WO2016104906A9 - Transfection system for producing genetically modified animal - Google Patents

Transfection system for producing genetically modified animal Download PDF

Info

Publication number
WO2016104906A9
WO2016104906A9 PCT/KR2015/007926 KR2015007926W WO2016104906A9 WO 2016104906 A9 WO2016104906 A9 WO 2016104906A9 KR 2015007926 W KR2015007926 W KR 2015007926W WO 2016104906 A9 WO2016104906 A9 WO 2016104906A9
Authority
WO
WIPO (PCT)
Prior art keywords
expression vector
recombinant
specific
sequence
recombinant expression
Prior art date
Application number
PCT/KR2015/007926
Other languages
French (fr)
Korean (ko)
Other versions
WO2016104906A1 (en
Inventor
강신욱
Original Assignee
연세대학교 산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 연세대학교 산학협력단 filed Critical 연세대학교 산학협력단
Publication of WO2016104906A1 publication Critical patent/WO2016104906A1/en
Publication of WO2016104906A9 publication Critical patent/WO2016104906A9/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K67/00—Rearing or breeding animals, not otherwise provided for; New or modified breeds of animals
    • A01K67/027—New or modified breeds of vertebrates
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/8509—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells for producing genetically modified animals, e.g. transgenic
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86—Viral vectors
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86—Viral vectors
    • C12N15/861—Adenoviral vectors
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86—Viral vectors
    • C12N15/867—Retroviral vectors
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2800/00—Nucleic acids vectors
    • C12N2800/30—Vector systems comprising sequences for excision in presence of a recombinase, e.g. loxP or FRT
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2840/00—Vectors comprising a special translation-regulating system
    • C12N2840/007—Vectors comprising a special translation-regulating system cell or tissue specific
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2840/00—Vectors comprising a special translation-regulating system
    • C12N2840/10—Vectors comprising a special translation-regulating system regulates levels of translation
    • C12N2840/102—Vectors comprising a special translation-regulating system regulates levels of translation inhibiting translation

Definitions

  • the present invention relates to a transfection system for the production of transgenic animals.
  • the upregul at i on or downregul at i on of a particular gene is closely related to the induction of disease and the development of the disease. Therefore, the production of artificially regulated transgenic animals (t ransgeni c animals) is essential for studying the exact role of specific genes in the study of disease. Transgenic animal production methods such as mediated rearrangement have been developed. Recently, the most actively used method is oocytes or embryonic stem cells (embryoni c stem eel Is), which knocks out the genes of oocytes or embryonic stem cells, It is a method of suppressing the expression of genes from the beginning of development.
  • this method affects all kinds of cells by inhibiting the expression of genes from the beginning of development, so that the survival of the transgenic animal itself is difficult, or other unexpected methods to replace the genes whose expression is suppressed. Not only does it have various problems such as increased or decreased expression of genes, but it also has a long time in the production of transgenic animals because it is necessary to produce a fully transgenic animal through maturation, or through mating. In fact, high costs are required.
  • Cre-recombinant-1 oxP system which can regulate the expression of genes by organspeci fic, has been widely used (Korean Journal of Endocrinology (2006) 21 (5): 364-639). Cre is a recombinant enzyme 0 ⁇ «) 111 ⁇ 56) that can recognize ⁇ ⁇ specifically to knock out genes in selected cells or tissues.
  • NASH National Institutes of Health
  • the present invention has been made to solve the above-mentioned problems in the prior art, a transfection system for producing a transgenic animal that can directly inhibit the expression of genes directly in adult species of various species and use thereof
  • the purpose is to provide a transgenic animal produced.
  • a recombinant expression vector of the present invention refers to a promoter that can be regulated to operate only in specific cells of interest.
  • Various types of cells that make up the kidney, such as the Hoxb7 promoter Means a gene (promoter) that expresses the subgene only in the collecting duct cell, but is not limited to any sequence that can control the expression of the vector specifically.
  • site-specific recombinase refers to a recombinant enzyme that performs recombination by recognizing only a specific sequence (recognition sequence).
  • recognition sequence a recombinant enzyme that recognizes two ⁇ sequences, such as Cre, but is not limited to any recombinant enzyme capable of recognizing two specific sequences on both sides and removing the middle sequence.
  • target gene refers to a target gene for which expression is to be regulated or to confirm function, and there is no limitation on the type of gene.
  • expression inhibiting oligonucleotide refers to a nucleotide fragment capable of suppressing the expression of a gene of interest, and specifically, a shRNA (short hairpin RNA), siRNA (siRNA) that specifically acts on a gene of interest. lencing NA), miRNA (micro RNA), antisense-oligonucleotide, etc., but may be a nucleotide fragment that can inhibit the expression of the target gene is not limited thereto.
  • the "target time” means a time to comprehensively check the function of the target gene, and there is no limitation as long as it is a step capable of transfecting the vector of the present invention.
  • the “function of the target gene” refers to the role, function, etc. of the target gene according to the time, organization (location) and the like of the target gene, if the element can be confirmed by controlling the expression of the gene is not limited thereto.
  • vector refers to a DNA fragment, nucleic acid molecule, etc. that is delivered into a cell, wherein the vector replicates DNA and can be independently remanufactured in a host cell and compatible with the term "carrier".
  • “Expression vector” means a recombinant DNA molecule comprising a coding sequence of interest and an appropriate nucleic acid sequence essential for expressing a coding sequence operably linked in a particular host organism, and generally a selection marker used in the vector. ), And various base sequences such as fluorescent protein expression genes may be further included.
  • transfection means a method of directly introducing DNA into an animal cell to mutate the genetic trait of the cell, and there is no limitation as long as the vector of the present invention can be introduced into the cell.
  • transgenic animal refers to an animal that can artificially control the expression of a specific gene by using the transfection system of the present invention.
  • Mouse, pig, goat There are no restrictions on species of animals such as sheep.
  • nasal layer is not limited thereto.
  • the present invention comprises the steps of: (a) transfecting a first recombinant expression vector comprising a cell-specific promoter and a site-specific recombinase; And (b) transfecting a second recombinant expression vector comprising a recognition sequence of the position-specific recombinase and an oligonucleotide for inhibiting expression of a gene of interest.
  • a method of inhibiting expression of a gene of interest comprising a stop codon sequence between two recombinant enzyme recognition sequences.
  • the present invention comprises the steps of: (a) transfecting a first recombinant expression vector comprising a cell-type specific promoter and a site-specific recombinase; And (b) transfecting a second recombinant expression vector comprising a recognition sequence of said position-specific recombinase and an oligonucleotide for inhibiting expression of a target gene at a desired time, wherein said second recombination is performed.
  • Expression vectors provide a method for identifying the function of a target gene at a desired time, including a stop codon sequence between two recombinant enzyme recognition sequences.
  • the present invention (a) a first recombinant expression vector comprising a cell-specific promoter (cen- type specific promoter) and site-specific recombinase (site- specif ic recombinase); And (b) a second recombinant expression vector comprising the recognition sequence of said position-specific recombinase and an oligonucleotide for inhibiting expression of the gene of interest.
  • a composition for inhibiting expression of a target gene comprising a stop codon sequence between two recombinant enzyme recognition sequences.
  • the present invention provides a composition comprising: (a) a first region comprising a ceU-type specific promoter and a site-specific recombinase; And (b) a second region comprising a promoter, a recognition region of the site-specific recombinase and an oligonucleotide for inhibiting expression of a target gene.
  • the present invention also provides a method for producing a transgenic animal except for humans, which comprises transfecting the vector into an animal other than a human, and a transgenic animal prepared by the method.
  • the recombinant expression vector is preferably characterized in that the vector described in FIG.
  • the present invention (a) transfection of animals except humans with a first recombinant expression vector comprising a cell-type specific promoter and a site-specific recombinase Doing; And (b) transfecting a second recombinant expression vector comprising a recognition sequence of the position-specific recombinase and an oligonucleotide for inhibiting expression of a target gene into an animal other than a human.
  • 2 Recombinant expression vectors provide a method for the production of transgenic animals, except humans, comprising a stop codon sequence between two recombinant enzyme recognition sequences.
  • the present invention is (a) a first recombinant expression vector comprising a cell-specific promoter (ceU—type specific promoter) and site-specific recombinase; And (b) a second recombinant expression vector comprising a recognition sequence of said position-specific recombinase and an oligonucleotide for inhibiting expression of a gene of interest.
  • a transgenic animal other than human comprising a stop codon sequence between two recombinant enzyme recognition sequences.
  • the cell-specific promoter is preferably a Hoxb7 promoter, including the nucleotide sequence of SEQ ID NO: 15, and the like, as long as it is a promoter capable of regulating cell-specific expression is not limited thereto.
  • the recombinant enzyme may be regulated only in specific cells under the control of the cell-specific promoter, preferably -e comprising the nucleotide sequence of SEQ ID NO: 16, SEQ ID NO: Flp and the like, which include the nucleotide sequence of 17, and a recombinant enzyme capable of recognizing a specific sequence and removing a gene between specific sequences are not limited thereto.
  • the first recombinant expression vector is preferably characterized in that the vector described in Figure 1A.
  • the sequence-specific recombinant enzyme recognizes the sequence ⁇ comprising the nucleotide sequence of SEQ ID NO: 18, FRT including the nucleotide sequence of SEQ ID NO: 19, etc., or the recombinant enzyme is recognized If it is a specific sequence is not limited thereto.
  • the oligonucleotide for inhibiting the expression of the target gene is not limited thereto as long as it is a substance capable of inhibiting the expression of a specific gene, such as shRNA (short hai rpin RNA) of the target gene.
  • the second recombinant expression vector is preferably characterized in that the vector described in FIG.
  • the recombinant expression vector may be a lentiviral, adenovirus (adenovi rus), retrovirus (ret rovi rus) and the like, but transfected with animal cells
  • adenovirus adenovi rus
  • retrovirus ret rovi rus
  • the type of virus that can be used for the virus is not limited thereto.
  • the recombinant expression vector may further include, in addition to the sequence included in the recombinant expression vector, such as a selection marker (sel ect i on marker), a fluorescent protein expression gene.
  • the transfection system for producing a transgenic animal according to the present invention can control the inhibition of expression of a gene of interest in a target cell of an adult animal by changing only the vector-specific promoter sequence of the vector and the shRNA sequence of the gene of interest.
  • a stop codon between two sequences recognized by the site-specific recombination enzyme it is possible to suppress the expression of the gene through RNA interference at the desired time. Therefore, by using the transfection system according to the present invention, it is possible to produce a transgenic animal with high efficiency in a short period of time at a low cost since it is possible to inhibit the expression of a target gene in a cell specific time at the desired time in the adult of various species It is expected that it can be easily used to study the role of various genes.
  • FIG. 1 is a diagram showing a dual transfection system according to an embodiment of the present invention.
  • FIG. 2 is a view showing the results of confirming the efficiency of the transfection system in in vi t ro according to an embodiment of the present invention.
  • FIG 3 is a view showing the results of confirming the efficiency of a single transfection system in vivo according to an embodiment of the present invention.
  • FIG. 4 is a view showing the results of confirming the efficiency of the dual transfection system in vivo in accordance with an embodiment of the present invention.
  • Figure 5 confirms the efficiency of the dual transfection system in vivo according to an embodiment of the present invention The figure which showed the result.
  • FIG. 6 is a diagram illustrating a single vector system according to an embodiment of the present invention.
  • a lent ivirus expressing loxP-AQP3 shRNA and a lent ivirus expressing HoxB7-Cre were used.
  • Produced. First, in order to produce a lentiviral vector, based on the aquaporin-3 (3 ⁇ 1330 11-3, AQP3) cDNA sequence of the mouse, siRNA Selection Web Server (http: //jura.wi. m.edu/bioc/siRNA), si NA target sites were selected, and a scrambled sequence was used as a control, and each synthesized oligonucleotide was determined by Xho I ⁇ of pSico lentiviral vector (Addgene).
  • the base sequences (SEQ ID NOS: 1 to 4) are shown in Table 1.
  • the HoxB7 promoter was inserted into the Xball-Nhel site of the Puro-Cr ⁇ empty vector (Addgene).
  • Each fabricated vector design is shown in FIG. 1.
  • a single vector was prepared by cutting the sequence located in front of the U6 promoter of the ' ⁇ — sMQP3' vector with restriction enzyme (Xbal) and inserting the Hoxb7 promoter -Cre recombinase sequence (SEQ ID NO: 20).
  • the fabricated single vector system design is shown in FIG. 6.
  • the vesicular stomatitis virus G protein plasmid was transfected together according to the calcium phosphate method. After 72 hours, the supernatant was collected and centrifuged at 780g for 5 minutes, filtered using a 0.45um filter, and the pellet was collected by centrifugation at 83,000g for 1.5 hours.
  • LV ⁇ Hoxb7 Cre lentiviral and LV—loxP shAQP3 lentiviral produced by the method of Example 1 the collecting cells (kidney collecting duct cell) and mesential cells (mesangial cell) ) was used. Each cell was treated with lentiviral 4 ⁇ 10 5 TU, incubated for 48 hours, then changed to a new culture medium, and further cultured for 72 hours, and then cultured cells were collected and used for the experiment. Transfection efficiency was measured by Western blotting of the expression level of mCherry and EGFP contained in each virus.
  • Western blotting was performed by lysing the collected cells using SDS sample buffer (2% SDS, 10 mM Tris-HCl, 10% (vol / vol) glycerol, pH6.8), and then buffer solution for Lae ⁇ ⁇ sample. After heating at 100 ° C for 5 minutes, the protein was separated by electrophoresis using a 12% aery 1 amide denaturing SDS-polyacrylamide gel, and then using a Hoeffer semi dry blotting apparatus, a Hybond-ECL membrane (membrane). ).
  • the protein-transferred membrane was polyclonal, diluted in blocking buffer A (1X PBS, 0.1% Tween 20, 5% nonfat milk), reacted for 1 hour at room temperature, and then diluted 1: 1, 000.
  • Membranes finished with reaction were washed once for 15 minutes using IX PBS added with 0.1% Tween 20, washed twice for 5 minutes to remove unbound antibody, and horseradish peroxidase-1 diluted 1: 2,000.
  • RNA STAT-60 reagent Te ⁇ Test
  • 700uL RNA STAT ⁇ 60 reagent After additional addition, mix well and leave for 5 minutes at-.
  • 160uL of chloroform (chloroform) was added and mixed vigorously for 30 seconds, and then centrifuged at 12,000g, 4 ° C for 15 minutes to collect only the supernatant.
  • Polymerase chain reaction is then at 95 ° C initially heated 9 minutes, 30 seconds at 94.5 ° C, 30 sec at 60 ° C, after repeating 35 cycles of 1 minute sequence at 72 ° C, 7 min at 72 ° C The reaction was carried out. And the temperature was set to increase to 2 ° C per minute from 60 ° C to 95 ° C, the melting curve was confirmed, and the amount of cDNA was measured using the comparative CT method. The results are shown in FIG.
  • Ant i sense GATCCGAGGGCCTCACTAAAC 8
  • mCherry was expressed in the collection tube cells treated with LV ⁇ Hoxb7 Cre, and the collection tube cells treated with LV-Hoxb7 Cre and LV-loxP scr, whereas EGFP It was confirmed that only observed in the collection tube cells treated with LV-loxP shAQP3.
  • FIG. 2B it was confirmed that expression of the AQP3 gene was suppressed only in cells treated with LVHoxb7 Cre and LV—loxP shAQP3 regardless of the amount of EGFP expression.
  • FIG. 2C mcherry was not expressed in vascular mesenteric cells, and all of the cells treated with LV-Hoxb7 Cre were expressed in EGFP.
  • Transfection efficiency was confirmed by semi-nested PCR and immunofluorescence staining by extracting the liver, spleen, kidney, trachea, and colon of each mouse. It was.
  • Semi- nested PCR was carried out in the same manner as in Example 2.1, each primer sequence used is shown in Table 3.
  • each extracted tissue was cut into 4 ⁇ height units, placed on a slide ( sl ide ), and acetone.
  • EGFP was strongly expressed in the liver, spleen, and kidney, whereas n herry was expressed only in the kidney.
  • LV57X7 Cre, LV-loxP shAQP3, LV-Hoxb7 Cre and LV-loxP shAQP3 were transfected into C57BL / 6J mice, respectively.
  • LV-loxP shAQP3 was injected on days 3, 7, and 11 after the last day of LV ⁇ HoxB7 Cre injection.
  • mice transfected with LV-Hoxb7 Cre As shown in FIG. 4, mCherry was expressed only in the collection tube cells in mice transfected with LV-Hoxb7 Cre, and expression of EGFP protein was increased in all cells including the collection tube cells in mice transfected with LV-loxP shAQP3. Confirmation (FIG. 4C). However, in both groups, there was no change in the expression level, urine volume, and osmotic pressure of urine (FIG. 4D). On the other hand, mice transfected with LV—Hoxb7 Cre and LV-loxP shAQP3 showed decreased protein and mRNA expression levels of AQP3 (FIG. 4B), increased urine volume, and decreased osmotic pressure (FIG. 4D). .
  • transfection system By using the transfection system according to the present invention, it is possible to produce a transgenic animal with high efficiency in a short period of time at a low cost since it is possible to inhibit the expression of a target gene in a specific time at a desired time in various species of animal adult. As such, it is expected to be easily used to study the role of various genes.

Landscapes

  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Zoology (AREA)
  • Chemical & Material Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Biotechnology (AREA)
  • Organic Chemistry (AREA)
  • Molecular Biology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Virology (AREA)
  • Environmental Sciences (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Veterinary Medicine (AREA)
  • Biodiversity & Conservation Biology (AREA)
  • Animal Husbandry (AREA)
  • Animal Behavior & Ethology (AREA)

Abstract

The present invention relates to a transfection system for producing a genetically modified animal. With the transfection system according to the present invention, a viral vector can be used in order to effect direct genetic modification in an adult animal, such that not only is it possible to cell-specifically regulate inhibition of expression of a target gene by changing only the cell-specific promoter sequence of the vector and the shRNA sequence of the target gene but it is also possible to inhibit gene expression at a desired time by including a stop codon between two sequences recognised by a site-specific recombination enzyme. Consequently, it is expected that the transfection system according to the present invention can be easily used in studies into the roles of diverse genes, because the transfection system is able to cell-specifically inhibit the expression of a target gene at a desired time in various species of adult animals, when used.

Description

【명세서】  【Specification】
【발명의 명칭】  [Name of invention]
형질전환동물 제작을 위한 형질주입 시스템 Transfection System for Transgenic Animal Production
【기술분야】 Technical Field
본 발명은 형질전환동물 제작을 위한 형질주입 시스템에 관한 것이다. 【배경기술】 The present invention relates to a transfection system for the production of transgenic animals. Background Art
특정 유전자의 과다발현 (upregul at i on) 또는 발현억제 (downregul at i on) 현상은 대부분 질병의 유발 및 질병의 발달 과정과 밀접하게 연관되어져 있다. 따라서， 유전자의 발현 을 인위적으로 조절한 형질전환동물 ( t ransgeni c animal )들의 제작은 질병의 연구에 있어 서 특정 유전자의 정확한 역할 연구를 위해 필수적인 요소이다ᅳ 이를 위하여， 비—선별 방법， 트랜스포존 -매개 재배치 등 형질전환동물 제작 방법이 개발되고 있다. 최근에 가 장 활발히 이용되고 있는 방법은 난모세포 (oocytes) 또는 배아줄기세포 (embryoni c stem eel I s)를 이용한 방법으로， 난모세포 또는 배아줄기세포의 유전자를 낙아웃 (knock-out ) 시켜， 발생 초기부터 유전자의 발현을 억제시키는 방법이다. 그러나 이러한 방법의 경우 에는 발생 초기부터 유전자의 발현을 억제시킴으로써 모든 종류의 세포에 영향을 주기 때문에 형질전환동물의 생존 자체가 어렵거나， 발현이 억제된 유전자를 대체하기 위한 생존방식으로 예상하지 못했던 다른 유전자들의 발현이 증가되거나 감소되는 등의 다양 한 문제점을 가지고 있을 뿐만 아니라， 발생과정을 거쳐 성체로 성장시키거나， 또는 교 배를 통하여 완전한 형질전환동물을 제작해야 하기 때문에 형질전환동물의 제작에 장시 간， 고비용이 요구되고 있는 실정이다. The upregul at i on or downregul at i on of a particular gene is closely related to the induction of disease and the development of the disease. Therefore, the production of artificially regulated transgenic animals (t ransgeni c animals) is essential for studying the exact role of specific genes in the study of disease. Transgenic animal production methods such as mediated rearrangement have been developed. Recently, the most actively used method is oocytes or embryonic stem cells (embryoni c stem eel Is), which knocks out the genes of oocytes or embryonic stem cells, It is a method of suppressing the expression of genes from the beginning of development. However, this method affects all kinds of cells by inhibiting the expression of genes from the beginning of development, so that the survival of the transgenic animal itself is difficult, or other unexpected methods to replace the genes whose expression is suppressed. Not only does it have various problems such as increased or decreased expression of genes, but it also has a long time in the production of transgenic animals because it is necessary to produce a fully transgenic animal through maturation, or through mating. In fact, high costs are required.
이와 같은 문제점을 극복하기 위하여， 최근에는 세포 또는 조직 특이적인 유전자 조작 기술이 활발히 개발되고 있다. 최근에는 기관특이적 (organspeci f i c)으로 유전자의 발현 을 조절할 수 있는 Cre-recombinant- l oxP 시스템이 널리 사용되어지고 있다 (대한내분비 학회지 (2006) 21(5)： 364-639) . Cre는 재조합 효소0^«)111^ 56)로서 위치 특이적으로 Ι οχΡ를 인식하여 선택된 세포 또는 조직에서 유전자를 낙아웃시킬 수 있다. 그러나 이러 한 장점에도 불구하고, 여전히 마우스를 교배시키는 데는 장시간이 소요될 뿐만 아니라， 교배 후 원하는 형질전환동물이 생산되는 데는 낮은 성공률을 나타내고 있고， 다른 종에 는 적용할수 없다는 단점들이 여전히 존재하고 있다. 또한， 국립보건원 (NIH)의 연구 보 고에 따르면, 세포특이적인 Cre 유전자를 배아줄기세포에 도입하고, 형질전환동물을 제 조하는 데는 대략 10만 내지 20만 USD(uni ted states do l l ar )가 소요된다고 보고된 바 있다. In order to overcome such a problem, recently, cell or tissue-specific gene manipulation techniques have been actively developed. In recent years, the Cre-recombinant-1 oxP system, which can regulate the expression of genes by organspeci fic, has been widely used (Korean Journal of Endocrinology (2006) 21 (5): 364-639). Cre is a recombinant enzyme 0 ^ «) 111 ^ 56) that can recognize Ι οχΡ specifically to knock out genes in selected cells or tissues. However, in spite of these advantages, not only does it take a long time to breed mice, but also shows a low success rate in producing a desired transgenic animal after mating, and there are still disadvantages that cannot be applied to other species. In addition, according to a report by the National Institutes of Health (NIH), cell-specific Cre genes are introduced into embryonic stem cells and transgenic animals are removed. It has been reported that roughly $ 100,000 to $ 200,000 (united states do ll ar) is required.
이와 같이， 저비용으로 단기간 내에 형질전환동물을 제작하기 위해서는 성체 동물에서 직접 세포특미적으로 유전자의 발현을 조절할 수 있는 시스템이 필요한 실정이다. As such, in order to produce a transgenic animal at a low cost in a short period of time, a system capable of directly controlling gene expression in an adult animal is required.
【발명의 상세한 설명】 [Detailed Description of the Invention]
【기술적 과제】  [Technical problem]
본 발명은 상기와 같은 종래 기술상의 문제점을 해결하기 위해 안출된 것으로， 다양한 종의 성체 동물에서 직접 세포특이적으로 유전자의 발현을 억제시킬 수 있는 형질전환동 물 제작을 위한 형질주입 시스템 및 이를 이용하여 제작된 형질전환동물을 제공하는 것 을 그 목적으로 한다. The present invention has been made to solve the above-mentioned problems in the prior art, a transfection system for producing a transgenic animal that can directly inhibit the expression of genes directly in adult species of various species and use thereof The purpose is to provide a transgenic animal produced.
그러나 본 발명이 이루고자 하는 기술적 과제는 이상에서 언급한 과제에 제한되지 않으 며， 언급되지 않은 또 다른 과제들은 아래의 기재로부터 당업계에서 통상의 지식을 가진 자에게 명확하게 이해될 수 있을 것이다. However, the technical problem to be achieved by the present invention is not limited to the above-mentioned problem, another task not mentioned will be clearly understood by those skilled in the art from the following description.
【과제 해결 수단】 [Task solution]
이하， 본원에 기재된 다양한 구체예가 도면을 참조로 기재된다. 하기 설명에서， 본 발명 의 완전한 이해를 위해서， 다양한 특이적 상세사항, 예컨대， 특이적 형태， 조성물， 및 공정 등이 기재되어 있다. 그러나, 특정의 구체예는 이들 특이적 상세 사항 중 하나 이 상 없이, 또는 다른 공지된 방법 및 형태와 함께 실행될 수 있다. 다른 예에서， 공지된 공정 및 제조 기술은 본 발명을 불필요하게 모호하게 하지 않게 하기 위해서 , 특정의 상 세사항으로 기재되지 않는다. "한 가지 구체예" 또는 "구체예1 '에 대한 본 명세서 전체를 통한 참조는 '구체예와 결부되어 기재된 특별한 특징， 형태, 조성 또는 특성이 본 발명의 하나 이상의 구체예에 포함됨을 의미한다. 따라서， 본 명세서 전체에 걸친 다양한 위치 에서 표현된 "한 가지 구체예에서" 또는 "구체예 "의 상황은 반드시 본 발명의 동일한 구 체예를 나타내지는 않는다. 추가로， 특별한 특징, 형태， 조성， 또는 특성은 하나 이상의 구체예에서 어떠한 적합한 방법으로 조합될 수 있다. 본 명세서에 있어서， "세포특이적 프로모터 (cel l-type spec i f i c promoter ) "란 목적하는 세포의 종류에서만 하위 유전자의 발현을 조절할 수 있는 프로모터로서， 본 발명의 재조 합 발현 백터가 목적하는 특정 세포에서만 작동되도톡 조절할 수 있는 프로모터를 의미 한다. 예를 들어， Hoxb7 프로모터와 같이 신장 (kidney)을 구성하는 다양한 종류의 세포 중 집합관 세포 (collecting duct cell)에서만 하위 유전자를 발현시키는 유전자 (프로모 터)를 의미하나, 세포특이적으로 백터의 발현을 조절할 수 있는 서열이라면 이에 제한되 지 않는다. Hereinafter, various embodiments described herein are described with reference to the drawings. In the following description, for a thorough understanding of the present invention, various specific details are set forth, such as specific forms, compositions, processes and the like. However, certain embodiments may be practiced without one or more of these specific details, or in combination with other known methods and forms. In other instances, well-known processes and manufacturing techniques have not been described in particular detail in order to not unnecessarily obscure the present invention. To "one embodiment" or "embodiment 1" see through this specification for the 'means included in the special features described in conjunction with embodiments, forms, embodiments in which the composition or properties of one or more of the present invention; Thus, the context of “in one embodiment” or “embodiment” expressed at various places throughout this specification does not necessarily represent the same embodiment of the invention. In addition, a particular feature, form, composition, or The properties may be combined in any suitable manner in one or more embodiments.In this specification, a "cel l-type spec ific promoter" may regulate expression of a subgene only in the type of cell of interest. As a promoter, a recombinant expression vector of the present invention refers to a promoter that can be regulated to operate only in specific cells of interest. Various types of cells that make up the kidney, such as the Hoxb7 promoter Means a gene (promoter) that expresses the subgene only in the collecting duct cell, but is not limited to any sequence that can control the expression of the vector specifically.
본 명세서쎄 있어서， "위치특이적 재조합 효소 (site— specific recombinase)"란 특정 서 열만을 인식 (인식 서열)하여 재조합 작용을 하는 재조합 효소를 의미한다. 예를 들어, Cre와 같이 두 개의 ΙοχΡ 서열을 인식하는 재조합 효소를 의미하나， 양 쪽 두 개의 특정 서열을 인식하여 가운데 서열을 제거할 수 있는 재조합 효소라면 이에 제한되지 않는다. 본 명세서에 있어서， "목적 유 자 (target gene)"란 발현을 조절하고자 하는 또는 기능 을 확인하고자 하는 타겟 유전자를 의미하며 , 유전자의 종류에는 제한이 없다. In the present specification, "site-specific recombinase" refers to a recombinant enzyme that performs recombination by recognizing only a specific sequence (recognition sequence). For example, it refers to a recombinant enzyme that recognizes two ΙοχΡ sequences, such as Cre, but is not limited to any recombinant enzyme capable of recognizing two specific sequences on both sides and removing the middle sequence. In the present specification, "target gene" refers to a target gene for which expression is to be regulated or to confirm function, and there is no limitation on the type of gene.
본 명세서에 있어서， "발현 억제용 올라고뉴클레오티드 (oligonucleotide)"란 목적 유전 자의 발현을 억제할 수 있는 뉴클레오티드 단편을 의미하며， 목적 유전자에 특이적으로 작용하는 shRNA(short hairpin RNA), siRNA(si lencing NA), miRNA(micro RNA) , antisense-oligonucleotide 등 일 수 있으나， 목적 유전자의 발현을 억제할 수 있는 뉴 클레오티드 단편이라면 이에 제한되지 않는다. In the present specification, "expression inhibiting oligonucleotide" refers to a nucleotide fragment capable of suppressing the expression of a gene of interest, and specifically, a shRNA (short hairpin RNA), siRNA (siRNA) that specifically acts on a gene of interest. lencing NA), miRNA (micro RNA), antisense-oligonucleotide, etc., but may be a nucleotide fragment that can inhibit the expression of the target gene is not limited thereto.
본 명세서에 있어서， "목적하는 시기"란 목적 유전자의 기능을 확인하고자 하는 시기를 포괄적으로 의미하며, 본 발명의 백터를 형질주입할 수 있는 단계라면 시기에는 제한이 없다. 상기 "목적 유전자의 기능' '이란 목적 유전자의 시기별, 조직별 (위치별) 등에 따른 목적 유전자의 역할， 기능 등을 의미하며 , 유전자의 발현을 조절하여 확인할 수 있는 요 소라면 이에 제한되지 않는다. In the present specification, the "target time" means a time to comprehensively check the function of the target gene, and there is no limitation as long as it is a step capable of transfecting the vector of the present invention. The "function of the target gene" refers to the role, function, etc. of the target gene according to the time, organization (location) and the like of the target gene, if the element can be confirmed by controlling the expression of the gene is not limited thereto.
본 명세서에 있어서 , "백터 (vector)"란 세포 내로 전달되는 DNA 단편， 핵산 분자 등을 의미하며, 상기 백터는 DNA를 복제시키고， 숙주세포에서 독립적으로 재제조될 수 있으며 용어 "전달체 "와 호환하여 사용될 수 있다. "발현 백터"는 목적한 코딩 서열과， 특정 숙 주 생물에서 작동 가능하게 연결된 코딩 서열을 발현하는데 필수적인 적정 핵산 서열을 포함하는 재조합 DNA 분자를 의미하며， 일반적으로 백터에 사용되는 선별 마커 (selection marker), 형광 단백질 발현 유전자 등 다양한 염기서열을 추가로 포함할 수 있다. As used herein, "vector" refers to a DNA fragment, nucleic acid molecule, etc. that is delivered into a cell, wherein the vector replicates DNA and can be independently remanufactured in a host cell and compatible with the term "carrier". Can be used. "Expression vector" means a recombinant DNA molecule comprising a coding sequence of interest and an appropriate nucleic acid sequence essential for expressing a coding sequence operably linked in a particular host organism, and generally a selection marker used in the vector. ), And various base sequences such as fluorescent protein expression genes may be further included.
본 명세서에. 있어서 , "형질주입 (transfection)"이란， 동물 세포에 DNA를 직접 도입하여 세포의 유전 형질을 변이시키는 방법을 의미하며， 본 발명의 백터를 세포에 도입할 수 방법이라면 제한이 없다 . Herein. In the present invention, "transfection" means a method of directly introducing DNA into an animal cell to mutate the genetic trait of the cell, and there is no limitation as long as the vector of the present invention can be introduced into the cell.
본 명세서에 있어서， "형질전환동물 (transgenic animal )"이란, 본 발명의 형질주입 시스 템을 이용하여 특정 유전자 (target gene)의 발현을 인위적으로 조절할 수 있는 동물을 의미하며， 마우스, 돼지, 염소， 양 등 동물의 종에는 제한이 없다. 이 외에도 식물체, 곤층 등 본 발명의 형질주입 시스템을 이용하여 유전자의 발현을 조절할 수 있는 개체라 면 이에 제한되지 않는다 . 본 발명은 (a) 세포특이적 프로모터 (eel卜 type specific promoter) 및 위치특이적 재조 합 효소 (site-specific recombinase)를 포함하는 제 1 재조합 발현 백터를 형질주입 (transfection)하는 단계; 및 (b) 상기 위치특이적 재조합 효소의 인식 서열 및 목적 유 전자의 발현 억제용 을리고뉴클레오티드 (oligonucleotide)를 포함하는 제 2 재조합 발현 백터를 형질주입하는 단계를 포함하고， 상기 제 2 재조합 발현 백터는 두 개의 재조합 효소 인식 서열 사이에 종결코돈 (stop codon) 서열을 포함하는, 목적 유전자의 발현을 억제하는 방법을 제공한다. 상기 목적 유전자의 발현을 억제하는 방법은'바람직하게는 두 개의 재조합 효소 인식 서열 사이에 존재하는 종결코돈을 재조합 효소를 이용하여 제 거하고, 이를 통하여 목적 유전자의 발현을 RNA간섭을 통해 억제하는 방법이다. 또한, 본 발명은 (a) 세포특이적 프로모터 (cell-type specific promoter) 및 위치특이적 재조합 효소 (site-specific recombinase)를 포함하는 제 1 재조합 발현 백터를 형질주입 (transfection)하는 단계; 및 (b) 목적하는 시기에 상기 위치특이적 재조합 효소의 인식 서열 및 목적 유전자의 발현 억제용 올리고뉴클레오티드 (oligonucleotide)를 포함하는 제 2 재조합 발현 백터를 형질주입하는 단계를 포함하고， 상기 제 2 재조합 발현 백터는 두 개의 재조합 효소 인식 서열 사이에 종결코돈 (stop codon) 서열을 포함하는， 목적하 는 시기의 목적 유전자의 기능을 확인하는 방법을 제공한다. 또한， 본 발명은 (a) 세포특이적 프로모터 (cen— type specific promoter) 및 위치특이적 재조합 효소 (site— specif ic recombinase)를 포함하는 제 1 재조합 발현 백터; 및 (b) 상 기 위치특이적 재조합 효소의 인식 서열 및 목적 유전자의 발현 억제용 올리고뉴클레오 티드 (oligonucleot ie)를 포함하는 제 2 재조합 발현 백터를 포함하고， 상기 제 2 재조 합 발현 백터는 두 개의 재조합 효소 인식 서열 사이에 종결코돈 (stop codon) 서열을 포 함하는， 목적 유전자의 발현 억제용 조성물을 제공한다. 또한, 본 발명은 (a) 세포특이적 프로모터 (ceU— type specific promoter) 및 위치특이적 재조합 효소 (site-specific recombinase)를 포함하는 제 1 지역 (region); 및 (b) 프로모 터， 상기 위치특이적 재조합 효소의 인식 서열 및 목적 유전자의 발현 억제용 올리고뉴 클레오티드 (oHgonucleotide)를 포함하는 제 2 지역을 포함하는 재조합 발현 백터를 제 공한다. 또한, 본 발명은 상기 백터를 인간을 제외한 동물에 형질주입 (transfection)하 는 단계를 포함하는 인간을 제외한 형질전환동물의 제조 방법 및 상기 방법으로 제조된 형질전환동물을 제공한다. 본 발명의 일 구체예에서， 상기 재조합 발현 백터는 바람직하 게는 도 6에 기재된 백터인 것을 특징으로 한다. 또한， 본 발명은 (a) 세포특이적 프로모터 (cell-type specific promoter) 및 위치특이적 재조합 효소 (site-specific recombinase)를 포함하는 제 1 재조합 발현 백터를 인간을 제외한 동물에 형질주입 (transfection)하는 단계 ; 및 (b) 상기 위치특이적 재조합 효소 의 인식 서열 및 목적 유전자의 발현 억제용 올리고뉴클레오티드 (oligonucleotide)를 포 함하는 제 2 재조합 발현 백터를 인간을 제외한 동물에 형질주입하는 단계를 포함하고， 상기 제 2 재조합 발현 백터는 두 개의 재조합 효소 인식 서열 사이에 종결코돈 (stop codon) 서열을 포함하는， 인간을 제외한 형질전환동물의 제조 방법을 제공한다. 또한， 본 발명은 (a) 세포특이적 프로모터 (ceU—type specific promoter) 및 위치특이적 재조합 효소 (site-specific recombinase)를 포함하는 제 1 재조합 발현 백터; 및 (b) 상 기 위치특이적 재조합 효소의 인식 서열 및 목적 유 전자의 발현 억제용 을리고뉴클레 오티드 (oligonucleotide)를 포함하는 제 2 재조합 발현 백터를 포함하고， 상기 제 2 재 조합 발현 백터는 두 개의 재조합 효소 인식 서열 사이에 종결코돈 (stop codon) 서열을 포함하는， 인간을 제외한 형질전환동물을 제공한다. 본 발명의 일 구체예에서 , 상기 세포특이적 프로모터는 바람직하게는 서열번호 15의 염 기서열을 포함하는 Hoxb7 프로모터 등이나， 세포특이적으로 발현을 조절할 수 있는 프로 모터라면 이에 제한되지 않는다. In the present specification, "transgenic animal" refers to an animal that can artificially control the expression of a specific gene by using the transfection system of the present invention. Mouse, pig, goat ， There are no restrictions on species of animals such as sheep. In addition to plants, As long as the individual that can control the expression of the gene using the transfection system of the present invention, such as nasal layer is not limited thereto. The present invention comprises the steps of: (a) transfecting a first recombinant expression vector comprising a cell-specific promoter and a site-specific recombinase; And (b) transfecting a second recombinant expression vector comprising a recognition sequence of the position-specific recombinase and an oligonucleotide for inhibiting expression of a gene of interest. Provides a method of inhibiting expression of a gene of interest, comprising a stop codon sequence between two recombinant enzyme recognition sequences. How to a method for inhibiting the expression of the target gene is' preferably two recombinase recognizing the termination codon present between the sequences using recombinant enzyme expression of a target gene through the removal, and this inhibition by RNA interference to be. In addition, the present invention comprises the steps of: (a) transfecting a first recombinant expression vector comprising a cell-type specific promoter and a site-specific recombinase; And (b) transfecting a second recombinant expression vector comprising a recognition sequence of said position-specific recombinase and an oligonucleotide for inhibiting expression of a target gene at a desired time, wherein said second recombination is performed. Expression vectors provide a method for identifying the function of a target gene at a desired time, including a stop codon sequence between two recombinant enzyme recognition sequences. In addition, the present invention (a) a first recombinant expression vector comprising a cell-specific promoter (cen- type specific promoter) and site-specific recombinase (site- specif ic recombinase); And (b) a second recombinant expression vector comprising the recognition sequence of said position-specific recombinase and an oligonucleotide for inhibiting expression of the gene of interest. Provided is a composition for inhibiting expression of a target gene, comprising a stop codon sequence between two recombinant enzyme recognition sequences. In addition, the present invention provides a composition comprising: (a) a first region comprising a ceU-type specific promoter and a site-specific recombinase; And (b) a second region comprising a promoter, a recognition region of the site-specific recombinase and an oligonucleotide for inhibiting expression of a target gene. Ball. The present invention also provides a method for producing a transgenic animal except for humans, which comprises transfecting the vector into an animal other than a human, and a transgenic animal prepared by the method. In one embodiment of the invention, the recombinant expression vector is preferably characterized in that the vector described in FIG. In addition, the present invention (a) transfection of animals except humans with a first recombinant expression vector comprising a cell-type specific promoter and a site-specific recombinase Doing; And (b) transfecting a second recombinant expression vector comprising a recognition sequence of the position-specific recombinase and an oligonucleotide for inhibiting expression of a target gene into an animal other than a human. 2 Recombinant expression vectors provide a method for the production of transgenic animals, except humans, comprising a stop codon sequence between two recombinant enzyme recognition sequences. In addition, the present invention is (a) a first recombinant expression vector comprising a cell-specific promoter (ceU—type specific promoter) and site-specific recombinase; And (b) a second recombinant expression vector comprising a recognition sequence of said position-specific recombinase and an oligonucleotide for inhibiting expression of a gene of interest. Provides a transgenic animal other than human, comprising a stop codon sequence between two recombinant enzyme recognition sequences. In one embodiment of the present invention, the cell-specific promoter is preferably a Hoxb7 promoter, including the nucleotide sequence of SEQ ID NO: 15, and the like, as long as it is a promoter capable of regulating cell-specific expression is not limited thereto.
본 발명의 다른 구체예에서， 상기 재조합 효소는 상기 세포특이적 프로모터의 조절 하에 있어서， 특정 세포에서만 발현이 조절될 수 있으며， 바람직하게는 서열번호 16의 염기서 열을 포함하는 -e, 서열번호 17의 염기서열을.포함하는 Flp 등이나, 특정 서열을 인식 하여 특정 서열 사이 유전자를 제거할 수 있는 재조합 효소라면 이에 제한되지 않는다. 본 발명의 또 다른 구체예에서， 상기 제 1 재조합 발현 백터는 바람직하게는 도 1A에 기 재된 백터인 것을 특징으로 한다. In another embodiment of the present invention, the recombinant enzyme may be regulated only in specific cells under the control of the cell-specific promoter, preferably -e comprising the nucleotide sequence of SEQ ID NO: 16, SEQ ID NO: Flp and the like, which include the nucleotide sequence of 17, and a recombinant enzyme capable of recognizing a specific sequence and removing a gene between specific sequences are not limited thereto. In another embodiment of the invention, the first recombinant expression vector is preferably characterized in that the vector described in Figure 1A.
본 발명의 또 다른 구체예에서, 상기 위치특이적 재조합 효소가 인식하는 서열은 서열번 호 18의 염기서열을포함하는 ΙοχΡ, 서열번호 19의 염기서열을포함하는 FRT 등이나， 재 조합 효소가 인식하는 특정 서열이라면 이에 제한되지 않는다. 본 발명와 또 다른 구체예에서， 상기 목적 유전자의 발현 억제용 올리고뉴클레오티드는 목적 유전자의 shRNA(short hai rpin RNA) 등이나， 특정 유전자의 발현을 억제할 수 있는 물질이라면 이에 제한되지 않는다. In another embodiment of the present invention, the sequence-specific recombinant enzyme recognizes the sequence ΙοχΡ comprising the nucleotide sequence of SEQ ID NO: 18, FRT including the nucleotide sequence of SEQ ID NO: 19, etc., or the recombinant enzyme is recognized If it is a specific sequence is not limited thereto. In another embodiment of the present invention, the oligonucleotide for inhibiting the expression of the target gene is not limited thereto as long as it is a substance capable of inhibiting the expression of a specific gene, such as shRNA (short hai rpin RNA) of the target gene.
본 발명의 또 다른 구체예에서， 상기 제 2 재조합 발현 백터는 바람직하게는 도 B에 기 재된 백터인 것을 특징으로 한다. In another embodiment of the invention, the second recombinant expression vector is preferably characterized in that the vector described in FIG.
발명의 또 다른 구체예에서， 상기 재조합 발현 백터는 렌티바이러스 ( l ent ivi rus) , 아데 노바이러스 (adenovi rus) , 레트로바이러스 (ret rovi rus) 등 일 수 있으나， 동물 세포에 감 염되어 형질주입에 사용될 수 있는 바이러스 종류라면 이에 제한되지 않는다. In another embodiment of the invention, the recombinant expression vector may be a lentiviral, adenovirus (adenovi rus), retrovirus (ret rovi rus) and the like, but transfected with animal cells The type of virus that can be used for the virus is not limited thereto.
본 발명의 또 다른 구체예에서 , 상기 재조합 발현 백터는 이외에 선별 마커 (sel ect i on marker ) , 형광단백질 발현 유전자 등 일반적으로 재조합 발현 백터에 포함되는 서열 등 을 추가로 포함할 수 있다. In another embodiment of the present invention, the recombinant expression vector may further include, in addition to the sequence included in the recombinant expression vector, such as a selection marker (sel ect i on marker), a fluorescent protein expression gene.
【발명의 효과】 " [Effects of the Invention] "
본 발명에 따른 형질전환동물 제작을 위한 형질주입 시스템은 백터의 세포특이적 프로모 터 서열 및 목적하는 유전자의 shRNA 서열만 변경함으로써, 성체 동물의 목적하는 세포 에서 목적하는 유전자의 발현 억제를 조절할 수 있을 뿐 만 아니라， 위치특이적 재조합 효소가 인식하는 두 개의 서열 사이에 종결코돈을 포함함으로써， 원하는 시기에 RNA 간 섭을 통하여 유전자의 발현을 억제시킬 수 있다. 따라서 본 발명에 따른 형질주입 시스 템을 이용하면, 다양한 종의 동물 성체에 서 원하는 시기에 세포특이적으로 목적 유전 자의 발현을 억제시킬 수 있기 때문에 저렴한 비용으로 단기간에 높은 효을로 형질전환 동물을 제작할 수 있기 때문에 다양한 유전자의 역할 연구에 용이하게 사용될 수 있을 것으로 기대된다. The transfection system for producing a transgenic animal according to the present invention can control the inhibition of expression of a gene of interest in a target cell of an adult animal by changing only the vector-specific promoter sequence of the vector and the shRNA sequence of the gene of interest. In addition, by including a stop codon between two sequences recognized by the site-specific recombination enzyme, it is possible to suppress the expression of the gene through RNA interference at the desired time. Therefore, by using the transfection system according to the present invention, it is possible to produce a transgenic animal with high efficiency in a short period of time at a low cost since it is possible to inhibit the expression of a target gene in a cell specific time at the desired time in the adult of various species It is expected that it can be easily used to study the role of various genes.
【도면의 간단한 설명】 [Brief Description of Drawings]
도 1은 본 발명의 일 실시예에 따른 이중 형질주입 시스템을 나타낸 도면이다. 1 is a diagram showing a dual transfection system according to an embodiment of the present invention.
도 2는 본 발명의 일 실시예에 따른 in vi t ro에서 형질주입 시스템의 효율을 확인한 결 과를 나타낸 도면이다. 2 is a view showing the results of confirming the efficiency of the transfection system in in vi t ro according to an embodiment of the present invention.
도 3은 본 발명의 일 실시예에 따론 in vivo에서 단일 형질주입 시스템의 효율을 확인한 결과를 나타낸 도면이다. 3 is a view showing the results of confirming the efficiency of a single transfection system in vivo according to an embodiment of the present invention.
도 4는 본 발명의 일 실시예에 따른 i n vivo에서 이중 형질주입 시스템의 효율을 확인한 결과를 나타낸 도면이다. 4 is a view showing the results of confirming the efficiency of the dual transfection system in vivo in accordance with an embodiment of the present invention.
도 5는 본 발명의 일 실시예에 따른 in vivo에서 이중 형질주입 시스템의 효율을 확인한 결과를 나타낸 도면이다. Figure 5 confirms the efficiency of the dual transfection system in vivo according to an embodiment of the present invention The figure which showed the result.
도 6은 본 발명의 일 실시예에 따른 단일 백터 시스템을 나타낸 도면이다. 6 is a diagram illustrating a single vector system according to an embodiment of the present invention.
【발명의 실시를 위한 최선의 형태】 [Best form for implementation of the invention]
이하， 실시예를 통하여 본 발명을 더욱 상세히 설명하고자 한다. 이들 실시예는 오로지 본 발명을 보다 구체적으로 설명하기 위한 것으로서 , 본 발명의 요지에 따라 본 발명의 범위가 이들 실시예에 의해 제한되지 않는다는 것은 당업계에서 통상의 지식을 가진 자 에게 있어서 자명할 것이다. 실시예 1: 형질주입 시스템의 제작 Hereinafter, the present invention will be described in more detail with reference to Examples. These examples are only for illustrating the present invention in more detail, it will be apparent to those skilled in the art that the scope of the present invention is not limited by these examples in accordance with the gist of the present invention. . Example 1 Construction of Transfection System
1.1. 백터의 제작 1.1. The making of the vector
형질전환 동물 (transgenic animal)을 제조하기 위한 형질주입 시스템 (transfection system)을 제작하기 위하여， loxP-AQP3 shRNA를 발현하는 렌티바이러스 ( lent ivirus) 및 HoxB7-Cre를 발현하는 렌티바이러스 ( lent ivirus)를 제작하였다. 우선 렌티바이러스용 백 터를 제작하기 위하여， 마우스 (mouse)의 아쿠아포린-3(3먀1330 11-3， AQP3) cDNA 서열을 기초로 하여， siRNA Selection Web Server(http://jura.wi .m .edu/bioc/siRNA)에서 si NA 타겟 사이트를 정하고, 대조군으로는 무작위 서열 (scrambled sequence)을 사용하 였고， 각각의 합성된 올리고뉴클레오티드 (oligonucleotide)는 pSico lentiviral vector (Addgene)의 Xho I -Hpa I. 사이트에 삽입하였다. 염기서열 (서열번호 1 내지 4)은 표 1에 나타내었다. 또한， HoxB7 프로모터 (promoter)는 Puro-Cr^ empty vector (Addgene) 의 Xball— Nhel 사이트에 삽입하였다. 각각의 제작된 백터 디자인은 도 1에 나타내었다. 또한， 단일 백터 시스템을 위해서는 'ΊοχΡ— sMQP3" 백터의 U6 프로모터 앞에 위치한 서 열을 제한효소 (Xbal )로 자른 후， Hoxb7 프로모터 -Cre recombinase 서열 (서열번호 20)을 삽입하여 단일 백터를 제작하였다. 제작된 단일 백터 시스템 디자인은 도 6에 나타내었 다. In order to construct a transfection system for producing transgenic animals, a lent ivirus expressing loxP-AQP3 shRNA and a lent ivirus expressing HoxB7-Cre were used. Produced. First, in order to produce a lentiviral vector, based on the aquaporin-3 (3 먀 1330 11-3, AQP3) cDNA sequence of the mouse, siRNA Selection Web Server (http: //jura.wi. m.edu/bioc/siRNA), si NA target sites were selected, and a scrambled sequence was used as a control, and each synthesized oligonucleotide was determined by Xho I − of pSico lentiviral vector (Addgene). Inserted at the Hpa I. site. The base sequences (SEQ ID NOS: 1 to 4) are shown in Table 1. In addition, the HoxB7 promoter was inserted into the Xball-Nhel site of the Puro-Cr ^ empty vector (Addgene). Each fabricated vector design is shown in FIG. 1. Also, for the single vector system, a single vector was prepared by cutting the sequence located in front of the U6 promoter of the 'ΊοχΡ— sMQP3' vector with restriction enzyme (Xbal) and inserting the Hoxb7 promoter -Cre recombinase sequence (SEQ ID NO: 20). The fabricated single vector system design is shown in FIG. 6.
【표 1】 Table 1
Gene Sequence(5 ' -> 3' ) 서열번호 Gene Sequence (5 '-> 3') Sequence Number
Sense： TGCCATCGnGACCCmTAmMGAGATAT G(¾}TC CGAT(^CTTmTC 1Sense ： TGCCATCGnGACCCmTAmMGAGATAT G (¾) TC CGAT (^ CTTmTC 1
AQP3 AQP3
Ant i sense:  Ant i sense:
shRNA 2shRNA 2
TCGAGAAAAAAGCCATCGTTGACCCTTATATCTCTTGAATATAAGGGTCAACGATGGCA Sense: TCGAGAAAAAAGCCATCGTTGACCCTTATATCTCTTGAATATAAGGGTCAACGATGGCA Sense:
3 3
Scram TGCGTATGAGTAGTGCGCAGAmC GAG TCTGCGCACTACTCATACGCmTTTC Scram TGCGTATGAGTAGTGCGCAGAmC GAG TCTGCGCACTACTCATACGCmTTTC
bled Ant i sense: bled Ant i sense:
4 4
TCGAGAAAAAAGCGTATGAGTAGTGCGCAGATTCTCnGAAATCTGCGCACTACTCATACGCA TCGAGAAAAAAGCGTATGAGTAGTGCGCAGATTCTCnGAAATCTGCGCACTACTCATACGCA
1.2. 형질전환된 렌티바이러스 제작 1.2. Transformed lentivirus production
인간의 배아 신장 (human embryonic kidney, HEK) 293FT 세포주 (Invitrogen)에 실시예 1.1의 방법으로 제조한 각각의 발현 백터 (expression vector)와 두 종류의 헬퍼 플라스 미드 (helper plasmid)인 pCMV ᅀ 8.9 및 수포성 구내염 바이러스 G 단백질 플라스미드 (vesicular stomatitis virus G protein plasmid)를 함께 칼슘一포스페이트 방법 (calcium phosphate method)에 따라 형질주입 (transf ect ion)하였다. 그리고 72시간 후에 상층액을 수거하여 780g에서 5분간 원심분리하고, 0.45um 필터를 이용하여 걸러내고, 다시 83,000g에서 1.5시간 동안 원심분리를 시행하여 가라앉은 펠렛 (pellet)을 수거하였다. 수거된 펠렛에 lOOuL의 PBS(phosphate buffered saline)를 첨가하고 렌티바이러스 (lentivirus)의 양을 측정한 다음 4X108 transf ect ion units/mL이 되도록 나누어 -80 °C 에서 사용시까지 보관하였다. 실시예 2: 유전자 발현 억제 확인 Each expression vector and two helper plasmids, pCMV ᅀ 8.9 and number, prepared by the method of Example 1.1 on a human embryonic kidney (HEK) 293FT cell line (Invitrogen) The vesicular stomatitis virus G protein plasmid was transfected together according to the calcium phosphate method. After 72 hours, the supernatant was collected and centrifuged at 780g for 5 minutes, filtered using a 0.45um filter, and the pellet was collected by centrifugation at 83,000g for 1.5 hours. 100uL of phosphate buffered saline (PBS) was added to the collected pellets, and the amount of lentiviruses was measured and divided into 4 × 10 8 transfect ion units / mL and stored at -80 ° C until use. Example 2: Confirmation of Gene Expression Inhibition
2.1. in vitro 실험 2.1. in vitro experiment
실시예 1의 방법으로 제작된 LVᅳ Hoxb7 Cre 렌티바이러스와 LV— loxP shAQP3 렌티바이러스 의 유전자 발현 억제능 (gene silencing ability)을 확인하기 위하여， 집합관 세포 (kidney collecting duct cell)와 혈관간막세포 (mesangial cell)를 사용하였다. 각각의 세포에 렌티바이러스 4X105 TU를 처리하고, 48시간 배양한 후에 새로운 배양용 배지로 갈아준 후 다시 72시간 동안 추가 배양한 후에 배양된 세포를 수거하여 실험에 사용하였 다. 형질주입 효율은 각각의 바이러스에 포함되어 있는 mCherry 및 EGFP의 발현량을 웨 스턴 블로팅 (western blotting)으로 확인하여 측정하였다. 웨스턴 블로팅은 수거된 세포 를 SDS 시료용 완충용액 (2% SDS, 10mM Tris-HCl, 10%(vol/vol) glycerol, pH6.8)을 이용 하여 용해시킨 후， Lae隱 Π 시료용 완충용액을 처리하고， 100°C에서 5분간 가열한 후에 12% aery 1 amide denaturing SDS-polyacrylamide 겔을 이용하여 전기영동하여 단백질을 분리한 早에， Hoeffer semi dry blotting apparatus를 이용하여 Hybond-ECL 막 (membrane) 으로 이동시켰다. 단백질이 이동된 막은 blocking buffer A(1X PBS, 0.1% Tween 20， 5% nonfat mi lk)에 담가 실온에서 1시간 동안 반웅시킨 후에 1:1, 000으로 회석한 다클론성 항체 (polyclonal antibody)인 AQP3(Abcam), EGFP(Abcam) , mCherry(GeneFopoeia) , 또는 beta-act in(Sigma-Aldrich)을 각각 처리한 후에 4°C에서 16시간 동안 반웅시켰다. 반웅 이 종료된 막은 0.1% Tween 20이 첨가되어 있는 IX PBS를 이용하여 15분 동안 1회 세척 하고， 5분간 2회 세척하여 결합되지 않은 항체를 제거하고， 1:2,000으로 회석된 horseradish peroxidase-1 inked donkey antigoat IgGCSanta Cruz Biotechnology)가 포함 되어 있는 blocking buffer A에서 다시 반웅시킨 후에 다시 동일한 방법으로 세척하여 결합되지 않은 항체를 제거하였다. 세척된 막은 ECL 용액을 사용하여 현상 (developing) 하였다. 그리고 각각의 단백질 양은 TINA image sof tware(Raytest)를 사용하여 측정하였 다. In order to confirm the gene silencing ability of LV ᅳ Hoxb7 Cre lentiviral and LV—loxP shAQP3 lentiviral produced by the method of Example 1, the collecting cells (kidney collecting duct cell) and mesential cells (mesangial cell) ) Was used. Each cell was treated with lentiviral 4 × 10 5 TU, incubated for 48 hours, then changed to a new culture medium, and further cultured for 72 hours, and then cultured cells were collected and used for the experiment. Transfection efficiency was measured by Western blotting of the expression level of mCherry and EGFP contained in each virus. Western blotting was performed by lysing the collected cells using SDS sample buffer (2% SDS, 10 mM Tris-HCl, 10% (vol / vol) glycerol, pH6.8), and then buffer solution for Lae 隱 Π sample. After heating at 100 ° C for 5 minutes, the protein was separated by electrophoresis using a 12% aery 1 amide denaturing SDS-polyacrylamide gel, and then using a Hoeffer semi dry blotting apparatus, a Hybond-ECL membrane (membrane). ). The protein-transferred membrane was polyclonal, diluted in blocking buffer A (1X PBS, 0.1% Tween 20, 5% nonfat milk), reacted for 1 hour at room temperature, and then diluted 1: 1, 000. Antibody (polyclonal antibody) AQP3 (Abcam), EGFP (Abcam), mCherry (GeneFopoeia), or beta-act in (Sigma-Aldrich) after treatment for 16 hours at 4 ° C. Membranes finished with reaction were washed once for 15 minutes using IX PBS added with 0.1% Tween 20, washed twice for 5 minutes to remove unbound antibody, and horseradish peroxidase-1 diluted 1: 2,000. After reacting again in blocking buffer A containing inked donkey antigoat IgGCSanta Cruz Biotechnology, the unbound antibody was removed by washing in the same manner. The washed membrane was developed using ECL solution. The amount of each protein was measured using TINA image software (Raytest).
또한， AQP3 RNA 양은 실시간 중합효소연쇄반웅 (real-time polymerase chain reaction)을 이용하여 측정하였다. RNA를 추출하기 위하여 , 수거된 세포에 lOOuL의 RNA STAT-60 reagent(Te卜 Test)를 첨가한 후에 냉동 및 해동 단계를 세 번을 반복하여 세포를 용해시 킨 후에 700uL의 RNA STATᅳ 60 reagent를 추가로 첨가한 후에 잘 섞은 후 5분간 실은에서 방치하였디-. 그리고 160uL의 클로로포름 (chloroform)을 첨가하고 30초 동안 강하게 섞어 준 후에 12,000g, 4°C에서 15분간 원심분리하여 상층액만 수거하였다. 수거된 상층액에 400uL의 이소프로판올 (isopropanol)을 첨가하고， 12,000g, 4°C에서 30분간 원심분리하여 RNA를 침전시키고， 70% 에탄올 (ethanol)을 이용하여 세척한 후에 DEPC가 처리된 3차 증 류수에 사용시까지 보관하였다. 추출된 RNA 2ug에 lOuM random hexanucleot ide primer, ImM dNTP, 8ιτιΜ의 MgC12, 30mM C1 , 50mM Tris-HCl , 0.2mM dithithreithol , 25U RNase inhibitor, 및 40U AMV reverse transcr iptase(Boehr inger Mannheim cDNA synthesis kit) 를 첨가한 후에 30°C에서 10분， 42°C에서 1시간 반웅시키고， 99°C에서 5분간 가열하여 반응을 종료시켜 cDNA를 합성하였다. 그리고 합성된 cDNA를 이용하여 실시간 중합효소연 쇄반응을 실시하였다. 실시간 중합효소연쇄반웅에 사용된 프라이머 서열은 표 2에 나타 내었다. 25ng의 cDNA(5uL)에 10uL SYBR Green PCR Master kit와 5pM의 프라이머 세트를 첨가하고, ABI PRISM 7700 SOequence Detection System(Appl ied Biosystenis)을 이용하여 중합효소연쇄반웅을 실시하였다. 중합효소연쇄반응은 95°C에서 9분간 초기 가열한 후에， 94.5°C에서 30초， 60°C에서 30초, 72°C에서 1분 순서로 35회 반복한 후에， 72°C에서 7분 간 반응시켜 실시하였다. 그리고 60°C에서 95°C까지 분당 2°C로 증가되도록 온도를 설정 하여， melting curve를 확인하고, comparative CT method를 이용하여 cDNA의 양을 측 정하였다. 그 결과는 도 2에 나타내었다. In addition, the amount of AQP3 RNA was measured using a real-time polymerase chain reaction. To extract RNA, add lOOuL RNA STAT-60 reagent (Te 卜 Test) to the collected cells, repeat the freeze and thaw steps three times to dissolve the cells, and then use 700uL RNA STAT ᅳ 60 reagent. After additional addition, mix well and leave for 5 minutes at-. And 160uL of chloroform (chloroform) was added and mixed vigorously for 30 seconds, and then centrifuged at 12,000g, 4 ° C for 15 minutes to collect only the supernatant. 400 μL of isopropanol was added to the collected supernatant, the RNA was precipitated by centrifugation at 12,000g, 4 ° C. for 30 minutes, washed with 70% ethanol, and then DEPC treated. Store in distilled water until use. Add 2OuM random hexanucleotide primer, ImM dNTP, 8ιτιΜ MgC12, 30 mM C1, 50 mM Tris-HCl, 0.2 mM dithithreithol, 25 U RNase inhibitor, and 40 U AMV reverse transcr iptase (Boehr inger Mannheim cDNA synthesis kit) After reaction at 30 ° C for 10 minutes, 42 ° C. for 1 hour, the reaction was terminated by heating at 99 ° C for 5 minutes to synthesize cDNA. And real-time polymerase chain reaction was performed using the synthesized cDNA. Primer sequences used in the real-time polymerase chain reaction are shown in Table 2. 10uL SYBR Green PCR Master kit and 5pM primer set were added to 25ng cDNA (5uL), and polymerase chain reaction was performed using ABI PRISM 7700 SOequence Detection System (Appl ied Biosystenis). Polymerase chain reaction is then at 95 ° C initially heated 9 minutes, 30 seconds at 94.5 ° C, 30 sec at 60 ° C, after repeating 35 cycles of 1 minute sequence at 72 ° C, 7 min at 72 ° C The reaction was carried out. And the temperature was set to increase to 2 ° C per minute from 60 ° C to 95 ° C, the melting curve was confirmed, and the amount of cDNA was measured using the comparative CT method. The results are shown in FIG.
【표 2】 Gene Sequence(5' -> 3' ) 서열번호 Table 2 Gene Sequence (5 '->3') Sequence Number
Sense: AGCCCTGGATCAAGCTGCCC 5  Sense: AGCCCTGGATCAAGCTGCCC 5
AQP3  AQP3
Ant i sense： TTGGCAAAGGCCCAGATTG 6  Ant i sense ： TTGGCAAAGGCCCAGATTG 6
Sense: AGTCCCTGCCCT TTGTACACA- 7  Sense: AGTCCCTGCCCT TTGTACACA-7
18s RNA  18s RNA
Ant i sense： GATCCGAGGGCCTCACTAAAC 8 도 2A에 나타난 바와 같이, LVᅳ Hoxb7 Cre를 처리한 집합관 세포， LV-Hoxb7 Cre 및 LV- loxP scr을 처리한 집합관 세포에서 mCherry가 발현된 것을 확인할 수 있는 반면， EGFP 는 LV-loxP shAQP3을 처리한 집합관 세포에서만 관찰되는 것을 확인하였다. 또한, 도 2B 에 나타난 바와 같이， EGFP의 발현량과 관계없이 LVHoxb7 Cre 및 LV— loxP shAQP3을 함께 처리한 세포에서만 AQP3 유전자의 발현이 억제된 것을 확인하였다. 반면 도 2C에 나타난 바와 같이, 혈관간막세포에서는 mcherry가 발현되지 않으며, LV-Hoxb7 Cre를 처리한 세 포 외에는 모두 EGFP를 발현하는 것을 확인하였다.  Ant i sense: GATCCGAGGGCCTCACTAAAC 8 As shown in FIG. 2A, mCherry was expressed in the collection tube cells treated with LV ᅳ Hoxb7 Cre, and the collection tube cells treated with LV-Hoxb7 Cre and LV-loxP scr, whereas EGFP It was confirmed that only observed in the collection tube cells treated with LV-loxP shAQP3. As shown in FIG. 2B, it was confirmed that expression of the AQP3 gene was suppressed only in cells treated with LVHoxb7 Cre and LV—loxP shAQP3 regardless of the amount of EGFP expression. On the other hand, as shown in FIG. 2C, mcherry was not expressed in vascular mesenteric cells, and all of the cells treated with LV-Hoxb7 Cre were expressed in EGFP.
2.2. in vivo 실험 (단일 형질주입) 2.2. in vivo experiment (single transfection)
실시예 1의 방법으로 제작된 LV-Hoxb7 Cre 렌티바이러스와 LV-loxP shAQP3 렌티바이러스 의 유전자 발현 억제능 (gene silencing ability)을 확인하기 위하여， 12마리의 수컷 C57BL/6J 마우스를 사용하였다. 24 내지 26g의 수컷 C57BL/6J 마우스를 Jackson laboratories에서 구입하고， 4개의 그룹으로 나누어 대조군으로 lmL의 PBS를 주입하고， 실험군으로는 4X108 TU의 LV-Hoxb7 Cre, LV-loxP shAQP3, 또는 LV-loxP scr을 각각 hydrodynamic tail vein injection 방식으로 0일, 4일， 및 8일에 형질주입 (transf ect ion) 하였고, 각각의 마우스는 처음 형질주입한 날로부터 6주 후에 실험에 사용하였다. 형질 주입 효율은 각각의 마우스의 간 (liver), 비장 (spleen), 신장 (kidney), 기도 (trachea), 및 결장 (colon)을 추출하여 Semi-nested PCR 및 면역형광염색법 (immunofluorescence staining)으로 확인하였다. Semi— nested PCR은 실시예 2.1과 동일한 방법으로 실시하였 고, 사용한 각각의 프라이머 서열은 표 3에 나타내었다. 면역형광염색법을 위해서는 추 출된 각각의 조직을 4而 높이 단위로 자른 후에 슬라이드 (sl ide) 위에 올려놓고 아세톤In order to confirm the gene silencing ability of the LV-Hoxb7 Cre lentivirus and LV-loxP shAQP3 lentivirus produced by the method of Example 1, 12 male C57BL / 6J mice were used. 24 to 26 g male C57BL / 6J mice were purchased from Jackson laboratories, divided into four groups and injected with 1 mL of PBS as a control group, and 4 x 10 8 TU of LV-Hoxb7 Cre, LV-loxP shAQP3, or LV- LoxP scr was transfected on days 0, 4, and 8 by hydrodynamic tail vein injection, respectively, and each mouse was used for the experiment 6 weeks after the first transfection. Transfection efficiency was confirmed by semi-nested PCR and immunofluorescence staining by extracting the liver, spleen, kidney, trachea, and colon of each mouse. It was. Semi- nested PCR was carried out in the same manner as in Example 2.1, each primer sequence used is shown in Table 3. For immunofluorescence staining, each extracted tissue was cut into 4而 height units, placed on a slide ( sl ide ), and acetone.
(acetone)에 담가 4°C에서 10분 동안 고정시키고, 10분간 건조시킨 후, 10% donkey serum에서 20분 동안 반웅시키고, 1:1,000으로 희석된 EGFP 단클론항체 (Abeam)을 처리하 고 실온에서 3시간 동안 반응시켰다. 그리고 PBS로 세척하여 결합하지 않은 항체는 제거 한 早에 Cy2( green) -conjugated ant i -mouse IgG ant ibody(Research Diagnost ics) 처리 하고 60분 동안 반응시킨 후에 1:500으로 희석된 단클론항체 rabbit ant i-mCherry(Abcam) 또는 anti-AQP3(Abcam)을 처리하고 형광 현미경으로 확인하였다. '결과는 도 3에 나타내 었다. Soak in acetone, fix for 10 minutes at 4 ° C, dry for 10 minutes, react for 20 minutes in 10% donkey serum, treat EGFP monoclonal antibody (Abeam) diluted 1: 1,000 and at room temperature The reaction was carried out for 3 hours. After washing with PBS, unbound antibody was removed and treated with Cy2 (green) -conjugated ant i -mouse IgG ant ibody (Research Diagnost ics) and reacted for 60 minutes, and then diluted 1: 500 monoclonal antibody rabbit ant i-mCherry (Abcam) Or anti-AQP3 (Abcam) was treated and confirmed by fluorescence microscopy. The results are shown in FIG.
【표 3] [Table 3]
Figure imgf000013_0001
도 3에 나타난 바와 같이， EGFP는 간, 비장 및 신장에서 모두 강하게 발현되는 반면， n herry는 오직 신장에서만 발현되는 것을 확인하였다.
Figure imgf000013_0001
As shown in FIG. 3, EGFP was strongly expressed in the liver, spleen, and kidney, whereas n herry was expressed only in the kidney.
2.3. in vivo 실험 (이중 형질주입) 2.3. in vivo experiment (double transfection)
AQP3의 발현이 억제된 형질전환 동물이 정상적으로 제작되는지 확인하기 위하여， LV- Hoxb7 Cre, LV-loxP shAQP3, LV-Hoxb7 Cre 및 LV-loxP shAQP3을 각각 C57BL/6J 마우스에 형질주입하였다. 이중 형질주입을 위해서는， LVᅳ HoxB7 Cre를 주입한 마지막 날 이후에 3 일， 7일, 및 11일에 LV-loxP shAQP3를 주입하였다. 그리고 실시예 2.1과 동일한 방법으 로 웨스턴 블로팅 및 실시간 중합효소연쇄반웅을 실시하고, 실험 종료 하루 전에는 마우 스의 소변을 24시간 동안 수거하여, 소변의 양 (volume)을 측정하고， vapor pressure osmometer (5100C; Wescor)를 이용하여 삼투압 (osmol ali ty)를 측정하였다. 그 결과는 도 4 및 도 5에 나타내었다.  In order to confirm that the transgenic animals that suppressed the expression of AQP3 were normally constructed, LV57X7 Cre, LV-loxP shAQP3, LV-Hoxb7 Cre and LV-loxP shAQP3 were transfected into C57BL / 6J mice, respectively. For double transfection, LV-loxP shAQP3 was injected on days 3, 7, and 11 after the last day of LV ᅳ HoxB7 Cre injection. Western blotting and real-time polymerase chain reaction were performed in the same manner as in Example 2.1, and the urine of the mouse was collected for 24 hours before the end of the experiment, the volume of urine was measured, and the vapor pressure osmometer Osmotic pressure (osmol ali ty) was measured using (5100C; Wescor). The results are shown in FIGS. 4 and 5.
도 4에 나타난 바와 같이， LV-Hoxb7 Cre를 형질주입한 마우스에서는 집합관 세포에서만 mCherry가 발현되고, LV-loxP shAQP3을 형질주입한 마우스에서는 집합관 세포를 포함한 모든 세포에서 EGFP 단백질의 발현이 증가되는 것을 확인하였다 (도 4C). 그러나 두 실험 군 모두 AQP3의 발현량， 소변량, 소변의 삼투압에는 변화가 없는 것을 확인하였다 (도 4D). 반면, LV— Hoxb7 Cre 및 LV-loxP shAQP3을 형질주입한 마우스에서는 AQP3의 단백질 및 mRNA 발현량이 감소되었으며 (도 4B), 소변량은 증가하고, 소변의 삼투압은 감소된 것 을 확인하였다 (도 4D).  As shown in FIG. 4, mCherry was expressed only in the collection tube cells in mice transfected with LV-Hoxb7 Cre, and expression of EGFP protein was increased in all cells including the collection tube cells in mice transfected with LV-loxP shAQP3. Confirmation (FIG. 4C). However, in both groups, there was no change in the expression level, urine volume, and osmotic pressure of urine (FIG. 4D). On the other hand, mice transfected with LV—Hoxb7 Cre and LV-loxP shAQP3 showed decreased protein and mRNA expression levels of AQP3 (FIG. 4B), increased urine volume, and decreased osmotic pressure (FIG. 4D). .
또한， 도 5에 나타난 바와 같이， LV-Hoxb7 Cre 및 LV-loxP shAQP3을 형질주입한 마우스 의 기도 및 결장에서 EGFP 단백질이 발현되지만, AQP3 단백질 및 niRNA의 발현량에는 변 화가 없는 것을 확인하였다. 상기 결과를 통하여, Hoxb7 프로모터는 신장에서만 작동되 며 , LV— HoxB7 Cre 및 LV-loxP shAQP3 시스템이 신장에서 정상적으로 작동되는 것을 확인 할 수 있었다ᅳ 상기 결과들을 통하여， 본 발명의 형질전환 시스템은 in vi tro 및 in vivo에서 모두 효 과적으로 작동되는 것을 확인할 수 있었으며， 상기 형질전환 시스템을 이용하여 프로모 터， 유전자 등을 원하는 종에 맞춰 전환하면 여러 동물의 성체에서 세포 특이적 유전자 발현 억제 형질전환 동물을 용이하게 제작할 수 있다는 것을 확인할수 있었다. 이상으로 본 발명의 특정한 부분을 상세히 기술하였는바， 당업계의 통상의 7ᅵ식을 가진 자에게 있어서 이러한 구체적인 기술은 단지 바람직한 구현 예일 뿐이며， 이에 본 발명 의 범위가 제한되는 것이 아닌 점은 명백하다. 따라서 본 발명의 실질적인 범위는 첨부 된 청구항과 그의 등가물에 의하여 정의된다고 할 것이다. In addition, as shown in Figure 5, the mouse transfected with LV-Hoxb7 Cre and LV-loxP shAQP3 Although EGFP protein is expressed in airway and colon, it was confirmed that there is no change in expression level of AQP3 protein and niRNA. Through the above results, it was confirmed that the Hoxb7 promoter works only in the kidney and that the LV—HoxB7 Cre and LV-loxP shAQP3 systems operate normally in the kidney. Both tro and in vivo were found to be effective. When the promoter, gene, etc. were converted to the desired species by using the transformation system, cell-specific gene expression was suppressed in adult animals. It could be confirmed that it can be easily produced. As described above in detail a specific part of the present invention, for those having ordinary 7 formula in the art, such a specific technology is only a preferred embodiment, it is obvious that the scope of the present invention is not limited thereto. Therefore, the substantial scope of the present invention will be defined by the appended claims and equivalents thereof.
【산업상 이용가능성】 Industrial Applicability
본 발명에 따른 형질주입 시스템을 이용하면 , 다양한 종의 동물 성체에 서 원하는 시기 에 세포특이적으로 목적 유전자의 발현을 억제시킬 수 있기 때문에 저렴한 비용으로 단 기간에 높은 효율로 형질전환동물을 제작할 수 있기 때문에 다양한 유전자의 역할 연구 에 용이하게 사용될 수 있을 것으로 기대된다. By using the transfection system according to the present invention, it is possible to produce a transgenic animal with high efficiency in a short period of time at a low cost since it is possible to inhibit the expression of a target gene in a specific time at a desired time in various species of animal adult. As such, it is expected to be easily used to study the role of various genes.
【서열목록 Free Text ] 【Sequence List Free Text】
서열번호 1. (AQP3 shRNA - Sense) SEQ ID NO: 1. (AQP3 shRNA-Sense)
TGCCATCGnGACCCmTAmAAGAGATAT GGGTC CGATGGCTTTTTTC  TGCCATCGnGACCCmTAmAAGAGATAT GGGTC CGATGGCTTTTTTC
서열번호 2. (AQP3 shRNA - Ant i sense) SEQ ID NO: 2. (AQP3 shRNA-Ant i sense)
TCGAGAAAAAAGCCATCGTTGACCCmTATCTOTGAATATAAGGGTCAACGATGGCA  TCGAGAAAAAAGCCATCGTTGACCCmTATCTOTGAATATAAGGGTCAACGATGGCA
서열번호 3. (Scrambl ed - Sense) SEQ ID NO: 3. (Scrambl ed-Sense)
TGCGTATGAGTAGTGCGCAGAmC GAG TCTGCGCACTACTCATACGCTTTnTC  TGCGTATGAGTAGTGCGCAGAmC GAG TCTGCGCACTACTCATACGCTTTnTC
서열번호 4. (Scrambl ed - Ant i sense) SEQ ID NO: 4. (Scrambl ed-Ant i sense)
TCGAGAAAAAAGCGTATGAGTAGTGCGCAGAnCTCTTGAAATCTGCGCACTACTCATACGCA  TCGAGAAAAAAGCGTATGAGTAGTGCGCAGAnCTCTTGAAATCTGCGCACTACTCATACGCA
서열번호 5. (AQP3 - Sense) SEQ ID NO: 5. (AQP3-Sense)
AGCCCTGGATCAAGCTGCCC 서열번호 6. (AQP3 - Antisense)AGCCCTGGATCAAGCTGCCC SEQ ID NO: 6. (AQP3-Antisense)
TTGGCAAAGGCCCAGATTG TTGGCAAAGGCCCAGATTG
서열번호 7. (18s RNA - Sense) SEQ ID NO: 7. (18s RNA-Sense)
AGTCCCTGCCCT TTGTACACA  AGTCCCTGCCCT TTGTACACA
서열번호 8. (18s RNA. - Antisense) SEQ ID NO: 8. (18s RNA.- Antisense)
GATCCGAGGGCCTCACTAAAC  GATCCGAGGGCCTCACTAAAC
서열번호 9. (EGFP primer ― Sense) SEQ ID NO: 9. (EGFP primer-Sense)
GCAGCACGACTTCTTCAAGT  GCAGCACGACTTCTTCAAGT
서열번호 10. (EGFP primer - Antisense)SEQ ID NO: 10. (EGFP primer-Antisense)
CCGTCCTCCTTGAAGTCGAT CCGTCCTCCTTGAAGTCGAT
서열번호 11. (EGFP primer 一 Semi-sense)SEQ ID NO: 11. (EGFP primer 一 Semi-sense)
GAGCGCACCATCTTCTTCA GAGCGCACCATCTTCTTCA
서열번호 12. (mCherry primer - Sense)SEQ ID NO: 12. (mCherry primer-Sense)
ACAAGGTGAAGCTGCGCG ACAAGGTGAAGCTGCGCG
서열번호 13. (mCherry primer - Antisense)SEQ ID NO: 13. (mCherry primer-Antisense)
TTGACCTCAGCGTCGTAGTGGC TTGACCTCAGCGTCGTAGTGGC
서열번호 14. (mCherry primer ― Semi-sense)SEQ ID NO: 14. (mCherry primer-Semi-sense)
CAGAAGAAGACCATGGGCTG CAGAAGAAGACCATGGGCTG
서열번호 15. (Hoxb7 promoter) SEQ ID NO: 15. (Hoxb7 promoter)
GACACTAAAACGTCCCCGA 서열번호 16. (Cre)GACACTAAAACGTCCCCGA SEQ ID NO: 16. (Cre)
TGGAAGATGGCGATTAG TGGAAGATGGCGATTAG
서열번호 17. (Flp) SEQ ID NO: 17. (Flp)
서열번호 18. (ΙοχΡ) SEQ ID NO: 18. (ΙοχΡ)
ATMCTTCGTATAGTATAAATTATACGAAGTTAT ATMCTTCGTATAGTATAAATTATACGAAGTTAT
서열번호 19. (FRT) SEQ ID NO: 19. (FRT)
GAAGTTCCTATTCCGAAGTTCCTATTCTCTAGAAAGTATAGGAACTTC  GAAGTTCCTATTCCGAAGTTCCTATTCTCTAGAAAGTATAGGAACTTC
서열번호 20. (Hoxb7 promoter-Cre recombinase) SEQ ID NO: 20. (Hoxb7 promoter-Cre recombinase)
Figure imgf000018_0001
Figure imgf000018_0001
906 )ΐ/9ΐΟΖ OAV 906) ΐ / 9ΐΟΖ OAV

Claims

【청구범위】  [Claim]
【청구항 11  [Claim 11
(a) 세포특이적 프로모터 (cell-type specific promoter) 및 위치특이적 재조합 효소 (site-specific recombinase)를 포함하는 제 1 재조합 발현 백터를 형질주입 (transfection)하는 단계; 및  (a) transfecting a first recombinant expression vector comprising a cell-type specific promoter and a site-specific recombinase; And
(b) 상기 위치특이적 재조합 효소의 인식 서열 및 목적 유전자의 발현 억제용 올리고뉴 클레오티드 (oligonucleotide)를 포함하는 제 2 재조합 발현 백터를 형질주입하는 단계를 포함하고，  (b) transfecting a second recombinant expression vector comprising a recognition sequence of said position specific recombinant enzyme and an oligonucleotide for inhibiting expression of a gene of interest;
상기 제 2 재조합 발현 백터는 두 개의 재조합 효소 인식 서열 사이에 종결코돈 (stop codon) 서열을 포함하는, 목적 유전자의 발현을 억제하는 방법 . Wherein said second recombinant expression vector comprises a stop codon sequence between two recombinant enzyme recognition sequences.
【청구항 2] [Claim 2]
제 1 항에 있어서, The method of claim 1,
상기 세포특이적 프로모터는 서열번호 15의 염기서열을 포함하는 Hoxb7 프로모터인 것을 특징으로 하는， 방법 . The cell specific promoter is characterized in that the Hoxb7 promoter comprising the nucleotide sequence of SEQ ID NO: 15, method.
[청구항 3】 [Claim 3]
제 1 항에 있어서， The method of claim 1,
상기 재조합 효소는 세포특이적 프로모터의 조절을 받는 것을 특징으로 하는， 방법 . The recombinant enzyme is characterized in that the regulation of the cell-specific promoter, method.
【청구항 4】 [Claim 4]
제 1 항에 있어서, The method of claim 1,
상기 위치특이적 재조합 효소는 Cre 또는 Flp인 것을 특징으로 하는, 방법. Wherein said regiospecific enzyme is Cre or Flp.
【청구항 5】 [Claim 5]
제 1 항에 있어서， The method of claim 1,
상기 위치특이적 재조합 효소가 인식하는 서열은 ΙοχΡ 또는 FRT인 것을 특징으로 하는， 방법. And the sequence recognized by the site-specific recombinase is ΙοχΡ or FRT.
【청구항 6】 [Claim 6]
제 1 항에 있어서, The method of claim 1,
상기 목적 유전자의 발현 억제용 올리고뉴클레오티드는 목적 유전자의 shRNA(short hairpin RNA)인 것을 특징으로 하는， 방법 . Oligonucleotides for inhibiting the expression of the target gene is shRNA (short hairpin RNA).
【청구항 7】 [Claim 7]
제 1 항에 있어서, The method of claim 1,
상기 재조합 발현 백터는 렌티바이러스 (lentivirus), 아데노바이러스 (adenovirus)， 또는 레트로바이러스 (retrovirus) 용인 것을 특징으로 하는， 방법. The recombinant expression vector, characterized in that for lentivirus (adetivirus), adenovirus (adenovirus), or retrovirus (retrovirus), method.
【청구항 8] [Claim 8]
(a) 세포특이적 프로모터 (ceH-type specific promoter) 및 위치특이적 재조합 효소 (site-specific recombinase)를 포함하는 제 1 재조합 발현 백터를 형질주입 (transfection)하는 단계; 및  (a) transfecting a first recombinant expression vector comprising a ceH-type specific promoter and a site-specific recombinase; And
(b) 목적하는 시기에 상기 위치특이적 재조합 효소의 인식 서열 및 목적 유전자의 발현 억제용 을리고뉴클레오티드 (oligonucleotide)를 포함하는 제 2 재조합 발현 백터를 형질 주입하는 단계를 포함하고，  (b) transfecting a second recombinant expression vector comprising a recognition sequence of said position-specific recombinant enzyme and an oligonucleotide for inhibiting expression of a target gene at a desired time;
상기 제 2 재조합 발현 백터는 두 개의 재조합 효소 인식 서열 사이에 종결코돈 (stop codon) 서열을 포함하는， 목적하는 시기의 목적 유전자의 기능을 확인하는 방법. Wherein said second recombinant expression vector comprises a stop codon sequence between two recombinant enzyme recognition sequences, wherein said second recombinant expression vector comprises a stop codon sequence.
【청구항 9】 [Claim 9]
제 8 항에 있어서 , The method of claim 8,
상기 세포특이적 프로모터는 서열번호 15의 염기서열을 포함하는 Hoxb7프로모터인 것을 특징으로 하는, 방법 . The cell specific promoter is characterized in that the Hoxb7 promoter comprising the nucleotide sequence of SEQ ID NO: 15.
【청구항 10】 [Claim 10]
제 8 항에 있어서， The method of claim 8,
상기 재조합 효소는 세포특이적 프로모터의 조절을 받는 것을 특징으로 하는, 방법 . Wherein said recombinant enzyme is regulated by a cell-specific promoter.
【청구항 111 [Claim 111]
제 8 항에 있어서， The method of claim 8,
상기 위치특이적 재조합 효소는 Cre 또는 Flp인 것을 특징으로 하는, 방법. Wherein said regiospecific enzyme is Cre or Flp.
【청구항 12】 [Claim 12]
제 8 항에 있어서， 상기 위치특이적 재조합 효소가 인식하는 서열은 ΙοχΡ또는 FRT 인 것을 특징으로 하는， 방법. The method of claim 8, And the sequence recognized by the site-specific recombinase is ΙοχΡ or FRT.
【청구항 13】 [Claim 13]
제 8항에 있어서， The method of claim 8,
상기 목적 유전자의 발현 억제용 을리고뉴클레오티드는 목적 유전자의 shRNA(short hairpin R A)인 것을 특징으로 하는, 방법. The method for inhibiting expression of the target gene for expression ligonucleotide is shRNA (short hairpin R A) of the target gene.
【청구항 14] [Claim 14]
제 8항에 있어서， The method of claim 8,
상기 재조합 발현 백터는 렌티바이러스 (lent ivirus), 아데노바이러스 (adenovirus)， 또는 레트로바이러스 (retrovirus) 용인 것을 특징으로 하는， 방법. The recombinant expression vector is characterized in that for lent ivirus, adenovirus, or retrovirus.
【청구항 15】 [Claim 15]
(a) 세포특이적 프로모터 (ceH-type specific promoter) 및 위치특이적 재조합 효소 (site-specific recombinase)를 포함하는 제 1 재조합 발현 백터; 및  (a) a first recombinant expression vector comprising a ceH-type specific promoter and a site-specific recombinase; And
(b) 상기 위치특이적 재조합 효소의 인식 서열 및 목적 유전자의 발현 억제용 올리고뉴클레오티드 (oligonucleotide)를 포함하는 제 2 재조합 발현 백터를 포함하고, 상기 제 2 재조합 발현 백터는 두 개의 재조합 효소 인식 서열 사이에 종결코돈 (stop codon) 서열을 포함하는, 목적 유전자의 발현 억제용 조성물.  (b) a second recombinant expression vector comprising a recognition sequence of said position-specific recombinant enzyme and an oligonucleotide for inhibiting expression of a target gene, said second recombinant expression vector being between two recombinant enzyme recognition sequences; A composition for inhibiting expression of a gene of interest, comprising a stop codon sequence.
【청구항 16】 [Claim 16]
(a) 세포특이적 프로모터 (cen-type specific promoter) 및 위치특이적 재조합 효소 (site一 specif ic recombinase)를 포함하는 제 1지역 (region); 및  (a) a first region comprising a cen-type specific promoter and a site one specific recombinase; And
(b) 프로모터, 상기 위치특이적 재조합 효소의 인식 서열 및 목적 유전자의 발현 억제용 올리고뉴클레오티드 (oligonucleotide)를 포함하는 제 2 지역을 포함하는， 재조합 발현 백터.  (b) a recombinant expression vector comprising a promoter, a second region comprising a recognition sequence of said site-specific recombinase and an oligonucleotide for inhibiting expression of a target gene.
【청구항 17】 [Claim 17]
제 16항의 백터를 인간을 제외한 동물에 형질주입 (transfection)하는 단계를 포함하는， 인간을 제외한 형질전환동물의 제조 방법 . A method for producing a transgenic animal other than human, comprising transfecting a vector of claim 16 to an animal other than human.
【청구항 18] [Claim 18]
제 16 항의 백터를 포함하는， 인간을 제외한 형질전환동물 . A transgenic animal other than humans, comprising the vector of claim 16.
【청구항 19] [Claim 19]
(a) 세포특이적 프로모터 (cell-type specific promoter) 및 위치특이적 재조합 효소 (site-specific recombinase)를 포함하는 제 1 재조합 발현 백터를 인간을 제외한 동물에 형질주입( ∑113£6 101 하는 단계; 및  (a) transfecting a non-human animal with a first recombinant expression vector comprising a cell-type specific promoter and a site-specific recombinase (∑113 £ 6 101) ; And
(b) 상기 위치특이적 재조합 효소의 인식 서열 및 목적 유전자의 발현 억제용 을리고뉴클레오티드 (oligonucleotide)를 포함하는 제 2 재조합 발현 백터를 인간을 제외한 동물에 형질주입하는 단계를 포함하고，  (b) transfecting a second recombinant expression vector comprising a recognition sequence of said position-specific recombinant enzyme and an oligonucleotide for inhibiting expression of a target gene into an animal except a human;
상기 제 2 재조합 발현 백터는 두 개의 재조합 효소 인식 서열 사이에 종결코돈 (stop codon) 서열을 포함하는， 인간을 제외한 형질전환동물의 제조 방법 . Wherein said second recombinant expression vector comprises a stop codon sequence between two recombinant enzyme recognition sequences.
【청구항 20】 [Claim 20]
(a) 세포특이적 프로모터 (cen-type specific promoter) 및 위치특이적 재조합 효소 (site-specific recombinase)를 포함하는 제 1 재조합 발현 백터; 및  (a) a first recombinant expression vector comprising a cen-type specific promoter and a site-specific recombinase; And
(b) 상기 위치특이적 재조합 효소의 인식 서열 및 목적 유전자의 발현 억제용 을리고뉴클레오티드 (oligonucleotide)를 포함하는 제 2 재조합 발현 백터를 포함하고， 상기 제 2 재조합 발현 백터는 두 개의 재조합 효소 인식 서열 사이에 종결코돈 (stop codon) 서열을 포함하는, 인간을 제외한 형질전환동물.  (b) a second recombinant expression vector comprising a recognition sequence of the position-specific recombinase and an oligonucleotide for inhibiting expression of a target gene, wherein the second recombinant expression vector comprises two recombinant enzyme recognition sequences A transgenic animal, except human, comprising a stop codon sequence therebetween.
PCT/KR2015/007926 2014-12-23 2015-07-29 Transfection system for producing genetically modified animal WO2016104906A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR1020140186879A KR101703506B1 (en) 2014-12-23 2014-12-23 Transfection system for production of transgenic animal
KR10-2014-0186879 2014-12-23

Publications (2)

Publication Number Publication Date
WO2016104906A1 WO2016104906A1 (en) 2016-06-30
WO2016104906A9 true WO2016104906A9 (en) 2016-10-20

Family

ID=56150895

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2015/007926 WO2016104906A1 (en) 2014-12-23 2015-07-29 Transfection system for producing genetically modified animal

Country Status (2)

Country Link
KR (1) KR101703506B1 (en)
WO (1) WO2016104906A1 (en)

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR102070763B1 (en) * 2018-08-21 2020-01-29 성균관대학교산학협력단 Dopaminergic neuron specific expression control system
KR102479490B1 (en) * 2019-11-13 2022-12-21 주식회사 마크로젠 Neuron-specific promoter and recombinant vector comprising the same for inducing DNA modification

Also Published As

Publication number Publication date
KR20160076628A (en) 2016-07-01
KR101703506B1 (en) 2017-02-07
WO2016104906A1 (en) 2016-06-30

Similar Documents

Publication Publication Date Title
US11753641B2 (en) Structurally designed shRNAs
WO2017062754A1 (en) Compositions and methods for enhancing crispr activity by polq inhibition
US20070155014A1 (en) Methods for increasing efficiency of homologous recombination
TWI516592B (en) An inducible gene expression composition for using eukaryotic pol-2 promoter-driven transcription in prokaryotes and the applications thereof
WO2019086007A1 (en) Sgrna for targeting and guiding cas9 protein to efficiently cleave tcr and b2m gene loci
WO2013109713A1 (en) Targeting rnas to microvesicles
JP4517061B2 (en) Efficient production method for dumbbell-shaped DNA
WO2021226151A2 (en) Selection by essential-gene knock-in
Song et al. circPTPN12/miR-21–5 p/∆ Np63α pathway contributes to human endometrial fibrosis
CN109402118B (en) miRNA apla-mir-145-4 related to follicular development of laying ducks as well as detection primer, inhibitor and application thereof
WO2016104906A9 (en) Transfection system for producing genetically modified animal
WO2020093575A1 (en) Polynucleotide for tumor treatment and use thereof
WO2020128006A1 (en) Mirna for use in therapy
CN110511933B (en) Rat long-chain non-coding lncRNA-lncMSTRG10078 and application thereof in resisting cell injury
JP2006500017A (en) Adenoviral VA1 PolIII expression system for RNA expression
KR101048417B1 (en) Mouse cells knocked down with the expression of micro-RNA and prion genes for the prion gene of mice
US20230293690A1 (en) 5' s/mar applications
Korostowski Transcript Regulation within the Kcnq1 Domain

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 15873434

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 15873434

Country of ref document: EP

Kind code of ref document: A1