1 ; Jones et al., 2010). To view the data described in Examples 2-7, see Gan et al. (2014).

[0127] To elucidate the function of this group, two previously-described loss-of-function mutants for JMJ30 jmj30-l (SAILJl 1_H12) and jmj30-2 (GK-454C10) (Lu et al., 201 1 ; Jones et al., 2010) were use. One T-DNA insertional mutant for JMJ32: jmj32-l (SALK_003313) was isolated. No full-length JMJ30 mRNA was detected for either allele, and jmj30-2 was used for subsequent experiments, as it produced no partial fragments. No full-length JMJ32 mRNA was detected in jmj^'32-1, but partial fragments were still detectable. However, because the T-DNA is inserted at the catalytic JmjC domain in jmj32-l, it likely produces a null mutant. Under the standard growth conditions (22° C LD), neither the single nor the double jmj30-2 jmj32-l (hereinafter jmj30 jmj32) mutants differed from WT in terms of flowering time. However, it was found that the jmj30 jmj32 double mutant flowered earlier than the WT when grown under elevated temperatures with the decreased leaf number ratio (29° C / 22° C) of 0.52 compared to 0.69 in WT, but no obvious difference in phyllochron length was observed. The response of jmj30 jmj32 to elevated temperature was studied in short days (SD, 8-h light/16-h dark). The enhanced early-flowering phenotype compared to WT grown under the same conditions was observed with the leaf number ratio (29° C / 22° C) of 0.19 for jmj30 jmj32 and 0.24 for WT.

EXAMPLE 3

Expression Analysis

[0128] The expression profiles of the flowering time genes were then studied. 5, 9, and 13 DAG seedling samples grown at 29° C LD conditions were collected at the end of the light photoperiod. The jmj30 jmj32 double mutant decreased FLC expression at all tested time points. Furthermore, the trend of decreased FLC expression at 13 DAG is similar in jmj30 jmj32 seedlings grown at 29° C and WT grown at 22° C. The other thermosensory mediator SVP was not significantly affected. In contrast, the expression of the florigen FT and another floral promoter SOCl were increased especially in 13 DAG seedlings of jmj30 jmj32 relative to WT at 29° C LD. These results align with reports that the FLC-SVP complex represses FT in leaves and SOCl in both leaves and shoot apical meristems (Searle et al., 2006). AGAMOUS-LIKE 24 (AGL24) and CONSTANS (CO) were not significantly affected in jmj30 jmj32. In short, the results suggest that jmj30 jmj32 mutations decrease FLC expression at elevated temperatures, and this effect appears to up-regulate the floral integrators FT and SOC1, which are two common targets of FLC.

[0129] To determine the spatial expression of JMJ30 and JMJ32, RNA from different tissues of WT plants was extracted and subjected to RT-PCR. It was found that JMJ30 and JMJ32 were expressed in all tested tissue types, namely, seedlings, roots, rosette leaves, cauline leaves, stems and inflorescences. JMJ30 was highly expressed in leaves, whereas JMJ32 expression showed no appreciable difference across the various tissue types. Furthermore, JMJ30 and JMJ32 expression in the vasculature of leaves overlapped with the expression patterns of their putative targets FLC (Bastow et al., 2004), FT (Yoo et al., 2005) and SOC1 (Hepworthh et al., 2002; Liu et al., 2008), and FLC is known to directly repress FT and SOC1 in the leaf veins (Searle et al., 206).

[0130] In a sub-cellular expression analysis, it was observed that JMJ30-HA (JMJ30 with with a short hemagglutinin (HA) epitope tag) localized primarily to the nucleus consistent with its role as a histone demethylase, and its expression pattern resembled H3K27me3. It was also observed that JMJ30-HA localized to the euchromatin but not the DAPI-dense heterochromatic chromocenters, resembling reported localization of H3K27me3 (Mathieu et al., 2005; Lindroth et al., 2004), and this localization was not affected by the ambient temperature.

EXAMPLE 4

Demethylation Analysis

[0131] Proteins that have the catalytic JmjC domain are known to be histone demethylases (Klose et al., 2006), and, as reported above, JMJ30 localization resembled the euchromatic histone marks. In view of these points, the activity of JMJ30 and JMJ32 was analyzed. The ability of JMJ30 and JMJ32 to demethylate methylated histones was first determined in an in vitro demethylase assay. Calf thymus histones were incubated with JMJ30-HA proteins, together with reported JmjC cofactors Fe(II) ions and a-ketoglutarate (a-KG). Indeed, western blotting analyses indicated that JMJ30-HA was able to demethylate oligonucleosomes at H3K27me3 and H3K27me2 but not at H3K27mel . A mutated version of JMJ30-HA in which one of the conserved Fe(II)-binding histidine residues in the JmjC domain was mutated to alanine was tested. It was found that the effect of mutated version of JMJ30-HA on H3K27me2/3 was completely abolished by the mutation. No noticeable demethylation activity for H3K4me2/3, H3K9me2/3 and H3K36me2/3 was seen in the in vitro demethylase assay. [0132] To confirm whether JMJ30 and JMJ32 can exert this demethylase activity in plants, JMJ30-HA and JMJ32-HA and their mutated versions were transiently over-expressed in Arabidopsis leaf protoplasts. Immunostaining assays were then conducted on the isolated nuclei using anti-H3K27me3 and anti-HA antibodies to observe their demethylase activity in vivo. It was found that over-expression of JMJ30-HA reduced H3K27me3 levels, however, over- expression of the mutated JMJ30-HA version had no effect on H3K27me3 methylation. Similarly, the H3K27me3 levels were reduced in nuclei over-expressing JMJ32-HA but not in the mutated JMJ32-HA version expressing nuclei. Taken together, these results indicate that JMJ30 and JMJ32 function as H3K27me3 demethylases.

EXAMPLE 5

JMJ30 Over-Expression Delays Flowering by Up-Regulating FLC

[0133] To further elucidate the function of JMJ30, JMJ30-HA was over-expressed in WT plants, and it was confirmed that JMJ30-HA transgenic lines exhibit constitutive over-expression of JMJ30 and late flowering phenotypes at 22° C LD conditions (Lu et al., 201 1). To understand the effects of JMJ30 over-expression at a molecular level, the expression profiles of the flowering time genes were checked in two independent transgenic lines grown at 22° C under inductive LD conditions. Supporting the phenotypic observations, the floral repressor FLC is strongly increased in the JMJ30-HA over-expression lines. It was also found that FT and SOC1 are mildly down-regulated. As FLC is the common repressor of the two floral integrators (Searle et al., 2006) and was most significantly affected, the increase in FLC expression is likely to be the main reason for the late-flowering phenotype. To test whether FLC is genetically necessary for JMJ30 functions, a genetic analysis was performed by crossing JMJ30-HA with flc-3. Introduction of the flc mutation largely abolished the late-flowering phenotype of JMJ30-HA, and JMJ30-HA flc-3 flowered at a similar time as flc-3 or WT plants. Taken together, these results support the notion that JMJ30 and FLC function in the same genetic pathway that regulates flowering time and that FLC functions downstream of the histone demethylase JMJ30.

EXAMPLE 6

JMJ30 and JMJ32 Regulate H3K27me3 at the FLC Locus

[0134] ChIP assays were carried out to verify whether the increased FLC expression in JMJ30 over-expression lines is similarly reflected in the H3K27 methylation status of the FLC locus. The H3K27me3 levels between WT and JMJ30-HA plants were compared, and it was found that the repressive H3K27me3 levels were decreased at the FLC locus in the JMJ30-HA lines, which is consistent with the increased FLC expression levels. H3K27me3 enrichment at the FLC locus was then measured in jmj30 jmj32 and WT grown under 29° C LD conditions, in which the jmj30 jmj32 double mutant showed decreased FLC expression and accelerated flowering. Consistent with its expression, it was found that the H3K27me3 levels at the FLC locus are increased in jmj30 jmj32 at 29° C. Taken together, these results indicate that JMJ30 and JMJ32 demethylate H3K27me3 at the FLC locus to activate FLC expression at elevated temperatures.

EXAMPLE 7

Prolonged JMJ30 Activity Directly Regulates FLC Expression

[0135] ChIP assays were conducted using an over-expression JMJ30-HA transgenic line and the endogenous promoter-driven pJMJ30::JMJ30-HA jmj30-2 line grown at 29° C under LD conditions. The epitope-tagged JMJ30-HA protein was immunoprecipitated using anti-HA agarose to assess the level of JMJ30-HA binding across the FLC chromatin region. Compared with WT plants, it was found that JMJ30-HA associates with FLC chromatin directly in both lines, with the P2 region near the transcriptional start site showing the highest levels of binding enrichment.

[0136] To further elucidate the mechanism underlying the positive regulation of FLC expression at elevated temperatures by JMJ30, JMJ30 mRNA and protein expression and stability at 22° C and 29° C were studied. JMJ30 mRNA diurnal expression has been previously reported (Lu et al., 201 1 ; Jones, 2010). Taking samples from WT seedlings grown at 22° C and 29° C under LD condition every 4 hours, it was found that JMJ30 expression peaked approximately 4 hours before dark for both conditions, and the peak levels in the JMJ30 diurnal expression were not significantly affected by the temperature. However, it was found that the width of the peak broadened under the 29° C conditions, which could be due to prolonged expression or increased mRNA stability.

[0137] To test if the protein expression of JMJ30 is similarly affected, a western blot was performed with total proteins extracted from jmj30-2 pJMJ30: :JMJ30-HA using an anti-HA- HRP antibody. Under standard growth conditions (22° C LD), the peak of the JMJ30-HA protein accumulation at the beginning of dark was slightly delayed compared to its mRNA expression, and JMJ30-HA was degraded quickly after that. At 29° C, not only was the JMJ30- HA protein accumulation lengthened, it was also more stable as it persisted much longer than expected based on mRNA expression. To confirm this result, a protein stability assay was performed by pre-treating the seedlings with cycloheximide to prevent de novo protein synthesis, and adding the proteasome inhibitor MG132 at the end of the light photoperiod. Samples were collected at different time points, and it was found that the rapid degradation of JMJ30-HA degradation at 22° C was inhibited by the addition of the proteasome inhibitor MG132, suggesting that the proteasome-dependent JMJ30-HA degradation is impaired at higher temperatures. These results suggested that the strongly-prolonged JMJ30 expression at elevated temperatures may allow JMJ30 to bind and demethylate H3 27me3 at the FLC locus, thus maintaining a transcriptionally permissive chromatin status.

EXAMPLE 8

Loss-of-Function of jmj30 jmj32 Is Sensitized for Vernalization

[0138] The rapid-cycling Columbia (Col) ecotype of Arabidopsis has a non-functional fri and low expression level of FLC, hence it shows an early-flowering phenotype and completes its life cycle in 2-3 months. Previous studies had showed that introgression of a functional allele of FRI from the San Feliu-2 (Sf-2) ecotype into Col wild-type (WT) causes a drastic up-regulation of FLC and a late-flowering phenotype (Lee et al, 1993; Michaels and Amasino, 1999). The Col WT with FRI-Sfl (herein FRI) has to undergo weeks of vernalization to induce PRC2-mediated FLC repression and cause early flowering.

[0139] As described above, JMJ30/32 were identified as H3K27me3 histone demethylases. Studies were performed to determine whether PRC2 and JMJ30/32 may act antagonistically in regulating FLC expression, where PRC2 deposits the repressive mark on the FLC locus while JMJ30/32 actively removes it. If this genetic interaction happens in a competitive manner, the flowering repressor FLC would be more easily repressed in the loss-of-function mutant of the histone demethylases (jmj30 jmj32). In other words, the jmj30 jmj32 plants would be sensitized for vernalization. To understand the genetic interaction of FRI and JMJ30/32, the jmj30 jmj32 double mutant was crossed into the FRI background. The FRI and FRI jmj30 jmj32 plants were exposed to different period of vernalization treatment: non-vernalized (NV), vernalized 2-weeks (V2W), vernalized 4- weeks (V4W), and vernalized 6-weeks (V6W) (Figure la). Flowering time was initially comparable between untreated FRI and FRI jmj30 jmj32 (leaf number ratio of FRI jmj30jmj32/FRINV: 0.91). However, V2W- and V4W-treated FRIjmj30 jmj32 flowered earlier than their FRI counterpart, suggesting FRI jmj30 jmj32 reached the vernalized state faster (leaf number ratio of FRI jmj30 jmj32IFRI V2W: 0.78; V4W: 0.81). With V6W-treatment, both FRI and FRI jmj30 jmj32 were fully vernalized, hence they showed similar early flowering phenotype (leaf number ratio of FRI jmjSO jmj32/FRI V6W: 0.95). This showed that compared to FRI, FRI jmj30 jmj32 is sensitized for vernalization.

[0140] Since FLC is the key gene being regulated in the vernalization pathway, the difference in flowering time between FRI and FRI jmj30 jmj32 was studied to determine if it is due to the difference in FLC expression. RNA was extracted from seedling samples with different periods of exposure to cold. The expression of FLC in the two genotypes was analyzed (Figure lb). Indeed, the difference in FLC expression was similarly reflected as in their phenotypic difference. FLC expression was similarly high in NV-treated samples. In V2W samples, FLC expression level was relatively unchanged in FRI, but FRI jmj30 jmj32 already showed a 20% decrease in FLC expression. The expression difference gets smaller at V4W and V6W treatment. It is worth noticing that V4W-treated FRI jmj30 jmj32 already reduced FLC level to a comparable level with V6W-treated FRI, molecularly showing that FRI jmj30 jmj32 required a shorter period of cold treatment to reach a vernalized state.

[0141] We next wondered if the difference in phenotype and FLC expression was due to difference in H3K27me3 levels as we previously identified JMJ30/32 as H3K27me3 histone demethylases (Gan et al., 2015). We collected NV, V2W- and V6W-treated samples and performed a ChIP using anti-H3K27me3 antibody. It was found that the initial level of H3K27me3 was similar in both non-vernalized samples. At V2W, we observed that FRI jmj30 jmj32 accumulates H3K27me3 at a higher level compared to FRI, whereas both showed a similar vernalized state when vernalized for 6 weeks. These results suggest that that in the absence of the H3K27me3 demethylases JMJ30/32, FLC is more easily repressed, hinting that JMJ30/32 may counter the effect of PRC2 during vernalization to fine tune the level of suppression.

EXAMPLE 9

Function of JMJ30 and JMJ32 During Devemalization

[0142] It was recently shown that a vernalized Arabidopsis seedling can be devernalized by exposing the plant to a week of 30° C high ambient temperature treatment, and FLC was suggested to be the key contributor to this devemalization effect (Perilleux et al, 2013). Moreover, the H3K27me3 level at the FLC locus was reduced after devemalization (Bouche et al., 2015. In view of the fact that JMJ30/32 can antagonize the effect of PRC2 on FLC in the FRI background, coupled with the above findings that JMJ30 is up-regulated and stabilized at elevated temperatures, studies are performed to determine whether the derepression of FLC during devemalization is conferred by the action of JMJ30/32 H3K27me3 demefhylases.

[0143] To study the function of JMJ30/32 during the devemalization process, FRI and FRI jmj30 jmj32 seeds (Figure 2a) and seedlings (Figure 2b) are subjected to different periods of SD 4° C vernalization treatment to determine the shortest possible period to obtain the vernalization effect. After vernalization, the flowering time is compared between untreated plants (vernalization + 22° C standard) and treated plants (vernalization + 30° C devemalization + 22° C standard). The effect of devemalization is shown in Figure 3. Exposing the plant to different periods of vernalization establishes the length of treatment when the plant loses its responsiveness to devemalization and allows further optimization the most economical period of treatment. The FRI and FRI jmjSO jmj32 seeds (Figure 2a) and seedlings (Figure 2b) are also subjected to different devemalization temperatures, e.g., 35° C, 37° C, 40° C, etc., to establish the optimum devemalization temperature. The optimum devemalization temperature is selected so to induce the devemalization effect faster without detrimental effect on the plant for prolonged exposure at that temperature.

[0144] To further study this effect, we sowed seeds of FRI and FRI jmj30 jmj32 on soil and vernalized them in the dark for 5 weeks (V5W). After vernalization, we compared the flowering time between untreated plants (V5W vernalization + 22°C standard) and treated plants (V5W vernalization + 30°C devemalization + 22°C standard) (Figure 2a). We observed that after a V5W-treatment, both genotypes were floral induced with the FRI jmj30 jmj32 flowering slightly earlier than FRI (leaf number ratio of FRI jmj30 jmj32IFRI V5W+22°C). However, only the FRI plants were responsive to the 30°C devemalization treatment and flowered late (leaf number ratio of FRI jmj30 jmj32IFRI V5W+30°C+22°C). The 1 week 30°C treatment on FRI jmj30 jmj32 not only did not induce a late-flowering phenotype, but caused a flowering time even earlier than V5W+22°C-treated FRI jmj30 jmj32, which might be caused by the PIF4-mediated Jupregulation at higher temperatures (Kumar et al., 2012).

[0145] We next compared the expression of FLC in the FRI and FRI jmj30 jmj32 seedlings and indeed the difference in flowering time was similarly reflected in the FLC expression. FLC was repressed after 5 weeks of vernalization in both genotypes. However, the vernalization- repressed FLC was reactivated in the V5W+30°C+22°C-treated FRI but not FRI jmj30 jmj32 plants suggesting the importance of JMJ30/32 in devemalization (Figure 2d). We subsequently performed an H3K27me3 ChIP to examine the level of the repressive mark on the FLC locus after the devemalization treatment. We observed that H3K27me3 marks were increased after vernalization (V5W+22°C) corresponding to the reduced FLC expression in both samples. After 1 week of 30°C treatment, the H3K27me3 mark was reduced in FRI similar to previous report (Bouche et al, 2015), however the repressive marks maintained at a high level in FRI jmj30 jmj32, showing that JMJ30/32 was required to remove these marks from the locus. These results suggested that the devernalization process was perturbed in the absence of the H3K27me3 demethylases JMJ30 and JMJ32.

EXAMPLE 10

Identification of JMJ Binding Partners

[0146] The tagged lines of pJMJ30::JMJ30-HA jmj30-2 (Gan et al, 2014) are used to identify the binding partners of JMJ30 through immunoprecipitation and mass spectrometry. The identification of the binding partners of JMJ30 enhances knowledge of the larger histone demethylase protein complex, and allows the design of multiple strategies to modify the epigenetic status of the target genes. As shown above, JMJ30 mRNA is diurnally expressed and the JMJ30 protein is degraded through the proteasomal pathway under standard LD 22° C growth conditions (see also Gan et al., 2014). This proteasome-mediated degradation of JMJ30 is retarded when Arabidopsis plants are grown at elevated temperatures. The mechanism for this difference in JMJ protein stability is determined by comparing the binding affinity of the partners at different temperatures. Molecular strategies are then be derived to prevent or enhance the JMJ30 protein accumulation to achieve flowering time control.

EXAMPLE 11

Control of Floral Transition

[0147] The above data and other's data has shown that over-expression of JMJ30 is sufficient to induce a mild late-flowering phenotype in Col by upregulating FLC expression (Gan et al, 2014; Lu et al, 2011). To control the floral transition, the over-expression of JMJ30 is induced by utilizing an inducible promoter or inducible system. An inducible JMJ30 over-expression construct is prepared using the β-estradiol inducible XVE system (Zuo et al, 2000). The full length JMJ30 coding sequence is amplified using primer set XhoI-JMJ30_F and Bspl20I- JMJ30_R (Table 1). XVE:JMJ30 is constructed by cloning the JMJ30 coding sequence into vector pER8. Similarly, the full length JMJ32 coding sequence is amplified using primer set XhoI-JMJ32_F and Bspl20I-JMJ32_R (Table 1). XVE MJ32 is constructed by cloning the JMJ32 coding sequence into vector pER8. β-estradiol (Sigma) is used to induce JMJ30 expression in transgenic Arabidopsis thaliana seedlings carrying XVE:JMJ30. Similarly, β- estradiol is used to induce JMJ32 expression in transgenic Arabidopsis thaliana seedlings carrying XVE:JMJ32. It is seen that flowering is delayed in seedlings in which expression of JMJ30 or JMJ32 is induced which can be associated with the upregulation of FLC in the induced XVE:JMJ30 or XVE:JMJ32 seedlings.

[0148] First the inducibility of the construct is tested by transforming the construct into Col WT sowing the seeds on MS containing β-estradiol. The seedling samples are harvested at 8 day-after-germination (DAG) and 13 DAG, and JMJ30 is greatly induced in the seedlings harboring the pER8-JMJ30 construct compared to WT seedlings. The direct target of JMJ30, FLC is also upregulated in the 8 DAG seedlings and to a lesser extent at 13 DAG. To examine if this increased FLC is morphologically important, the plants are observed to floral transition. The β-estradiol-treated pER8-JMJ30 (Col) plants show a late-flowering phenotype compared to the WT and mock-treated pER8-JMJ30 (Col) plants (Figure 4). This shows that the induced overexpression of JMJ30 is able to upregulate FLC expression and repress flowering, consistent with previous findings (Gan et al., 2014).

[0149] We then transformed the pER8-JMJ30 construct into the FRI background to study its effect on flowering. To mimic the effect of devernalization, we vernalized the pER8-JMJ30 (FRI) plants for 3 weeks, then instead of subjecting the plants to 1 week of 30°C devernalization conditions, are treated with β-estradiol to induce the overexpression of JMJ30. We detected increased JMJ30 expression with β-estradiol-treatment and in correlation an upregulation of FLC expression which leads to delayed flowering when allowed to grow to maturation, compared to the FRI plants and mock-treated pER8-JMJ30 (FRI) plants. By regulating the expression of FLC in this manner, it is possible not only to induce the reversal of vernalization, but also to delay the flowering of plants when environmental conditions are unfavorable for fruit-bearing.

[0150] We next wondered if this reactivation of FLC expression is similarly reflected in its chromatin status. We harvested the seedlings 1 week after the β-estradiol-treatment and performed a ChIP using anti-H3K27me3 antibody. The H3K27me3 levels at the transcription start site of FLC were reduced in β-estradiol-treated pER8-JMJ30 (FRI) seedlings. This suggested that an induced overexpression of JMJ30 after a long period of cold exposure was able to reverse the effect of vernalization in a similar manner like devernalization treatment by removing the repressive H3K27me3 marks from the FLC locus, strengthening the notion that JMJ30 is the main player in the devernalization process. EXAMPLE 12

Transformation of Maize Using Particle Bombardment

[0151] Maize plants can be transformed to contain a recombinant DNA construct of a validated Arabidopsis lead gene or the corresponding homologs from various species in order to examine the resulting phenotype.

[0152] A recombinant DNA construct can be cloned into a maize transformation vector. Expression of the gene in the maize transformation vector can be under control of an inducible promoter or regulatory element, such as the XVE system (Zuo et al., 2000).

[0153] The recombinant DNA construct can then be introduced into corn cells by particle bombardment. Techniques for corn transformation by particle bombardment have been described in WO 2009/006276.

[0154] Tl plants can be subjected to an inducer and effect on flowering can be examined. Recombination DNA constructs that result in devernalization or delayed flowering will be considered evidence that the Arabidopsis gene or corresponding homologs functions in maize to devernalize the maize plant or delay flowering of the maize plant.

EXAMPLE 13

Transformation of Maize Using Agrobacterium

[0155] Maize plants can be transformed to contain a recombinant DNA construct of a validated Arabidopsis lead gene or the corresponding homologs from various species in order to examine the resulting phenotype.

[0156] A recombinant DNA construct can be cloned into a maize transformation vector.

Expression of the gene in the maize transformation vector can be under control of an inducible promoter or regulatory element, such as the XVE system (Zuo et al., 2000).

[0157] Agrobacterium-mediaXed transformation of maize is performed essentially as described by Zhao et al. (2006) (see also Zhao et al., 2001 , and U.S. Patent No. 5,981 ,840). The transformation process involves bacterium innoculation, co-cultivation, resting, selection and plant regeneration.

[0158] Transgenic TO plants can be regenerated and their phenotype determined. Tl seed can be collected. [0159] Furthermore, a recombinant DNA construct of a validated Arabidopsis gene or homolog thereof can be introduced into an elite maize inbred line either by direct transformation or introgression from a separately transformed line.

EXAMPLE 14

Transformation of Soybean

[0160] Soybean plants can be transformed to contain a recombinant DNA construct of a validated Arabidopsis lead gene or the corresponding homologs from various species in order to examine the resulting phenotype.

[0161] A recombinant DNA construct can be cloned into a soybean transformation vector. Expression of the gene in the soybean transformation vector can be under control of an inducible promoter or regulatory element, such as the XVE system (Zuo et al., 2000).

[0162] Soybean embryos may then be transformed with the expression vector. Techniques for soybean transformation and regeneration have been described in WO 2009/006276.

[0163] Tl plants can be subjected to an inducer and effect on flowering can be examined. Recombination DNA constructs that result in devernalization or delayed flowering will be considered evidence that the Arabidopsis gene or corresponding homologs functions in soybean to devernalize the soybean plant or delay flowering of the soybean plant.

EXAMPLE 15

Transformation of Root Chicory

[0164] Root chicory plants can be transformed to recombinant DNA construct of a validated Arabidopsis lead gene or the corresponding homologs from various species in order to examine the resulting phenotype.

[0165] A recombinant DNA construct can be cloned into a root chicory transformation vector. Expression of the gene in the root chicory transformation vector can be under control of an inducible promoter or regulatory element, such as the XVE system (Zuo et al., 2000).

[0166] Root chicory explants can then be transformed using Agrobacterium tumefaciens- mediated transformation. Techniques for root chicory transformation and regeneration have been described in Maroufil et al. (2012).

[0167] Tl plants can be subjected to an inducer and effect on flowering can be examined. Recombination DNA constructs that result in devernalization or delayed flowering will be considered evidence that the Arabidopsis gene or corresponding homologs functions in root chicory to devernalize the root chicory plant or delay flowering of the root chicory plant.

EXAMPLE 16

Transformation of Sugar Beet

[0168] Sugar beet plants can be transformed to recombinant DNA construct of a validated Arabidopsis lead gene or the corresponding homologs from various species in order to examine the resulting phenotype.

[0169] A recombinant DNA construct can be cloned into a sugar beet transformation vector. Expression of the gene in the sugar beet transformation vector can be under control of an inducible promoter or regulatory element, such as the XVE system (Zuo et al., 2000).

[0170] Sugar beet explants can then be transformed using Agrobacterium rhizogenes- mediated transformation. Techniques for sugar beet transformation and regeneration have been described in Pavil and Skarcis (2010).

[0171] Tl plants can be subjected to an inducer and effect on flowering can be examined. Recombination DNA constructs that result in devemalization or delayed flowering will be considered evidence that the Arabidopsis gene or corresponding homologs functions in sugar beet to devernalize the sugar beet plant or delay flowering of the sugar beet plant.

EXAMPLE 17

Devemalization of Root Chicory

[0172] Transgenic root chicory plants containing a recombinant DNA construct of a validated Arabidopsis lead gene (e.g., JMJ30) or the corresponding homologs from various species operable linked to the XVE system (Zuo et al., 2000) are prepared as described in Example 15. The transgenic root chicory plants are planted and treated with the inducer β- estradiol using conventional techniques. The inducer-treated transgenic root chicory plants are found to overexpress JMJ30 compared to control plants. The overexpression of JMJ30 is found to demethylate a histone associated with the root chicory FLC-like gene leading to the repression of flowering genes and the devemalization of the transgenic root chicory plants. This effect is seen as long as the inducer is applied to the transgenic root chicory plants. This effect is reversed when the inducer is no longer applied to the transgenic root chicory plants. [0173] The use of the terms "a" and "an" and "the" and similar referents in the context of describing the invention (especially in the context of the following claims) are to be construed to cover both the singular and the plural, unless otherwise indicated herein or clearly contradicted by context. The terms "comprising," "having," "including," and "containing" are to be construed as open-ended terms (i.e., meaning "including, but not limited to,") unless otherwise noted. Recitation of ranges of values herein are merely intended to serve as a shorthand method of referring individually to each separate value falling within the range, unless otherwise indicated herein, and each separate value is incorporated into the specification as if it were individually recited herein. All methods described herein can be performed in any suitable order unless otherwise indicated herein or otherwise clearly contradicted by context. The use of any and all examples, or exemplary language (e.g., "such as") provided herein, is intended merely to better illuminate the invention and does not pose a limitation on the scope of the invention unless otherwise claimed. No language in the specification should be construed as indicating any non- claimed element as essential to the practice of the invention.

[0174] Embodiments of this invention are described herein, including the best mode known to the inventors for carrying out the invention. Variations of those embodiments may become apparent to those of ordinary skill in the art upon reading the foregoing description. The inventors expect skilled artisans to employ such variations as appropriate, and the inventors intend for the invention to be practiced otherwise than as specifically described herein. Accordingly, this invention includes all modifications and equivalents of the subject matter recited in the claims appended hereto as permitted by applicable law. Moreover, any combination of the above-described elements in all possible variations thereof is encompassed by the invention unless otherwise indicated herein or otherwise clearly contradicted by context.

BIBLIOGRAPHY

[0175] Aikawa, S. et al. (2010). Robust control of the seasonal expression of the Arabidopsis FLC gene in a fluctuating environment. Proc Natl Acad Sci USA 107, 11632-11637.

[0176] Alexandre, CM. and Hennig, L. (2008). FLC or not FLC: the other side of vernalization. J Exp Bot 59, 1127-1135.

[0177] Angel, A. et al. (2011). A Polycomb-based switch underlying quantitative epigenetic memory. Nature 476, 105-108.

[0178] Bastow, R. et al. (2004). Vernalization requires epigenetic silencing of FLC by histone methylation. Nature All, 164-167.

[0179] Becker, A. and Theissen, G. (2003). The major clades of MADS-box genes and their role in the development and evolution of flowering plants. Mol Phylogenet Evol 29, 464-489. [0180] Bernier, G. et al. (1981 ). The Physiology of Flowering, vol. 1. Boca Raton, FL: CRC Press.

[0181] Bohner et al. (1999). Plant J 19, 87-95.

[0182] Bouche F, Detry N, Perilleux C (2015) Heat can erase epigenetic marks of vernalization in Arabidopsis. Plant signaling & behavior 10: e990799.

[0183] Buchman and Berg (1988). Mol Cell Biol 8, 4395-440.

[0184] Bruce et al. (2000). Plant Cell 12, 65-79.

[0185] Caddick et al. (1988). Nature Biotechnol 16, 177-180.

[0186] Callis et al. (1987). Genes Dev 1, 1183-1200.

[0187] Cao et al. (2006). Plant Cell Reports 6, 554-560.

[0188] Chouard, P. (1960). Vernalization and its relations to dormancy. Ann Rev Plant Physiol 11, 191-238.

[0189] Christensen et al. (1989). Plant Mol Biol. 12:619-632.

[0190] Christensen et al. (1992). Plant Mol Biol. 18:675-689.

[0191] Clough, S.J. and Bent, A.F. (1998). Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant J 16, 735-743.

[0192] Czechowski, T. et al. (2005). Genome-wide identification and testing of superior reference genes for transcript normalization in Arabidopsis. Plant Physiol 139, 5-17.

[0193] DAloia, M. et al. (2008). Vernalization-induced repression of FLOWERING LOCUS C stimulates flowering in Sinapis alba and enhances plant responsiveness to photoperiod. New Phytol 178, 755-765.

[0194] Demeulemeester, M.A.C. and De Proft, M.P. (1999). In vivo and in vitro flowering response of chicory (Cichorium intybus L.): influence of plant age and vernalization. Plant Cell Rep 18, 781-785.

[0195] Dennis, E.S. and Peacock, W.J. (2009). Vernalization in cereals. J Biol 8, 57 (epub).

[0196] De Veylder et al. (1997). Plant Cell Physiol 38, 568-577.

[0197] Dielen, V. et al. (2005). Bolting control by low temperature in root chicory (Cichorium intybus var. sativum). Field Crops Res 94, 76-85.

[0198] Gan, E.S. et al. (2014). Jumonji demethylases moderate precocious flowering at elevated temperature via regulation of FLC in Arabidopsis. Nature communications 5, 5098

[0199] Gazzani, S. et al. (2003). Analysis of the molecular basis of flowering time variation in Arabidopsis accessions. Plant Physiol 132, 1107-1114.

[0200] Gendall, A.R. et al. (2001 ). The VERNALIZATION 2 gene mediates the epigenetic regulation of vernalization in Arabidopsis. Cell 107, 525-535.

[0201] Gianquinto, G. (1997). Morphological and physiological aspects of phase transition in radicchio (Cichorium intybus L. var. silvestre Bisch.): influence of daylength and its interaction with low temperature. Sci Hortic 71, 13-26.

[0202] Gregory, F.G. and Purvis O.N. (1937). Devernalization of Spring Rye by Anaerobic Conditions and Revernalisation by Low Temperature. Nature 140, 547. [0203] Guo, Y.L. et al. (2012). Independent FLC mutations as causes of flowering time variation in Arabidopsis thaliana and Capsella rubella. Genetics 192, 729-739.

[0204] He, Y. and Amasino, R.M. (2005). Role of chromatin modification in flowering-time control. Trends in plant science 10, 30-35

[0205] Helliwell, C.A. et al. (2006). The Arabidopsis FLC protein interacts directly in vivo with SOC1 and FT chromatin and is part of a high-molecular-weight protein complex. Plant J 46, 183-192.

[0206] Hepworth, S.R. et al. (2002). Antagonistic regulation of flowering-time gene SOC1 by CONSTANS and FLC via separate promoter motifs. EMBO J 21, 4327-4337.

[0207] Ietswaart, R. et al. (2012). Flowering time control: another window to the connection between antisense RNA and chromatin. Trends Genet 28, 445-453.

[0208] Jiang, D. et al. (2008). Repression of FLOWERING LOCUS C and FLOWERING LOCUS T by the Arabidopsis Polycomb repressive complex 2 components. PloS one 3, e3404.

[0209] Johanson, U. et al. (2000). Molecular analysis of FRIGIDA, a major determinant of natural variation in Arabidopsis flowering time. Science 290, 344-347.

[0210] Jones, M.A. et al. (2010). Jumonji domain protein JMJD5 functions in both the plant and human circadian systems. Proc Natl Acad Sci USA 107, 21623-21628.

[0211] lose, R.J. et al. (2006). JmjC-domain-containing proteins and histone demethylation. Nat Rev Genet 7, 715-727 (2006).

[0212] Kumar SV, Lucyshyn D, Jaeger KE, Alos E, Alvey E, Harberd NP, Wigge PA (2012) Transcription factor PIF4 controls the themiosensory activation of flowering. Nature 484: 242- 245.

[0213] Last et al. (1991). Theor. Appl. Genet. 81 :581 -588.

[0214] Lee, I. and Amasino, R.M. (1995). Effect of vernalization, photoperiod, and light quality on the flowering phenotype of Arabidopsis plants containing the FRIGIDA gene. Plant Physiol 108, 157-162.

[0215] Lee, I. et al. (1993). Analysis of naturally occurring late flowering in Arabidopsis thaliana. Mol Gen Genetics 237:171 -176.

[0216] Lindroth, A.M. et al. (2004). Dual histone H3 methylation marks at lysines 9 and 27 required for interaction with CHROMOMETH YLASE3. EMBO J 23, 4286-4296.

[0217] Liu, C. et al. (2008). Direct interaction of AGL24 and SOC1 integrates flowering signals in Arabidopsis. Development 135, 1481 -1491.

[0218] Liu, J. et al. (2004). siRNAs targeting an intronic transposon in the regulation of natural flowering behavior in Arabidopsis. Genes Dev 18, 2873-2878.

[0219] Lu, S.X. et al. (2011). The Jumonji C domain-containing protein JMJ30 regulates period length in the Arabidopsis circadian clock. Plant Physiol 155, 906-915.

[0220] Maroufil, A. et al. (2012). Regeneration ability and genetic transformation of root chicory (Chicorium intybus var sativim). African J Biotechnol 11, 11874-11886.

[0221] Mathieu, O. et atl. (2005). Distinct regulation of histone H3 methylation at lysines 27 and 9 by CpG methylation in Arabidopsis. EMBO J 24, 2783-2791.

[0222] McElroy et al. (1990). Plant Cell 2:163-171. [0223] McNellis et al. (1998). Plant J 14, 247-257.

[0224] Mett et al. (1993). Proc Natl Acad Sci USA 90, 4567-4571.

[0225] Michaels, S.D. and Amasino, R.M. (1999). FLOWERING LOCUS C encodes a novel MADS domain protein that acts as a repressor of flowering. Plant Cell 11, 949-956.

[0226] Michaels, S.D. and Amasino, R.M. (2001). Loss of FLOWERING LOCUS C activity eliminates the late- flowering phenotype of FRIGIDA and autonomous pathway mutations but not responsiveness to vernalization. Plant Cell 13, 935-941.

[0227] Michaels, S.D. et al. (2003). Attenuation of FLOWERING LOCUS C activity as a mechanism for the evolution of summer-annual flowering behavior in Arabidopsis. Proc Natl Acad Sci USA 100, 10102-10107.

[0228] Odell et al. (1985). Nature 313:810-812.

[0229] Ono et al. (2004). Biosci Biotechnol Biochem 68, 803-807.

[0230] Padidam et al. (2003). Transgenic Res 12, 101-109.

[0231] Paulet, P. (1985). Cichorium intybus and C. endivia. In Handbook of Flowering (Halevy, A.H., ed.). Boca Raton, FL: CRC Press, pp. 265-271.

[0232] Pavil, O.I. and Skarcis, G.N. (2010). Fast and efficient genetic transformation of sugar beet by Agrobacterium rhizogenes. Nature Protocol Exchange, Nature Publishing Group, http://dx.doi.Org/l 0.1038/nprot.2010.98

[0233] Perilleux, C. et al. (2013). A root chicory MADS box sequence and the Arabidopsis flowering repressor FLC share common features that suggest conserved function in vernalization and de-vernalization responses. The Plant journal : for cell and molecular biology 75, 390-402.

[0234] Pimpini, F. and Gianquinto, G. (1988). The influence of climatic conditions and age of plant at transplanting on bolting and yield of chicory (Cichorium intybus L.) cv. Rosso di Chioggia grown for early production. Acta Hortic 229, 379-386.

[0235] Pin, P.A. et al. (2012). The role of a pseudo-response regulator gene in life cycle adaptation and domestication of beet. Curr Biol 22, 1095-1101.

[0236] Purvis, O.N. and Gregory, F.G. (1945). Devemalization by High Temperature. Nature 155, 113-114.

[0237] Reeves, P.A. et al. (2007). Evolutionary conservation of the FLOWERING LOCUS C-mediated vernalization response: evidence from the sugar beet (Beta vulgaris). Genetics 176, 295-307.

[0238] Schena et al. (1991 ). Proc Natl Acad Sci USA 88, 10421 - 10425.

[0239] Schranz, M.E. et al. (2002). Characterization and effects of the replicated flowering time gene FLC in Brassica rapa. Genetics 162, 1457-1468.

[0240] Searle, I. et al. (2006). The transcription factor FLC confers a flowering response to vernalization by repressing meristem competence and systemic signaling in Arabidopsis. Genes Dev 20, 898-912.

[0241] Sheldon, C.C. et al. (1999) .The FLF MADS box gene: a repressor of flowering in Arabidopsis regulated by vernalization and methylation. Plant Cell 11, 445^458.

[0242] Sheldon, C.C. et al. (2000). The molecular basis of vernalization: the central role of FLOWERING LOCUS C (FLC). Proc Natl Acad Sci USA 97, 3753-3758. [0243] Turck, F. et al. (2008). Regulation and identity of florigen: FLOWERING LOCUS T moves center stage. Ann Rev Plant Biol 59, 573-594.

[0244] Velten et al. (1984). EMBO J. 3:2723-2730.

[0245] Wang, R. et al. (2009). PEP1 regulates perennial flowering in Arabis alpina. Nature 459, 423-427.

[0246] Ward, et al. (1993). Plant Mol Biol 22, 361-366.

[0247] Yang H, Howard M, Dean C (2014) Antagonistic roles for H3K36me3 and H3K27me3 in the cold-induced epigenetic switch at Arabidopsis FLC. Current biology : CB 24: 1793-1797.

[0248] Yoo, S.K. et al. (2005). CONSTANS activates SUPPRESSOR OF OVEREXPRESSION OF CONSTANS 1 through FLOWERING LOCUS T to promote flowering in Arabidopsis. Plant Physiol 139, 770-778.

[0249] Zhao et al. (2001 ). Mol Breed 8, 323-333.

[0250] Zhao et al. (2006). Meth Mol Biol 318, 315-323.

[0251] Zuo, J. et al. (2000). Technical advance: An estrogen receptor-based transactivator XVE mediates highly inducible gene expression in transgenic plants. The Plant Journal 24, 265- 273.

Claims

WHAT IS CLAIMED IS:

1. A plant comprising in its genome a recombinant DNA construct comprising at least one heterologous regulatory element operably linked to a polynucleotide, wherein said polynucleotide is selected from the group consisting of:

(a) a polynucleotide comprising a nucleotide sequence encoding a polypeptide, wherein the polypeptide has an amino acid sequence of at least 90% sequence identity, based on the Clustal V or Clustal W method of alignment, when compared to SEQ ID NO:2;

(b) a polynucleotide comprising a nucleotide sequence encoding a polypeptide wherein the amino acid sequence of the polypeptide comprises SEQ ID NO:2;

(c) a polynucleotide comprising a nucleic acid sequence of at least 90% sequence identity, based on the Clustal V or Clustal W method of alignment, when compared to SEQ ID NO: 1 ;

(d) a polynucleotide comprising a nucleic acid sequence comprising SEQ ID NO: 1 ;

(e) a polynucleotide comprising a nucleotide sequence encoding a polypeptide, wherein the polypeptide has an amino acid sequence of at least 90% sequence identity, based on the Clustal V or Clustal W method of alignment, when compared to SEQ ID NO:4;

(f) a polynucleotide comprising a nucleotide sequence encoding a polypeptide wherein the amino acid sequence of the polypeptide comprises SEQ ID NO:4;

(g) a polynucleotide comprising a nucleic acid sequence of at least 90% sequence identity, based on the Clustal V or Clustal W method of alignment, when compared to SEQ ID NO:3; and

(h) a polynucleotide comprising a nucleic acid sequence comprising SEQ ID NO:3; wherein the heterologous regulatory element is a heterologous constitutive regulatory element or a heterologous inducible regulatory element and

wherein the plant exhibits devernalization or delayed timing of flowering upon constitutive or inducible expression of the polynucleotide when compared to a control plant not comprising said recombinant DNA construct.

2. The plant of claim 1 , wherein the heterologous regulatory element is a heterologous inducible regulatory element.

3. The plant of claim 1 or 2, wherein the plant is a monocot or dicot.

4. A seed, fruit or tuber of the plant of any one of claims 1 to 3, wherein said seed, fruit or tuber comprises in its genome said recombinant DNA construct and wherein a plant produced from said seed, fruit or tuber exhibits devemalization or delayed timing of flowering upon induced expression of the polynucleotide.

5. A method of devemalization or controlling timing of flowering in a plant, comprising:

(i) introducing into a regenerable plant cell a recombinant DNA construct comprising at least one heterologous regulatory element operably linked to a polynucleotide, wherein said polynucleotide is selected from the group consisting of:

(a) a polynucleotide comprising a nucleotide sequence encoding a polypeptide, wherein the polypeptide has an amino acid sequence of at least 90% sequence identity, based on the Clustal V or Clustal W method of alignment, when compared to SEQ ID NO:2;

(b) a polynucleotide comprising a nucleotide sequence encoding a polypeptide wherein the amino acid sequence of the polypeptide comprises SEQ ID NO:2;

(c) a polynucleotide comprising a nucleic acid sequence of at least 90% sequence identity, based on the Clustal V or Clustal W method of alignment, when compared to SEQ ID NO: 1 ;

(d) a polynucleotide comprising a nucleic acid sequence comprising SEQ ID NO: 1 ;

(e) a polynucleotide comprising a nucleotide sequence encoding a polypeptide, wherein the polypeptide has an amino acid sequence of at least 90% sequence identity, based on the Clustal V or Clustal W method of alignment, when compared to SEQ ID NO:4;

(f) a polynucleotide comprising a nucleotide sequence encoding a polypeptide wherein the amino acid sequence of the polypeptide comprises SEQ ID NO:4;

(g) a polynucleotide comprising a nucleic acid sequence of at least 90% sequence identity, based on the Clustal V or Clustal W method of alignment, when compared to SEQ ID NO:3; and

(h) a polynucleotide comprising a nucleic acid sequence comprising SEQ ID NO:3; and (ii) regenerating a transgenic plant from the regenerable plant cell after step

(a),

wherein the heterologous regulatory element is a heterologous constitutive regulatory element or a heterologous inducible regulatory element and

wherein the transgenic plant comprises in its genome the recombinant DNA construct and exhibits devemalization or delayed timing of flowering upon constitutive or inducible expression of the polynucleotide when compared to a control plant not comprising said recombinant DNA construct.

6. The method of claim 4, wherein the heterologous regulatory element is a heterologous inducible regulatory element.

7. The method of claim 5 or 6, further comprising:

(iii) obtaining a progeny plant derived from the transgenic plant, wherein said progeny plant comprises in its genome the recombinant DNA construct and exhibits devemalization or delayed flowering when compared to a control plant not comprising the recombinant DNA construct.

8. A method of selecting for (or identifying) devemalization or controlled flowering timing in a plant, comprising:

(i) obtaining a transgenic plant, wherein the transgenic plant comprises in its genome a recombinant DNA construct comprising at least one heterologous regulatory element operably linked to a polynucleotide, wherein said polynucleotide is selected from the group consisting of:

(a) a polynucleotide comprising a nucleotide sequence encoding a polypeptide, wherein the polypeptide has an amino acid sequence of at least 90% sequence identity, based on the Clustal V or Clustal W method of alignment, when compared to SEQ ID NO:2;

(b) a polynucleotide comprising a nucleotide sequence encoding a polypeptide wherein the amino acid sequence of the polypeptide comprises SEQ ID NO:2;

(c) a polynucleotide comprising a nucleic acid sequence of at least 90% sequence identity, based on the Clustal V or Clustal W method of alignment, when compared to SEQ ID NO: 1 ; (d) a polynucleotide comprising a nucleic acid sequence comprising SEQ ID NO: 1 ;

(e) a polynucleotide comprising a nucleotide sequence encoding a polypeptide, wherein the polypeptide has an amino acid sequence of at least 90% sequence identity, based on the Clustal V or Clustal W method of alignment, when compared to SEQ ID NO:4;

(f) a polynucleotide comprising a nucleotide sequence encoding a polypeptide wherein the amino acid sequence of the polypeptide comprises SEQ ID NO:4;

(g) a polynucleotide comprising a nucleic acid sequence of at least 90% sequence identity, based on the Clustal V or Clustal W method of alignment, when compared to SEQ ID NO:3; and

(h) a polynucleotide comprising a nucleic acid sequence comprising SEQ ID NO:3; and

(ii) obtaining a progeny plant derived from the transgenic plant, wherein the progeny plant comprises in its genome the recombinant DNA construct; and

(iii) selecting (or identifying) the progeny plant with devernalization or controlled flowering timing compared to a control plant not comprising the recombinant DNA construct

wherein the heterologous regulatory element is a heterologous constitutive regulatory element or a heterologous inducible regulatory element and.

9. The method of claim 8, wherein the heterologous regulatory element is a heterologous inducible regulatory element.

10. The method of any one of claims 5 to 9, wherein the plant is a monocot or a dicot.

1 1. A recombinant DNA construct comprising at least one heterologous regulatory element operably linked to a polynucleotide, wherein said polynucleotide is selected from the group consisting of:

(a) a polynucleotide comprising a nucleotide sequence encoding a polypeptide, wherein the polypeptide has an amino acid sequence of at least 90% sequence identity, based on the Clustal V or Clustal W method of alignment, when compared to SEQ ID NO:2; (b) a polynucleotide comprising a nucleotide sequence encoding a polypeptide wherein the amino acid sequence of the polypeptide comprises SEQ ID NO:2;

(c) a polynucleotide comprising a nucleic acid sequence of at least 90% sequence identity, based on the Clustal V or Clustal W method of alignment, when compared to SEQ ID NO:l ;

(d) a polynucleotide comprising a nucleic acid sequence comprising SEQ ID NO:l ;

(e) a polynucleotide comprising a nucleotide sequence encoding a polypeptide, wherein the polypeptide has an amino acid sequence of at least 90% sequence identity, based on the Clustal V or Clustal W method of alignment, when compared to SEQ ID NO:4;

(f) a polynucleotide comprising a nucleotide sequence encoding a polypeptide wherein the amino acid sequence of the polypeptide comprises SEQ ID NO:4;

(g) a polynucleotide comprising a nucleic acid sequence of at least 90% sequence identity, based on the Clustal V or Clustal W method of alignment, when compared to SEQ ID NO:3; and

(h) a polynucleotide comprising a nucleic acid sequence comprising SEQ ID NO:3; wherein the heterologous regulatory element is a heterologous constitutive regulatory element or a heterologous inducible regulatory element and.

wherein said recombinant DNA construct when introduced into a plant conveys devemalization or delayed timing of flowering to the plant upon constitutive or inducible expression of the polynucleotide when compared to a control plant not comprising said recombinant DNA construct.

12. The recombinant DNA construct of claim 1 1 , wherein the heterologous regulatory element is a heterologous inducible regulatory element.

13. A vector comprising the recombinant DNA construct of claim 1 1 or 12.

14. A cell comprising the recombinant DNA construct of claim 11 or 12, wherein the cell is selected from the group consisting of a bacterial cell and a plant cell.

15. A seed, fruit or tuber comprising the recombinant DNA construct of claim 1 1 or 12.