WO2016117816A1 - 인간 중간엽 줄기세포의 줄기세포능을 증가시키는 방법 - Google Patents

인간 중간엽 줄기세포의 줄기세포능을 증가시키는 방법 Download PDF

Info

Publication number
WO2016117816A1
WO2016117816A1 PCT/KR2015/012751 KR2015012751W WO2016117816A1 WO 2016117816 A1 WO2016117816 A1 WO 2016117816A1 KR 2015012751 W KR2015012751 W KR 2015012751W WO 2016117816 A1 WO2016117816 A1 WO 2016117816A1
Authority
WO
WIPO (PCT)
Prior art keywords
stem cells
mesenchymal stem
human mesenchymal
endothelin
cells
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/KR2015/012751
Other languages
English (en)
French (fr)
Inventor
김효수
이은주
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Seoul National University Hospital
Original Assignee
Seoul National University Hospital
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Seoul National University Hospital filed Critical Seoul National University Hospital
Priority to US15/544,619 priority Critical patent/US10294453B2/en
Publication of WO2016117816A1 publication Critical patent/WO2016117816A1/ko
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06Animal cells or tissues; Human cells or tissues
    • C12N5/0602Vertebrate cells
    • C12N5/0607Non-embryonic pluripotent stem cells, e.g. MASC
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/12Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
    • A61K35/28Bone marrow; Haematopoietic stem cells; Mesenchymal stem cells of any origin, e.g. adipose-derived stem cells
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • A61K38/16Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A61K38/22Hormones
    • A61K38/2285Endothelin, vasoactive intestinal contractor [VIC]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06Animal cells or tissues; Human cells or tissues
    • C12N5/0602Vertebrate cells
    • C12N5/0652Cells of skeletal and connective tissues; Mesenchyme
    • C12N5/0662Stem cells
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06Animal cells or tissues; Human cells or tissues
    • C12N5/0602Vertebrate cells
    • C12N5/0652Cells of skeletal and connective tissues; Mesenchyme
    • C12N5/0662Stem cells
    • C12N5/0663Bone marrow mesenchymal stem cells (BM-MSC)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2501/00Active agents used in cell culture processes, e.g. differentation
    • C12N2501/30Hormones
    • C12N2501/365Endothelin
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2501/00Active agents used in cell culture processes, e.g. differentation
    • C12N2501/998Proteins not provided for elsewhere

Definitions

  • the present invention relates to a method for increasing the stem cell capacity (stemness) of human mesenchymal stem cells.
  • MSCs Mesenchymal stem cells
  • the MSCs are various types of mesoderm lineages in vivo, such as osteoblasts, chondrocytes, tendon cells, adipocytes, myocytes, fibroblasts, and the like. Can be differentiated into In addition, under appropriate media conditions, they can cross-differentiate into neurons, cardiomyocytes, endothelial cells, and hepatocytes.
  • bone marrow MSCs express class I MHC antigens, but not class II, or express stimulatory molecules that indicate that MSCs lack immunogenic activity (Klyushnenkova E et al., J Biomed Sci, 12 (1): 47-57). , 2005).
  • MSCs exhibit immunosuppressive activity and can therefore be used as graft promoters, fetal grafts and inhibitors of host diseases (Le Blanc K et al., Lancet, 363 (9419): 1439-1441, 2004 El-Badri NS et al., Exp Hematol, 26 (2): 110-116, 1998).
  • MSCs can be separated from various adult tissues such as bone marrow, adipose tissue, cord blood, peripheral blood, neonatal tissues, human placenta, etc., but the number of MSCs obtained from adult tissues is limited.
  • the minimum number of cells required for cell therapy or regenerative medicine is around 1 ⁇ 10 9 , and the amount is even greater if conditions are included to establish conditions and establish standards.
  • To supply this amount of existing mesenchymal stem cells of various origins requires at least 10 passages in vitro . The cells then become aging and deformed and no longer fit the concept of treatment. This is a big problem to be solved in the current culture system of mesenchymal stem cells. And even if the conditions and criteria are established with these cells, the cells may already run out of cells and require the use of other human mesenchymal stem cells when used for treatment. In order to use the mesenchymal stem cells as a cell therapy, it is necessary to develop a new method that can solve the above problems by increasing stem cell capacity.
  • Stem cell capacity is a generic term for pluripotency capable of producing all cells, such as embryonic stem cells, and self-renewal capacity capable of producing infinitely similar cells. It is commonly used in the industry. Thus, it may be characterized by increased telomerase activity, increased expression of stemness acting signals, increased proliferation while maintaining undifferentiated cells, or increased cell migration activity. (Pittenger, MF et al. 1999. Multilineage potential of adult human mesenchymal stem cells. Science 284 (5411), 143-147).
  • endothelin is a peptide produced in vascular endothelial cells and is composed of 21 amino acid residues and is known as a vasoconstrictive peptide. Endothelin has two S-S bonds in a molecule and is produced by modification of an ET precursor with an ET convertase. Endothelin-1 was first isolated from pig vascular endothelial cell culture in 1988, and most mammals have three types of isopeptides (ET-1, ET-2, and ET-3).
  • Endothelin causes transient vasodilation and subsequent vasoconstriction.
  • the three types of isopeptides have almost similar effects on transient vasodilation, whereas the effects of ET-3 on vasoconstriction are ET- It is only about a hundredth of one and ET-2.
  • Two subtypes are known for the ET receptor, of which ETA is involved in vasoconstriction and ETB is involved in vasodilation.
  • endothelin affects the stem cell capacity of human mesenchymal stem cells.
  • Endothelin-1 (Endothelin-1) is an important factor that can increase the stem cell (stemness) of human mesenchymal stem cells (Mesenchymal stem cells)
  • the conventional mesenchymal stem cell culture can be used to overcome the disadvantages of cell aging and to produce cells for cell therapy and regenerative medicine, and completed the present invention.
  • the present invention provides a method for increasing the stem cell (stemness) of human mesenchymal stem cells (Mesenchymal stem cell), the method is endothelin- in stem cell culture medium- 1 (Endothelin-1) is to process the step of culturing.
  • the method may be to treat the endothelin-1 at a concentration of 0.0125 to 0.25ug / ml.
  • the method may be to extend the telomere (telomere) length of human mesenchymal stem cells.
  • the method may be to prolong the life of human mesenchymal stem cells, and to inhibit the aging of human cells.
  • the method may be to treat the endothelin-1 after 24 hours of the culture of attachment of the mesenchymal stem cells.
  • the method may further comprise culturing 1 to 5 days after the endothelin-1 treatment.
  • the present invention provides a human mesenchymal stem cell increased stem cell capacity by the above method.
  • the present invention provides a composition for increasing stem cell capacity (stemness) of human mesenchymal stem cells, including endothelin-1 as an active ingredient.
  • the composition may be a cell culture.
  • the cell may be a human stem cell.
  • the endothelin-1 may be included in a concentration of 0.0125 to 0.25ug / ml.
  • the present invention provides a method for increasing the stem cell capacity of human mesenchymal stem cells, the treatment of ET-1 to human mesenchymal stem cells in accordance with the present invention increases the stem cell capacity is possible long-term and mass culture, differentiation capacity There is an advantage that can secure a high yield of stem cells in the state.
  • ET-1 has an effect of extending the length of telomeres, which are cellular aging markers, and is expected to be applicable as an anti-aging factor.
  • Figure 1 shows the results confirmed by Western blot the amount of Oct4 protein expression according to ET-1 treatment in human mesenchymal stem cells.
  • Figure 2 shows the results confirmed by real time PCR the amount of Oct4 mRNA expression according to ET-1 treatment in human mesenchymal stem cells.
  • Figure 3 shows the real time gDNA PCR results using gDNA obtained from ET-1 treated human mesenchymal stem cells.
  • Figure 4 shows the results of confirming the chromosome stability of ET-1 treated human mesenchymal stem cells by G-banding karyotype analysis.
  • the present invention is characterized by providing a method for increasing the stem cell (stemness) of human mesenchymal stem cells (Mesenchymal stem cells, MSC), endothelin-1 (Endothelin-1, ET) in the stem cell culture for this purpose -1) treating and culturing.
  • MSC mesenchymal stem cells
  • Endothelin-1 Endothelin-1
  • the present inventors studied to solve the problem that the stem cell capacity of the stem cells decreases as the number of passages during passage of the human mesenchymal stem cells in the prior art, stem cells by treating endothelin-1 in the human mesenchymal stem cell culture medium The ability was improved.
  • Stem cell capacity related markers are known as Oct4, Nanog, Sox2, c-Myc, KLF4, etc.
  • Oct4 which is known to express undifferentiated stem cells, plays a role in preventing cell differentiation and disappears when natural differentiation of cells begins. Therefore, it is possible to predict the degree of differentiation of stem cells according to the expression level of Oct4.
  • telomeres are found at the ends of eukaryotic chromosomes and are a special structure that prevents degradation or end-to-end fusion of chromosomes.
  • Telomere DNA is a primary structure consisting of short sequences of serial repeats (TTAGGG in humans), varying in length from hundreds of bp in lower eukaryotic cells to thousands of bp in mammalian cells. The telomeric DNA portion exhibits GC-rich, as in the centromere region.
  • telomere shortening occurs after repeated cell division, which limits cell proliferation by activating cell cycle limitations that induce replicative senescence or apoptosis.
  • telomeres that is, the length of the chromosomal end portion can be extended (see FIG. 3), and it was confirmed that no chromosomal aberration was caused by the endothelin-1 treatment (see FIG. 4).
  • endothelin-1 treatment of human mesenchymal stem cells extends the telomere length, thereby prolonging the lifespan of stem cells, inhibiting aging, and increasing the growth and viability of the cells, thereby culturing the cells in large quantities. It can be seen that it is possible to overcome the limitations of conventional human mesenchymal stem cells in vitro culture.
  • the present invention can provide a method for increasing the stem cell capacity of human mesenchymal stem cells by treating the endothelin-1, it can provide a human mesenchymal stem cells with increased stem cell capacity by the above method.
  • Increased stem cell capacity of mesenchymal stem cells means that they are likely to differentiate into various mesoderm lineage cells such as bone, ligaments, and muscles.
  • the present invention can provide a composition for increasing stem cell capacity of human mesenchymal stem cells comprising an endothelin-1 as an active ingredient.
  • the "cell culture medium” is a human mesenchymal stem cell culture medium, wherein the human mesenchymal stem cells are derived from various tissues and pluripotent stem cells of the human body such as bone marrow, adipose tissue, umbilical cord blood, peripheral blood, neonatal tissue, and human placenta. It may be, but is preferably derived from bone marrow, but is not limited thereto.
  • stem cell refers to an undifferentiated cell that is capable of differentiating into various cells constituting biological tissue, and is capable of non-limiting regeneration to form specialized cells of tissues and organs. .
  • Stem cells are developable pluripotent or pluripotent cells. Stem cells can divide into two daughter stem cells, or one daughter stem cell and one derived (transit) cell, and then proliferate into mature, fully formed cells of the tissue.
  • the term "cell culture liquid” means a medium containing cultured cells
  • the "medium” means a medium for animal cells commonly used in the art.
  • the medium that can be used in the present invention may be any medium conventionally used for culturing animal cells, for example, Eagles' MEM (Eagle's minimum essential medium, Eagle, H. Science 130: 432 (1959)), ⁇ -MEM (Stanner, CP et al., Nat. New Biol. 230: 52 (1971)), Iscove's MEM (Iscove, N. et al., J. Exp. Med. 147: 923 (1978)), 199 medium (Morgan et al., Proc. Soc. Exp. Bio.
  • ⁇ -MEM Eagles's MEM, Iscove's MEM, 199 medium, CMRL 1066, RPMI 1640, F12, F10, DMEM, Way-mouth's MB752 / 1 and McCoy's 5A, most preferably Preferably it may be ⁇ -MEM medium, but is not limited thereto.
  • the medium of the present invention may further include serum, and the medium of the present invention may include any component known in the art as a conventional stem cell culture composition for efficiently culturing stem cells in addition to serum.
  • endothelin-1 is preferably included in the medium at a concentration of 0.0125 to 0.25 ug / ml, more preferably contained at a concentration of 0.02 to 0.09 ug / ml, 0.02 to It is most preferably included at a concentration of 0.03 ug / ml, but is not limited thereto.
  • Protein Size (kDa) Primary antibody Secondary antibody ECL Oct4 43 santacruz anti-Oct4 antibody sc-90811: 2000 Dilution Anti-Goat IgG (whole molecule) Peroxidase antibody produced in rabbit (Sigma-Aldrich A5420) 1: 3000 Dilution ⁇ 7min Positive control ( ⁇ -tubulin) 55 1: 10000 Dilution anti-mouse IgG (Whole molecule) -peroxidase antibody produced in goat (Sigma-Aldrich A4416) 1: 2000 Dilution ⁇ 5s
  • RNA was extracted to synthesize complementary cDNA, and then Real time PCR was performed using Oct4 amplification primers of SEQ ID NOs: 1 and 2.
  • telomeres of human mesenchymal stem cells In order to confirm the change in the telomeres of human mesenchymal stem cells with or without ET-1 treatment, prepare a cell with 60% confluency of human mesenchymal stem cells on a 60 mm plate, and prepare a new culture medium before ET-1 treatment. And then treated with 0.025 ug / ml of ET-1 and after 24 hours the medium was ground and 3 days later gDNA samples were collected. And the telomeres length according to the ET-1 treatment was compared by performing a real time gDNA PCR using the sample.
  • G-banding karyotype analysis which is known as a basic test for genome stability evaluation, was performed.
  • G-banding karyotyping is a method of pretreatment with trypsin, a protease, followed by staining of chromosomes with Giemsa pigments, where the euchromatin is bright and the heterochromatin is dark. .
  • G-banding karyotype is the most widely used test for chromosome analysis because it generates a lot of bands.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Zoology (AREA)
  • Chemical & Material Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biotechnology (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Wood Science & Technology (AREA)
  • Developmental Biology & Embryology (AREA)
  • General Health & Medical Sciences (AREA)
  • Cell Biology (AREA)
  • Immunology (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Rheumatology (AREA)
  • Veterinary Medicine (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Epidemiology (AREA)
  • Hematology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Endocrinology (AREA)
  • Vascular Medicine (AREA)
  • Virology (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

본 발명은 인간 중간엽 줄기세포의 줄기세포능(stemness)을 증대시키는 방법에 관한 것으로, 더욱 구체적으로는 엔도텔린-1(Endothelin-1)을 처리함으로써 인간 중간엽 줄기세포의 줄기세포능을 증가시키는 방법, 상기 방법으로 줄기세포능이 증가된 인간 중간엽 줄기세포, 및 엔도텔린-1을 유효성분으로 포함하는 인간 중간엽 줄기세포의 줄기세포능 증가용 조성물에 관한 것이다. 본 발명에서는 인간 중간엽 줄기세포에 엔도텔린-1을 처리함으로써 줄기세포능 마커의 발현이 증가하고, 텔로미어 길이가 연장되는 등 줄기세포의 특성을 향상시킬 수 있음을 확인함으로써, 이를 통해 세포의 수명을 연장되고, 노화를 억제할 뿐 아니라, 세포의 성장 및 생존력을 증대시켜 인간 중간엽 줄기세포를 대량으로 배양할 수 있으므로, 세포치료 또는 재생의학에 효과적으로 이용될 수 있을 것으로 기대된다.

Description

인간 중간엽 줄기세포의 줄기세포능을 증가시키는 방법
본 발명은 인간 중간엽 줄기세포의 줄기세포능(stemness)을 증대시키는 방법 등에 관한 것이다.
골수에서 처음 확인된 중간엽 줄기세포(Mesenchymal stem cells;, MSCs)는 전능성 세포로, 재생 의학에서 큰 잠재성을 가진다. 상기 MSCs는 생체 내 여러 유형의 중배엽 계통, 예를 들어 골세포(Osteocytes), 연골세포(Chondrocytes), 힘줄세포(tendinocytes), 지방세포(Adipocytes), 근육세포(Myocytes), 섬유아세포(Fibroblasts) 등으로 분화될 수 있다. 또한, 적절한 배지 조건에서는 신경 세포, 심근세포, 내피세포, 및 간세포로 교차 분화될 수 있다. 그리고 골수 MSCs는 클래스 II가 아닌 클래스 I MHC 항원을 발현하거나, MSCs가 면역원성 활성이 없는 것을 나타내는 상호 자극 분자들을 발현한다(Klyushnenkova E et al., J Biomed Sci, 12(1):47-57, 2005).
이에 더하여, MSCs는 면역억제 활성을 나타내므로, 이식 촉진제, 태아 이식(fatal graft) 및 숙주 질환의 억제제로 사용될 수 있다(Le Blanc K et al., Lancet, 363(9419):1439-1441, 2004; El-Badri N.S et al., Exp Hematol, 26(2):110-116, 1998).
이러한 MSCs는 골수, 지방 조직, 제대혈(cord blood), 말초혈, 신생아 조직(neonatal tissues), 인간 태반 등의 다양한 성인 조직으로부터 분리될 수 있으나 성인 조직에서 수득한 MSCs의 개수에는 한계가 있다.
세포 치료나 재생의학에서 최소 필요한 세포의 수는 1X109 정도이며, 조건을 잡고 기준을 정하는 실험까지 포함한다면 그 양은 더욱 늘어난다. 기존의 다양한 기원의 중간엽 줄기세포로 이 정도의 양을 공급하려면 최소 in vitro에서 10번 이상의 계대가 필요하게 된다. 그러면 세포는 노화되고 변형되어 더 이상 치료의 개념에 적합하지 않게 되는 문제점이 있다. 이는 지금의 중간엽 줄기세포의 배양시스템이 가지고 있는 풀어야 할 큰 문제점이다. 그리고 이러한 세포로 조건과 기준을 잡았다 하더라도 치료에 사용할 시에는 이미 그 세포는 바닥이 나고 다른 인간의 중간엽 줄기세포를 써야 하는 경우가 발생하며, 그럴 경우 또 다른 세포이용에 따른 부가적인 실험을 다시 거쳐야 하기 때문에 중간엽 줄기세포를 세포치료제로 사용하기 위해서는, 줄기세포능(stemness)을 증가시켜 상기와 같은 문제점을 해결할 수 있는 새로운 방법의 개발이 절실한 실정이다.
줄기세포능은 배아줄기세포와 같이 모든 세포를 생성할 수 있는 능력이 있는 만능성(pluripotency)과, 자기와 닮은 세포들을 무한정 만들어 낼 수 있는 자기재생(self-renewal) 능력을 총칭하는 의미로 당업계에서 통용된다. 따라서 텔로머라제 활성을 증가시키거나, 줄기세포성 인자(stemness acting signals)의 발현을 증가시키거나, 미분화 세포를 미분화 상태를 유지하면서 증식을 증가시키거나, 세포 이동 활성을 증가시키는 특징이 나타나는 것을 포함할 수 있다(Pittenger, M. F. et al. 1999. Multilineage potential of adult human mesenchymal stem cells. Science 284(5411), 143-147).
한편, 엔도텔린(Endothelin, ET)은 혈관내피세포에서 생성되는 펩타이드로, 21개의 아미노산 잔기로 구성되며, 혈관수축펩티드로 알려져 있다. 엔도텔린은 한 분자에 2개의 S-S결합을 갖고 있으며, ET 변환효소로 ET 전구체가 변형됨으로써 생성된다. 엔도텔린-1은 1988년 돼지의 혈관내피세포배양액에서 처음 분리되었으며, 대부분의 포유류에는 3종류의 이소펩타이드(ET-1, ET-2, ET-3)가 존재한다.
엔도텔린은 일과성 혈관 확장과 이어지는 지속적인 혈관수축을 일으키는데, 일과성 혈관확장작용에 관해서는 3종류의 이소펩타이드가 거의 비슷한 효력을 나타내는 데에 비해, 혈관수축작용에 관해서는 ET-3의 효력은 ET-1과 ET-2의 100분의 1정도 밖에 안 된다. ET 수용체에는 2종류의 아형(subtype)이 알려져 있으며, 그 중 ETA는 혈관수축작용, ETB는 혈관확장작용에 관여한다.
그러나 아직까지 엔도텔린이 인간 중간엽 줄기세포의 줄기세포능(stemness)에 영향을 미치는지 여부에 대하여서는 알려진 바 없다.
본 발명은 종래 기술상의 문제점을 해결하기 위해 안출된 것으로, 엔도텔린-1(Endothelin-1)이 인간 중간엽 줄기세포(Mesenchymal stem cell)의 줄기세포능(stemness)을 증가시킬 수 있는 중요한 인자임을 확인함으로써, 이를 통해 종래 중간엽 줄기세포 배양 시 세포 노화의 단점을 극복하여, 세포치료 및 재생의학에 필요한 세포를 만들어 내기 위해 활용될 수 있음을 발견하고 본 발명을 완성하였다.
그러나 본 발명이 이루고자 하는 기술적 과제는 이상에서 언급한 과제에 제한되지 않으며, 언급되지 않은 또 다른 과제들은 아래의 기재로부터 당업자에게 명확하게 이해될 수 있을 것이다.
상기와 같은 본 발명의 목적을 달성하기 위해서, 본 발명은 인간 중간엽 줄기세포(Mesenchymal stem cell)의 줄기세포능(stemness)을 증가시키는 방법을 제공하며, 상기 방법은 줄기세포 배양액에 엔도텔린-1(Endothelin-1)을 처리하여 배양하는 단계를 포함하는 것이다.
본 발명의 일구현예에 있어서, 상기 방법은 엔도텔린-1을 0.0125 내지 0.25ug/ml 농도로 처리하는 것일 수 있다.
본 발명의 다른 구현예에 있어서, 상기 방법은 인간 중간엽 줄기세포의 텔로미어(telomere) 길이를 연장시키는 것일 수 있다.
본 발명의 또 다른 구현예에 있어서, 상기 방법은 인간 중간엽 줄기세포의 수명을 연장시키고, 인간 세포의 노화를 억제하는 것일 수 있다.
본 발명의 또 다른 구현예에 있어서, 상기 방법은 상기 엔도텔린-1을 상기 중간엽 줄기세포의 부착배양 24 시간 후에 처리하는 것일 수 있다.
본 발명의 또 다른 구현예에 있어서, 상기 방법은 엔도텔린-1을 처리한 후 1일 내지 5일간 배양하는 단계를 더 포함하는 것일 수 있다.
또한, 본 발명은 상기 방법으로 줄기세포능이 증가된 인간 중간엽 줄기세포를 제공한다.
이에 더하여, 본 발명은 엔도텔린-1(Endothelin-1)을 유효성분으로 포함하는, 인간 중간엽 줄기세포(Mesenchymal stem cell)의 줄기세포능(stemness) 증가용 조성물을 제공한다.
본 발명의 일구현예에 있어서, 상기 조성물은 세포 배양액일 수 있다.
본 발명의 다른 구현예에 있어서, 상기 세포는 인간 줄기세포일 수 있다.
본 발명의 또 다른 구현예에 있어서, 상기 엔도텔린-1은 0.0125 내지 0.25ug/ml 농도로 포함되는 것일 수 있다.
본 발명은 인간 중간엽 줄기세포의 줄기세포능을 증가시키는 방법을 제공함으로써, 본 발명에 따라 인간 중간엽 줄기세포에 ET-1을 처리하면 줄기세포능이 증가되어 장기 및 대량 배양이 가능하고, 분화능을 유지한 상태의 줄기세포를 높은 수율로 확보할 수 있는 장점이 있다.
또한, 본 발명은 ET-1이 세포 노화 마커인 텔로미어의 길이를 연장시키는 효과가 있음을 규명하였으므로, 이를 노화 방지 인자로써도 적용할 수 있을 것으로 기대된다.
도 1은 인간 중간엽 줄기세포에서 ET-1 처리에 따른 Oct4 단백질 발현량을 western blot을 통해 확인한 결과를 나타낸 것이다.
도 2는 인간 중간엽 줄기세포에서 ET-1 처리에 따른 Oct4 mRNA 발현량을 real time PCR을 통해 확인한 결과를 나타낸 것이다.
도 3은 ET-1이 처리된 인간 중간엽 줄기세포에서 얻어진 gDNA를 이용한 real time gDNA PCR 결과를 나타낸 것이다.
도 4는 ET-1이 처리된 인간 중간엽 줄기세포의 염색체 안정성을 G-banding 핵형 분석법으로 확인한 결과를 나타낸 것이다.
본 발명은 인간 중간엽 줄기세포(Mesenchymal stem cell, MSC)의 줄기세포능(stemness)을 증가시키는 방법을 제공하는 것을 특징으로 하며, 이를 위해 줄기세포 배양액에 엔도텔린-1(Endothelin-1, ET-1)을 처리하여 배양하는 단계를 포함한다.
본 발명자들은 종래 인간 중간엽 줄기세포의 계대 배양시 계대 수가 증가할수록 줄기세포의 줄기세포능이 감소하는 문제점을 해결하기 위하여 연구한 결과, 인간 중간엽 줄기세포 배양액에 엔도텔린-1을 처리함으로써 줄기세포능이 향상됨을 규명하였다.
줄기세포능 관련 지표(마커)로는 Oct4, Nanog, Sox2, c-Myc, KLF4 등이 알려져 있는데, 이들의 발현양이 높을수록 줄기세포의 배양 수율이 우수하고 줄기세포 특성이 우수하게 유지되고 있음을 알 수 있기 때문에 연구에 유용하게 이용되고 있다. 특히, 미분화된 줄기세포가 발현하는 것으로 알려진 Oct4는 세포의 분화를 방지하는 역할을 담당하고, 세포의 자연적인 분화가 시작되면 사라지는 것으로 알려져 있다. 따라서 Oct4의 발현수준에 따라 줄기세포의 분화정도를 예측할 수 있다.
본 발명의 일실시예에서는 인간 중간엽 줄기세포 배양액에 엔도텔린-1을 다양한 농도로 처리하고 Oct-4의 발현량을 측정한 결과, 계대 수가 증가할수록 발현수준이 감소하는 Oct-4의 단백질 및 mRNA 발현량이 증가함을 확인하였다(도 1 및 2 참조). 이러한 결과는 인간 중간엽 줄기세포에 엔도텔린-1을 처리함으로써 줄기세포능이 회복되었음을 시사하는 것이다. 또한, 줄기세포능 마커인 Oct4 등의 발현을 증가시킬 수 있음을 밝힘으로써, 본 발명의 방법이 세포치료 및 재생의학에 효과적으로 적용될 수 있음을 알 수 있다.
그리고 줄기세포능의 향상을 확인하는 또 다른 방법으로 텔로미어(Telomeres)의 길이를 확인할 수 있다. 텔로미어는 진핵세포 염색체의 말단에서 발견되며 염색체들의 분해나 말단-대-말단 융합을 방지하는 특별한 구조이다. 텔로머릭(telomeric) DNA는 짧은 염기서열의 직렬 반복(인간의 경우 TTAGGG)으로 구성된 일차적 구조로서, 그 길이는 하등 진핵세포의 수백 bp에서부터 포유동물 세포의 수천 bp까지 변화한다. 텔로머릭 DNA 부분은 동원체(centromere) 영역에서와 같이 GC의 불균형(GC-rich)을 나타낸다. 이러한 성질은 염색체가 복제될 때 종래 DNA 폴리머라제에 의한 G-가닥의 불완전 복제를 야기하여, 노출된 반대 가닥의 C-가닥이 핵산 제거 효소에 의해 분해되거나 텔로머라제에 의한 합성으로 텔로머릭 말단부위가 완성될 수 있다. 텔로미어의 주요 기능은 염색체 말단을 캡핑하는 것과 분해, 말단 대 말단 융합, 및 비정형 재조합으로부터 염색체를 보호하는 것이며, 이는 게놈의 안전성 유지 및 세포 증식 조절과도 관련되어 있다. 반복된 세포 분열 후에 텔로미어의 단축(telomere shortening)이 일어나는데, 이는 복제형 노화(senescense)나 세포자살(apoptosis)를 유도하는 세포 주기 제한점 등을 활성화하여 세포 증식을 제한하게 된다. 이는 유전적으로 불안정한 세포나 암의 기원이 될 변형세포들의 축적을 막는 순기능도 있지만, 노화나 질병이 발생할 때 장기의 항상성과 재생 그리고 생존을 제한하는 역기능도 있다. 텔로미어 단축으로 인한 조직 재생 기능의 감퇴는 줄기세포의 기능 장애와도 관련이 있으며, 텔로미어 기능 장애는 세포 고유의 제한점들을 활성화시킬 뿐 아니라, 줄기세포를 둘러싼 미세 및 거시환경을 모두 변형시켜 줄기세포의 기능손상을 유발한다(E Hiyama et al., British Journal of Cancer, 96: 1020-1024, 2007).
이에 본 발명의 일실시예에서는 부착배양한 중간엽 줄기세포에 엔도텔린-1을 처리하고 24시간 이상 배양한 다음 대조군인 엔도텔린-1 미처리군과 텔로미어 길이를 비교한 결과, 인간 중간엽 줄기세포에 엔도텔린-1을 처리할 경우, 텔로미어, 즉 염색체 말단 부분 길이를 연장시킬 수 있으며(도 3 참조), 엔도텔린-1 처리로 인해 염색체 이상이 유발되는 바도 없음을 확인하였다(도 4 참조). 상기 결과로부터 인간 중간엽 줄기세포에 엔도텔린-1을 처리하면 텔로미어 길이가 연장됨으로써, 줄기세포의 수명을 연장시키고, 노화를 억제할 뿐 아니라, 세포의 성장 및 생존력을 증대시켜 세포를 대량으로 배양가능하게 하여, 종래 인간 중간엽 줄기세포 체외 배양 시의 한계점을 극복할 수 있음을 알 수 있다.
따라서 본 발명은 엔도텔린-1을 처리하여 인간 중간엽 줄기세포의 줄기세포능을 증가시키는 방법을 제공할 수 있으며, 상기 방법으로 줄기세포능이 증가된 인간 중간엽 줄기세포를 제공할 수 있다. 중간엽 줄기세포의 줄기세포능이 높아진다는 것은 뼈, 인대, 근육 등 다양한 중배엽 계통(mesoderm lineage) 세포로의 분화 가능성이 높아진다는 것을 의미하므로, 세포치료제로서 더 많은 영역의 질환에 적용 가능할 것으로 기대된다. 또한, 본 발명은 엔도텔린-1을 유효성분으로 포함하는 인간 중간엽 줄기세포의 줄기세포능 증가용 조성물을 제공할 수 있다.
본 발명에서 상기 “세포 배양액”은 인간 중간엽 줄기세포 배양액으로서, 상기 인간 중간엽 줄기세포는 골수, 지방 조직, 제대혈, 말초혈, 신생아 조직, 인간 태반 등 인체의 여러 조직과 만능 줄기세포에서 유래할 수 있으며, 골수에서 유래한 것이 바람직하나, 이에 한정되지 않는다.
본 발명에서 용어 "줄기세포(stem cell)"는 생물 조직을 구성하는 다양한 세포들로 분화할 수 있는 세포로서, 조직 및 기관의 특수화된 세포를 형성하도록 비제한적으로 재생할 수 있는 미분화 세포들을 지칭한다. 줄기세포는 발달 가능한 만능성 또는 다능성 세포이다. 줄기세포는 2개의 딸 줄기세포, 또는 하나의 딸줄기세포와 하나의 유래(전이(transit)) 세포로 분열될 수 있으며, 이후에 조직의 성숙하고 완전한 형태의 세포로 증식된다.
본 발명에서 사용되는 용어 "세포 배양액"은 배양된 세포가 포함되어 있는 배지를 의미하고, 상기 "배지"는 당업계에서 통상적으로 이용되는 동물세포용 배지를 의미한다. 본 발명에서 이용될 수 있는 배지는 동물세포의 배양에 통상적으로 이용되는 어떠한 배지도 가능하며, 예를 들어, Eagles's MEM (Eagle's minimum essential medium, Eagle, H. Science 130:432(1959)), α-MEM (Stanner,C.P. et al., Nat. New Biol. 230:52(1971)), Iscove's MEM (Iscove, N. et al., J. Exp. Med. 147:923(1978)), 199 배지 (Morgan et al., Proc. Soc. Exp. Bio. Med., 73:1(1950)), CMRL 1066, RPMI 1640 (Moore et al., J. Amer. Med. Assoc. 199:519(1967)), F12 (Ham, Proc. Natl. Acad. Sci. USA 53:288(1965)), F10 (Ham, R.G. Exp. Cell Res. 29:515(1963)), DMEM (Dulbecco's modification of Eagle's medium, Dulbecco, R. et al., Virology 8:396(1959)), DMEM과 F12의 혼합물 (Barnes, D. et al., Anal. Biochem. 102:255(1980)), Way-mouth's MB752/1 (Waymouth, C. J. Natl. Cancer Inst. 22:1003(1959)), McCoy's 5A (McCoy, T.A., et al., Proc. Soc. Exp. Biol. Med. 100:115(1959)) 및 MCDB 시리즈 (Ham, R.G. et al., In Vitro 14:11(1978)) 등이 이용될 수 있다. 이에, 바람직하게는 α-MEM, Eagles's MEM, Iscove's MEM, 199 배지, CMRL 1066, RPMI 1640, F12, F10, DMEM, Way-mouth's MB752/1 및 McCoy's 5A로 구성된 군으로부터 선택될 수 있으며, 가장 바람직하게는 α-MEM 배지일 수 있으나, 이에 한정되는 것은 아니다. 본 발명의 배지는 혈청을 추가적으로 포함할 수 있고, 본 발명의 배지에는 혈청 이외에 줄기세포를 효율적으로 배양하기 위해 통상적인 줄기세포 배양용 조성물로 당업계에 알려진 어떠한 성분도 포함될 수 있다.
또한, 본 발명에서 엔도텔린-1(ET-1)은 0.0125 내지 0.25 ug/ml의 농도로 배지 내에 포함되는 것이 바람직하고, 0.02 내지 0.09 ug/ml의 농도로 포함되는 것이 더욱 바람직하며, 0.02 내지 0.03 ug/ml의 농도로 포함되는 것이 가장 바람직하나, 이에 한정되는 것은 아니다.
이하, 본 발명의 이해를 돕기 위하여 바람직한 실시예를 제시한다. 그러나 하기의 실시예는 본 발명을 보다 쉽게 이해하기 위하여 제공되는 것일 뿐, 하기 실시예에 의해 본 발명의 내용이 한정되는 것은 아니다.
[실시예]
실시예 1. ET-1 처리에 따른 인간 중간엽 줄기세포의 줄기세포능 증가 효과 확인
ET-1이 인간 중간엽 줄기세포의 줄기세포능(stemness)을 증가시키는지 확인하고자 줄기세포능 관련 인자로 가장 일반적인 마커 Oct4의 발현을 살펴보았다.
1-1. Western blot 결과 확인
인간 중간엽 줄기세포에서 ET-1 처리에 따른 Oct4의 단백질 발현량을 확인하기 위하여, Lonza에서 구입한 인간 중간엽 줄기세포에 ET-1을 농도별(0, 0.0125, 0.025, 0.125, 0.25 ug/ml)로 처리한 후 단백질 발현 수치를 western blot을 수행하여 확인하였다. 이때 사용된 1차 항체 및 2차 항체의 종류 및 희석 비율은 하기 표 1에 나타낸 바와 같다.
Protein Size(kDa) Primary antibody Secondary antibody ECL
Oct4 43 santacruz anti-Oct4 antibody sc-90811:2000 Dilution Anti-Goat IgG (whole molecule)Peroxidase antibody produced in rabbit(Sigma-Aldrich A5420)1:3000 Dilution ~7min
Positive control(α-tubulin) 55 1:10000 Dilution anti-mouse IgG(Whole molecule)-peroxidase antibody produced in goat (Sigma-Aldrich A4416)1:2000 Dilution ~5s
그 결과, 도 1에 나타낸 바와 같이, 인간 중간엽 줄기세포에 ET-1을 처리하면 줄기세포능 마커인 Oct4의 단백질 발현 수치가 현저하게 증가함을 확인하였으며, 특히 0.025ug/ml의 처리 농도에서 가장 높은 단백질 발현 수치를 나타냄을 알 수 있었다.
1-2. Real time PCR 결과 확인
ET-1을 처리한 인간 중간엽 줄기세포에서 Oct4의 mRNA 발현율을 비교하기 위하여, 인간 중간엽 줄기세포에 ET-1을 처리하고 24시간 후 RNA를 추출하여 상보적인 cDNA를 합성한 다음, 이를 주형으로 하기 서열번호 1 및 2의 Oct4 증폭 프라이머를 이용하여 real time PCR을 수행하였다.
서열번호 1: 5'-gaggcaacct ggagaatttg-3' (Oct4 forward primer)
서열번호 2: 5'-tagcctgggg taccaaaatg-3' (Oct4 reverse primer)
그 결과, 도 2에 나타낸 바와 같이, 인간 중간엽 줄기세포에 ET-1을 처리하였을 때 Oct4의 mRNA 발현이 증가함을 확인하였다.
실시예 2. ET-1 처리 유무에 따른 인간 중간엽 줄기세포의 텔로미어 길이 변화 확인
ET-1 처리 유무에 따른 인간 중간엽 줄기세포의 텔로미어 길이 변화를 확인하기 위하여, 60mm plate에 인간 중간엽 줄기세포의 confluency 가 60% 되도록 세포를 준비하고, ET-1을 처리하기 전 배양액을 새것으로 갈아준 다음, ET-1 0.025 ug/ml을 처리하고 24시간 후 배지를 갈고 3일 후 gDNA 샘플을 수거하였다. 그리고 상기 샘플을 이용하여 Real time gDNA PCR을 수행함으로써 ET-1 처리에 따른 텔로미어 길이를 비교하였다.
그 결과, 도 3에 나타낸 바와 같이, 인간 중간엽 줄기세포에 ET-1을 처리하였을 때, 약 3배 이상 텔로미어의 길이가 길어졌음을 확인하였다.
실시예 3. ET-1 처리된 인간 중간엽 줄기세포의 염색체 안정성 확인
상기 실시예 2로부터 인간 중간엽 줄기세포에 ET-1을 처리하면 텔로미어의 길이가 길어짐을 확인함에 따라, 염색체 이상을 유발하지 않는지 G-banding 핵형 분석법으로 염색체 안정성을 확인하였다. 이를 위해, 유전체 안정성 평가에 있어서 기본적인 검사법으로 알려져 있는 G-banding 핵형 분석법을 수행하였다. G-banding 핵형 분석법은 단백질 분해효소인 트립신(trypsin)으로 전처리한 후, Giemsa 색소로 염색체를 염색하는 방법으로, 진정염색질(euchromatin)은 밝은 색으로, 이형염색질(heterochromatin)은 진한 색으로 염색된다. G-banding 핵형 분석법은 염색대(band)를 많이 생성하기 때문에 염색체 분석 시 가장 많이 사용되는 시험법이다.
G-banding 핵형 분석 결과, 도 4에 나타낸 바와 같이, ET-1 처리에 의해 염색체의 이상이 유발되지 않음을 확인하였다.
전술한 본 발명의 설명은 예시를 위한 것이며, 본 발명이 속하는 기술분야의 통상의 지식을 가진 자는 본 발명의 기술적 사상이나 필수적인 특징을 변경하지 않고서 다른 구체적인 형태로 쉽게 변형이 가능하다는 것을 이해할 수 있을 것이다. 그러므로 이상에서 기술한 실시예들은 모든 면에서 예시적인 것이며 한정적이 아닌 것으로 이해해야만 한다.
<210> 1
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> Oct4 forward primer
<400> 1
gaggcaacctggagaatttg 20
<210> 2
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> Oct4 reverse primer
<400> 2
tagcctggggtaccaaaatg 20

Claims (9)

  1. 인간 중간엽 줄기세포(Mesenchymal stem cell)의 줄기세포능(stemness)을 증가시키는 방법으로, 상기 방법은 줄기세포 배양액에 엔도텔린-1(Endothelin-1)을 처리하여 배양하는 단계를 포함하는 것을 특징으로 하는, 방법.
  2. 제1항에 있어서,
    상기 방법은 엔도텔린-1을 0.0125 내지 0.25ug/ml 농도로 처리하는 것을 특징으로 하는, 방법.
  3. 제1항에 있어서,
    상기 방법은 인간 중간엽 줄기세포의 텔로미어(telomere) 길이를 연장시키는 것을 특징으로 하는, 방법.
  4. 제1항에 있어서,
    상기 방법은 인간 중간엽 줄기세포의 수명을 연장시키는 것을 특징으로 하는, 방법.
  5. 제1항에 있어서,
    상기 방법은 엔도텔린-1을 상기 중간엽 줄기세포의 부착배양 24시간 후에 처리하는 것을 특징으로 하는, 방법.
  6. 제1항의 방법으로 줄기세포능이 증가된 인간 중간엽 줄기세포.
  7. 엔도텔린-1(Endothelin-1)을 유효성분으로 포함하는, 인간 중간엽 줄기세포(Mesenchymal stem cell)의 줄기세포능(stemness) 증가용 조성물.
  8. 제7항에 있어서,
    상기 조성물은 세포 배양액인 것을 특징으로 하는, 조성물.
  9. 제7항에 있어서,
    상기 엔도텔린-1은 0.0125 내지 0.25ug/ml 농도로 포함되는 것을 특징으로 하는, 조성물.
PCT/KR2015/012751 2015-01-19 2015-11-26 인간 중간엽 줄기세포의 줄기세포능을 증가시키는 방법 Ceased WO2016117816A1 (ko)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US15/544,619 US10294453B2 (en) 2015-01-19 2015-11-26 Method for increasing stemness of human mesenchymal stem cells

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR1020150008605A KR102048067B1 (ko) 2015-01-19 2015-01-19 인간 중간엽 줄기세포의 줄기세포능을 증가시키는 방법
KR10-2015-0008605 2015-01-19

Publications (1)

Publication Number Publication Date
WO2016117816A1 true WO2016117816A1 (ko) 2016-07-28

Family

ID=56417310

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2015/012751 Ceased WO2016117816A1 (ko) 2015-01-19 2015-11-26 인간 중간엽 줄기세포의 줄기세포능을 증가시키는 방법

Country Status (3)

Country Link
US (1) US10294453B2 (ko)
KR (1) KR102048067B1 (ko)
WO (1) WO2016117816A1 (ko)

Families Citing this family (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101980562B1 (ko) * 2017-01-16 2019-05-21 사회복지법인 삼성생명공익재단 옥살산염을 이용한 줄기세포능 향상 방법
KR102132807B1 (ko) 2017-12-13 2020-07-13 연세대학교 산학협력단 줄기세포능의 제어가 가능한 고분자 공중합체를 포함하는 줄기세포 배양 조성물
KR102177349B1 (ko) * 2018-02-13 2020-11-12 서울대학교병원 체세포 복제 효율 증진용 조성물
AU2020364800A1 (en) * 2019-10-08 2022-05-26 Genechem Inc. Composition for augmenting stemness and use thereof
CN111979187B (zh) * 2020-08-21 2022-04-08 遵义医科大学附属医院 一种抗人间充质干细胞衰老及增强其干性特征的方法
WO2024215151A1 (ko) * 2023-04-14 2024-10-17 의료법인 성광의료재단 세포의 줄기세포능 유도 인자 및 이를 이용하여 세포의 줄기세포능을 증가 또는 유지시키는 방법
KR102674715B1 (ko) * 2023-10-06 2024-06-13 휴먼바이오텍 주식회사 줄기세포의 텔로미어의 길이를 신장시키는 방법

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20070082394A1 (en) * 2005-10-06 2007-04-12 Coriell Institute For Medical Research Inc. Cell culture media, kits and methods of use
KR100908481B1 (ko) * 2006-04-24 2009-07-21 코아스템(주) 중간엽 줄기세포 배양 배지 및 이를 이용한 중간엽줄기세포의 배양 방법
KR20110115688A (ko) * 2010-04-16 2011-10-24 서울대학교병원 줄기세포의 활성을 증가시키는 방법 및 상기 방법에 의해 제조된 고활성 줄기 세포
KR20120134360A (ko) * 2011-06-02 2012-12-12 서울대학교병원 세포의 역분화 증진용 조성물 및 이를 이용한 유도 만능 줄기세포의 제조방법
KR20130061658A (ko) * 2011-12-01 2013-06-11 주식회사 알앤엘바이오 줄기세포를 젊게 만들기 위한 배지 조성물

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20070082394A1 (en) * 2005-10-06 2007-04-12 Coriell Institute For Medical Research Inc. Cell culture media, kits and methods of use
KR100908481B1 (ko) * 2006-04-24 2009-07-21 코아스템(주) 중간엽 줄기세포 배양 배지 및 이를 이용한 중간엽줄기세포의 배양 방법
KR20110115688A (ko) * 2010-04-16 2011-10-24 서울대학교병원 줄기세포의 활성을 증가시키는 방법 및 상기 방법에 의해 제조된 고활성 줄기 세포
KR20120134360A (ko) * 2011-06-02 2012-12-12 서울대학교병원 세포의 역분화 증진용 조성물 및 이를 이용한 유도 만능 줄기세포의 제조방법
KR20130061658A (ko) * 2011-12-01 2013-06-11 주식회사 알앤엘바이오 줄기세포를 젊게 만들기 위한 배지 조성물

Also Published As

Publication number Publication date
KR20160089110A (ko) 2016-07-27
US10294453B2 (en) 2019-05-21
KR102048067B1 (ko) 2019-11-22
US20180087027A1 (en) 2018-03-29

Similar Documents

Publication Publication Date Title
WO2016117816A1 (ko) 인간 중간엽 줄기세포의 줄기세포능을 증가시키는 방법
Xu et al. Mesenchymal stern cells from adult human bone marrow differentiate into a cardiomyocyte phenotype in vitro
Carlson et al. Loss of stem cell regenerative capacity within aged niches
US8334135B2 (en) Stem cells from adipose tissue, and differentiated cells from said cells
EP3286301B1 (en) Generation of muscle-lineage cells from stem cells
EP2665811B1 (en) Somatic cells with innate potential for pluripotency
Abu Kasim et al. Unique molecular signatures influencing the biological function and fate of post‐natal stem cells isolated from different sources
WO2008129563A2 (en) Human mesenchymal stem cells and preparation thereof
CN107937338B (zh) 一种来自多能干细胞的中胚层谱系间充质干细胞及其制备方法
Karaöz et al. A comprehensive characterization study of human bone marrow mscs with an emphasis on molecular and ultrastructural properties
Jeon et al. Differentiation potential of mesenchymal stem cells isolated from human dental tissues into non-mesodermal lineage
Lee et al. Transdifferentiation of mouse adipose-derived stromal cells into acinar cells of the submandibular gland using a co-culture system
Tomokiyo et al. Generation of neural crest‐like cells from human periodontal ligament cell‐derived induced pluripotent stem cells
US20120003186A1 (en) Method for dedifferentiating adipose tissue stromal cells
WO2014114023A1 (zh) 一种能够大规模并快速高纯度地诱导间充质干细胞转决定成造血干细胞的方法
Hua et al. Multipotent mesenchymal stem cells (MSCs) from human umbilical cord: potential differentiation of germ cells
WO2011102680A9 (ko) Pi3k/akt/gsk3 경로를 통해 성체줄기세포의 증식, 다분화능 및 재프로그래밍을 촉진하는 cd49f
CN101198691B (zh) 多种系干细胞的分离
WO2019103528A2 (ko) 무혈청 배지 조성물
Lin et al. Isolation, characterization and cardiac differentiation of human thymus tissue derived mesenchymal stromal cells
Rieske et al. A population of human brain cells expressing phenotypic markers of more than one lineage can be induced in vitro to differentiate into mesenchymal cells
O'Brien et al. Recent advances in and therapeutic potential of muscle‐derived stem cells
CN110628824A (zh) Dj-1功能丧失的细胞模型的构建方法与应用
CN113667635A (zh) 无异源培养基及使用其扩增间充质干细胞的方法
Cárdenas-León et al. Enhanced proliferative capacity of human preadipocytes achieved by an optimized cultivating method that induces transient activity of hTERT

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 15879070

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 15544619

Country of ref document: US

122 Ep: pct application non-entry in european phase

Ref document number: 15879070

Country of ref document: EP

Kind code of ref document: A1

32PN Ep: public notification in the ep bulletin as address of the adressee cannot be established

Free format text: NOTING OF LOSS OF RIGHTS PURSUANT TO RULE 112(1) EPC (EPO FORM 1205 DATED 19/12/2017)