WO2016120396A1 - Procédé de détection de virus à arn de plasmodium combiné - Google Patents

Procédé de détection de virus à arn de plasmodium combiné Download PDF

Info

Publication number
WO2016120396A1
WO2016120396A1 PCT/EP2016/051824 EP2016051824W WO2016120396A1 WO 2016120396 A1 WO2016120396 A1 WO 2016120396A1 EP 2016051824 W EP2016051824 W EP 2016051824W WO 2016120396 A1 WO2016120396 A1 WO 2016120396A1
Authority
WO
WIPO (PCT)
Prior art keywords
plasmodium
virus
specific primers
rna
list
Prior art date
Application number
PCT/EP2016/051824
Other languages
English (en)
Inventor
Lieselotte CNOPS
Kevin ARIËN
Original Assignee
Instituut Voor Tropische Geneeskunde
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Instituut Voor Tropische Geneeskunde filed Critical Instituut Voor Tropische Geneeskunde
Publication of WO2016120396A1 publication Critical patent/WO2016120396A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/6893—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for protozoa
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
    • C12Q1/701—Specific hybridization probes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/16—Primer sets for multiplex assays
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Definitions

  • the present invention in general relates to a combined Plasmodium-RNA virus detection method. More in particular, the present invention relates to a combined detection method for Plasmodium in combination with Ebolaviruses and/or Arboviruses, such as for example Dengue Viruses, Chikungunya Viruses, or West Nile viruses. Furthermore, the present invention relates to kits comprising primers and/or probes for performing the combined Plasmodium-RNA virus detection method according to this invention.
  • malaria caused by parasitic protozoans of the Plasmodium type causes symptoms that typically include fever, fatigue, vomiting and headaches, at least in the early stages of the disease. Similar symptoms are, however, found in patients infected with RNA viruses such as haemorrhagic fever viruses (e.g. Ebola virus) and Arboviruses (e.g. Dengue virus, Chikungunya virus, West Nile virus, ...), therefore these disorders can easily be mistaken from one another.
  • haemorrhagic fever viruses e.g. Ebola virus
  • Arboviruses e.g. Dengue virus, Chikungunya virus, West Nile virus, .
  • each type of causing pathogen requires its own adapted containment measures and treatment regime and it is thus essential to distinguish Plasmodium infections from RNA virus infections in order to combat these pathogens.
  • Plasmodium parasites and RNA viruses differ substantially, rendering it difficult to analyse both type of species using one and the same detection method.
  • Plasmodium parasites have a DNA genome, and can be detected using DNA-specific detection methods
  • RNA viruses have an RNA genome, which can only be detected using RNA-specific detection methods. Therefore, combining the various assays (e.g. DNA vs RNA analysis) for parallel screening of tropical diseases is not a feasible approach given the high diversity of the protocols with many limitations associated with each pathogen.
  • references aimed at improving species coverage make use of separate detection reactions for each type of species (Tan et al., 2014, Venter et al., 2014, Waggoner et al., 2014, commercial FastTrack assay) and/or make use of microarray assays or Lab-On-Chip approaches (Palacios et al., 2007, Venter et al., 2014).
  • Palacios et al., 2007 provides a microarray assay for the simultaneous detection of viruses, bacteria, parasites, and fungi.
  • Venter et al., 2014 uses a microarray chip assay with hybridization.
  • Tan et al., 2014 provides a Lab-On-Chip approach for allowing the rapid identification of up to 26 tropical pathogens (including parasites, bacteria and viruses). Such microarrays and chips still require specialized detection equipment and expertise for data interpretation and have not found their place yet as diagnostic tool in clinical practice. On the other hand, improvement of species coverage has also been reported using separate detection reactions for each type of species (i.e. viruses, parasites, bacteria, ). For example in Tan et al., 2014 pathogen detection was split in 2 chip versions to be subjected to 2 different multiplex reactions; i.e. a DNA chip and an RNA chip. Waggoner et al., 2014 uses 2 different extraction and detection methods, i.e.
  • RNA virus Dengue virus
  • DNA extraction/detection method for Plasmodium detection DNA species
  • simultaneous detection of RNA and DNA species is achieved using whole nucleic acid extracts.
  • the detection limit for Plasmodium species is rather high in the FastTrack kit (i.e. +/- 100 copies/ml based on plasmid DNA) and the sensitivity even further decreased (2-log difference) in the multiplex detection using clinical samples (compared to the single-plex detection.
  • the inventors have now developed a combined Plasmodium-RNA virus PCR based detection method including a single RNA extraction step, a reverse transcription step, and a multiplex PCR assay.
  • the inventors have surprisingly found that the combined Plasmodium-RNA virus detection method according to this invention, has a significantly improved detection (4-10 Ct lower, which correlates to an improvement of 1 - to 3-logs) for Plasmodium species compared to a single- plex Plasmodium detection assay, and is thus much more sensitive in terms of Plasmodium detection, as further detailed in the examples.
  • This finding was very surprising, since Plasmodium species have a DNA genome, and it was thus not expected that by applying an RNA extraction method, an improved detection could be established.
  • a DNA extract or a whole nucleic acid extract, rather than an RNA extract could improve the detection of the Plasmodium species (having a DNA genome).
  • the combined detection method of the present invention also allows the simultaneous detection of Plasmodium and filoviruses (e.g. Ebolavirus), which has up till now not been achieved.
  • the present invention provides a combined Plasmodium-RNA virus detection method comprising the steps of:
  • step (b) performing an RNA extraction method on said sample of step (a);
  • step (c) performing a reverse transcription step on said extract of step (b);
  • step (d) performing a multiplex PCR-based assay on the sample obtained in step (c), using one or more Plasmodium specific primers and one or more RNA virus specific primers;
  • step (e) analysing the presence of said Plasmodium species and/or RNA virus in said sample, based on the outcome of said multiplex PCR-based assay of step (d).
  • said multiplex PCR-based assay of step (d) is a real-time PCR assay further comprising one or more Plasmodium specific probes and one or more RNA virus specific probes.
  • said Plasmodium species is selected from the list comprising: Plasmodium falciparum, Plasmodium vivax, Plasmodium ovale, Plasmodium malahae, and Plasmodium knowlesi.
  • said at least one RNA virus is selected from the list comprising: Filoviruses (e.g. Ebolaviruses) and one or more Arboviruses; and wherein said one or more RNA virus specific primers are selected from the list comprising one or more Filovirus-specific primers (e.g. Ebolavirus specific primers) and one or more Arbovirus specific primers.
  • said one or more Arboviruses are selected from the list comprising: Flaviviruses (e.g. Dengue viruses, or West Nile viruses) or Alphaviruses (e.g. Chikungunya viruses); and wherein said one or more Arbovirus specific primers are selected from the list comprising one or more Flavivirus specific primers (e.g. Dengue virus specific primers, or West Nile virus specific primers) and one or more Alphavirus specific primers (e.g. Chikungunya virus specific primers).
  • Flaviviruses e.g. Dengue viruses, or West Nile viruses
  • Alphaviruses e.g. Chikungunya virus specific primers
  • the present invention thus in particular provides a combined Plasmodium-RN/ ⁇ virus detection method comprising the steps of:
  • RNA virus selected from the list comprising Dengue virus, Chikungunya virus and West Nile virus;
  • step (b) performing an RNA extraction method on said sample of step (a);
  • step (c) performing a reverse transcription step on said extract of step (b);
  • step (d) performing a multiplex PCR-based assay on the sample obtained in step (c) using
  • step (e) analysing the presence of said Plasmodium species and/or RNA viruses in said blood sample, based on the outcome of said multiplex PCR-based assay of step (d).
  • the present invention provides a combined Plasmodium-RN/ ⁇ virus detection method comprising the steps of:
  • RNA virus selected from the list comprising Ebolavirus, Dengue virus,
  • step (b) performing an RNA extraction method on said sample of step (a);
  • step (c) performing a reverse transcription step on said extract of step (b);
  • step (d) performing a multiplex PCR-based assay on the sample obtained in step (c) using
  • the present invention provides a kit for performing a combined Plasmodium- RNA virus detection method according to claim 1 ; said kit comprising:
  • RNA virus specific primers selected from the list comprising one or more Ebolavirus specific primers and one or more Arbovirus specific primers.
  • kit according to the present invention may further comprise:
  • RNA virus specific probes selected from the list comprising Ebolavirus specific probes and/or one or more Arbovirus specific probes.
  • said one or more Arbovirus specific primers are selected from the list comprising:
  • said one or more Arbovirus specific probes are selected from the list comprising:
  • said one or more Plasmodium specific primers are preferably selected from the list comprising SEQ ID N°1 -4. Furthermore, said one or more RNA virus specific primers are preferably selected from the list comprising SEQ ID N° 7-8, SEQ ID N° 1 1 -12, SEQ ID N° 14-17, SEQ ID N° 19-20 and SEQ ID N° 22-23. Furthermore, said one or more Plasmodium specific probes are preferably selected from the list comprising SEQ ID N° 5-6. Finally, said one or more RNA virus specific probes are preferably selected from the list comprising SEQ ID N° 9-10, SEQ ID N° 13, SEQ ID N° 18, SEQ ID N° 21 and SEQ ID N° 24. DETAILED DESCRIPTION OF THE INVENTION
  • the inventors have developed a combined Plasmodium- RNA virus PCR-based detection method including an RNA extraction step, a reverse transcription step, and a multiplex PCR-based assay.
  • Said combined Plasmodium-RNA virus detection method was found to have a significantly lower detection limit for Plasmodium species compared to a single-plex Plasmodium detection assay, and is thus much more sensitive in terms of Plasmodium detection.
  • the present invention provides a combined Plasmodium-RNA virus detection method comprising the steps of:
  • step (b) performing an RNA extraction method on said sample of step (a);
  • step (c) performing a reverse transcription step on said extract of step (b);
  • step (d) performing a multiplex PCR-based assay on the sample obtained in step (c), using one or more Plasmodium specific primers and one or more RNA virus specific primers;
  • step (e) analysing the presence of said Plasmodium species and/or RNA virus in said sample, based on the outcome of said multiplex PCR-based assay of step (d).
  • an RNA extraction method is to be considered as a method aimed at specifically enriching the RNA fraction of a sample (total RNA extraction), and hence, does not encompass methods aimed at enriching the DNA fraction specifically or whole nucleic acid extraction methods. It is generally known that any RNA extraction method will co-purify DNA to some extend (usually around 1 -10%). Such DNA 'contamination' is usually removed by DNAse treatment, however, since the method of the present invention, includes the detection of DNA species i.e. Plasmodium, the RNA extraction method of the present invention does not include a further DNAse treatment.
  • a suitable method for RNA extraction in the context of the present invention is for example the use of RNA-selective binding silica membranes to bind RNA using fast-spin columns or vacuum assisted procedures, followed by water/buffer-assisted elution from the membranes, such as for example in the QIAamp Viral RNA kit. More specifically, the sample is first lysed under highly denaturing conditions to inactivate RNases and to ensure isolation of intact (viral) RNA. Buffering conditions are then adjusted to provide optimum binding of the RNA to the silica membrane, and the sample is loaded onto the silica membrane-containing spin column. The RNA binds to the membrane, and contaminants are efficiently washed away.
  • RNA is eluted in a special RNase-free buffer or in RNase-free water.
  • the purified RNA is free of protein, nucleases, and other contaminants and inhibitors, but includes low amounts of co- purified DNA.
  • Other suitable RNA extraction technologies are organic extraction methods with a phenol-containing solution or magnetic particle methods using particles or beads. RNA extraction methods can be performed manually or can be partially or completely automated and even be integrated into the RT-PCR system.
  • the method of the present invention is preferably performed on an RNA extract, to improve sensitivity of the Plasmodium species detection, the method could alternatively be performed on a whole nucleic acid extract as it encompasses a RNA extraction and DNA extraction.
  • the method according to the invention is a 'combined' detection method, i.e. capable of simultaneously detecting Plasmodium and RNA virus templates in a sample. This means that the method has the potential of detecting more than one target template in a sample at the same time. If the sample contains only one target template (e.g. only Plasmodium), then the method of course detects that one template only, the primers and probes specific for other templates are then not used.
  • the phrase "simultaneously detecting" as used herein indicates that a plurality, i.e. more than 1 , different targets may be detected in one and the same analysis. For that purpose, the method according to the invention provides a different primer pair for each nucleic acid template to be amplified.
  • the term "primer” refers to an oligonucleotide, whether occurring naturally as in a purified restriction digest or produced synthetically, which is capable of acting as a point of initiation of nucleic acid sequence synthesis when placed under conditions in which synthesis of a primer extension product which is complementary to a nucleic acid strand is induced, i.e. in the presence of different nucleotide triphosphates and a polymerase in an appropriate buffer ("buffer” includes pH, ionic strength, cofactors etc.) and at a suitable temperature.
  • buffer includes pH, ionic strength, cofactors etc.
  • nucleotides of the primer can be modified for instance by addition of a methyl group, a biotin or digoxigenin moiety, a fluorescent tag or by using radioactive nucleotides.
  • sample' is meant to include a variety of sample types obtained from an organism.
  • the term encompasses bodily fluids such as blood, blood components, saliva, serum, plasma, urine and other liquid samples of biological origin, solid tissue biopsy, tissue cultures, or supernatant taken from cultured patient cells.
  • the biological sample is typically a bodily fluid such as blood, serum, plasma, CSF, urine, ....
  • the biological sample can be processed prior to assay, e.g., to remove cells or cellular debris.
  • the term encompasses samples that have been manipulated after their procurement, such as by treatment with reagents, solubilization, sedimentation, or enrichment for certain components.
  • identification of the species may be accomplished by amplification of a target nucleic acid sequence and detection of the resulting DNA by visualisation using gel electrophoresis and DNA-binding fluorescent dyes, preferably, the target is detected using real-time analysis methods. Therefore, in a particular embodiment, said multiplex PCR-based assay of step (d) is a real-time PCR assay further comprising one or more Plasmodium specific probes and one or more RNA virus specific probes.
  • the method and kits of the present invention are suitable for detecting any type of Plasmodium infection, in as far as specific primers and/or probes suitable for detecting and/or distinguishing said specific Plasmodium species are used.
  • said Plasmodium species is selected from the list comprising: Plasmodium falciparum, Plasmodium vivax, Plasmodium ovale, Plasmodium malahae, and Plasmodium knowlesi.
  • the method and kits of the present invention are suitable for detecting any type of RNA virus infection, in as far as specific primers and/or probes suitable for detecting and/or distinguishing said specific RNA viruses are used.
  • said RNA virus is selected from the list comprising: Ebolaviruses and one or more Arboviruses; and said one or more RNA virus specific primers are thus preferably selected from the list comprising one or more Ebolavirus specific primers and one or more Arbovirus specific primers.
  • said one or more Arboviruses are selected from the list comprising: Dengue viruses, Chikungunya viruses and West Nile viruses; and said one or more Arbovirus specific primers are thus preferably selected from the list comprising one or more Dengue virus specific primers, one or more Chikungunya virus specific primers and one or more West Nile virus specific primers.
  • a particularly interesting combination assay relates to the simultaneous detection of Plasmodium species, Dengue viruses, Chikungunya viruses and West Nile viruses.
  • the present invention provides a combined Plasmodium-RNA virus detection method comprising the steps of:
  • RNA virus selected from the list comprising Dengue virus, Chikungunya virus and West Nile virus;
  • step (b) performing an RNA extraction method on said sample of step (a);
  • step (c) performing a reverse transcription step on said extract of step (b);
  • step (d) performing a multiplex PCR-based assay on the sample obtained in step (c) using
  • step (d) analysing the presence of said Plasmodium species and/or RNA viruses in said blood sample, based on the outcome of said multiplex PCR-based assay of step (d).
  • Another particularly interesting combination assay relates to the simultaneous detection of Plasmodium species, Ebolavirus, Dengue viruses, Chikungunya viruses and West Nile viruses.
  • the present invention provides a combined Plasmodium-RNA virus detection method comprising the steps of:
  • RNA virus selected from the list comprising Ebolavirus, Dengue virus, Chikungunya virus and West Nile virus;
  • step (b) performing an RNA extraction method on said sample of step (a);
  • step (c) performing a reverse transcription step on said extract of step (b);
  • step (d) performing a multiplex PCR-based assay on the sample obtained in step (c) using
  • step (e) analysing the presence of said Plasmodium species and/or RNA virus in said blood sample, based on the outcome of said multiplex PCR-based assay of step (d).
  • the present invention provides a kit for performing a combined Plasmodium- RNA virus detection method according to claim 1 ; said kit comprising:
  • RNA virus specific primers selected from the list comprising one or more
  • Ebolavirus specific primers and one or more Arbovirus specific primers are Ebolavirus specific primers and one or more Arbovirus specific primers.
  • Said kit may further comprise instructions for use of said kit.
  • kit according to the present invention may further comprise:
  • RNA virus specific probes selected from the list comprising Ebolavirus specific probes and/or one or more Arbovirus specific probes.
  • said one or more Arbovirus specific primers are selected from the list comprising:
  • said one or more Arbovirus specific probes are selected from the list comprising:
  • said one or more Plasmodium specific primers are preferably selected from the list comprising SEQ ID N°1 -4.
  • said one or more RNA virus specific primers are preferably selected from the list comprising SEQ ID N° 7-8, SEQ ID N° 1 1 -12, SEQ ID N° 14-17, SEQ ID N° 19-20 and SEQ ID N° 22-23.
  • said one or more Plasmodium specific probes are preferably selected from the list comprising SEQ ID N° 5-6.
  • said one or more RNA virus specific probes are preferably selected from the list comprising SEQ ID N° 9-10, SEQ ID N° 13, SEQ ID N° 18, SEQ ID N° 21 and SEQ ID N° 24.
  • the Plasmodium-RNA virus combination RT-PCR test aims to detect Plasmodium in combination with haemorrhagic fever viruses (e.g. Ebola virus) and/or arboviruses (dengue virus, Chikungunya virus, West Nile virus,... ) in one real-time reverse- transcriptase polymerase chain reaction (RT-PCR).
  • haemorrhagic fever viruses e.g. Ebola virus
  • arboviruses dengue virus, Chikungunya virus, West Nile virus,...
  • RT-PCR real-time reverse- transcriptase polymerase chain reaction
  • RNA from 140 ⁇ of sample was extracted by QIAamp viral RNA mini kit (Qiagen Benelux, Venlo, The Netherlands) and eluted into 80 ⁇ buffer according to the manufacturer's instructions.
  • DNA was extracted from 200 ⁇ blood with Qiagen DNA mini kit (Qiagen Benelux, Venlo, The Netherlands) according to manufacturer's guidelines. DNA was eluted with 100 ⁇ elution buffer. Total nucleic acid extraction
  • RT-PCRs were performed on the SmartCycler II (Cepheid Benelux) in a 25 ⁇ reaction volume using 5 ⁇ RNA and iTaq universal Probes one step kit (Biorad Laboratories, Temse, Belgium).
  • the RT-PCR program consisted of a RT-reaction of 10 min at 50 °C and a denaturation step of 5 min at 95 °C, followed by 50 cycles of 10 sec at 95 °C and 30 sec at 60 °C. See table 1 , for the sequence of the primers and probes used in this assay.
  • Ebola Virus EBOV
  • WNV West Nile virus
  • RV linWNV GCGTTTTAGCATATTGACAGCC 23
  • Ebola virus DNA (gBlock, IDT) and P. falciparum and P. vivax DNA extracted from whole blood were successfully detected in the Ebola-Plasmodium combination RT-PCR (Table 2). Furthermore, both P. falciparum and P. vivax detection was significantly improved in terms of sensitivity (lower Ct value) in the combined detection assay versus the single-plex detection assay of both species.
  • Table 2 combined detection of EBOV RNA and Plasmodium DNA
  • Plasmodium DNA and RNA extracted from a P. falciparum positive whole blood sample and EBOV RNA spiked in whole blood before RNA extraction were analyzed by the single PCR for Plasmodium and Ebola, respectively.
  • P. falciparum and P. vivax detection in the mo no- infected samples was significantly improved in terms of sensitivity (> 10 Ct lower, ⁇ 3- log difference, underlined in Table 3) in the combined detection assay versus the single-plex detection assay of both species.
  • RNA extracted from serum samples positive for CHIKV or DENV1 and EBOV were detected by the Ebola-arbovirus combination RT-PCR (Table 6, Table 7).
  • Plasmodium positive clinical blood samples can be detected in combination with RNA viruses such as ebolaviruses and arboviruses in a combination RT-PCR test after the use of a single RNA extraction method.
  • RNA viruses such as ebolaviruses and arboviruses
  • This test enables a rapid differential diagnosis between Plasmodium species and RNA viruses in a single combination test and will be useful for the clinical management of tropical fevers.
  • EXAMPLE 2 RT-PCR for the simultaneous detection of Plasmodium and a RNA virus
  • RNA extraction gave the best results (> 4 Ct lower, at least 1 -log difference, underlined in Table 9).
  • Table 8 combined detection of Plasmodium total NA and DNA, EBOV RNA and synthetic DNA, and DENV total NA and RNA
  • Table 9 combined detection of Plasmodium total NA and DNA, EBOV RNA and synthetic DNA, and DENV and CHIKV total NA and RNA.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Zoology (AREA)
  • Analytical Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Virology (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

La présente invention concerne, en général, un procédé de détection de virus à ARN de Plasmodium combiné. Plus particulièrement, la présente invention concerne un procédé de détection combiné pour le Plasmodium en combinaison avec des virus Ebola et/ou des Arbovirus, tels que, par exemple, les virus de la Dengue, les virus du Chikungunya ou les virus du Nil Occidental. En outre, la présente invention concerne des kits comprenant des amorces et/ou des sondes pour la réalisation du procédé de détection de virus à ARN de Plasmodium combiné selon cette invention.
PCT/EP2016/051824 2015-01-29 2016-01-28 Procédé de détection de virus à arn de plasmodium combiné WO2016120396A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
EP15153127 2015-01-29
EP15153127.4 2015-01-29

Publications (1)

Publication Number Publication Date
WO2016120396A1 true WO2016120396A1 (fr) 2016-08-04

Family

ID=52434615

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2016/051824 WO2016120396A1 (fr) 2015-01-29 2016-01-28 Procédé de détection de virus à arn de plasmodium combiné

Country Status (1)

Country Link
WO (1) WO2016120396A1 (fr)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN114507753A (zh) * 2022-02-16 2022-05-17 赵俊 一种虫媒传染性疾病病原体检测试剂盒及应用

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20130323716A1 (en) * 2012-02-03 2013-12-05 California Institute Of Technology Signal encoding and decoding in multiplexed biochemical assays

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20130323716A1 (en) * 2012-02-03 2013-12-05 California Institute Of Technology Signal encoding and decoding in multiplexed biochemical assays

Non-Patent Citations (16)

* Cited by examiner, † Cited by third party
Title
"Validation FTD Tropical fever core", 1 July 2014 (2014-07-01), XP055199475, Retrieved from the Internet <URL:http://www.fast-trackdiagnostics.com/media/98377/FTD-36-VALIDATION-v5-2014_07-EN.pdf> [retrieved on 20150701] *
B. W. JOHNSON ET AL: "Serotype-Specific Detection of Dengue Viruses in a Fourplex Real-Time Reverse Transcriptase PCR Assay", JOURNAL OF CLINICAL MICROBIOLOGY, vol. 43, no. 10, 1 October 2005 (2005-10-01), pages 4977 - 4983, XP055068153, ISSN: 0095-1137, DOI: 10.1128/JCM.43.10.4977-4983.2005 *
CNOPS L; JACOBS J; VAN ESBROECK M: "Validation of a four-primer real-time PCR as a diagnostic tool for single and mixed Plasmodium infections", CLIN MICROBIOL INFECT, vol. 17, no. 7, July 2011 (2011-07-01), pages 1101 - 7, XP055199528, DOI: doi:10.1111/j.1469-0691.2010.03344.x
DROSTEN ET AL.: "Rapid Detection and Quantification of RNA of Ebola and Marburg Viruses, Lassa Virus, Crimean-Congo Hemorrhagic Fever Virus, Rift Valley Fever Virus, Dengue Virus and Yellow Fever Virus by Real-Time Reverse Transcription-PCR", JOURNAL OF CLINICAL MICROBIOLOGY, vol. 40, no. 7, 2002, pages 2323 - 2330, XP002251382, DOI: doi:10.1128/JCM.40.7.2323-2330.2002
GIBB T R ET AL: "Development and evaluation of a 5' fluorogenic nuclease assay to detect and differentiate between Ebola virus subtypes Zaire and Sudan", JOURNAL OF CLINICAL MICROBIOLOGY, AMERICAN SOCIETY FOR MICROBIOLOGY, US, vol. 39, no. 11, 1 November 2001 (2001-11-01), pages 4125 - 4130, XP002460216, ISSN: 0095-1137, DOI: 10.1128/JCM.39.11.4125-4130.2001 *
GIBB TR; NORWOOD DA JR; WOOLLEN N; HENCHAL EA: "Development and evaluation of a fluorogenic 5' nuclease assay to detect and differentiate between Ebola virus subtypes Zaire and Sudan", J CLIN MICROBIOL., vol. 39, no. 11, November 2001 (2001-11-01), pages 4125 - 30, XP002460216, DOI: doi:10.1128/JCM.39.11.4125-4130.2001
J. J. WAGGONER ET AL: "Multiplex Nucleic Acid Amplification Test for Diagnosis of Dengue Fever, Malaria, and Leptospirosis", JOURNAL OF CLINICAL MICROBIOLOGY, vol. 52, no. 6, 26 March 2014 (2014-03-26), pages 2011 - 2018, XP055199526, ISSN: 0095-1137, DOI: 10.1128/JCM.00341-14 *
JOHNSON BW; RUSSELL BJ; LANCIOTTI RS: "Serotype-specific detection of dengue viruses in a fourplex real-time reverse transcriptase PCR assay", J CLIN MICROBIOL., vol. 43, no. 10, October 2005 (2005-10-01), pages 4977 - 83, XP055068153, DOI: doi:10.1128/JCM.43.10.4977-4983.2005
L. CNOPS ET AL: "Validation of a four-primer real-time PCR as a diagnostic tool for single and mixed Plasmodium infections", CLINICAL MICROBIOLOGY AND INFECTION, vol. 17, no. 7, 1 July 2011 (2011-07-01), pages 1101 - 1107, XP055199528, ISSN: 1198-743X, DOI: 10.1111/j.1469-0691.2010.03344.x *
LINKE ET AL: "Detection of West Nile virus lineages 1 and 2 by real-time PCR", JOURNAL OF VIROLOGICAL METHODS, ELSEVIER BV, NL, vol. 146, no. 1-2, 3 November 2007 (2007-11-03), pages 355 - 358, XP022327175, ISSN: 0166-0934, DOI: 10.1016/J.JVIROMET.2007.05.021 *
LINKE S; ELLERBROK H; NIEDRIG M; NITSCHE A; PAULI G: "Detection of West Nile virus lineages 1 and 2 by real-time PCR", J VIROL METHODS, vol. 146, no. 1-2, December 2007 (2007-12-01), pages 355 - 8, XP022327175, DOI: doi:10.1016/j.jviromet.2007.05.021
MARCUS PANNING ET AL: "Chikungunya Fever in Travelers Returning to Europe from the Indian Ocean Region, 2006", EMERGING INFECTIOUS DISEASES, vol. 14, no. 3, 3 March 2008 (2008-03-03), pages 416 - 422, XP055199534, ISSN: 1080-6040, DOI: 10.3201/eid1403.070906 *
MARIETJIE VENTER ET AL: "Macroarray assay for differential diagnosis of meningoencephalitis in southern Africa", JOURNAL OF CLINICAL VIROLOGY, vol. 60, no. 1, 1 May 2014 (2014-05-01), pages 50 - 56, XP055199525, ISSN: 1386-6532, DOI: 10.1016/j.jcv.2014.02.001 *
PALACIOS ET AL.: "MassTag Polymerase Chain Reaction for Differential Diagnosis of Viral Hemorrhagic Fevers", EMERGING INFECTIOUS DISEASES, vol. 12, no. 4, 2006, pages 692 - 695
PANG ET AL.: "Comprehensive Multiplex One-Step Real-Time TaqMan qRT-PCR Assays for Detection and Quantification of Hemorrhagic Fever Viruses", PLOS ONE, vol. 9, no. 4, 2014, pages E95635
PANNING M; GRYWNA K; VAN ESBROECK M; EMMERICH P; DROSTEN C: "Chikungunya fever in travelers returning to Europe from the Indian Ocean region, 2006", EMERG INFECT DIS, vol. 14, no. 3, March 2008 (2008-03-01), pages 416 - 22, XP055199534, DOI: doi:10.3201/eid1403.070906

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN114507753A (zh) * 2022-02-16 2022-05-17 赵俊 一种虫媒传染性疾病病原体检测试剂盒及应用

Similar Documents

Publication Publication Date Title
Osman et al. Development and validation of a multiplex reverse transcription quantitative PCR (RT-qPCR) assay for the rapid detection of Citrus tristeza virus, Citrus psorosis virus, and Citrus leaf blotch virus
WO2017212904A1 (fr) Procédé pour la détection rapide du virus de la peste porcine africaine à l&#39;aide d&#39;un procédé lamp dans lequel de multiples ensembles d&#39;amorces sont combinés
US20060240409A1 (en) Method for extraction and identification of nucleic acids
RU2720713C9 (ru) Набор синтетических олигонуклеотидов для выявления рнк коронавируса
US20220221382A1 (en) Method of pooling blood samples
CN105992827B (zh) 用于测序测定的通用对照
Thanarajoo et al. Detection of Coconut cadang-cadang viroid (CCCVd) in oil palm by reverse transcription loop-mediated isothermal amplification (RT-LAMP)
JP2010527245A (ja) 粗製サンプルから核酸を直接増幅する方法
AU2017257978B2 (en) Blood cell lysis reagent
Nishimura et al. Detection of noroviruses in fecal specimens by direct RT-PCR without RNA purification
WO2015051456A1 (fr) Dosage diagnostique multiplex permettant de détecter des pathogènes de salmonidés
Faggioli et al. Viroid Amplification Methods: RT-PCR, Real-Time RT-PCR, and RT-LAMP
JP5278919B2 (ja) ウイロイドＰＳＴＶｄ及びＴＣＤＶｄの同時検出方法
WO2016120396A1 (fr) Procédé de détection de virus à arn de plasmodium combiné
JP6592697B2 (ja) 血清型２のデングウイルス検出用キット、血清型３のデングウイルス検出用キット及びデングウイルス検出用キット
WO2013175365A1 (fr) Contrôle d&#39;extraction pour l&#39;arn
CN115989323A (zh) 检测SARS-CoV-2感染的方法
US20180044741A1 (en) Methods and reagents for detecting ebola virus
CN113337638A (zh) 一种新型冠状病毒（SARS-CoV-2）的检测方法和试剂盒
KR20130080968A (ko) 박과 작물 바이러스 검출용 프라이머 및 이를 이용한 박과 작물 바이러스 검출 방법
Antonishyn et al. Rapid detection of Norovirus based on an automated extraction protocol and a real-time multiplexed single-step RT-PCR
EP2446061A1 (fr) Procédé pour l&#39;amplification par pcr quantitative d&#39;acides désoxyribonucléiques provenant d&#39;un échantillon comprenant des inhibiteurs de pcr
WO2018033382A1 (fr) Procédé d&#39;isolement d&#39;acides nucléiques pour des lectures de séquençage longues
JP2007000040A (ja) Ｂ型肝炎ウイルスの検出方法
Zhang et al. Detection of viroids

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 16706539

Country of ref document: EP

Kind code of ref document: A1

DPE1 Request for preliminary examination filed after expiration of 19th month from priority date (pct application filed from 20040101)
NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 16706539

Country of ref document: EP

Kind code of ref document: A1