WO2016118930A1 - Antibodies recognizing medin - Google Patents
Antibodies recognizing medin Download PDFInfo
- Publication number
- WO2016118930A1 WO2016118930A1 PCT/US2016/014633 US2016014633W WO2016118930A1 WO 2016118930 A1 WO2016118930 A1 WO 2016118930A1 US 2016014633 W US2016014633 W US 2016014633W WO 2016118930 A1 WO2016118930 A1 WO 2016118930A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- occupied
- antibody
- seq
- variable region
- humanized
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
- C07K16/18—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/395—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum
- A61K39/39533—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum against materials from animals
- A61K39/39558—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum against materials from animals against tumor tissues, cells, antigens
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
- A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
- A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
- A61K47/68—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment
- A61K47/6835—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment the modifying agent being an antibody or an immunoglobulin bearing at least one antigen-binding site
- A61K47/6843—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment the modifying agent being an antibody or an immunoglobulin bearing at least one antigen-binding site the antibody targeting a material from animals or humans
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K49/00—Preparations for testing in vivo
- A61K49/0004—Screening or testing of compounds for diagnosis of disorders, assessment of conditions, e.g. renal clearance, gastric emptying, testing for diabetes, allergy, rheuma, pancreas functions
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K49/00—Preparations for testing in vivo
- A61K49/001—Preparation for luminescence or biological staining
- A61K49/0013—Luminescence
- A61K49/0017—Fluorescence in vivo
- A61K49/005—Fluorescence in vivo characterised by the carrier molecule carrying the fluorescent agent
- A61K49/0058—Antibodies
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K51/00—Preparations containing radioactive substances for use in therapy or testing in vivo
- A61K51/02—Preparations containing radioactive substances for use in therapy or testing in vivo characterised by the carrier, i.e. characterised by the agent or material covalently linked or complexing the radioactive nucleus
- A61K51/04—Organic compounds
- A61K51/08—Peptides, e.g. proteins, carriers being peptides, polyamino acids, proteins
- A61K51/10—Antibodies or immunoglobulins; Fragments thereof, the carrier being an antibody, an immunoglobulin or a fragment thereof, e.g. a camelised human single domain antibody or the Fc fragment of an antibody
- A61K51/1018—Antibodies or immunoglobulins; Fragments thereof, the carrier being an antibody, an immunoglobulin or a fragment thereof, e.g. a camelised human single domain antibody or the Fc fragment of an antibody against material from animals or humans
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
- A61P1/18—Drugs for disorders of the alimentary tract or the digestive system for pancreatic disorders, e.g. pancreatic enzymes
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P17/00—Drugs for dermatological disorders
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
- A61P25/28—Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P29/00—Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P3/00—Drugs for disorders of the metabolism
- A61P3/04—Anorexiants; Antiobesity agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
- A61P37/02—Immunomodulators
- A61P37/06—Immunosuppressants, e.g. drugs for graft rejection
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P9/00—Drugs for disorders of the cardiovascular system
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
- C07K16/18—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
- C07K16/28—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
- C07K16/30—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants from tumour cells
- C07K16/3015—Breast
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/20—Immunoglobulins specific features characterized by taxonomic origin
- C07K2317/24—Immunoglobulins specific features characterized by taxonomic origin containing regions, domains or residues from different species, e.g. chimeric, humanized or veneered
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/30—Immunoglobulins specific features characterized by aspects of specificity or valency
- C07K2317/33—Crossreactivity, e.g. for species or epitope, or lack of said crossreactivity
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/30—Immunoglobulins specific features characterized by aspects of specificity or valency
- C07K2317/34—Identification of a linear epitope shorter than 20 amino acid residues or of a conformational epitope defined by amino acid residues
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
- C07K2317/52—Constant or Fc region; Isotype
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
- C07K2317/56—Immunoglobulins specific features characterized by immunoglobulin fragments variable (Fv) region, i.e. VH and/or VL
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
- C07K2317/56—Immunoglobulins specific features characterized by immunoglobulin fragments variable (Fv) region, i.e. VH and/or VL
- C07K2317/565—Complementarity determining region [CDR]
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
- C07K2317/56—Immunoglobulins specific features characterized by immunoglobulin fragments variable (Fv) region, i.e. VH and/or VL
- C07K2317/567—Framework region [FR]
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/60—Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments
- C07K2317/64—Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments comprising a combination of variable region and constant region components
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/90—Immunoglobulins specific features characterized by (pharmaco)kinetic aspects or by stability of the immunoglobulin
- C07K2317/92—Affinity (KD), association rate (Ka), dissociation rate (Kd) or EC50 value
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2800/00—Detection or diagnosis of diseases
- G01N2800/32—Cardiovascular disorders
- G01N2800/329—Diseases of the aorta or its branches, e.g. aneurysms, aortic dissection
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2800/00—Detection or diagnosis of diseases
- G01N2800/70—Mechanisms involved in disease identification
- G01N2800/7047—Fibrils-Filaments-Plaque formation
Definitions
- Medin a 50 aa cleavage fragment of lactadherin/ MFG-E8 is known to aggregate (e.g., undergo amyloidogenesis). Medin amyloid deposits are seen in patients with aortic aneurysms and in patients with Marfan syndrome. While the pathogenic nature of these aggregates is not fully understood, it is thought that medin may perturb smooth muscle cell function and thereby weaken the integrity of the aorta wall. Lactadherin and/or medin have also been implicated in pancreatitis, lupus, Alzheimer's disease and obesity.
- the invention provides an isolated monoclonal antibody that specifically binds to medin, such as, for example, an antibody that specifically binds to full length medin or an N-terminal or C-terminal fragment of medin.
- an antibody that specifically binds to full length medin or an N-terminal or C-terminal fragment of medin examples of such antibodies bind to an epitope within amino acid residues 1-50 of SEQ ID NO: 1 or within amino acid residues 44-50 of SEQ ID NO: 1.
- Some such antibodies compete for binding to human medin with antibody 18G1 or 6B3.
- the antibodies may specifically bind medin and not native lactadherin, for example, antibodies that specifically recognize a neo-epitope created when medin is cleaved from lactadherin.
- Other antibodies may specifically bind medin and misfolded lactadherin, but not native lactadherin, such as the form of lactadherin expressed on MDA-MB-231 cells. Certain of these antibodies preferentially bind dense aggregated medin or medin deposits and only weakly bind to monomeric or oligomeric medin.
- antibodies preferentially bind monomeric or oligomeric medin and only weakly bind to dense aggregated medin or medin deposits, while still other antibodies may specifically bind to multiple aggregated forms of medin (e.g., oligomeric, fibrillar, densely aggregated, deposits) as well as monomeric medin.
- Some antibodies comprise three light chain CDRs and three heavy chain CDRs of monoclonal antibody 18G1, such as the mouse antibody characterized by a heavy chain variable region having an amino acid sequence comprising SEQ ID NO: 3 and a light chain variable region having an amino acid sequence comprising SEQ ID NO:36.
- Some antibodies are a humanized or chimeric 18G1 antibody that specifically binds to human medin, wherein 18G1 is a mouse antibody characterized by a mature heavy chain variable region of SEQ ID NO:3 and a mature light chain variable region of SEQ ID NO: 36.
- Some antibodies are a humanized antibody comprising a humanized mature heavy chain variable region comprising the three heavy chain CDRs of 18G1 and a humanized mature light chain variable region comprising the three light chain CDRs of 18G1.
- the CDRs are as defined by Kabat/Chothia Composite, for example, SEQ ID NOS: 4, 5 and 6 for the heavy chain CDRs and SEQ ID NOs: 8, 9 and 10 for the light chain CDRs.
- the CDRs are of a definition selected from the group of Kabat, Chothia, Kabat/Chothia Composite, AbM and Contact.
- the antibody can be 18G1 or a chimeric, veneered, or humanized form thereof.
- the humanized mature heavy chain variable region comprises the three Kabat heavy chain CDRs of 18G1 (CDR-Hl residues 6-10 of SEQ ID NO:4; CDR-H2 SEQ ID NO: 5, CDR-H3 SEQ ID NO:6) and the humanized mature light chain variable region comprises the three Kabat light chain CDRs of 18G1 (SEQ ID NOs: 8-10).
- the humanized mature heavy chain variable region comprises the three Chothia heavy chain CDRs of 18G1 (CDR-Hl residues 1-7 of SEQ ID NO:4; CDR-H2 residues 3-8 of SEQ ID NO: 5, CDR-H3 SEQ ID NO:6) and the humanized mature light chain variable region comprises the three Chothia light chain CDRs of 18G1 (SEQ ID NOs: 8-10).
- the humanized mature heavy chain variable region comprises the three AbM heavy chain CDRs of 18G1 (CDR-Hl SEQ ID NO:4; CDR-H2 residues 1-10 of SEQ ID NO: 5, CDR-H3 SEQ ID NO:6) and the humanized mature light chain variable region comprises the three AbM light chain CDRs of 18G1 (SEQ ID NOs: 8-10).
- the humanized mature heavy chain variable region comprises the three Contact heavy chain CDRs of 18G1 (CDR-Hl residues 30-35 of SEQ ID:3; CDR-H2 residues 47-59 of SEQ ID NO: 3, CDR-H3 residues 97-108 of SEQ ID NO:3) and the humanized mature light chain variable region comprises the three Contact light chain CDRs of 18G1 (CDR-Ll residues 30-36 of SEQ ID:36; CDR-L2 residues 46-55 of SEQ ID NO: 36, CDR- L3 residues 89-96 of SEQ ID NO:36).
- the humanized mature heavy chain variable region has an amino acid sequence at least 90% identical to any one of SEQ ID NO:34-35 and the humanized mature light chain variable region has an amino acid sequence at least 90% identical to any one of SEQ ID NO: 37-39.
- positions are occupied by the amino acid as specified: position L3 is occupied by V, position L10 is occupied by S, position L13 is occupied by V, position LI 5 is occupied by P, position LI 9 is occupied by A, position L20 is occupied by S, position L22 is occupied by S, position L42 is occupied by Q, position L70 is occupied by D, position L77 is occupied by R, position L78 is occupied by V, position L80 is occupied by A, and position L85 is occupied by V.
- positions are occupied by the amino acid as specified: position L3 is occupied by V, position L10 is occupied by S, position L13 is occupied by V, position LI 5 is occupied by P, position LI 9 is occupied by A, position L20 is occupied by S, position L22 is occupied by S, position L24 is occupied by K, position L28 is occupied by N, position L29 is occupied by V, position L42 is occupied by Q, position L46 is occupied by L, position L70 is occupied by D, position L77 is occupied by R, position L78 is occupied by V, position L80 is occupied by A, and position L85 is occupied by V.
- positions L3, L10, L13, L15, L19, L20, L22, L42, L70, L77, L78, L80, and L85 are occupied by V, S, V, P, A, S, S, Q, D, R, V, A, and V, respectively.
- positions occupied by the amino acid as specified position HI is occupied by E or Q, position H5 is occupied by V or Q, position H13 is occupied by Q or K, position H19 is occupied R or K, position H40 is occupied by A or T, position H42 is occupied by G or D, position H44 is occupied G or R, position H49 is occupied by S or A, position H77 is occupied by S or T, position H82a is occupied by N or S, position H83 is occupied by R or K, position H84 is occupied by A or S, position H89 is occupied by V or M, H93 is occupied by V or A, position HI 08 is occupied by T or M, position L45 is occupied by Q, position L60 is occupied by D, and position L83 is occupied by L.
- positions occupied by the amino acid as specified position HI is occupied by E or Q, position H5 is occupied by V or Q, position H13 is occupied Q or K, position H19 is occupied R or K, position H40 is occupied by A or T, position H42 is occupied by G or D, position H44 is occupied G or R, position H49 is occupied by S or A, position H50 is occupied by G, position 63 is occupied by T, position H77 is occupied by S or T, position H82a is occupied by N or S, position H83 is occupied by R, position H84 is occupied by A, position H89 is occupied by V or M, H93 is occupied by V or A, position H108 is occupied by T or M.
- positions HI, H5, H13, H19, H40, H42, H44, H49, H77, H82a, H83, H84, H89, H93, and H108 are occupied by, E, V, Q, R, A, G, G, S, S, N, R, A, V, V, and T, respectively.
- positions L45, L60, and L83 are occupied by Q, D, and L, respectively.
- position L45 is occupied by Q.
- positions L60 and L83 are occupied by D and L, respectively.
- the mature heavy chain variable region has an amino acid sequence at least 95% identical to any one of SEQ ID NO: 34-35 and the mature light chain variable region has an amino acid sequence at least 95% identical to any one of SEQ ID NO: 38- 39.
- the mature heavy chain variable region has an amino acid sequence at least 98% identical to any one of SEQ ID NO: 34-35 and the mature light chain variable region has an amino acid sequence at least 98% identical to any one of SEQ ID NO: 38-39.
- the mature heavy chain variable region has an amino acid sequence of any of SEQ ID NO:34-35 and the mature light chain variable region has an amino acid sequence of any one of SEQ ID NO:38-39.
- the mature heavy chain variable region has an amino acid sequence of SEQ ID NO:34 and the mature light chain variable region has an amino acid sequence of SEQ ID NO:38.
- the mature heavy chain variable region has an amino acid sequence of SEQ ID NO:34 and the mature light chain variable region has an amino acid sequence of SEQ ID NO:39.
- the mature heavy chain variable region has an amino acid sequence of SEQ ID NO:35 and the mature light chain variable region has an amino acid sequence of SEQ ID NO:38.
- the mature heavy chain variable region has an amino acid sequence of SEQ ID NO:35 and the mature light chain variable region has an amino acid sequence of SEQ ID NO:39.
- Additional antibodies comprise three light chain CDRs and three heavy chain CDRs of monoclonal antibody 6B3, such as the mouse antibody characterized by a heavy chain variable region having an amino acid sequence comprising SEQ ID NO: 11 and a light chain variable region having an amino acid sequence comprising SEQ ID NO: 29.
- the CDRs are as defined by Kabat/Chothia Composite, for example, SEQ ID NOs: 12, 13 and 14 for the heavy chain CDRs and SEQ ID NOs: 16, 17 and 18 for the light chain CDRs.
- the antibody can be 6B3 or a chimeric, veneered, or humanized form thereof.
- Some antibodies are a humanized or chimeric 6B3 antibody that specifically binds to human medin, wherein 6B3 is a mouse antibody characterized by a mature heavy chain variable region of SEQ ID NO: 11 and a mature light chain variable region of SEQ ID NO: 29.
- Some antibodies comprise a humanized mature heavy chain variable region comprising the three heavy chain CDRs of 6B3 and a humanized mature light chain variable region comprising the three light chain CDRs of 6B3.
- the CDRs are of a definition selected from the group of Kabat, Chothia, Kabat/Chothia Composite, AbM and Contact.
- the humanized mature heavy chain variable region comprises the three Kabat/Chothia Composite heavy chain CDRs of 6B3 (SEQ ID NOs: 12-14) and the humanized mature light chain variable region comprises the three Kabat/Chothia Composite light chain CDRs of 6B3 (SEQ ID NOs: 16-18).
- the humanized mature heavy chain variable region comprises the three Kabat heavy chain CDRs of 6B3 (CDR-Hl residues 6-12 of SEQ ID NO: 12; CDR-H2 SEQ ID NO: 13, CDR-H3 SEQ ID NO: 14) and the humanized mature light chain variable region comprises the three Kabat light chain CDRs of 6B3 (SEQ ID NOs: 16-18).
- the humanized mature heavy chain variable region comprises the three Chothia heavy chain CDRs of 6B3 (CDR-Hl residues 1-9 of SEQ ID NO: 12; CDR-H2 residues 3-7 of SEQ ID NO: 13, CDR-H3 SEQ ID NO: 14) and the humanized mature light chain variable region comprises the three Chothia light chain CDRs of 6B3 (SEQ ID NOs: 16-18).
- the humanized mature heavy chain variable region comprises the three AbM heavy chain CDRs of 6B3 (CDR-Hl SEQ ID NO: 12; CDR-H2 residues 1-9 of SEQ ID NO: 13, CDR-H3 SEQ ID NO: 14) and the humanized mature light chain variable region comprises the three AbM light chain CDRs of 6B3 (SEQ ID NOs: 16-18).
- the humanized mature heavy chain variable region comprises the three Contact heavy chain CDRs of 6B3 (CDR-H1 residues 30-37 of SEQ ID NO: 11; CDR-H2 residues 49-60 of SEQ ID NO: 11, CDR-H3 residues 98-106 of SEQ ID NO: 11) and the humanized mature light chain variable region comprises the three Contact light chain CDRs of 6B3 (CDR-Ll residues 30-36 of SEQ ID:29; CDR-L2 residues 46-55 of SEQ ID NO: 29, CDR-L3 residues 89-96 of SEQ ID NO:29).
- the humanized mature heavy chain variable region has an amino acid sequence at least 90% identical to any one of SEQ ID NO:26-28 and the humanized mature light chain variable region has an amino acid sequence at least 90% identical to any one of SEQ ID NO: 31-32.
- At least one of the following positions is occupied by the amino acid as specified: H3 is occupied by Q, H5 is occupied by Q, H10 is occupied by G, H15 is occupied by S, and H19 is occupied by S. .
- positions H3, H5, H10, H15, and H19 are occupied by, Q, Q, G, S, and S respectively.
- At least one of the following positions is occupied by the amino acid as specified: position: HI is occupied by E or Q, H44 is occupied by G, H48 is occupied by I or L, H49 is occupied by G or A, H67 is occupied by V or L, H78 is occupied by F or V, H79 is occupied by S or V, H81 is occupied by K or T, H82 is occupied by L or M, H82a is occupied by S or T, H82b is occupied by S or N, H82c is occupied by V or M, H83 is occupied by T or D, H84 is occupied by A or P, H85 is occupied by A or V, H89 is occupied by V or T, H108 is occupied by T or L, L71 is occupied by Y or F, L87 is occupied by F or Y, L100 is occupied by Q or G, and L104 is occupied by L or V.
- At least one of the following positions is occupied by the amino acid as specified: position: HI is occupied by E or Q, H35 is occupied by G, H35b is occupied by G, H44 is occupied by G or A, H48 is occupied by I or L, H49 is occupied by G or A, H50 is occupied by H, H58 is occupied by Y, H60 is occupied by N, H61 is occupied by I, H62 is occupied by A, H65 is occupied by N, H67 is occupied by V or L, H78 is occupied by F or V, H79 is occupied by S or V, H81 is occupied by K or T, H82 is occupied by L or M, H82a is occupied by S or T, H82b is occupied by S or N, H82c is occupied by V or M, H83 is occupied by T or D, H84 is occupied by A or P, H85 is occupied by A or V, H89 is occupied by V or T
- positions HI, H44, H79, H81, H82, H82b, H82c, H83, H84, H85, and H89 are occupied by, E, G, S, K, L, S, V, T, A, A, and V, respectively.
- positions H48, H49, H67, H78, H82a, and H108 are occupied by, I, G, V, F, S, and T, respectively.
- positions L71, L87, L100, and L104 are occupied by Y, F, Q, and L, respectively.
- Some antibodies comprise a mature heavy chain variable region having an amino acid sequence at least 95% identical to at least one of SEQ ID NO: 26-28 and a mature light chain variable region having an amino acid sequence at least 95% identical to at least one of SEQ ID NO: 31-32.
- Some antibodies comprise a mature heavy chain variable region having an amino acid sequence at least 98% identical to SEQ ID NO: 26-28 and a mature light chain variable region having an amino acid sequence at least 98% identical to SEQ ID NO: 31-32.
- the mature heavy chain variable region has an amino acid sequence of any of SEQ ID NO:26-28 and the mature light chain variable region has an amino acid sequence of any one of SEQ ID NO:31-32.
- the mature heavy chain variable region has an amino acid sequence of SEQ ID NO:26 and the mature light chain variable region has an amino acid sequence of SEQ ID NO:31. In some antibodies, the mature heavy chain variable region has an amino acid sequence of SEQ ID NO:26 and the mature light chain variable region has an amino acid sequence of SEQ ID NO:32. In some antibodies, the mature heavy chain variable region has an amino acid sequence of SEQ ID NO:27 and the mature light chain variable region has an amino acid sequence of SEQ ID NO:31. In some antibodies, the mature heavy chain variable region has an amino acid sequence of SEQ ID NO:27 and the mature light chain variable region has an amino acid sequence of SEQ ID NO:32.
- the mature heavy chain variable region has an amino acid sequence of SEQ ID NO:28 and the mature light chain variable region has an amino acid sequence of SEQ ID NO:31. In some antibodies, the mature heavy chain variable region has an amino acid sequence of SEQ ID NO:28 and the mature light chain variable region has an amino acid sequence of SEQ ID NO:32.
- the antibody can be an intact mouse, chimeric, veneered or humanized antibody or a binding fragment, single-chain antibody Fab fragment, Fab'2 fragment, or single chain Fv.
- Some of the antibodies have a human IgGl isotype, while others may have a human IgG2 or IgG4 isotype. Some antibodies have the mature light chain variable region fused to a light chain constant region and the mature heavy chain variable region fused to a heavy chain constant region.
- the heavy chain constant region of some antibodies is a mutant form of a natural human heavy chain constant region which has reduced binding to a Fey receptor relative to the natural human heavy chain constant region.
- Some antibodies may have at least one mutation in the constant region, such as a mutation that reduces complement fixation or activation by the constant region, for example, a mutation at one or more of positions 241, 264, 265, 270, 296, 297, 318, 320, 322, 329 and 331 by EU numbering. Some antibodies have an alanine at positions 318, 320 and 322. Some antibodies can be at least 95% w/w pure. The antibody can be conjugated to a therapeutic or cytotoxic agent.
- the invention provides a pharmaceutical composition comprising any of the antibodies disclosed herein and a pharmaceutically-acceptable carrier.
- the invention provides a nucleic acid encoding the heavy chain and/or light chain of any of the antibodies disclosed herein, a recombinant expression vector comprising the nucleic acid and a host cell transformed with the recombinant expression vector.
- the invention provides methods of humanizing any non- human antibody described herein, for example, mouse antibodies 18G1 or 6B3.
- Such methods can involve selecting one or more acceptor antibodies, synthesizing a nucleic acid encoding a humanized heavy chain comprising CDRs of the mouse heavy chain and a nucleic acid encoding a humanized light chain comprising CDRs of the mouse antibody light chain, and expressing the nucleic acids in a host cell to produce a humanized antibody.
- Methods of producing antibodies such as a humanized, chimeric or veneered antibody, for example humanized, chimeric or veneered forms of 18G1 or 6B3, are also provided.
- cells transformed with nucleic acids encoding the heavy and light chains of the antibody are cultured so that the cells secrete the antibody.
- the antibody can then be purified from the cell culture media.
- Cell lines producing any of the antibodies disclosed herein can be produced by introducing a vector encoding heavy and light chains of the antibody and a selectable marker into cells, propagating the cells under conditions to select for cells having increased copy number of the vector,isolating single cells from the selected cells; and banking cells cloned from a single cell selected based on yield of antibody.
- Some cells can be propagated under selective conditions and screened for cell lines naturally expressing and secreting at least 100 mg/L/10 6 cells/24 hours. Single cells can be isolated from the selected cells. Cells cloned from a single cell can then be banked. Single cells can be selected based on desirable properties, such as the yield of the antibody. Exemplary cell lines are cell lines expressing 18G1 or 6B3.
- the invention also provides methods of inhibiting or reducing aggregation of medin in a subject having or at risk of developing a medin- mediated amyloidosis, comprising administering to the subject an effective regime of an antibody disclosed herein, thereby inhibiting or reducing aggregation of medin in the subject.
- An example of amyloidosis is aortic medial amyloid.
- Exemplary antibodies include humanized versions of 6B3 and 18G1.
- a disease include pancreatitis, lupus, Alzheimer's disease, obesity, cardiac disease, Marfan syndrome aortic aneurysm, or an inflammatory condition affecting the vascular system.
- An example of an inflammatory condition affecting the vascular system is giant cell arteritis.
- Some methods involve a subject that has been diagnosed with Marfan syndrome. Some subjects have one or more risk factors for an aortic aneurysm, such as, for example, smoking, hypertension, atherosclerosis, bicuspid aortic valves and genetic connective disorders. In some methods, the disease is aortic aneurysm.
- the invention also provides methods of reducing aortic medial amyloid formation in a subject having or at risk of an aortic aneurysm, comprising administering to the subject an effective amount of an antibody disclosed herein, thereby reducing aortic medial amyloid formation in the subject.
- the antibody can be a humanized version of 18G1 or 6B3.
- the invention also provides a method of improving elasticity of the aorta in subjects having aortic medial amyloid, comprising administering to the subject an effective amount of an antibody disclosed herein, thereby improving the elasticity of the aorta of the subject.
- Some subjects have aortic medial amyloid in the thoracic aorta.
- the invention provides a method of detecting aortic medial amyloid in a subject having or at risk of a disease associated with medin aggregation or deposition, comprising administering to the subject an effective amount of an antibody disclosed herein, wherein the antibody binds to aortic medial amyloid, and detecting bound antibody in the subject.
- FIG. 1A & FIG. IB depicts the position of medin within lactadherin.
- FIG. IB depicts the amino acid sequence of full length human medin and peptides derived from C- terminal human and murine medin.
- FIG. 2A & FIG. 2B depicts binding curves of murine antibody 6B3 to lactadherin, full length medin, and peptides derived from C-terminal human and murine medin.
- FIG. 2B depicts binding curves of murine antibody 18G1 to lactadherin, full length medin, and peptides derived from C-terminal human and murine medin.
- FIG. 3 A & FIG. 3B depicts a Western blot analysis of a commercial lactadherin antibody binding to human lactadherin, but not to the medin peptide.
- FIG. 3B depicts a Western blot analysis of murine antibody 6B3 binding to human lactadherin and medin peptide.
- FIG. 4A & FIG. 4B depicts a Western blot analysis of murine antibody 6B3 binding to human lactadherin and medin peptide.
- FIG. 4B depicts a Western blot analysis of murine antibodyl8Gl binding to human medin peptide, but not to lactadherin.
- FIG. 5 depicts an alignment of heavy chain variable regions of the murine antibodies 6B3 and 18G1.
- the CDRs as defined by Kabat/Chothia Composite are in boldface. Positions where amino acid residues differ between the heavy chain variable regions of murine antibody 6B3 and murine antibody 18G1 are boxed.
- FIG. 6 depicts an alignment of light chain variable regions of the murine antibodies 6B3 and 18G1.
- the CDRs as defined by Kabat are in boldface. Positions where amino acid residues differ between the light chain variable regions of murine antibody 6B3 and murine antibody 18G1 are boxed.
- FIG. 7 depicts an alignment of heavy chain variable regions of the mouse 6B3 antibody, human acceptor antibody, and humanized versions of the 6B3 antibody.
- the CDRs as defined by Kabat/Chothia Composite are enclosed in boxes.
- FIG. 8 depicts an alignment of light chain variable regions of the mouse 6B3 antibody, human acceptor antibody, and humanized versions of the 6B3 antibody.
- the CDRs as defined by Kabat are enclosed in boxes.
- FIG. 9 depicts an alignment of heavy chain variable regions of the mouse 18G1 antibody, human acceptor antibody, and humanized versions of the 18G1 antibody.
- the CDRs as defined by Kabat/Chothia Composite are enclosed in boxes.
- FIG. 10 depicts an alignment of light chain variable regions of the mouse 18G1 antibody, human acceptor antibody, and humanized versions of the 18G1 antibody.
- the CDRs as defined by Kabat are enclosed in boxes.
- SEQ ID NO: 1 sets forth the amino acid equence of human medin.
- SEQ ID NO: 2 sets forth the amino acid sequence of a human C-terminal medin peptide immunogen.
- SEQ ID NO: 3 sets forth the amino acid sequence of the heavy chain variable region of the mouse 18G1 antibody.
- SEQ ID NO: 4 sets forth the amino acid sequence of Kabat/Chothia Composite CDR- Hl of the mouse 18G1 antibody.
- SEQ ID NO: 5 sets forth the amino acid sequence of Kabat CDR-H2 of the mouse 18G1 antibody.
- SEQ ID NO: 6 sets forth the amino acid sequence of Kabat CDR-H3 of the mouse 18G1 antibody.
- SEQ ID NO: 7 sets forth the amino acid sequence of the light chain variable region of the mouse 18G1 antibody.
- SEQ ID NO: 8 sets forth the amino acid sequence of Kabat CDR-L1 of the mouse 18G1 antibody.
- SEQ ID NO: 9 sets forth the amino acid sequence of Kabat CDR-L2 of the mouse 18G1 antibody.
- SEQ ID NO: 10 sets forth the amino acid sequence of Kabat CDR-L3 of the mouse 18G1 antibody.
- SEQ ID NO: 11 sets forth the amino acid sequence of the heavy chain variable region of the mouse 6B3 antibody.
- SEQ ID NO: 12 sets forth the amino acid sequence of Kabat/Chothia composite CDR-H1 of the mouse 6B3 antibody.
- SEQ ID NO: 13 sets forth the amino acid sequence of Kabat CDR-H2 of the mouse 6B3 antibody.
- SEQ ID NO: 14 sets forth the amino acid sequence of Kabat CDR-H3 of the mouse 6B3 antibody.
- SEQ ID NO: 15 sets forth the amino acid sequence of the light chain variable region of the mouse 6B3 antibody.
- SEQ ID NO: 16 sets forth the amino acid sequence of Kabat CDR-L1 of the mouse 6B3 antibody.
- SEQ ID NO: 17 sets forth the amino acid sequence of Kabat CDR-L2 of the mouse 6B3 antibody.
- SEQ ID NO: 18 sets forth the amino acid sequence of Kabat CDR-L1 of the mouse 6B3 antibody.
- SEQ ID NO: 19 sets forth the nucleic acid sequence of a CK3' primer for VL PCR amplification of the medin antibody kappa light chains.
- SEQ ID NO: 20 sets forth the nucleic acid sequence of a 3' primer for VH PCR amplification of the 18G1 antibody heavy chain.
- SEQ ID NO: 21 sets forth the nucleic acid sequence of a 3' primer for VH PCR amplification of the 6B3 antibody heavy chain.
- SEQ ID NO: 22 sets forth the amino acid sequence of a mouse C-terminal medin peptide immunogen.
- SEQ ID NO:23 sets forth the consensus amino acid sequence between the heavy chain variable regions of the 6B3 and 18G1 mouse antibodies (labeled "Majority' in Figure 5).
- SEQ ID NO:24 sets forth the consensus amino acid sequence between the light chain variable regions of the 6B3 and 18G1 mouse antibodies (labeled "Majority' in Figure 6).
- SEQ ID NO:25 sets forth the amino acid sequence of the heavy chain variable acceptor Acc.# AAD53863.1.
- SEQ ID NO:26 sets forth the amino acid sequence of heavy chain variable region of the humanized 6B3 antibody version 1 (Hu6B3VHvl).
- SEQ ID NO:27 sets forth the amino acid sequence of the heavy chain variable region of the humanized 6B3 antibody version 2 (Hu6B3VHv2).
- SEQ ID NO:28 sets forth the amino acid sequence of the heavy chain variable region of the humanized 6B3 antibody version 1 (Hu6B3VHv3).
- SEQ ID NO: 29 sets forth the amino acid sequence of the light chain variable region of the mouse 6B3 antibody minus the C-terminal arginine found in SEQ ID NO: 15.
- SEQ ID NO:30 sets forth the amino acid sequence of the light chain variable acceptor Acc.# BAC01558.1.
- SEQ ID NO:31 sets forth the amino acid sequence of the light chain variable region of the humanized 6B3 antibody version 1 (Hu6B3VLvl).
- SEQ ID NO:32 sets forth the amino acid sequence of the light chain variable region of the humanized 6B3 antibody version 2 (Hu6B3VLv2).
- SEQ ID NO:33 sets forth the amino acid sequence of the heavy chain variable acceptor Acc.# AAX82494.1.
- SEQ ID NO:34 sets forth the amino acid sequence of heavy chain variable region of the humanized 18Glantibody version 1 (Hul8GlVHvl).
- SEQ ID NO:35 sets forth the amino acid sequence of the heavy chain variable region of the humanized 18G1 antibody version 2 (Hul8GlVHv2).
- SEQ ID NO: 36 sets forth the amino acid sequence of the light chain variable region of the mouse 18G1 antibody minus the C-terminal arginine found in SEQ ID NO:7.
- SEQ ID NO:37 sets forth the amino acid sequence of the light chain variable acceptor Acc.# AAD39507.1.
- SEQ ID NO:38 sets forth the amino acid sequence of the light chain variable region of the humanized 18Glantibody version 1 (Hul8GlVLvl).
- SEQ ID NO:39 sets forth the amino acid sequence of the light chain variable region of the humanized 18G1 antibody version 2 (Hul8GlVLv2).
- Monoclonal antibodies or other biological entities are typically provided in isolated form. This means that an antibody or other biologically entity is typically at least 50% w/w pure of interfering proteins and other contaminants arising from its production or purification but does not exclude the possibility that the monoclonal antibody is combined with an excess of pharmaceutically acceptable carrier(s) or other vehicle intended to facilitate its use. Sometimes monoclonal antibodies are at least 60%, 70%, 80%, 90%, 95% or 99% w/w pure of interfering proteins and contaminants from production or purification. Often an isolated monoclonal antibody or other biological entity is the predominant macromolecular species remaining after its purification.
- Specific binding of an antibody to its target antigen means an affinity of at least 10 6 , 10 7 , 10 s , 10 9 , or 10 10 M "1 . Specific binding is detectably higher in magnitude and distinguishable from non-specific binding occurring to at least one unrelated target. Specific binding can be the result of formation of bonds between particular functional groups or particular spatial fit (e.g., lock and key type) whereas nonspecific binding is usually the result of van der Waals forces. Specific binding does not however necessarily imply that an antibody binds one and only one target.
- the basic antibody structural unit is a tetramer of subunits.
- Each tetramer includes two identical pairs of polypeptide chains, each pair having one "light” (about 25 kDa) and one "heavy" chain (about 50-70 kDa).
- the amino-terminal portion of each chain includes a variable region of about 100 to 110 or more amino acids primarily responsible for antigen recognition. This variable region is initially expressed linked to a cleavable signal peptide.
- the variable region without the signal peptide is sometimes referred to as a mature variable region.
- a light chain mature variable region means a light chain variable region without the light chain signal peptide.
- the carboxy-terminal portion of each chain defines a constant region primarily responsible for effector function.
- Light chains are classified as either kappa or lambda.
- Heavy chains are classified as gamma, mu, alpha, delta, or epsilon, and define the antibody's isotype as IgG, IgM, IgA, IgD and IgE, respectively.
- the variable and constant regions are joined by a "J" region of about 12 or more amino acids, with the heavy chain also including a "D” region of about 10 or more amino acids. See generally, Fundamental Immunology, Paul, W., ed., 2nd ed. Raven Press, N.Y., 1989, Ch. 7 (incorporated by reference in its entirety for all purposes).
- An immunoglobulin light or heavy chain variable region (also referred to herein as a "light chain variable domain” (“VL domain”) or “heavy chain variable domain” (“VH domain”), respectively) consists of a "framework” region interrupted by three “complementarity determining regions” or “CDRs.”
- the framework regions serve to align the CDRs for specific binding to an epitope of an antigen.
- CDRs include the amino acid residues of an antibody that are primarily responsible for antigen binding. From amino-terminus to carboxyl-terminus, both VL and VH domains comprise the following framework (FR) and CDR regions: FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4.
- CDRs 1, 2, and 3 of a VL domain are also referred to herein, respectively, as CDR-L1, CDR-L2, and CDR-L3;
- CDRs 1, 2, and 3 of a VH domain are also referred to herein, respectively, as CDR-Hl, CDR-H2, and CDR-H3T
- an antibody when an antibody is said to comprise CDRs by a certain definition of CDRs (e.g., Kabat) that definition specifies the minimum number of CDR residues present in the antibody (i.e., the Kabat CDRs). It does not exclude that other residues falling within another conventional CDR definition but outside the specified definition are also present.
- an antibody comprising CDRs defined by Kabat includes among other possibilities, an antibody in which the CDRs contain Kabat CDR residues and no other CDR residues, and an antibody in which CDR HI is a composite Chothia-Kabat CDR HI and other CDRs contain Kabat CDR residues and no additional CDR residues based on other definitions.
- antibody includes intact antibodies and binding fragments thereof.
- fragments compete with the intact antibody from which they were derived for specific binding to the target including separate heavy chains, light chains Fab, Fab', F(ab') 2 , F(ab)c, Dabs, nanobodies, and Fv. Fragments can be produced by recombinant DNA techniques, or by enzymatic or chemical separation of intact immunoglobulins.
- the term "antibody” also includes a bispecific antibody and/or a humanized antibody.
- a bispecific or bifunctional antibody is an artificial hybrid antibody having two different heavy/light chain pairs and two different binding sites (see, e.g., Songsivilai and Lachmann, Clin. Exp.
- the two different heavy/light chain pairs include a humanized 6B3 or 18G1 heavy chain/light chain pair and a heavy chain/light chain pair specific for a different epitope on medin than that bound by 6B3 or 18G1.
- one heavy chain/light chain pair is a humanized 6B3 or 18G1 antibody as further disclosed below and the other heavy chain/light chain pair is from an antibody that binds to a receptor expressed on the blood brain barrier, such as an insulin receptor, an insulin- like growth factor (IGF) receptor, a leptin receptor, or a lipoprotein receptor, or a transferrin receptor (Friden et al, Proc. Natl. Acad. Sci. USA 88:4771-4775, 1991; Friden et al, Science 259:373-377, 1993).
- IGF insulin- like growth factor
- leptin receptor a leptin receptor
- lipoprotein receptor or a transferrin receptor
- Brain uptake of the bispecific antibody can be further enhanced by engineering the bi- specific antibody to reduce its affinity to the blood brain barrier receptor. Reduced affinity for the receptor resulted in a broader distributioin in the brain (see, e.g., Atwal et al, Sci. Trans. Med. 3, 84ra43, 2011; Yu et al, Sci. Trans. Med. 3, 84ra44, 2011).
- Exemplary bispecific antibodies can also be: (1) a dual- variable-domain antibody (DVD-Ig), where each light chain and heavy chain contains two variable domains in tandem through a short peptide linkage (Wu et al, Generation and Characterization of a Dual Variable Domain Immunoglobulin (DVD-IgTM) Molecule, In: Antibody Engineering, Springer Berlin Heidelberg (2010)); (2) a Tandab, which is a fusion of two single chain diabodies resulting in a tetravalent bispecific antibody that has two binding sites for each of the target antigens; (3) a flexibody, which is a combination of scFvs with a diabody resulting in a multivalent molecule; (4) a so-called “dock and lock” molecule, based on the "dimerization and docking domain" in Protein Kinase A, which, when applied to Fabs, can yield a trivalent bispecific binding protein consisting of two identical Fab fragments linked to a
- bispecific antibodies examples include BiTE (Micromet), DART (MacroGenics), Fcab and Mab2 (F-star), Fc-engineered IgGl (Xencor) or DuoBody (based on Fab arm exchange, Genmab).
- epitope refers to a site on an antigen to which an antibody binds.
- An epitope can be formed from contiguous amino acids or noncontiguous amino acids juxtaposed by tertiary folding of one or more proteins. Epitopes formed from contiguous amino acids (also known as linear epitopes) are typically retained on exposure to denaturing solvents whereas epitopes formed by tertiary folding (also known as conformational epitopes) are typically lost on treatment with denaturing solvents.
- An epitope typically includes at least 3, and more usually, at least 5 or 8- 10 amino acids in a unique spatial conformation.
- Methods of determining spatial conformation of epitopes include, for example, x-ray crystallography and 2-dimensional nuclear magnetic resonance. See, e.g., Epitope Mapping Protocols, in Methods in Molecular Biology, Vol. 66, Glenn E. Morris, Ed. (1996).
- Antibodies that recognize the same or overlapping epitopes can be identified in a simple immunoassay showing the ability of one antibody to compete with the binding of another antibody to a target antigen.
- the epitope of an antibody can also be defined X-ray
- two antibodies have the same epitope if all amino acid mutations in the antigen that reduce or eliminate binding of one antibody reduce or eliminate binding of the other.
- Two antibodies have overlapping epitopes if some amino acid mutations that reduce or eliminate binding of one antibody reduce or eliminate binding of the other.
- Competition between antibodies is determined by an assay in which an antibody under test inhibits specific binding of a reference antibody to a common antigen (see, e.g. , Junghans et ah, Cancer Res. 50: 1495, 1990).
- a test antibody competes with a reference antibody if an excess of a test antibody (e.g. , at least 2x, 5x, lOx, 20x or lOOx) inhibits binding of the reference antibody by at least 50% as measured in a competitive binding assay.
- Some test antibodies inhibit binding of the references antibody by at least 75%, 90% or 99%.
- Antibodies identified by competition assay include antibodies binding to the same epitope as the reference antibody and antibodies binding to an adjacent epitope sufficiently proximal to the epitope bound by the reference antibody for steric hindrance to occur.
- pharmaceutically acceptable means that the carrier, diluent, excipient, or auxiliary is compatible with the other ingredients of the formulation and not substantially deleterious to the recipient thereof.
- patient includes human and other mammalian subjects that receive either prophylactic or therapeutic treatment.
- An individual is at increased risk of a disease if the subject has at least one known risk- factor (e.g., genetic, biochemical, family history, and situational exposure) placing individuals with that risk factor at a statistically significant greater risk of developing the disease than individuals without the risk factor.
- risk- factor e.g., genetic, biochemical, family history, and situational exposure
- biological sample refers to a sample of biological material within or obtainable from a biological source, for example a human or mammalian subject.
- samples can be organs, organelles, tissues, sections of tissues, bodily fluids, peripheral blood, blood plasma, blood serum, cells, molecules such as proteins and peptides, and any parts or
- biological sample can also encompass any material derived by processing the sample. Derived material can include cells or their progeny.
- Processing of the biological sample may involve one or more of filtration, distillation, extraction, concentration, fixation, inactivation of interfering components, and the like.
- control sample refers to a biological sample not known or suspected to include disease affected cells.
- Control samples can be obtained from individuals not afflicted with the disease. Alternatively, control samples can be obtained from patients afflicted with the disease. Such samples can be obtained at the same time as a biological sample thought to comprise the disease or on a different occasion.
- a biological sample and a control sample can both be obtained from the same tissue).
- control samples consist essentially or entirely of normal, healthy cells and can be used in comparison to a biological sample thought to comprise disease-affected cells.
- the cells in the control sample have the same tissue origin as the cancer cells thought to be in the biological sample.
- the cells thought to be in the biological sample arise from the same cell type as the type of cells in the control sample.
- disease refers to any abnormal condition that impairs physiological function.
- the term is used broadly to encompass any disorder, illness, abnormality, pathology, sickness, condition, or syndrome in which physiological function is impaired, irrespective of the nature of the etiology.
- symptom refers to a subjective evidence of a disease, such as altered gait, as perceived by the subject.
- a “sign” refers to objective evidence of a disease as observed by a physician.
- amino acids are grouped as follows: Group I (hydrophobic side chains): met, ala, val, leu, ile; Group II (neutral hydrophilic side chains): cys, ser, thr; Group III (acidic side chains): asp, glu; Group IV (basic side chains): asn, gin, his, lys, arg; Group V (residues influencing chain orientation): gly, pro; and Group VI (aromatic side chains): trp, tyr, phe.
- Conservative substitutions involve substitutions between amino acids in the same class. Non- conservative substitutions constitute exchanging a member of one of these classes for a member of another.
- Percentage sequence identities are determined with antibody sequences maximally aligned by the Kabat numbering convention. After alignment, if a subject antibody region (e.g. , the entire mature variable region of a heavy or light chain) is being compared with the same region of a reference antibody, the percentage sequence identity between the subject and reference antibody regions is the number of positions occupied by the same amino acid in both the subject and reference antibody region divided by the total number of aligned positions of the two regions, with gaps not counted, multiplied by 100 to convert to percentage.
- a subject antibody region e.g. , the entire mature variable region of a heavy or light chain
- compositions or methods "comprising” or “including” one or more recited elements may include other elements not specifically recited.
- Designation of a range of values includes all integers within or defining the range, and all subranges defined by integers within the range.
- the invention provides antibodies that specifically bind to medin.
- the antibodies have the capacity to bind to monomeric, misfolded, aggregated or fibril forms of medin.
- the antibodies can be used for treating or effecting prophylaxis of diseases or disorders associated with medin, medin accumulation or accumulation of medin deposits.
- one approach to treat aortic aneurysms may be to sequester medin and thereby block aggregation or remove the amyloid deposits from the aorta using a monoclonal antibody.
- the antibodies can also be used for diagnosing medin amyloidosis and inhibiting or reducing aggregation of medin, among other applications.
- Medin is a 50 amino acid peptide, is formed by enzymatic cleavage of lactadherin and has the sequence of SEQ ID NO: 1.
- Lactadherin is a 364 amino acid glycoprotein also known as Milk Fat Globule-EGF Factor 8 (MFG-E8), SED1, PAS 6/7 and P47.
- MFG-E8 Milk Fat Globule-EGF Factor 8
- SED1 Milk Fat Globule-EGF Factor 8
- medin The main component of senile aortic amyloid deposits is medin (Haggqvist et al., PNAS 96:8669-8674 (1999). Research indicates that prefibrillar oligomeric aggregates of medin, rather than mature amyloid fibrils, are toxic to the surrounding cells (Peng et al., Lab Invest. 87: 1195-1205 (2007). Unless otherwise apparent from context, reference to medin, lactadherin or their fragments includes the natural human amino acid sequences including isoforms, mutants, and allelic variants thereof.
- lactadherin An accumulation of lactadherin occurs in the arterial wall during inflammatory remodeling seen with aging, hypertension, diabetes mellitus, or atherosclerosis. In the atrial wall, lactadherin signaling promotes vascular smooth muscle cell invasion, proliferation and the secretion of inflammatory molecules. Analysis of senile aortic amyloid deposits revealed that medin, an internal cleavage product of the C-terminal region of Lactadherin was the main component. Medin is thought to disrupt lactadherin anchoring of smooth muscle to elastin and thereby lead to reduced elasticity or "hardening" of the aortic artery.
- Medin amyloid deposits are very common in aortas of patients over age 55, with one report estimating an incidence of 97%. The highest prevalence of medin amyloid is seen in the thoracic aorta. This may be due to the high levels of elastin in these vessels. Deposits have been seen in the extra-cellular space in close proximity to elastin fibers. Medin is less abundant or has not been detected in other tissues where lactadherin is expressed.
- Lactadherin and/or medin have also been implicated in Marfan syndrome (a genetic disease that affects the elastin fibers in the aorta and can eventually lead to an aneurysm), pancreatitis, lupus, Alzheimer's disease and obesity.
- Aortic aneurysms are characterized by a reduction in the structural framework and strength of the aorta which can lead to a rupture, severe internal bleeding, and death.
- Thoracic aneurysms affect approximately 15,000 people in the US each year and only about 20-30% of patients who get to the hospital with a rupture survive.
- the most common type of aneurysms are degenerative in nature, with a progressive increase in vessel diameter and decrease in wall thickness. Risk factors for aneurysms include smoking, hypertension, atherosclerosis, bicuspid aortic valves, and genetic connective disorders.
- Lactadherin and/or medin may also play a role in inflammatory conditions affecting the vascular system, e.g., of the vessel wall, e.g., GCA (giant cell arteritis).
- GCA giant cell arteritis
- the invention provides monoclonal antibodies binding to epitopes within medin. Some such epitopes are buried in the native form of lactadherin and exposed in misfolded lactadherin. Some epitopes are neo-epitopes exposed upon cleavage of lactadherin to produce medin. Some epitopes are located at the C-terminal region of medin.
- the epitope can be linear, such as an epitope of 2-5, 3-5, 3-6, 3-7, 3-9, 4-9 or 5-9 contiguous amino acids from SEQ ID NO: l. Some epitopes are within SEQ ID NO:2.
- the epitope can be a conformational epitope, including, for example, two or more non-contiguous segments of amino acids within residues 1- 50 of SEQ ID NO: 1.
- Antibodies designated 18G1 and 6B3 are two such exemplary mouse antibodies. The sequences of the heavy and light chain mature variable regions of these antibodies are designated SEQ ID NOs: 3 and 7, and 11 and 15 respectively.
- SEQ ID NO: 29 sets forth the amino acid sequence of the light chain variable region of the mouse 6B3 antibody minus the C-terminal arginine found in SEQ ID NO: 15.
- SEQ ID NO: 36 sets forth the amino acid sequence of the light chain variable region of the mouse 18G1 antibody minus the C- terminal arginine found in SEQ ID NO:7.
- the C-terminal Arg in SEQ ID NO;7 and SEQ ID NO:29 is sometimes included when linking a variable region to a constant region.
- antibodies were raised to full length medin or a C-terminal fragment of medin and screened by a number of laboratory techniques, including enzyme-linked
- Some antibodies specifically bind to an epitope within residues 44-50 of medin (SEQ ID NO: l).
- One such antibody is 18G1 and its chimeric, veneered and humanized forms. Unless otherwise apparent from the context, reference to 18G1 should be understood as referring to any of the mouse, chimeric, veneered or humanized forms. 18G1 specifically binds the medin peptide and does not specifically bind lactadherin.
- Some antibodies specifically bind to an epitope different than that of 18G1.
- 6B3 and its chimeric, veneered and humanized forms bind within residues 1-50 of medin (SEQ ID NO: l).
- reference to 6B3 should be understood as referring to any of the mouse, chimeric, veneered or humanized forms.
- 6B3 binds both full length medin peptide and synthetic lactadherin polypeptide in an ELISA and Western blot and does not bind the human medin C-terminal peptide (SEQ ID NO: 2).
- 6B3 does not bind lactadherin expressed on cells, suggesting that the medin region of lactadherin is likely hidden inside the native lactadherin molecule and only exposed when lactadherin is misfolded or denatured.
- Some antibodies specifically bind monomeric, as well as multimeric and oligomeric forms of medin. Some antibodies specifically bind
- Thioflavin S positive structures such as dense aggregated material or amyloid deposits found in aneurysms (e.g., 6B3), while other antibodies do not (e.g., 18G1).
- Some antibodies specifically bind to loose fibrillar, Thioflavin S negative structures (e.g., 18G1).
- Some antibodies can diffusely stain the tunica media, the region of the aorta that contains the elastin fibers and smooth muscle cells (e.g., 18G1).
- Some antibodies can bind both aneurysm amyloid deposits and Thioflavin S negative loose fibrillar structures in proximity to Thiovlavin S positive structures (e.g., 6B3).
- Some antibodies of the invention bind to the same or overlapping epitope as an antibody designated 6B3 or 18G1.
- Other antibodies having such a binding specificity can be produced by immunizing mice with medin or a portion thereof including the desired epitope, and screening resulting antibodies for binding to medin or fragments thereof, optionally in competition with 6B3 or 18G1.
- Antibodies identified by such assays can then be screened for binding specificity as described in the examples, or otherwise.
- Antibodies can also be screened for differential binding to wild-type medin or fragments thereof compared to mutagenized forms of the medin antigen.
- Mutations can be systematic replacement substitution with alanine (or serine if an alanine is present already) one residue at a time, or more broadly spaced intervals, throughout medin or through a section thereof in which an epitope is known to reside. If the same set of mutations significantly reduces the binding of two antibodies, the two antibodies bind the same epitope.
- Antibodies having the binding specificity of a selected murine antibody can also be produced using a variant of the phage display method. See Winter, WO 92/20791. This method is particularly suitable for producing human antibodies.
- either the heavy or light chain variable region of the selected murine antibody is used as a starting material. If, for example, a light chain variable region is selected as the starting material, a phage library is constructed in which members display the same light chain variable region (i.e., the murine starting material) and a different heavy chain variable region.
- the heavy chain variable regions can for example be obtained from a library of rearranged human heavy chain variable regions.
- a phage showing strong specific binding for medin e.g.
- each phage displays the same heavy chain variable region (i.e., the region identified from the first display library) and a different light chain variable region.
- the light chain variable regions can be obtained for example from a library of rearranged human variable light chain regions. Again, phage showing strong specific binding for medin are selected. The resulting antibodies usually have the same or similar epitope specificity as the murine starting material.
- Kabat CDRs of the heavy chain of 6B3 are designated as follows: (CDR-Hl: residues 6-12 of SEQ ID NO: 12; CDR-H2 SEQ ID NO: 13, CDR-H3: SEQ ID NO: 14); and Kabat CDRs of the light chain of 6B3 are designated SEQ ID NOs: 16-18, respectively.
- Kabat CDRs of the heavy chain of 18G1 are designated as follows: (CDR-Hl: residues 6-10 of SEQ ID NO:4; CDR- H2: SEQ ID NO: 5, CDR-H3: SEQ ID NO:6) and Kabat CDRs of the light chain of 18G1 are designated SEQ ID NOs: 8-10, respectively.
- Kabat/Chothia Composite CDRs of the heavy chain of 6B3 are designated SEQ ID NOs: 12-14, respectively, and Kabat/Chothia Composite CDRs of the light chain of 6B3 are designated SEQ ID NOs: 16-18, respectively.
- Kabat/Chothia Composite CDRs of the heavy chain of 18G1 are designated SEQ ID NOs:4-6, respectively, and Kabat/Chothia Composite CDRs of the light chain of 18G1 are designated SEQ ID NOs 8-10, respectively.
- Table 11 indicates the 18G1 CDRs as defined by Kabat, Chothia, Composite of Chothia and Kabat (also referred to herein as "Kabat/Chothia Composite”), AbM, and Contact.
- Table 12 indicates the 6B3 CDRs as defined by Kabat, Chothia, Composite of Chothia and Kabat (also referred to herein as "Kabat/Chothia Composite”), AbM, and Contact.
- Table 11 18G1 CDRs as defined by Kabat, Chothia, Composite of Chothia and Kabat, AbM, and Contact
- Table 12 6B3 CDRs as defined by Kabat, Chothia, Composite of Chothia and Kabat, AbM, and Contact
- Other antibodies can be obtained by mutagenesis of cDNA encoding the heavy and light chains of an exemplary antibody, such as 6B3 or 18G1.
- Monoclonal antibodies that are at least 70%, 80%, 90%, 95%, 96%, 97%, 98%, or 99% identical to 6B3 or 18G1 in amino acid sequence of the mature heavy and/or light chain variable regions and maintain its functional properties, and/or which differ from the respective antibody by a small number of functionally inconsequential amino acid substitutions (e.g. , conservative substitutions), deletions, or insertions are also included in the invention.
- Monoclonal antibodies having at least 1, 2, 3, 4, 5 and preferably all six CDR(s) as defined by Kabat that are 90%, 95%, 99% or 100% identical to corresponding CDRs of 6B3 or 18G1 are also included.
- the invention also provides antibodies having some or all (e.g., 3, 4, 5, and 6) CDRs entirely or substantially from 6B3 or 18G1.
- Such antibodies can include a heavy chain variable region that has at least two, and usually all three, CDRs entirely or substantially from the heavy chain variable region of 6B3 or 18G1 and/or a light chain variable region having at least two, and usually all three, CDRs entirely or substantially from the light chain variable region of 6B3 or 18G1.
- the antibodies can include both heavy and light chains.
- a CDR is substantially from a corresponding CDR when it contains no more than 4, 3, 2, or 1 substitutions, insertions, or deletions, except that CDRH2 (when defined by Kabat) can have no more than 6, 5, 4, 3, 2, or 1 substitutions, insertions, or deletions.
- Such antibodies can have at least 70%, 80%, 90%, 95%, 96%, 97%, 98%, or 99% identity to 6B3 or 18G1 in the amino acid sequence of the mature heavy and/or light chain variable regions and maintain their functional properties, and/or differ from 6B3 or 18G1 by a small number of functionally inconsequential amino acid substitutions (e.g., conservative substitutions), deletions, or insertions.
- non-human antibodies e.g., murine, guinea pig, primate, rabbit or rat
- medin e.g., murine, guinea pig, primate, rabbit or rat
- medin e.g., murine, guinea pig, primate, rabbit or rat
- medin e.g., murine, guinea pig, primate, rabbit or rat
- medin e.g., murine, guinea pig, primate, rabbit or rat
- Such an immunogen can be obtained from a natural source, by peptide synthesis, or by recombinant expression.
- the immunogen can be administered fused or otherwise complexed with a carrier protein.
- the immunogen can be administered with an adjuvant.
- adjuvant Several types can be used as described below. Complete Freund's adjuvant followed by incomplete adjuvant is preferred for immunization of laboratory animals. Rabbits or guinea pigs are typically used for making polyclonal antibodies. Mice are typically used for making monoclonal antibodies.
- Antibodies are screened for specific binding to medin or desired fragments thereof. Such screening can be accomplished by determining binding of an antibody to a collection of medin variants, and determining which medin variants bind to the antibody. Binding can be assessed, for example, by Western blot, FACS or ELISA.
- a humanized antibody is a genetically engineered antibody in which CDRs from a non- human "donor” antibody are grafted into human “acceptor” antibody sequences (see, e.g. , Queen, US 5,530, 101 and 5,585,089; Winter, US 5,225,539; Carter, US 6,407,213; Adair, US 5,859,205; and Foote, US 6,881,557).
- the acceptor antibody sequences can be, for example, a mature human antibody sequence, a composite of such sequences, a consensus sequence of human antibody sequences, or a germline region sequence.
- a humanized antibody is an antibody having at least three, four, five or all CDRs entirely or substantially from a donor antibody and variable region framework sequences and constant regions, if present, entirely or substantially from human antibody sequences.
- a humanized heavy chain has at least one, two and usually all three CDRs entirely or substantially from a donor antibody heavy chain, and a heavy chain variable region framework sequence and heavy chain constant region, if present, substantially from human heavy chain variable region framework and constant region sequences.
- a humanized light chain has at least one, two and usually all three CDRs entirely or substantially from a donor antibody light chain, and a light chain variable region framework sequence and light chain constant region, if present, substantially from human light chain variable region framework and constant region sequences.
- a humanized antibody comprises a humanized heavy chain and a humanized light chain.
- a CDR in a humanized antibody is substantially from a corresponding CDR in a non-human antibody when at least 85%, 90%, 95% or 100% of corresponding residues (as defined by any conventional definition but preferably defined by Kabat) are identical between the respective CDRs.
- the variable region framework sequences of an antibody chain or the constant region of an antibody chain are substantially from a human variable region framework sequence or human constant region respectively when at least 85%, 90%, 95% or 100% of corresponding residues defined by Kabat are identical.
- humanized antibodies often incorporate all six CDRs (defined by any conventional definition but preferably as defined by Kabat) from a mouse antibody, they can also be made with less than all CDRs (e.g., at least 3, 4, or 5 CDRs) from a mouse antibody (e.g. , Pascalis et al, J. Immunol. 169:3076, 2002; Vajdos et al, J. ofMol. Biol, 320: 415-428, 2002; Iwahashi et al, Mol. Immunol. 36: 1079-1091, 1999; Tamura et al, J. Immunol, 164: 1432-1441, 2000).
- CDRs defined by any conventional definition but preferably as defined by Kabat
- CDR residues not contacting antigen and not in the SDRs can be identified based on previous studies (for example residues H60-H65 in CDR H2 are often not required), from regions of Kabat CDRs lying outside Chothia hypervariable loops (Chothia, J. Mol. Biol. 196:901, 1987), by molecular modeling and/or empirically, or as described in Gonzales et al, Mol. Immunol. 41: 863, 2004.
- the amino acid occupying the position can be an amino acid occupying the corresponding position (by Kabat numbering) in the acceptor antibody sequence.
- the number of such substitutions of acceptor for donor amino acids in the CDRs to include reflects a balance of competing considerations. Such substitutions are potentially advantageous in decreasing the number of mouse amino acids in a humanized antibody and consequently decreasing potential immunogenicity. However, substitutions can also cause changes of affinity, and significant reductions in affinity are preferably avoided. Positions for substitution within CDRs and amino acids to substitute can also be selected empirically.
- the human acceptor antibody sequences can optionally be selected from among the many known human antibody sequences to provide a high degree of sequence identity ⁇ e.g., 65- 85% identity) between a human acceptor sequence variable region frameworks and
- variable region frameworks of a donor antibody chain are corresponding variable region frameworks of a donor antibody chain.
- an acceptor sequence for the heavy chain is the human mature heavy chain variable region with NCBI accession code AAD53863.1 (SEQ ID NO: 25). This acceptor includes CDRs CDR-H1 and CDR-H2 having the same canonical form as mouse 6B3 heavy chain and is a member of Kabat human heavy subgroup 1.
- An example of an acceptor sequence for the light chain is the human mature light chain variable region with NCBI accession code BAC01558.1 (SEQ ID NO: 25). This acceptor has the same canonical classes for CDR-L1 and CDR-L2 as does mouse 6B3.
- BAC01558.1 is a member of Kabat human kappa subgroup 2.
- an acceptor sequence for the heavy chain is the human mature heavy chain variable region with NCBI accession code AAX82494.1 (SEQ ID NO: 33). This acceptor includes CDRs CDR-H1 and CDR-H2 having the same canonical form as mouse 18G1 heavy chain and is a member of Kabat human heavy subgroup 1.
- An example of an acceptor sequence for the light chain is the human mature light chain variable region with NCBI accession code AAD39507.1 (SEQ ID NO: 37). This acceptor has the same canonical classes for CDR-L1 and CDR-L2 as does mouse 18G1.
- AAD39507.1 is a member of Kabat human kappa subgroup 2.
- Certain amino acids from the human variable region framework residues can be selected for substitution based on their possible influence on CDR conformation and/or binding to antigen. Investigation of such possible influences is by modeling, examination of the characteristics of the amino acids at particular locations, or empirical observation of the effects of substitution or mutagenesis of particular amino acids.
- the human framework amino acid when an amino acid differs between a murine variable region framework residue and a selected human variable region framework residue, the human framework amino acid can be substituted by the equivalent framework amino acid from the mouse antibody when it is reasonably expected that the amino acid:
- CDR region e.g. , is within about 6 A of a CDR region
- a CDR region e.g. , identified by modeling the light or heavy chain on the solved structure of a homologous known immunoglobulin chain
- framework residues that are candidates for substitution are residues creating a potential glycosylation site. Still other candidates for substitution are acceptor human framework amino acids that are unusual for a human immunoglobulin at that position. These amino acids can be substituted with amino acids from the equivalent position of the mouse donor antibody or from the equivalent positions of more typical human immunoglobulins.
- exemplary humanized antibodies with N-terminal glutamine to glutamate substitutions are Hu6B3VHv2 (SEQ ID NO:27), Hu6B3VHv3 (SEQ DI NO:28), and Hul8GlVHv2 (SEQ ID NO:39).
- Exemplary humanized antibodies are humanized forms of the mouse medin antibodies, designated 6B3 and 18G1.
- the mouse 6B3 antibody comprises mature heavy and light chain variable regions having amino acid sequences comprising SEQ ID NO: 11 and SEQ ID NO: 29, respectively.
- the mouse 18G1 antibody comprises mature heavy and light chain variable regions having amino acid sequences comprising SEQ ID NO: 3 and SEQ ID NO:36, respectively.
- Exemplary humanized antibodies are humanized forms of the mouse 6B3 or 18G1 antibodies, designated Hu6B3 or Hul8Gl, respectively.
- the mouse antibody 6B3 comprises mature heavy and light chain variable regions having amino acid sequences comprising SEQ ID NO: 11 and SEQ ID NO:29, respectively.
- the invention provides three exemplified humanized mature heavy chain variable regions:
- Hu6B3VHvl (SEQ ID NO: 26), Hu6B3VHv2 (SEQ ID NO: 27), and Hu6B3VHv3 (SEQ ID NO: 28).
- the invention further provides two exemplified human mature light chain variable regions: Hu6B3VLvl (SEQ ID NO: 31) and Hu6B3VLv2 (SEQ ID NO: 32)
- Figures 7 and 8 show alignments of the heavy chain variable region and light chain variable region, respectively, of mouse 6B3, human acceptor antibody, and various humanized antibodies.
- the mouse antibody 18G1 comprises mature heavy and light chain variable regions having amino acid sequences comprising SEQ ID NO: 3 and SEQ ID NO:36, respectively.
- the invention provides two exemplified humanized mature heavy chain variable regions:
- Hul8GlVHvl SEQ ID NO: 34
- Hul8GlVHv2 SEQ ID NO: 35
- the invention further provides two exemplified human mature light chain variable regions: Hul8GlVLvl (SEQ ID NO: 38) and Hul8GlVLv2 (SEQ ID NO: 39).
- Figures 9 and 10 show alignments of the heavy chain variable region and light chain variable region, respectively, of mouse 18G1, human acceptor antibody, and various humanized antibodies.
- variable region framework positions were considered as candidates for substitutions in the two exemplified Hu6B3 mature light chain variable regions and the three exemplified Hu6B3 mature heavy chain variable regions, as further specified in the examples: L71 (F71Y), L87 (Y87F), L100 (G100Q), L104 (V104L), HI (Q1E), H3 (T3Q), H5 (K5Q), H10 (A10G), H15 (T15S), H19 (T19S), H44 (A44G), H48 (L48I), H49 (A49G), H67 (L67V), H78 (V78F), H79 (V79S), H81 (T81K), H82 (M82L), H82a (T82aS) , H82b (N82bS), H82c (M82cV), H83 (D83T), H84 (P84A), H85 (V85A), H89 (T89V), and H
- variable region framework positions were considered as candidates for substitutions in the two exemplified Hul8Gl mature light chain variable regions and the two exemplified Hul8Gl mature heavy chain variable regions, as further specified in the examples: L3 (Q3V), L10 (F10S), L13 (A13V), L15 (V15P), L19 (V19A), L20 (T20S), L22 (T22S), L42 (K42Q), L45 (K45Q), L60 (S60D), L70 (E70D), L77 (S77R), L78 (L78V), L80 (P80A), L83 (F83L), L85 (T85V), HI (Q1E), H5 (Q5V), H13 (K13Q), H19 (K19R), H40 (T40A), H42 (D42G), H44 (R44G), H49 (A49S), H77 (T77S), H82a (S82aN), H83 (K83R), H84 (
- the first-mentioned residue is the residue of a humanized antibody formed by grafting Kabat CDRs or a Chothia-Kabat Composite CDR in the case of CDR-Hl into a human acceptor framework, and the second-mentioned residue is a residue being considered for replacing such residue.
- the first mentioned residue is human
- the first mentioned residue is mouse.
- Exemplified Hu6B3 antibodies include any permutations or combinations of the exemplified mature heavy and light chain variable regions (e.g., VHvl/VLvl or H1L1,
- VHvl/VLv2 or H1L2 VHv2/VLvl or H2L1, VHv2/VLv2 or H2L2, VHv3/VLvl or H3L1, VHv3/VLv2 or H3L2).
- the invention provides variants of humanized 6B3 antibodies in which the humanized mature heavy chain variable region shows at least 90%, 95%, 96%, 97%, 98%, or 99% identity to any one of Hu6B3VHvl, Hu6B3VHv2and Hu6B3VHv3 (SEQ ID NO: 26-28) and the humanized mature light chain variable region shows at least 90%, 95%, 96%, 97%, 98%, or 99% identity to Hu6B3VLvl or Hu6B3VLv2 (SEQ ID NO: 31-32).
- H3 is occupied by Q
- H5 is occupied by Q
- H10 is occupied by G
- H15 is occupied by S
- H19 is occupied by S.
- positions H3, H5, H10, HI 5, and H19 in the VH region are occupied by, Q, Q, G, S, and S respectively
- at least one of positions in the VH region is occupied by the amino acid as specified: position: HI is occupied by E or Q, H44 is occupied by G, H48 is occupied by I or L, H49 is occupied by G or A, H67 is occupied by V or L, H78 is occupied by F or V, H79 is occupied by S or V, H81 is occupied by K or T, H82 is occupied by L or M, H82a is occupied by S or T, H82b is occupied by S or N, H82c is occupied by V or M, H83 is occupied by T or D, H84 is occupied by A or P, H85 is occupied by A or V, H89 is occupied by V or T, HI 08 is occupied by T or L, L71 is occupied by Y or F, L87
- HI is occupied by E or Q
- H35 is occupied by G
- H35b is occupied by G
- H44 is occupied by G or A
- H48 is occupied by I or L
- H49 is occupied by G or A
- H50 is occupied by H
- H58 is occupied by Y
- H60 is occupied by N
- H61 is occupied by I
- H62 is occupied by A
- H65 is occupied by N
- H67 is occupied by V or L
- H78 is occupied by F or V
- H79 is occupied by S or V
- H81 is occupied by K or T
- H82 is occupied by L or M
- H82a is occupied by S or T
- H82b is occupied by S or N
- H82c is occupied by V or M
- H83 is occupied by T or D
- H84 is occupied by A or P
- H85 is occupied by A or V
- H85 is occupied by A or V
- positions HI, H44, H79, H81, H82, H82b, H82c, H83, H84, H85, and H89 in the VH region are occupied by, E, G, S, K, L, S, V, T, A, A, and V, respectively.
- positions H3, H5, H10, H15, and H19 in the VH region are occupied by, Q, Q, G, S, and S respectively as in Hu6B3VHvl.
- positions HI, H3, H5, H10, H15, H19, H44, H79, H81, H82, H82b, H82c, H83, H84, H85, H89 in the VH region are occupied by, E, Q, Q, G, S, S, G, S, K, L, S, V, T, A, A, and V, respectively, as in Hu6B3VHv2.
- positions HI, H3, H5, H10, H15, H19, H44, H48, H49, H67, H78, H79, H81, H82, H82a, H82b, H82c, H83, H84, H85, H89, and H108 in the VH region are occupied by E, Q, Q, G, S, S, G, I, G, V, F, S, K, L, S, S, V, T, A, A, V, and T, respectively, as in Hu6B3VHv3.
- positions L71, L87, LlOO, and L104 in the VL region are occupied by Y, F, Q, and L, respectively, as in Hu6B3VLv2.
- the CDR regions of such humanized antibodies can be identical or substantially identical to the CDR regions of 6B3 mouse donor antibody.
- the CDR regions can be defined by any conventional definition (e.g., Chothia, or composite of Chothia and Kabat) but are preferably as defined by Kabat.
- Variable regions framework positions are in accordance with Kabat numbering unless otherwise stated. Other such variants typically differ from the sequences of the exemplified Hu6B3 heavy and light chains by a small number (e.g., typically no more than 1, 2, 3, 5, 10, or 15) of replacements, deletions or insertions. Such differences are usually in the framework but can also occur in the CDRs. ,
- Exemplified Hul8Gl antibodies include any permutations or combinations of the exemplified mature heavy and light chain variable regions (e.g., VHvl/VLvl or H1L1,
- the invention provides variants of humanized 18G1 antibodies in which the humanized mature heavy chain variable region shows at least 90%, 95%, 96%, 97%, 98%, or 99% identity to Hul8GlVHvl or 18GlVHv2 (SEQ ID NO: 34-35) and the humanized mature light chain variable region shows at least 90%, 95%, 96%, 97%, 98%, or 99% identity to
- Hul8GlVLvl or Hul8GlVLv2 (SEQ ID NO: 38-39).
- SEQ ID NO: 38-39 In some such antibodies at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, or all 31 of the backmutations or other mutations found in SEQ ID NO:34-35 and SEQ ID NO:38-39 are retained. .
- At least one of the following positions in the VL region is occupied by the amino acid as specified: position L3 is occupied by V, position L10 is occupied by S, position LI 3 is occupied by V, position LI 5 is occupied by P, position LI 9 is occupied by A, position L20 is occupied by S, position L22 is occupied by S, position L42 is occupied by Q, position L70 is occupied by D, position L77 is occupied by R, position L78 is occupied by V, position L80 is occupied by A, and position L85 is occupied by V.
- positions are occupied by the amino acid as specified: position L3 is occupied by V, position L10 is occupied by S, position LI 3 is occupied by V, position LI 5 is occupied by P, position LI 9 is occupied by A, position L20 is occupied by S, position L22 is occupied by S, position L24 is occupied by K, position L28 is occupied by N, position L29 is occupied by V, position L42 is occupied by Q, position L46 is occupied by L, position L70 is occupied by D, position L77 is occupied by R, position L78 is occupied by V, position L80 is occupied by A, and position L85 is occupied by V.
- positions L3, L10, L13, L15, L19, L20, L22, L42, L70, L77, L78, L80, and L85 in the VL region are occupied by V, S, V, P, A, S, S, Q, D, R, V, A, and V, respectively.
- At least one of the following positions is occupied by the amino acid as specified: HI is occupied by E or Q, position H5 is occupied by V or Q, position H13 is occupied Q or K, position H19 is occupied R or K, position H40 is occupied by A or T, position H42 is occupied by G or D, position H44 is occupied G or R, position H49 is occupied by S or A, position H77 is occupied by S or T, position H82a is occupied by N or S, position H83 is occupied by R or K, position H84 is occupied by A or S, position H89 is occupied by V or M, position H108 is occupied by T or M, position L45 is occupied by Q, position L60 is occupied by D, and position L83 is occupied by L.
- HI is occupied by E or Q
- position H5 is occupied by V or Q
- position H13 is occupied Q or K
- position H19 is occupied R or K
- position H40 is occupied by A or T
- position H42 is occupied by G or D
- position H44 is occupied G or R
- position H49 is occupied by S or A
- position H50 is occupied by G
- position H63 is occupied by T
- position H77 is occupied by S or T
- position H82a is occupied by N or S
- position H83 is occupied by R
- position H84 is occupied by A
- position H89 is occupied by V or M
- H93 is occupied by V or A
- position H108 is occupied by T or M.
- positions L45, L60, and L83 in the VL region is occupied by Q, D, and L, respectively:.
- positions HI, H5, H13, H19, H40, H42, H44, H49, H77, H82a, H83, H84, H89, H93, and H108 in the VH region are occupied by,E, V, Q, R, A, G, G, S, S, N, R, A, V, V, and T, respectively, as in Hul8GlVHv2.
- positions L3, L10, L13, L15, L19, L20, L22, L42, L45, L70, L77, L78, L80, and L85 in the VL region are occupied by, V, S, V, P, A, S, S, Q, Q, D, R, V, A, and V respectively, as in Hul8GlVLvl.
- positions L3, L10, L13, L15, L19, L20, L22, L42, L60, L70, L77, L78, L80, L83, and L85 in the VL region are occupied by, V, S, V, P, A, S, S, Q, D, D, R, V, A, L, and V, respectively, as in Hul8GlVLv2.
- the CDR regions of such humanized antibodies can be identical or substantially identical to the CDR regions of 18G1 mouse donor antibody.
- the CDR regions can be defined by any conventional definition (e.g., Chothia, or composite of Chothia and Kabat) but are preferably as defined by Kabat.
- Variable regions framework positions are in accordance with Kabat numbering unless otherwise stated. Other such variants typically differ from the sequences of the exemplified Hul8Gl heavy and light chains by a small number (e.g., typically no more than 1, 2, 3, 5, 10, or 15) of replacements, deletions or insertions. Such differences are usually in the framework but can also occur in the CDRs. ,
- variable region frameworks A possibility for additional variation in humanized 6B3 or 18G1 variants is additional backmutations in the variable region frameworks.
- Many of the framework residues not in contact with the CDRs in the humanized mAb can accommodate substitutions of amino acids from the corresponding positions of the donor mouse mAb or other mouse or human antibodies, and even many potential CDR-contact residues are also amenable to substitution.
- Even amino acids within the CDRs may be altered, for example, with residues found at the corresponding position of the human acceptor sequence used to supply variable region frameworks.
- alternate human acceptor sequences can be used, for example, for the heavy and/or light chain.
- the potency in some or all of the assays described in the present examples of the variant humanized 6B3 or 18G1 antibody is essentially the same, i.e., within experimental error, as that of murine 6B3 or 18G1 antibody.
- the invention further provides chimeric and veneered forms of non-human antibodies, particularly the medin antibodies of the examples.
- a chimeric antibody is an antibody in which the mature variable regions of light and heavy chains of a non-human antibody (e.g., a mouse) are combined with human light and heavy chain constant regions. Such antibodies substantially or entirely retain the binding specificity of the mouse antibody, and are about two-thirds human sequence.
- a veneered antibody is a type of humanized antibody that retains some and usually all of the CDRs and some of the non-human variable region framework residues of a non-human antibody but replaces other variable region framework residues that may contribute to B- or T- cell epitopes, for example exposed residues (Padlan, Mol. Immunol. 28:489, 1991) with residues from the corresponding positions of a human antibody sequence.
- the result is an antibody in which the CDRs are entirely or substantially from a non-human antibody and the variable region frameworks of the non-human antibody are made more human-like by the substitutions.
- Veneered forms of the 6B3 and 18G1 antibodies are included in the invention.
- Human antibodies against medin are provided by a variety of techniques described below. Some human antibodies are selected by competitive binding experiments, by the phage display method of Winter, above, or otherwise, to have the same epitope specificity as a particular mouse antibody, such as one of the mouse monoclonal antibodies described in the examples. Human antibodies can also be screened for a particular epitope specificity by using only a fragment of medin, such as a C-terminal fragment of medin. [00193] Methods for producing human antibodies include the trioma method of Oestberg et al, Hybridoma 2:361-367 (1983); Oestberg, U.S. Patent No.
- the heavy and light chain variable regions of chimeric, veneered or humanized antibodies can be linked to at least a portion of a human constant region.
- the choice of constant region depends, in part, whether antibody-dependent cell-mediated cytotoxicity, antibody dependent cellular phagocytosis and/or complement dependent cytotoxicity are desired.
- human isotypes IgGl and IgG3 have complement-dependent cytotoxicity and human isotypes IgG2 and IgG4 do not.
- Human IgGl and IgG3 also induce stronger cell mediated effector functions than human IgG2 and IgG4.
- Light chain constant regions can be lambda or kappa. Numbering conventions for constant regions include EU numbering (Edelman, G.M.
- One or several amino acids at the amino or carboxy terminus of the light and/or heavy chain may be missing or derivatized in a proportion or all of the molecules. Substitutions can be made in the constant regions to reduce or increase effector function such as complement- mediated cytotoxicity or ADCC ⁇ see, e.g., Winter et al, US Patent No. 5,624,821; Tso et al, US Patent No. 5,834,597; and Lazar et al, Proc. Natl. Acad. Sci. USA 103:4005, 2006), or to prolong half- life in humans ⁇ see, e.g., Hinton et ah, J. Biol. Chem.
- Exemplary substitutions include a Gin at position 250 and/or a Leu at position 428 (EU numbering is used in this paragraph for the constant region) for increasing the half- life of an antibody.
- Substitution at any or all of positions 234, 235, 236 and/or 237 reduce affinity for Fey receptors, particularly FcyRI receptor ⁇ see, e.g., US 6,624,821).
- An alanine substitution at positions 234, 235, and 237 of human IgGl can be used for reducing effector functions.
- Some antibodies have alanine substitution at positions 234, 235 and 237 of human IgGl for reducing effector functions.
- positions 234, 236 and/or 237 in human IgG2 are substituted with alanine and position 235 with glutamine ⁇ see, e.g., US 5,624,821).
- a mutation at one or more of positions 241, 264, 265, 270, 296, 297, 322, 329, and 331 by EU numbering of human IgGl is used.
- a mutation at one or more of positions 318, 320, and 322 by EU numbering of human IgGl is used.
- positions 234 and/or 235 are substituted with alanine and/or position 329 is substituted with glycine.
- positions 234 and 235 are substituted with alanine.
- the isotype is human IgG2 or IgG4.
- Antibodies can be expressed as tetramers containing two light and two heavy chains, as separate heavy chains, light chains, as Fab, Fab', F(ab')2, and Fv, or as single chain antibodies in which heavy and light chain mature variable domains are linked through a spacer.
- Human constant regions show allotypic variation and isoallotypic variation between different individuals, that is, the constant regions can differ in different individuals at one or more polymorphic positions.
- Isoallotypes differ from allotypes in that sera recognizing an isoallotype bind to a non-polymorphic region of a one or more other isotypes.
- another heavy chain constant region is of IgGl Glm3with or without the C-terminal lysine.
- Reference to a human constant region includes a constant region with any natural allotype or any permutation of residues occupying positions in natural allotypes.
- a number of methods are known for producing chimeric and humanized antibodies using an antibody-expressing cell line ⁇ e.g., hybridoma).
- the immunoglobulin variable regions of antibodies can be cloned and sequenced using well known methods.
- the heavy chain variable VH region is cloned by RT-PCR using mRNA prepared from hybridoma cells. Consensus primers are employed to the VH region leader peptide
- sequences from multiple, independently derived clones can be compared to ensure no changes are introduced during amplification.
- sequence of the VH region can also be determined or confirmed by sequencing a VH fragment obtained by 5' RACE RT-PCR methodology and the 3' g2b specific primer.
- the light chain variable VL region can be cloned in an analogous manner.
- a consensus primer set is designed for amplification of VL regions using a 5' primer designed to hybridize to the VL region encompassing the translation initiation codon and a 3' primer specific for the Ck region downstream of the V-J joining region.
- 5'RACE RT-PCR methodology is employed to clone a VL encoding cDNA. Exemplary primers are described in Schenk, supra. The cloned sequences are then combined with sequences encoding human (or other non-human species) constant regions.
- the heavy and light chain variable regions are re-engineered to encode splice donor sequences downstream of the respective VDJ or VJ junctions and are cloned into a mammalian expression vector, such as pCMV-hyl for the heavy chain and pCMV-Mcl for the light chain. These vectors encode human ⁇ and Ck constant regions as exonic fragments downstream of the inserted variable region cassette.
- the heavy chain and light chain expression vectors can be co-transfected into CHO cells to produce chimeric antibodies. Conditioned media is collected 48 hours post-transfection and assayed by western blot analysis for antibody production or ELISA for antigen binding.
- the chimeric antibodies are humanized as described above.
- Chimeric, veneered, humanized, and human antibodies are typically produced by recombinant expression.
- Recombinant polynucleotide constructs typically include an expression control sequence operably linked to the coding sequences of antibody chains, including naturally associated or heterologous expression control elements, such as a promoter.
- the expression control sequences can be promoter systems in vectors capable of transforming or transfecting eukaryotic or prokaryotic host cells. Once the vector has been incorporated into the appropriate host, the host is maintained under conditions suitable for high level expression of the nucleotide sequences and the collection and purification of the crossreacting antibodies.
- expression vectors are typically replicable in the host organisms either as episomes or as an integral part of the host chromosomal DNA. Commonly, expression vectors contain selection markers, e.g., ampicillin resistance or hygromycin resistance, to permit detection of those cells transformed with the desired DNA sequences.
- selection markers e.g., ampicillin resistance or hygromycin resistance
- E. coli is one prokaryotic host useful for expressing antibodies, particularly antibody fragments.
- Microbes such as yeast, are also useful for expression.
- Saccharomyces is a yeast host with suitable vectors having expression control sequences, an origin of replication, termination sequences, and the like as desired.
- Typical promoters include 3-phosphoglycerate kinase and other glycolytic enzymes.
- Inducible yeast promoters include, among others, promoters from alcohol dehydrogenase, isocytochrome C, and enzymes responsible for maltose and galactose utilization.
- Mammalian cells can be used for expressing nucleotide segments encoding immunoglobulins or fragments thereof. See Winnacker, From Genes to Clones, (VCH
- suitable host cell lines capable of secreting intact heterologous proteins have been developed, and include CHO cell lines, various COS cell lines, HeLa cells, HEK293 cells, L cells, and non-antibody-producing myelomas including Sp2/0 and NS0.
- the cells can be nonhuman.
- Expression vectors for these cells can include expression control sequences, such as an origin of replication, a promoter, an enhancer (Queen et ah, Immunol. Rev. 89:49 (1986)), and necessary processing information sites, such as ribosome binding sites, RNA splice sites, polyadenylation sites, and transcriptional terminator sequences.
- Expression control sequences can include promoters derived from endogenous genes, cytomegalovirus, SV40, adenovirus, bovine papillomavirus, and the like. See Co et al., J.
- antibody coding sequences can be incorporated in transgenes for introduction into the genome of a transgenic animal and subsequent expression in the milk of the transgenic animal (see, e.g., U.S. Pat. No. 5,741,957; U.S. Pat. No. 5,304,489; and U.S. Pat. No. 5,849,992).
- Suitable transgenes include coding sequences for light and/or heavy chains operably linked with a promoter and enhancer from a mammary gland specific gene, such as casein or beta lactoglobulin.
- the vectors containing the DNA segments of interest can be transferred into the host cell by methods depending on the type of cellular host. For example, calcium chloride transfection is commonly utilized for prokaryotic cells, whereas calcium phosphate treatment, electroporation, lipofection, biolistics, or viral-based transfection can be used for other cellular hosts. Other methods used to transform mammalian cells include the use of polybrene, protoplast fusion, liposomes, electroporation, and microinjection. For production of transgenic animals, transgenes can be microinjected into fertilized oocytes or can be incorporated into the genome of embryonic stem cells, and the nuclei of such cells transferred into enucleated oocytes.
- cell pools can be screened for growth productivity and product quality in serum- free media. Top-producing cell pools can then be subjected of FACS-based single-cell cloning to generate monoclonal lines. Specific productivities above 50 pg or 100 pg per cell per day, which correspond to product titers of greater than 7.5 g/L culture, can be used. Antibodies produced by single cell clones can also be tested for turbidity, filtration properties, PAGE, IEF, UV scan, HP- SEC, carbohydrate-oligo saccharide mapping, mass spectrometry, and binding assay, such as ELISA or Biacore. A selected clone can then be banked in multiple vials and stored frozen for subsequent use.
- antibodies can be purified according to standard procedures of the art, including protein A capture, HPLC purification, column chromatography, gel electrophoresis and the like ⁇ see generally, Scopes, Protein Purification (Springer- Verlag, NY, 1982)).
- Methodology for commercial production of antibodies can be employed, including codon optimization, selection of promoters, selection of transcription elements, selection of terminators, serum- free single cell cloning, cell banking, use of selection markers for
- Antibodies can be subject to several screens including binding assays, functional screens, screens in animal models of diseases associated with medin, and clinical trials. Binding assays test for specific binding and, optionally, affinity and epitope specificity to medin (or a fragment thereof, such as amino acid residues 44-50 of SEQ ID NO: 1). Such screens are sometimes performed in competition with an exemplary antibody, such as 6B3 or 18G1.
- either the antibody or medin target is immobilized in such assay.
- Animal model screens test the ability of the antibody to therapeutically or prophylactically treat signs or symptoms in an animal model simulating a human disease associated with medin, such as a murine model of thoracic aortic aneurysms, such as that created by abluminal application of CaCl 2 to 129/SvE mice (Ikonomidis et al., J Surg Res. 115: 157- 163 (2003)) or a porcine model of thoracic aortic aneurysm, such as that created through intra- adventitial injections of collagenase and periadventitial application of crystalline CaCl 2
- a human disease associated with medin such as a murine model of thoracic aortic aneurysms, such as that created by abluminal application of CaCl 2 to 129/SvE mice (Ikonomidis et al., J Surg Res. 115: 157- 163 (2003)) or a porcine model of t
- aortic structural changes such as elastic lamellar degradation and decreased collagen content can be assessed by magnetic resonance imaging (MRI), as well as biochemical and histological measurements.
- MRI magnetic resonance imaging
- chimeric antibodies having a constant region appropriate for the animal model can be used (e.g. , mouse-rat chimeras could be used for testing antibodies in rats). It can be concluded that a humanized version of an antibody will be effective if the corresponding mouse antibody or chimeric antibody is effective in an appropriate animal model and the humanized antibody has similar binding affinity (e.g. , within experimental error, such as by a factor of 1.5, 2, or 3).
- Clinical trials test for safety and efficacy in a human having a disease associated with medin.
- the invention further provides nucleic acids encoding any of the heavy and light chains described above (e.g., SEQ ID NOs: 3, 36, 11 and 29).
- nucleic acids further encode a signal peptide and can be expressed with the signal peptide linked to the constant region.
- Coding sequences of nucleic acids can be operably linked with regulatory sequences to ensure expression of the coding sequences, such as a promoter, enhancer, ribosome binding site, transcription termination signal, and the like.
- the nucleic acids encoding heavy and light chains can occur in isolated form or can be cloned into one or more vectors.
- the nucleic acids can be synthesized by, for example, solid state synthesis or PCR of overlapping
- Nucleic acids encoding heavy and light chains can be joined as one contiguous nucleic acid, e.g., within an expression vector, or can be separate, e.g., each cloned into its own expression vector.
- Conjugated antibodies that specifically bind to antigens, such as medin are useful in aortic aneurysms, marfan syndrome, pancreatitis, Alzheimer's disease and obesity.
- antigens such as medin
- such antibodies can be conjugated with other therapeutic moieties, other proteins, other antibodies, and/or detectable labels.
- therapeutic moieties can be any agent that can be used to treat, combat, ameliorate, prevent, or improve an unwanted condition or disease in a patient, such as aortic aneurysms, marfan syndrome, pancreatitis, Alzheimer's disease and obesity.
- Therapeutic moieties can include cytotoxic agents, cytostatic agents, radiotherapeutic agents, immunomodulators, or any biologically active agents that facilitate or enhance the activity of the antibody.
- a cytotoxic agent can be any agent that is toxic to a cell.
- a cytostatic agent can be any agent that inhibits cell proliferation.
- An immunomodulator can be any agent that stimulates or inhibits the development or maintenance of an immunologic response.
- a radiotherapeutic agent can be any molecule or compound that emits radiation. If such therapeutic moieties are coupled to a tumor- specific antibody, such as the antibodies described herein, the coupled therapeutic moieties will have a specific affinity for tumor cells or cancer cells over normal cells. Consequently, administration of the conjugated antibodies directly targets cancer cells with minimal damage to surrounding normal, healthy tissue. This can be particularly useful for therapeutic moieties that are too toxic to be
- ricin a cellular toxin derived from plants
- S-acetylmercaptosuccinic anhydride for the antibody
- succinimidyl 3-(2-pyridyldithio) propionate for ricin.
- saporin an inhibitor of ribosomal assembly
- saporin an inhibitor of ribosomal assembly
- radioisotopes examples include, for example, yttrium 90 (90Y), indium 111 (l l lln), 131 I, "mTc, radiosilver-111, radiosilver-199, and Bismuth 213 .
- Linkage of radioisotopes to antibodies may be performed with conventional bifunction chelates.
- sulfur-based linkers may be used for radio silver- 111 and radiosilver-199 linkage. See Hazra et al., Cell Biophys. 24-25: 1-7 (1994). Linkage of silver radioisotopes may involve reducing the immunoglobulin with ascorbic acid.
- ibritumomab tiuxetan For radioisotopes such as 11 lln and 90Y, ibritumomab tiuxetan can be used and will react with such isotopes to form 11 lln- ibritumomab tiuxetan and 90Y-ibritumomab tiuxetan, respectively. See Witzig, Cancer Chemother. Pharmacol, 48 Suppl LS91-S95 (2001).
- antibodies can be linked to other therapeutic moieties.
- therapeutic moieties can be, for example, cytotoxic or cytostatic.
- antibodies can be conjugated with toxic chemotherapeutic drugs such as maytansine, geldanamycin, tubulin inhibitors such as tubulin binding agents ⁇ e.g., auristatins), or minor groove binding agents such as calicheamicin.
- Antibodies can also be coupled with other proteins or peptides.
- antibodies can be coupled with Fynomers.
- Fynomers are small binding proteins ⁇ e.g., 7 kDa) derived from the human Fyn SH3 domain. They can be stable and soluble, and they can lack cysteine residues and disulfide bonds.
- Fynomers can be engineered to bind to target molecules with the same affinity and specificity as antibodies. They are suitable for creating multi- specific fusion proteins based on antibodies. For example, Fynomers can be fused to N-terminal and/or C-terminal ends of antibodies to create bi- and tri-specific FynomAbs with different
- Fynomers can be selected using Fynomer libraries through screening technologies using FACS, Biacore, and cell-based assays that allow efficient selection of Fynomers with optimal properties. Examples of Fynomers are disclosed in Grabulovski et al., J. Biol. Chem. 282:3196-3204 (2007); Bertschinger et al, Protein Eng. Des. Sel. 20:57-68 (2007); Schlatter et al, MAbs. 4:497-508 (2011); Banner et al., Acta. Crystallogr. D. Biol. Crystallogr.
- the antibodies disclosed herein can also be coupled or conjugated to one or more other antibodies ⁇ e.g., to form antibody heteroconjugates). Such other antibodies can bind to different epitopes within medin or can bind to a different target antigen.
- Antibodies can also be coupled with a detectable label. Such antibodies can be used, for example, for diagnosing the reduction of elasticity or increase in thickening of the vessel wall, for monitoring propensity for an aortic aneurysm, and/or for assessing efficacy of treatment. Such antibodies are particularly useful for performing such determinations in subjects having or being susceptible to aortic aneurysms, or in appropriate biological samples obtained from such subjects.
- Representative detectable labels that may be coupled or linked to a medin antibody include various enzymes, such as horseradish peroxidase, alkaline phosphatase, beta- galactosidase, or acetylcholinesterase; prosthetic groups, such streptavidin/biotin and
- fluorescent materials such as umbelliferone, fluorescein, fluorescein
- nonradioactive paramagnetic metal ions and molecules that are radio labelled or conjugated to specific radioisotopes.
- Linkage of radioisotopes to antibodies may be performed with conventional bifunction chelates.
- sulfur-based linkers may be used for radiosilver-111 and radiosilver-199 linkage. See Hazra et al., Cell Biophys. 24-25: 1-7 (1994).
- Linkage of silver radioisotopes may involve reducing the immunoglobulin with ascorbic acid.
- ibritumomab tiuxetan For radioisotopes such as m In and 90 Y, ibritumomab tiuxetan can be used and will react with such isotopes to form m In- ibritumomab tiuxetan and 90 Y-ibritumomab tiuxetan, respectively. See Witzig, Cancer
- Therapeutic moieties, other proteins, other antibodies, and/or detectable labels may be coupled or conjugated, directly or indirectly through an intermediate (e.g., a linker), to a murine, chimeric, veneered, or humanized medin antibody using techniques known in the art. See e.g., Arnon et al., "Monoclonal Antibodies For Immunotargeting Of Drugs In Cancer Therapy," in Monoclonal Antibodies And Cancer Therapy, Reisfeld et al. (eds.), pp. 243-56 (Alan R. Liss, Inc. 1985); Hellstrom et al., "Antibodies For Drug Delivery,” in Controlled Drug Delivery (2nd Ed.), Robinson et al.
- an intermediate e.g., a linker
- Suitable linkers include, for example, cleavable and non-cleavable linkers. Different linkers that release the coupled therapeutic moieties, proteins, antibodies, and/or detectable labels under acidic or reducing conditions, on exposure to specific proteases, or under other defined conditions can be employed.
- the above antibodies can be used for treating or effecting prophylaxis of a disease in a patient having or at risk for the disease mediated at least in part by medin.
- the antibody may reduce the degradation of elasticity and/or reduce the deposition of aortic medial amyloid.
- Antibody-drug conjugates can have additional mechanisms of action including the cytotoxic or cytostatic effect of the linked agent, typically after uptake within a cancer cell. Antibody-drug conjugates may also induce tumor-associated macrophage toxicity.
- Antibodies are administered in an effective regime meaning a dosage, route of administration and frequency of administration that delays the onset, reduces the severity, inhibits further deterioration, and/or ameliorates at least one sign or symptom of a disorder being treated.
- the regime can be referred to as a therapeutically effective regime.
- the patient is at elevated risk of the disorder relative to the general population but is not yet experiencing symptoms, the regime can be referred to as a prophylactically effective regime.
- therapeutic or prophylactic efficacy can be observed in an individual patient relative to historical controls or past experience in the same patient.
- therapeutic or prophylactic efficacy can be demonstrated in a preclinical or clinical trial in a population of treated patients relative to a control population of untreated patients.
- Exemplary dosages for an antibody are 0.1-20 mg/kg body weight, or 0.5-5 mg/kg body weight (e.g., 0.5, 1, 2, 3, 4 or 5 mg/kg) or 10-1500 mg as a fixed dosage.
- the dosage depends on the condition of the patient and response to prior treatment, if any, whether the treatment is prophylactic or therapeutic and whether the disorder is acute or chronic, among other factors.
- Administration can be parenteral, intravenous, oral, subcutaneous, intra- arterial, intracranial, intrathecal, intraperitoneal, topical, intranasal or intramuscular.
- Some antibodies can be administered into the systemic circulation by intravenous or subcutaneous administration.
- Intravenous administration can be, for example, by infusion over a period such as 30-90 min.
- the frequency of administration depends on the half-life of the antibody in the circulation, the condition of the patient and the route of administration among other factors.
- the frequency can be daily, weekly, monthly, quarterly, or at irregular intervals in response to changes in the patient's condition or progression of the disorder being treated.
- An exemplary frequency for intravenous administration is between weekly and quarterly over a continuous cause of treatment, although more or less frequent dosing is also possible.
- an exemplary dosing frequency is daily to monthly, although more or less frequent dosing is also possible.
- the number of dosages administered depends on whether the disorder is acute or chronic and the response of the disorder to the treatment. For acute disorders or acute exacerbations of a chronic disorder, between 1 and 10 doses are often sufficient. Sometimes a single bolus dose, optionally in divided form, is sufficient for an acute disorder or acute exacerbation of a chronic disorder. Treatment can be repeated for recurrence of an acute disorder or acute exacerbation. For chronic disorders, an antibody can be administered at regular intervals, e.g. , weekly, fortnightly, monthly, quarterly, every six months for at least 1, 5 or 10 years, or the life of the patient.
- aortic aneurysm diseases that weaken the layers of the aortic wall and increase the risk of thoracic aortic aneurysms, including Marfan syndrome, Loeys-Dietz and other familial connective tissue disorders, other non-specific connective tissue disorders (characterized by a family history of aneurysms), presence of a bicuspid aortic valve, infections, inflammatory disease, and other diseases such as pancreatitis, Alzheimer's disease, lupus, obesity).
- Antibodies described above can be incorporated into a pharmaceutical composition for use in such methods.
- an antibody or pharmaceutical composition containing an antibody is administered to a subject in need thereof.
- Patients amenable to treatment include individuals at risk of a disease associated with medin but not showing symptoms, as well as patients presently showing symptoms. Therefore, the
- compositions can be administered prophylactically to individuals who have a known genetic risk of aortic aneurysm, e.g. subjects with Marfan syndrome. Such individuals include those having relatives who have experienced such a disease, and those whose risk is determined by analysis of genetic or biochemical markers.
- the identification of the subject can occur in a clinical setting, or elsewhere, such as in the subject's home, for example, through the subject's own use of a self-testing kit.
- treatment can begin at any age (e.g. , 10, 20, 30, 40, 50, 60, or 70 years of age). Usually, however, it is not necessary to begin treatment until a patient reaches 40, 50, 60 or 70.
- Treatment typically entails multiple dosages over a period of time and can be monitored by assaying antibody or activated T-cell or B-cell responses to a therapeutic agent (e.g. , a truncated form of medin) over time. If the response falls, a booster dosage is indicated.
- a therapeutic agent e.g. , a truncated form of medin
- thoracic aortic aneurysms often go unnoticed because patients rarely feel any symptoms, possible warning signs include pain in the jaw, neck and upper back, chest or back pain, coughing, hoarseness or difficulty breathing.
- the subject can be identified using imaging techniques, such as MRI or imaging using antibodies that specifically bind medin may be available in the future.
- an antibody or a pharmaceutical composition of the same is administered to a subject susceptible to, or otherwise at risk of a disease in a regime (dose, frequency and route of administration) effective to reduce the risk, lessen the severity, or delay the onset of at least one sign or symptom of the disease.
- a regime dose, frequency and route of administration
- an antibody or immunogen to induce an antibody is administered to a subject suspected of, or already suffering from a disease in a regime (dose, frequency and route of administration) effective to ameliorate or at least inhibit further deterioration of at least one sign or symptom of the disease.
- a regime is considered therapeutically or prophylactically effective if an individual treated subject achieves an outcome more favorable than the mean outcome in a control population of comparable subjects not treated by methods disclosed herein, or if a more favorable outcome is demonstrated for a regime in treated subjects versus control subjects in a controlled clinical trial (e.g. , a phase II, phase II/III, or phase III trial) or an animal model at the p ⁇ 0.05 or 0.01 or even 0.001 level.
- a controlled clinical trial e.g. , a phase II, phase II/III, or phase III trial
- Effective doses vary depending on many different factors, such as means of administration, target site, physiological state of the subject, whether the subject is human or an animal, other medications administered, and whether treatment is prophylactic or therapeutic.
- An exemplary dose range for antibodies can be from about 0.1-20 mg/kg body weight, or 0.5-5 mg/kg body weight (e.g., 0.5, 1, 2, 3, 4 or 5 mg/kg) or 10- 1500 mg as a fixed dosage. The dosage depends on the condition of the patient and response to prior treatment, if any, whether the treatment is prophylactic or therapeutic and whether the disorder is acute or chronic, among other factors.
- Antibody can be administered in such doses daily, on alternative days, weekly, fortnightly, monthly, quarterly, or according to any other schedule determined by empirical analysis.
- An exemplary treatment entails administration in multiple doses over a prolonged period, for example, of at least six months. Additional exemplary treatment regimes entail administration once per every two weeks or once a month or once every 3 to 6 months.
- Antibodies can be administered via a peripheral route. Routes of administration include topical, intravenous, oral, subcutaneous, intraarterial, intracranial, intrathecal, intraperitoneal, intranasal or intramuscular. Routes for administration of antibodies can be intravenous or subcutaneous. Intravenous administration can be, for example, by infusion over a period such as 30-90 min. This type of injection is most typically performed in the arm or leg muscles. In some methods, agents are injected directly into a particular tissue where deposits have accumulated, for example intracranial injection.
- compositions for parenteral administration can be sterile and substantially isotonic (250-350 mOsm/kg water) and manufactured under GMP conditions.
- Pharmaceutical compositions can be provided in unit dose form (i.e., the dose for a single administration).
- Pharmaceutical compositions can be formulated using one or more
- antibodies can be formulated in aqueous solutions, e.g., in physiologically compatible buffers such as Hank's solution, Ringer's solution, or physiological saline or acetate buffer (to reduce discomfort at the site of injection).
- physiologically compatible buffers such as Hank's solution, Ringer's solution, or physiological saline or acetate buffer (to reduce discomfort at the site of injection).
- the solution can contain formulatory agents such as suspending, stabilizing and/or dispersing agents.
- antibodies can be in lyophilized form for constitution with a suitable vehicle, e.g. , sterile pyrogen-free water, before use.
- the regimes can be administered in combination with another agent effective in treatment or prophylaxis of the disease being treated.
- the subject's condition can be evaluated to determine the progress or efficacy of such treatment.
- the methods can be used to monitor a course of therapeutic and prophylactic treatment with the agents provided herein.
- the methods can be used to monitor active immunization (e.g., antibody produced in response to administration of immunogen) and passive immunization (e.g., measuring level of administered antibody).
- Also provided are methods of detecting medin deposition or aggregation in a subject for example, by measuring medin in a sample from a subject or by in vivo imaging of medin in a subject. Such methods are useful to diagnose or confirm diagnosis of diseases associated with medin, or susceptibility thereto. The methods can also be used on asymptomatic subjects. The presence of medin indicates susceptibility to future symptomatic disease. The methods are also useful for monitoring disease progression and/or response to treatment in subjects who have been previously diagnosed with a disease associated with medin, such as, for example, Marfan syndrome or aortic aneurysm.
- the in vivo imaging methods can work by administering a reagent, such as antibody that binds to medin in the subject, and then detecting the reagent after it has bound.
- a reagent such as antibody that binds to medin in the subject
- Antibodies typically bind to an epitope of medin. If desired, the clearing response can be avoided by using antibody fragments lacking a full length constant region, such as Fabs. In some methods, the same antibody can serve as both a treatment and diagnostic reagent.
- Diagnostic reagents can be administered by intravenous injection into the body of the subject, or via other routes deemed reasonable.
- the dose of reagent should be within the same ranges as for treatment methods.
- the reagent is labeled, although in some methods, the primary reagent with affinity for medin is unlabeled and a secondary labeling agent is used to bind to the primary reagent.
- the choice of label depends on the means of detection. For example, a fluorescent label is suitable for optical detection. Use of paramagnetic labels is suitable for tomographic detection without surgical intervention. Radioactive labels can also be detected using PET or SPECT.
- Diagnosis is performed by comparing the number, size, and/or intensity of labeled loci to corresponding base line values.
- the base line values can represent the mean levels in a population of undiseased individuals. Base line values can also represent previous levels determined in the same subject. For example, base line values can be determined in a subject before beginning treatment, and measured values thereafter compared with the base line values. A decrease in values relative to base line generally signals a positive response to treatment.
- the antibody profile following passive immunization typically shows an immediate peak in antibody concentration followed by an exponential decay. Without a further dose, the decay approaches pretreatment levels within a period of days to months depending on the half- life of the antibody administered. For example the half-life of some human antibodies is of the order of 20 days.
- a baseline measurement of antibody to medin in the subject is made before administration, a second measurement is made soon thereafter to determine the peak antibody level, and one or more further measurements are made at intervals to monitor decay of antibody levels.
- a predetermined percentage of the peak less baseline e.g. , 50%, 25% or 10%
- administration of a further dose of antibody is administered.
- peak or subsequent measured levels less background are compared with reference levels previously determined to constitute a beneficial prophylactic or therapeutic treatment regime in other subjects. If the measured antibody level is significantly less than a reference level (e.g. , less than the mean minus one or, preferably, two standard deviations of the reference value in a population of subjects benefiting from treatment) administration of an additional dose of antibody is indicated.
- kits e.g. , containers
- instructions for use e.g. , package insert
- the instructions for use may contain, for example, instructions for
- the containers of medin antibody may be unit doses, bulk packages (e.g. , multi-dose packages), or sub-unit doses.
- Package insert refers to instructions customarily included in commercial packages of therapeutic products that contain information about the indications, usage, dosage,
- Kits can also include a second container comprising a pharmaceutically-acceptable buffer, such as bacteriostatic water for injection (BWFI), phosphate-buffered saline, Ringer's solution and dextrose solution. It can also include other materials desirable from a commercial and user standpoint, including other buffers, diluents, filters, needles, and syringes.
- BWFI bacteriostatic water for injection
- the antibodies can be used for detecting medin, or fragments thereof, in the context of clinical diagnosis or treatment or in research.
- the antibodies can be used to detect the presence of medin in a biological sample or biopsy as an indication that the biological sample comprises medin. Binding of the antibodies to the biological sample can be compared to binding of the antibodies to a control sample.
- the control sample and the biological sample can comprise cells of the same tissue origin. Control samples and biological samples can be obtained from the same individual or different individuals and on the same occasion or on different occasions. If desired, multiple biological samples and multiple control samples are evaluated on multiple occasions to protect against random variation independent of the differences between the samples.
- a direct comparison can then be made between the biological sample(s) and the control sample(s) to determine whether antibody binding (i.e., the presence of medin) to the biological sample(s) is increased, decreased, or the same relative to antibody binding to the control sample(s).
- Increased binding of the antibody to the biological sample(s) relative to the control sam le(s) indicates the presence of medin in the biological sample(s).
- the increased antibody binding is statistically significant.
- antibody binding to the biological sample is at least 1.5-fold, 2-fold, 3-fold, 4-fold, 5-fold, 10-fold, 20-fold, or 100-fold higher than antibody binding to the control sample.
- the antibodies can be used to detect the presence of the medin in a biological sample or biopsy to monitor and evaluate the efficacy of a therapeutic agent being used to treat a patient diagnosed with a disease associated with medin.
- a biological sample from a patient diagnosed with a disease associated with medin is evaluated to establish a baseline for the binding of the antibodies to the sample (i.e., a baseline for the presence of the medin in the sample) before commencing therapy with the therapeutic agent.
- multiple biological samples from the patient are evaluated on multiple occasions to establish both a baseline and measure of random variation independent of treatment.
- a therapeutic agent is then administered in a regime.
- the regime may include multiple administrations of the agent over a period of time.
- binding of the antibodies i.e., presence of the medin
- binding of the antibodies is evaluated on multiple occasions in multiple biological samples from the patient, both to establish a measure of random variation and to show a trend in response to immunotherapy.
- the various assessments of antibody binding to the biological samples are then compared. If only two assessments are made, a direct comparison can be made between the two assessments to determine whether antibody binding (i.e., presence of medin) has increased, decreased, or remained the same between the two assessments. If more than two measurements are made, the measurements can be analyzed as a time course starting before treatment with the therapeutic agent and proceeding through the course of therapy.
- binding decreases by at least 1%, 2%, 3%, 4%, 5%, 10%, 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100%.
- Assessment of antibody binding can be made in conjunction with assessing other signs and symptoms of diseases associated with medin.
- the antibodies can also be used as research reagents for laboratory research in detecting medin, fragments thereof, or misfolded lactadherin.
- antibodies can be labeled with fluorescent molecules, spin- labeled molecules, enzymes, or radioisotopes, and can be provided in the form of kit with all the necessary reagents to perform the detection assay for medin, or fragments thereof.
- the antibodies can also be used to purify medin, or binding partners of medin, e.g. , by affinity chromatography.
- mice were immunized with a c-terminal peptide or full-length human medin, hybridomas cloned and antibodies screened for activity using ELISA, Western blot, Biacore and immunocytochemistry.
- anti-medin antibodies can detect endogenous medin peptide present in aneurysm and Marfan patient samples and showed that the antibody epitope can play an important role in determining the size (monomer, dimer, trimer, etc.) and aggregation state (oligomer, protofibril, aggregate) of medin detected.
- mice with full-length human medin (50 aa, figure 1A and B) or the c-terminal human peptide (7 aa, figure IB) generated a panel of anti-medin monoclonal antibodies of interest.
- the IgGs emanating from the cloning of these antibodies were first assessed in a two-pronged ELISA, an assay that determined binding to human lactadherin polypeptide and human medin peptide (50 aa).
- the results of this initial screen revealed that almost all antibodies raised against the full-length medin peptide were able to bind both medin and lactadherin, while antibodies raised against the c-terminal peptide were largely medin specific (data not shown).
- biacore analysis was used to ascertain the binding affinity of antibodies for medin and to determine the selectivity of antibodies for lactadherin versus full-length medin.
- Table 2 depicts Biacore analysis of the binding affinity of 6B3 and 18G1 to full length medin. 6B3 and 18G1 had 1 nM and 12 nM affinities for medin, respectively. The affinity for lactadherin has yet to be determined.
- mice were immunized weekly for 4 to 10 weeks with 10, 25, or 50 ⁇ g of full length human medin (see figures 1A and B) (SEQ ID NO: 1) or human C-terminal peptide (Figure IB) (SEQ ID NO: 2) conjugated to KLH with RIBI adjuvant (Sigma Adjuvant System, Sigma- Aldrich).
- SEQ ID NO: 1 human medin
- Figure IB human C-terminal peptide conjugated to KLH with RIBI adjuvant
- RIBI adjuvant Sigma Adjuvant System, Sigma- Aldrich
- Fusions were performed using a modified procedure described by Kohler and Milstein (Kohler and Milstein, 1975) and electro fusion. Fused cells in selection media were plated in 96-well plates and screened 7-10 days later using an ELISA screen.
- Hybridoma selection was performed using a Direct ELISA method as the primary screen. Briefly, 96-well plates (Costar RIA/EIA plates) were coated with full length human medin (figure IB) and incubated at room temperature for 1 hour. The plates were then blocked with 1% BSA (bovine serum albumin)/ PBS (phosphate buffered saline) at room temperature. After about 15 minutes, plates were emptied and supernatants from the fusion or cloning plates were then added and incubated for 1 hour at room temperature.
- BSA bovine serum albumin
- PBS phosphate buffered saline
- ELISA titration curves were generated to determine antibody binding to human lactadherin (figure 1A, Sino Biological In.), full-length human medin peptide (50 aa, Figures 1 A and B) or to the human or mouse C-terminal peptides (see figure IB). Plates were coated with full length human medin, human C-terminal peptide- OVA, mouse C-terminal peptide-OVA and lactadherin at 2.5 ug/mL, 50 uL/well and incubated for about 1 hour at room temperature. The plates were then blocked with 1% BSA/ PBS at room temperature.
- the SDS-PAGE gels were blotted onto nitrocellulose filter paper (iBlot, P7 Program) and blocked with blocking buffer (Licor) for 30 minutes.
- the filters were then incubated in 0.5ug/ml rabbit ant i- lactadherin (Santa Cruz Biotech, Cat# sc-33546) or mouse anti-medin antibodies (including 6B3 and 18G1) in blocking buffer for 1 hour at room temperature (or overnight at 4°C), followed by three, 10 minute washes with lxTBS.
- the filters were placed in the appropriate IRDye 800CW-conjugated secondary antibody (goat anti-mouse or goat anti-rabbit, Odyssey) diluted 1:20,000 in block buffer. After incubating the filters in secondary antibody solution for 1 hour at room temperature, the filters were washed and imaged on an Odyssey CLx infrared imager (Licor). Immunohistochemistry
- the sections were washed in PBS (3x 10 minutes) and 0.05M Tris (pH 7.6, lx 10 minutes) before the 10- minute DAB reaction (100 mg 3, 3 '-diamino benzidine, 250 ml Tris, 30 ⁇ 1 30% H2O2). The sections were then transferred to Tris (2x 5 minutes), rinsed in H2O (1 minute) and stained with Myer's hematoxylin (Dako). Sectioned were then covered slipped with Cytoseal 60 (Richard Allen Scientific). Additional sections were stained with Thioflavin S (5 minutes; 0.5g/ 50ml H2O) after the hematoxylin step to visualize aggregated amyloid deposits in tissues. These slides were rinse in 70% ethanol (5 minutes) and H2O (2x 30 seconds) and coverslipped with Prolong Gold (Life Technologies). Slides were visualized with bright-field and fluorescence microscopy and digital images acquired using the MetaMorph software.
- Anti-mouse antibody (GE Heathcare) was immobilized on a sensor chip C5 (lacking dextran chains) via amine coupling following the instructions provided in the GE Healthcare anti-mouse kit. Anti-medin monoclonal antibodies of interest were then captured on the chip at a level that ensured a maximum binding of analyte at 30-50 RU.
- the concentration ranges of analyte were selected based on preliminary experimentation to span at least 10-fold above KD to 10-fold below KD.
- the data were doubled referenced to both an irrelevant sensor not containing the medin antibodies and a 0 nM concentration of medin to account for the dissociation of antibodies from the anti-mouse sensor.
- the data was then analyzed with a global 1: 1 fit using the Biacore software.
- variable domains of each medin monoclonal antibody the total mRNA was extracted from lxlO 7 hybridoma cells using the Oligotex Direct mRNA Mini Kit (Qiagen Cat. No.72022). Double strand cDNAs was then generated by using 80 ⁇ g of total mRNA as a template and the Marathon cDNA Amplification Kit (Clontech Cat. no. 634913).
- PCR was performed by using the universal adaptor primer included in Marathon cDNA Amplification kit as the 5' primer for both the VH and VL amplification. Since the anti- medin monoclonal antibodies of interest have a kappa light chain, the CK 3' primer
- ACTAGTCGACATGAAGTTGCCTGTTAGGCTGTTGGTGCTG (SEQ ID NO: 19) was used for VL PCR amplification.
- VH amplification the following 3' primers were used respectively:
- GGATCCCGGGAGTGGATAGACCGATGG (SEQ ID NO: 20) 6B3 (heavy chain is gamma 2b):
- PCR products were then gel purified and cloned into the Topo 4 vector using the Zero Blunt TOPO PCR cloning kit (Lifetech, Cat. No. K2800-20) and sent to Elimbio for sequencing.
- Example 5 Design of Humanized 6B3 Antibodies
- the starting point or donor antibody for humanization was the mouse antibody 6B3.
- the heavy chain variable amino acid sequence of mature m6B3 is provided as SEQ ID NO: 11.
- the light chain variable amino acid sequence of mature m6B3 is provided as SEQ ID NO:29.
- the heavy chain Kabat/Chothia Composite CDRl, CDR2, and CDR3 amino acid sequences are provided as SEQ ID NOS: 12-14, respectively.
- the light chain Kabat CDRl, CDR2, and CDR3 amino acid sequences are provided as SEQ ID NOS: 16-18, respectively. Kabat numbering is used throughout.
- variable kappa (Vk) of 6B3 belongs to mouse Kabat subgroup 5 which corresponds to human Kabat subgroup 1 and variable heavy (Vh) to mouse Kabat subgroup lb which corresponds to human Kabat subgroup 1 (Kabat, 1991, supra)
- Vk a human kappa light chain with NCBI accession code BAC01558.1 (GI: 21669067) (Akahori,Y., et al., Direct submission (25-JUN-2001) Yoshikazu Kurosawa, Institute for Comprehensive Medical Science, Fujita Health University; Kutsukake-cho, Toyoake 470-1192, Japan) was chosen. This has the same canonical classes for CDR-L1 and L2. It is a member of Kabat human kappa subgroup 2.
- human Ig heavy chain AAD53863.1 GI: 5834194
- Heavy and light chain variant sequences resulting from antibody humanization process were further aligned to human germ line sequences using IMGT Domain GapAlign tool to assess the humanness of the heavy and light chain as outlined by WHO INN committee guidelines.
- WHO-INN International nonproprietary names (INN) for biological and
- Residues were changed to align with corresponding human germ line sequence, where possible, to enhance humanness.
- 6B3VH was aligned to human germ line sequence IGHV4-30-3*01 and 6B3VL was aligned against IGKV1-NL1*01.
- Hu6B3VLvl and Hu6B3VLv2 (SEQ ID NOS:31-32, respectively) (Tables 3 and 4).
- the gray-shaded areas in Tables 3 and 4 indicate the CDRs as defined by Kabat/Chothia Composite.
- SEQ ID NOS:26- 28 and 32 contain backmutations and other mutations as shown in Table 5.
- Table 6 Kabat Numbering of Framework Residues (based on Kabat/Chothia Composite CDRs) for Backmutations and Other Mutations in Humanized 6B3 Antibodies
- FIG. 8 An alignment of the murine 6B3 Vk sequence (SEQ ID NO:29) with the human acceptor sequence (BAC01558.1; SEQ ID NO:30), and the Hu6B3VLvl and Hu6B3VLv2 (SEQ ID NOs 31 and 32:, respectively), is shown in Figure 8.
- the CDR regions as defined by Kabat are boxed. Positions at which canonical, vernier, or interface residues differ between mouse and human acceptor sequences are candidates for substitution. Examples of interface/packing (VH+VL) residues include Kabat residues L34, L36, L38, L44, L46, L87, L89, L91, L96, and L98 in Table 4.
- F71Y; Y87F; G100Q and V104L are frequency/germ- line aligning mutations.
- Q1E is a stability enhancing mutation to mitigate pyroglutamate formation potential.
- T3Q; K5Q; A10G; T15S; T19S; A44G; L48I; A49G; L67V; V78F; V79S; T81K; M82L; T82aS; N82bS; M82cV; D83T; P84A; V85A; T89V, and L108T are frequency based back-mutations or germ-line aligning mutations.
- the starting point or donor antibody for humanization was the mouse antibody 18G1.
- the heavy chain variable amino acid sequence of mature ml8Gl is provided as SEQ ID NO:3.
- the light chain variable amino acid sequence of mature ml8Gl is provided as SEQ ID NO:36.
- the heavy chain Kabat/Chothia Composite CDRl, CDR2, and CDR3 amino acid sequences are provided as SEQ ID NOS:4-6, respectively.
- the light chain Kabat CDRl, CDR2, and CDR3 amino acid sequences are provided as SEQ ID NOS:8-10, respectively. Kabat numbering is used throughout.
- variable kappa (Vk) of 18G1 belongs to mouse Kabat subgroup 5 which corresponds to human Kabat subgroup 1 and variable heavy (Vh) to mouse Kabat subgroup 3d which corresponds to human Kabat subgroup 3 (Kabat et al, 1991, supra).
- 11 residue CDR-L1 belongs to canonical class 2; 7 residue CDR-L2 to class 1 and 9 residue CDR-L3 to class 1 in Vk (Martin & Thornton, supra). 12 residue CDR-H1 belongs to class 3; 16 residue CDR-H2 to class 1 (Martin & Thornton, supra). CDR-H3 has no canonical classes (Shirai, supra).
- a search of the non-redundant protein sequence database from NCBI allowed selection of suitable human frameworks into which to graft the murine CDRs.
- Vk a human kappa light chain with NCBI accession code AAD39507.1 (GI: 5081723) (Van Den Brink E.N. et al., 2000, Blood 95, 558-563) was chosen. This has the same canonical classes for CDR-L1 and L2. It is a member of Kabat human kappa subgroup 2.
- human Ig heavy chain AAX82494.1 GI: 62421461 (Lundquist,R. et al, 2006 Infect. Immun. 74, 3222-3231) was chosen, again with the same canonical classes. It is a member of Kabat human heavy subgroup 1.
- Heavy and light chain variant sequences resulting from antibody humanization process were further aligned to human germ line sequences using IMGT Domain GapAlign tool to assess the humanness of the heavy and light chain as outlined by WHO INN committee guidelines. (WHO-INN, supra) Residues were changed to align with corresponding human germ line sequence, where possible, to enhance humanness.
- 18G1VH was aligned to human germ line sequence IGHV3-13*01 and 18G1VL was aligned against IGKV2D-29*02.
- Table 9 The gray-shaded areas in Tables 7 and 8 indicate the CDRs as defined by Kabat/Chothia Composite SEQ ID NOS:35, 38, and 39 contain backmutations and other mutations as shown in Table 9.
- Hul8GlVHv2 and at positions L3, L10, L13, L15, L19, L20, L22, L42, L45, L60, L70, L77, L78, L80, L83, and L85 in Hul8GlVLvl and Hul8GlVLv2, are listed in Table 10.
- Table 10 Kabat Numbering of Framework Residues (based on Kabat/Chothia Composite CDRs) for Backmutations and Other Mutations in Humanized 18G1 Antibodies
- VH+VL residues include Kabat residues L34, L36, L38, L44, L46, L87, L89, L91, L96, and L98 in Table 8.
- Q1E is a stability enhancing mutation to mitigate pyroglutamate formation potential. (Liu, supra).
- Q5V; K13Q; K19R; T40A; D42G; R44G; A49S; T77S; S82aN; K83R; S84A; M89V, A93V, and M108T are frequency based back-mutations or germ-line aligning mutations.
- Phe Leu Lys lie Ala Ser Val Asp Thr Ala Asp Thr Ala Thr Tyr Tyr
- VARIANT ⁇ 222> (117) .. (117)
- Trp Xaa Ala Xaa lie Xaa Xaa Xaa Asp Xaa Xaa Xaa Tyr Tyr Xaa Xaa 50 55 60
- Trp Leu Ala Arg lie Asp Trp Asp Asp Asp Lys Phe Tyr Ser Thr Ser 50 55 60
- Cys Ala Arg lie Met Met Gly Asn Trp Phe Asp Pro Trp Gly Gin Gly
- Trp Leu Ala His lie Trp Trp Asn Asp Asn Lys Tyr Tyr Asn He Ala 50 55 60
- Trp lie Gly His lie Trp Trp Asn Asp Asn Lys Tyr Tyr Asn lie Ala 50 55 60
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- General Health & Medical Sciences (AREA)
- Medicinal Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Veterinary Medicine (AREA)
- Immunology (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- Pharmacology & Pharmacy (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Epidemiology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Biomedical Technology (AREA)
- Biophysics (AREA)
- Genetics & Genomics (AREA)
- Molecular Biology (AREA)
- Biochemistry (AREA)
- Diabetes (AREA)
- Rheumatology (AREA)
- Oncology (AREA)
- Zoology (AREA)
- Neurosurgery (AREA)
- Neurology (AREA)
- Mycology (AREA)
- Microbiology (AREA)
- Cell Biology (AREA)
- Pathology (AREA)
- Physics & Mathematics (AREA)
- Optics & Photonics (AREA)
- Urology & Nephrology (AREA)
- Toxicology (AREA)
- Endocrinology (AREA)
- Gastroenterology & Hepatology (AREA)
- Cardiology (AREA)
Priority Applications (4)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| EP16703215.0A EP3247392A1 (en) | 2015-01-22 | 2016-01-22 | Antibodies recognizing medin |
| CA2974511A CA2974511A1 (en) | 2015-01-22 | 2016-01-22 | Antibodies recognizing medin |
| JP2017538576A JP2018508193A (ja) | 2015-01-22 | 2016-01-22 | メディンを認識する抗体 |
| HK18106911.3A HK1247132A1 (zh) | 2015-01-22 | 2016-01-22 | 识别medin的抗体 |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201562106690P | 2015-01-22 | 2015-01-22 | |
| US62/106,690 | 2015-01-22 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2016118930A1 true WO2016118930A1 (en) | 2016-07-28 |
Family
ID=55305090
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2016/014633 Ceased WO2016118930A1 (en) | 2015-01-22 | 2016-01-22 | Antibodies recognizing medin |
Country Status (6)
| Country | Link |
|---|---|
| US (1) | US20160251417A1 (https=) |
| EP (1) | EP3247392A1 (https=) |
| JP (1) | JP2018508193A (https=) |
| CA (1) | CA2974511A1 (https=) |
| HK (1) | HK1247132A1 (https=) |
| WO (1) | WO2016118930A1 (https=) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US10442855B2 (en) | 2015-01-22 | 2019-10-15 | Prothena Biosciences Limited | Antibodies recognizing medin |
Family Cites Families (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2000061637A1 (en) * | 1999-04-14 | 2000-10-19 | Smithkline Beecham Corporation | Erythropoietin receptor antibodies |
| MY148763A (en) * | 2006-03-10 | 2013-05-31 | Wyeth Corp | Anti-5t4 antibodies and uses thereof |
| PL2118300T3 (pl) * | 2007-02-23 | 2015-11-30 | Prothena Biosciences Ltd | Zapobieganie i leczenie synukleinopatii i amyloidozy |
| PT2125894T (pt) * | 2007-03-22 | 2019-02-27 | Biogen Ma Inc | Proteínas de ligação incluindo anticorpos, derivados de anticorpos e fragmentos de anticorpos que se ligam especificamente ao cd154 e as suas utilizações |
| AU2009296937B2 (en) * | 2008-09-29 | 2015-02-12 | Centocor Ortho Biotech Inc. | Anti-CD147 antibodies, methods, and uses |
| WO2012064733A2 (en) * | 2010-11-09 | 2012-05-18 | Medimmune, Llc | Antibody scaffold for homogenous conjugation |
-
2016
- 2016-01-22 CA CA2974511A patent/CA2974511A1/en not_active Abandoned
- 2016-01-22 HK HK18106911.3A patent/HK1247132A1/zh unknown
- 2016-01-22 EP EP16703215.0A patent/EP3247392A1/en not_active Withdrawn
- 2016-01-22 US US15/004,854 patent/US20160251417A1/en not_active Abandoned
- 2016-01-22 JP JP2017538576A patent/JP2018508193A/ja active Pending
- 2016-01-22 WO PCT/US2016/014633 patent/WO2016118930A1/en not_active Ceased
Non-Patent Citations (4)
| Title |
|---|
| HAEGGQVIST B ET AL: "MEDIN: AN INTEGRAL FRAGMENT OF AORTIC SMOOTH MUSCLE CELL-PRODUCED LACTADHERIN FORMS THE MOST COMMON HUMAN AMYLOID", PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES, NATIONAL ACADEMY OF SCIENCES, US, vol. 96, no. 15, 1 July 1999 (1999-07-01), pages 8669 - 8674, XP000919433, ISSN: 0027-8424, DOI: 10.1073/PNAS.96.15.8669 * |
| PAUL SHUGHRUE ET AL: "Abstract 464: Novel Anti-medin antibodies detect Medin Amyloid Deposits in the Aourta of Patients with Thoracic Aneurysms or Marfan Syndrome", ARTERIOSCLEROSIS, THROMBOSIS, AND VASCULAR BIOLOGY. POSTER ABSTRACT PRESENTATIONS. POSTER SESSION II., vol. 35, A464, 1 May 2015 (2015-05-01) - 1 May 2015 (2015-05-01), pages 1 - 2, XP002756975, Retrieved from the Internet <URL:http://atvb.ahajournals.org/content/35/Suppl_1/A464.abstract?sid=7079a197-c00d-42ec-9b72-33f4c809b590> [retrieved on 20160421] * |
| PENG SIWEI ET AL: "Medin-amyloid: a recently characterized age-associated arterial amyloid form affects mainly arteries in the upper part of the body", AMYLOID: THE INTERNATIONAL JOURNAL OF EXPERIMENTAL AND CLINICAL INVESTIGATION, PARTHENON PUBLISHING GROUP, LANCS, GB, vol. 12, no. 2, 1 June 2005 (2005-06-01), pages 96 - 102, XP002578164, ISSN: 1350-6129 * |
| SIWEI PENG ET AL: "Role of aggregated medin in the pathogenesis of thoracic aortic aneurysm and dissection", LABORATORY INVESTIGATION, vol. 87, no. 12, 1 October 2007 (2007-10-01), The United States and Canadian Academy of Pathology, Inc., pages 1195 - 1205, XP055268246, ISSN: 0023-6837, DOI: 10.1038/labinvest.3700679 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US10442855B2 (en) | 2015-01-22 | 2019-10-15 | Prothena Biosciences Limited | Antibodies recognizing medin |
Also Published As
| Publication number | Publication date |
|---|---|
| CA2974511A1 (en) | 2016-07-28 |
| EP3247392A1 (en) | 2017-11-29 |
| HK1247132A1 (zh) | 2018-09-21 |
| US20160251417A1 (en) | 2016-09-01 |
| JP2018508193A (ja) | 2018-03-29 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US11584791B2 (en) | Antibodies recognizing tau | |
| JP7587304B2 (ja) | タウ認識抗体 | |
| US20220372118A1 (en) | Antibodies recognizing tau | |
| JP7623699B2 (ja) | タウ認識抗体 | |
| US11926659B2 (en) | Antibodies recognizing tau | |
| AU2018345807A1 (en) | Methods of detecting transthyretin | |
| US20160251417A1 (en) | Antibodies recognizing medin | |
| US10442855B2 (en) | Antibodies recognizing medin | |
| US20240018226A1 (en) | Methods of using antibodies recognizing tau | |
| EA052560B1 (ru) | Способы применения антител, распознающих тау | |
| EA047155B1 (ru) | Антитела, распознающие тау | |
| EA041675B1 (ru) | Антитела, распознающие тау | |
| EA041230B1 (ru) | Антитела, распознающие тау |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 16703215 Country of ref document: EP Kind code of ref document: A1 |
|
| ENP | Entry into the national phase |
Ref document number: 2974511 Country of ref document: CA |
|
| ENP | Entry into the national phase |
Ref document number: 2017538576 Country of ref document: JP Kind code of ref document: A |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| REEP | Request for entry into the european phase |
Ref document number: 2016703215 Country of ref document: EP |