WO2016098125A2

WO2016098125A2 - An insecticidal composition

Info

Publication number: WO2016098125A2
Application number: PCT/IN2015/050200
Authority: WO
Inventors: Ashok Prabhakar GIRI; Amey Jayant BHIDE; Vidya Shrikant GUPTA; Sureshkumar RAMASAMY
Original assignee: Council Of Scientific & Industrial Research
Priority date: 2014-12-15
Filing date: 2015-12-15
Publication date: 2016-06-23
Also published as: WO2016098125A3

Abstract

The present invention relates to the cloning and expression of a nucleotide sequence encoding a premature α-amylase inhibitor (PMAI) protein and amino acid sequence having 100% sequence identity with the mature Amaranth α-amylase inhibitor (AAI) polypeptide sequence isolated from Amaranthus hypochondriacus. Further it includes recombinant constructs and anti-insecticidal compositions comprising strong amylase inhibitory (AI) activity against storage insect pest amylases. Additionally, present invention provides a signal peptide fused to the protein of interest that facilitates the extracellular secretion of the synthesized α-amylase inhibitor protein which results in significant inhibition of sucking pests of plants in agriculture.

Description

AN INSECTICIDAL COMPOSITION

FIELD OF THE INVENTION: The present invention relates to the transformation and expression of a nucleotide sequence encoding a premature a-amylase inhibitor (PMAI) protein and amino acid sequence of which have 100% sequence identity with the mature Amaranth a-amylase inhibitor (AAI) polypeptide sequence isolated from Amaranthus hypochondriacus. Further the present invention provides recombinant constructs and anti-insecticidal compositions comprising strong amylase inhibitory (AI) activity against storage insect pest amylases.

Additionally, the initial nucleotide sequence of the present invention encodes a signal peptides that facilitates the extracellular secretion of the synthesized α-amylase inhibitor protein which results in significant inhibition of sucking pests of plants in agriculture.

BACKGROUND AND PRIOR ART OF THE INVENTION: Grains produced may be stored for a period ranging from a few weeks to a few years before they are fed or processed for differential usage. The profitability of such storage entirely depends not only upon marketing concerns but also upon maintaining grain quality. The harvest and storage of grains should not end up with the possibility of losses caused by insects and pathogens. Therefore, successful management of stored-grain insects is possible only if proper storage practices are implemented. The addition of insecticides and fumigants do not represent sound storage methods, as they result in pesticide residues that threaten the health of consumers.

Naturally synthesized insect digestive enzyme inhibitors are important tools for regulating the activity of insect-pests. Plant seeds are known to produce a variety of insect digestive enzyme inhibitors that are thought to protect the seed against insects as well as microbial pathogens. The plant seed inhibitors are often species specific, i.e. they inhibit enzymes of a precise group of pathogenic organisms; however do not affect the mammalian counterpart and therefore, these enzyme inhibitors become attractive candidates for treating insect pests.

Generally a-amylase inhibitors inhibit broad range of a-amylases from different organisms. The inhibitory activity of the plant derived a-amylase inhibitors can be species- specific. For example, members of the cereal family of amylase/protease inhibitors are active against insect a-amylases but are unable to inhibit the a-amylases present in the digestive system of mammals. One such α-amylase inhibitor possessing species specific inhibitory activity was isolated from Amaranthus hypochondriacus, therefore has been come to be known as the Amaranth α-amylase inhibitor (AAI). An article referencing "A Novel a- Amylase Inhibitor from Amaranth (Amaranthus hypochondriacus) Seeds" by Alicia Chagolla- Lopez et al published in The Journal of Biological Chemistry Vol. 269, No. 38, Iss. September 23, pp. 2367523680, 1994, reports the α-amylase inhibitor (AAI) isolated from the seeds of Amaranthus hypochondriacus, comprising a 32-amino acid residue-long polypeptide with three disulfide bridges and which strongly inhibits the digestive a-amylases produced by larvae of the red flour beetle (Tribolium castaneum) and the grain borer (Prostephanus truncatus).

In view of the species specific inhibitory characteristic of the isolated AAI protein, several research studies have been initiated to decipher and evaluate the structural involvement and mechanism of inhibition of AAI. Another research article titled "Solution Structure of the Major a- Amylase Inhibitor of the Crop Plant Amaranth" by Shanyun Lu et al published in The Journal of Biological Chemistry Vol. 274, No. 29, Iss. July pp. 20473- 20478, 1999 reports a three-dimensional structure of α-amylase inhibitor (AAI) determined by NMR spectroscopy and via amino acid replacement and chimera construction identifies a short segment of the first loop of AAI which is involved in enzyme inhibition. The a-amylase binding domain of the AAI protein has also been deciphered by Shanyun Lu et al. Yet another publication titled "Specific inhibition of insect α-amylases: yellow meal worm a- amylase in complex with the Amaranth α-amylase inhibitor at 2.0 A resolution" by Pedro Jose Barbosa Pereira published in Structure 1999, Vol 7 No 9, reports the crystal structure of yellow meal worm α-amylase (TMA) complexed with AAI at 2.0 A resolution. The overall fold of AAI, its three stranded twisted β sheet and the topology of its disulfide bonds identify it as a knottin-like protein. This article further concludes that the binding of AAI to TMA presents a new inhibition mode for α-amylases and due to its unique specificity towards insect α-amylases; AAI might represent a valuable tool for protecting crop plants from predatory insects.

Researchers in the prior art have commenced upon a plethora of studies directed to the binding mechanism of the Amaranth a-amylase inhibitor with insect digestive enzymes. Apart from isolating AAI protein from the seeds of Amaranthus species, no attempts have been made until now to obtain convenient synthetic production of AAI protein.. Conventional techniques employed in the isolation of the AAI protein from seeds are laborious and require considerable amount of raw material. Further, isolated and purified AAI protein has to be brought in contact with insect-pests infesting the standing crops and stored grains. These processes are inconvenient and time consuming, with no practical possibility of comprehensive success.

Considering a crucial requirement for the synthetic production of the a-amylase inhibitor, the present inventors have employed molecular techniques to decipher the previously unidentified full length of the nucleotide and amino acid sequence of the AAI protein.

Chinese Patent Publication No. 103966206 discloses a preparation method, a nucleotide sequence and application of a novel recombinant alpha-amylase inhibitor. However, sequence identity analysis indicates that the amino acid sequence claimed in CN'206 is a metalloprotease and does not have any homologous relation with a-amylase inhibitor produced in seeds of A. hypocondriacus. In the light of the above, it is evident that there is further scope in the art to develop effective α-amylase inhibitors to deal with menace of insects and pests as well as other damage causing species.

Therefore, by using recombinant DNA methods, inventors have cloned, purified and characterized the premature α-amylase inhibitor protein (PMAI) in heterologous system. Additionally, successful use of signal peptide in transporting attached protein to the extracellular spaces of the plant cells has been achieved.

OBJECT OF INVENTION: In view of the need for convenient production with retention of the a-amylase inhibitory activity of α-amylase inhibitor, the object of the present inventors is to provide a composition comprising a nucleotide sequence cloned in an expression vector system, wherein the said sequence encodes a premature α-amylase inhibitor protein a part of which shows 100% identity with the Amaranth α-amylase inhibitor (AAI) protein produced by Amaranthus hypochondriacus .

Another object of the present invention is to provide a nucleotide sequence encoding a complete signal peptide which was used to express attached protein in extra-cellular spaces of the plant cells.

Furthermore, yet another object of the present invention is to provide a method for effective management of storage and sucking insect-pests by employing the present composition comprising Seq Id No. 2 encoding a premature α-amylase inhibitor protein a part of which shows 100% identity with the Amaranth α-amylase inhibitor (AAI) protein published in the literature.

This PMAI protein also possesses strong amylase inhibitory (AI) activity against storage insect pest amylases.

SUMMARY OF THE INVENTION:

Accordingly, the present invention provides a composition comprising a nucleotide sequence represented by Seq Id No.l encoding an amino acid sequence represented by Seq Id No. 5 comprising a signal peptide. The nucleotide sequence excluding signal peptide sequence (Seq Id No. 3) was cloned in a bacterial expression vector system. Resulted recombinant PMAI protein having the signal peptide showed α-amylase inhibitory activity against insect digestive a-amylases.

In an aspect, the present invention provides a nucleotide sequence represented by Seq Id No. l encoding a complete AI protein with signal peptide and a nucleotide sequence represented by Seq Id No.2 encoding a premature α-amylase inhibitor protein a part of which shows 100% identity with the Amaranth a- amylase inhibitor (AAI) protein produced by Amaranthus hypochondriacus . (published in the literature)

Further, the expressed protein comprises the signal peptide having role in transporting attached protein to the extra-cellular matrices of the plant cell.

Accordingly, Seq Id No. l encodes a signal peptide composed of 26 amino acids and a premature peptide composed of 75 amino acids. The complete amino acid sequence of the a- amylase inhibitor cloned and expressed in an appropriate expression system (E.coli) is featured in Figure 1.

In another aspect, the present invention provides a process for cloning the nucleotide sequence in an appropriate expression vector and the cloned sequence is represented by Seq Id No.2 encoding a premature a-amylase inhibitor (AI) protein, part of which has 100% sequence identity with the AAI isolated from Amaranthus hypochondriacus (Chagolla Lopez et al).

Expressed and purified recombinant a-amylase inhibitor (AI) protein was used to inhibit a-amylases of storage insect pests..

The premature AI protein (PMAI) in the absence of the signal peptide was shown to be expressed in BL21 cells. This protein was found to be accumulated in the insoluble fraction of the cell lysate, thereby requiring inclusion body separation, dissolution and protein refolding using urea . Further purification was done by passing refolded protein through Ni- NTA resin.

Moreover, reporter protein fused with signal peptide mentioned earlier was located in the extra-cellular spaces of the cells of the tobacco leaves after agroinfiltration experiments. Thereby, any protein fused with the signal peptide can be directed to the an extra-cellular matrix of the plant such as phloem in a standing crop plant and by this means could facilitates the contact of any fused inhibitory peptide with the digestive α-amylases of the sucking insect pests. Optionally, the present invention further provides the present composition in association with one or more insecticidal excipients/ingredients and carriers for use in inhibiting a- amylases of storage and sucking insect pests. The composition related to the PMAI protein according to the invention may be in solid forms such as granules, powders, pellets; liquid forms such as solutions, sprays, aerosols etc. In yet another aspect, the present invention provides a method for effective management of storage and sucking insect-pests by employing the present composition possessing strong a-amylase inhibitory (AI) activity against storage insect pest amylases.

According to this aspect, the inhibitory activity of purified recombinant PMAI was tested against human, insect, fungal and bacterial a- amylases. Complete inhibition of Tribolium castaneum amylases was observed at O.lnM concentration of the recombinant PMAI while no inhibitory effect was found to be exerted on human salivary a-amylases (Figure 3).

Therefore, the recombinant protein can be employed as a control measure for inhibiting storage pest while having no influence on human amylase activity. Further, activity of the bacterial and fungal amylases was inhibited by 13% and 50% respectively at 0.22 nM of the recombinant PMAI concentration (Figure 3).

Titration curve of inhibitory activity of Premature AI was carried out against T. castaneum amylases (Adult) and A. oryzae diastase. Activity of T. Castaneum amylase (Adult) was inhibited from 18% to 100% by the 0.01-.0.22 nM concentration of Premature AI (Figure 4).

In yet another aspect, the invention provides methods of controlling storage insect pest as well as sucking insect pests by admixing the composition comprising heterologougly expressed protein of sequence ID No. -3 with the stored grains to control the insect pest infestation.

Accordingly, the present invention provides methods of controlling storage insect pest as well as sucking insect pests, fungi or bacteria by methods of contacting (i.e. either by spraying or injecting the composition in a standing crop plant) the invading insect, fungal or bacterial species with the present composition comprising Seq Id No. 2 encoding a protein having 100% identity with Seq Id No. 3 to inhibit the aforesaid invading species of the crop plants. In one more aspect, the present invention provides compositions comprising Seq Id

No. 2 encoding the protein having 100% identity with Seq Id No. 3 in a concentration varying from 0.001 to 99% of the composition.

Accordingly, in another aspect, the invention provides compositions comprising Seq Id No. 2 encoding the protein having 100% identity with Seq Id No. 3 for use in inhibiting a- amylases of the stored grain insect pest as well as a- amylases of sucking insect pests.

BRIEF DESCRIPTION OF DRAWINGS: Figure 1 depicts a schematic representation of complete precursor of amylase inhibitor isolated from A. hypochondriacus;

Figure 2 depicts expression and purification of Premature AI in BL21 cells. A) Cloning strategy; Premature or Mature AI from A. hypochondriacus were cloned in pET28a (+) expression vector (5369 bp) between Notl and Xhol restriction enzyme sites. B) 12% SDS- PAGE; expressed protein accumulates in insoluble fraction (pellet). Arrow indicates expressed Premature AI. C) Premature AI purified using Ni-NTA column. BB, Before binding; AB, After binding; W, Wash fraction; M, Broad range protein ladder; E1-E5, eluted fractions. Protein was eluted using 250 mM imidazole. Arrow indicates ~15kD protein. D) Molecular weight was determined using MALDI TOF analysis. Identified Molecular weight is equivalent to the theoretical molecular weight (13.2 kD);

Figure 3 depicts the Inhibitory potential of recombinant Premature AI (PMAI) against various a-amylases: Inhibitory activity of recombinant PMAI against T. castaneum amylase (Adult) and A. oryzae diastase (For various concentrations of rPMAI);

Figure 4 depicts the titration curve of inhibitory activity of recombinant PMAI against (A) T. castaneum amylase (Adult) and (B) A. oryzae diastase; Figure 5 depicts real-time analysis for quantification of amylase inhibitor transcripts in different tissues of plants from Amaranthaceae family; and

Figure 6 depicts the localization of signal-peptide-mediated transport of Green Fluorescent protein (GFP).

DESCRIPTION OF THE INVENTION:

The invention will now be described in detail in connection with certain preferred and optional embodiments, so that various aspects thereof may be more fully understood and appreciated.

Keeping in mind the object of the present invention, the present inventors have provided an insecticidal composition comprising a nucleotide sequence encoding the heterologously expressed premature a-amylase inhibitor (PMAI) and a method for effective management of storage and sucking insect-pests employing the composition possessing strong amylase inhibitory (AI) activity against storage insect pest amylases.

In the most preferred embodiment, the present invention provides an insecticidal composition comprising a nucleotide sequence represented by Seq Id No. 2 cloned in an expression vector system, wherein the said sequence encodes a recombinant protein represented by Seq Id No. 5 wherein the said Seq Id No. 5 comprises a signal peptide to facilitate transport of the said recombinant protein to the extra-cellular matrix of the plant cell.

In a preferred embodiment, the present invention provides an insecticidal composition comprising a nucleotide sequence represented by Seq Id No. 1 cloned in an expression vector system, wherein the said sequence encodes a protein having 100% identity with Seq Id No.5 comprising a signal peptide and a polypeptide having inhibitory activity against insect digestive a-amylases, wherein the said protein is expressed heterologously.

In accordance with the above preferred embodiment, the present invention provides a nucleotide sequence represented by Seq Id No.l comprising 302 base pairs and encodes protein having Seq Id No.5 consisting of 101 amino acids. The precursor a-amylase inhibitor represented by Seq Id No.5 comprises a 26 amino acid signal peptide; 43 amino acid linker peptide and a 32 amino acid mature peptide. The schematic representation of the precursor α-amylase inhibitor, i.e. Seq Id No.5 comprising the signal peptide (26 amino acids); the premature AI (43 amino acids) and mature peptide (32 amino acids) is provided in Figure 1.

The presence of the signal peptide fused with premature α-amylase inhibitor (PMAI) directs the protein to the extra-cellular matrix of the plant i.e. the phloem. The localization of the amylase inhibitor protein in phloem facilitates the translocation of the recombinant protein along with other organic nutrients to various parts of the plant. The protein is secreted in the phloem which is the innermost layer of the plant. The phloem tissue plays a significant role in bringing the recombinant AI protein in contact with the a-amylases produced by insect, bacterial and fungal pests, thereby inhibiting the invading and damage causing species of sucking insect pests, bacteria and fungi. Evaluation studies of the inhibitory activity of the present recombinant PMAI protein encoded by Seq Id No. l indicated that the recombinant PMAI protein produced has no adverse inhibitory effect on the human a-amylases.

In another embodiment, the present invention provides a signal peptide represented by Seq Id No.4, wherein the said peptide when fused to a protein of interest directs the transport of the said protein to an extra-cellular matrix, thereby resulting in the external secretion of the protein.

In accordance with the above embodiment, the present invention provides the signal peptide comprising 26 amino acids which when fused to a protein of interest facilitates its translocation to the extra-cellular matrix of a plant. The signal peptide sequence fused to a reporter protein such as the Green Fluorescent Protein (GFP) or to the premature a-amylase inhibitor protein (PMAI) represented by Seq Id No.3 aids in the extracellular secretion of the fused protein in the plant matrix and consequently contributes in controlling insect-pests.

The signal peptide was fused with a reporter protein and was transiently expressed in plant epithelial cells such as those of tobacco by the agro-infiltration technique. Expression of only the reporter protein without signal peptide exhibits abundant reporter protein in the cytoplasm and nucleus of tobacco epithelial cells. However, when fused with the signal peptide represented by Seq Id No.4, the reporter protein secretion was observed in intercellular spaces called apoplasts but not in nucleus and cytoplasm (Figure 6).

While the amino acid sequence of the Amaranth a-amylase inhibitor protein (32 amino acids long) is known, the nucleotide sequence represented by Seq Id No.l encoding the entire protein sequence comprising the signal peptide and premature peptide (in the order of 26+43+32 amino acids) is novel. The heterologously expressed PMAI protein (43+32 amino acid sequence) in E. coli expression vector system shows no inhibition of Human salivary a-amylases.

In another preferred embodiment, the invention provides a process for cloning the novel nucleotide Seq Id No. 2 encoding a protein having 100% sequence identity with Seq Id No.3 cloned in an expression vector system and expression and purification of recombinant PMAI protein, for inhibiting stored grain insect pest a-amylases.

Accordingly, the method mentioned above comprises, a) Cloning the nucleotide sequence represented by Seq Id No.2 in an expression vector system and expressing the recombinant α-amylase inhibitor protein (PMAI) having 100% sequence identity with sequence ID-3; b) Refolding the protein using urea; and c) Purifying the refolded protein through Ni-NTA resin to obtain purified recombinant premature amylase inhibitor (PMAI) having sequence ID No. -3.

Accordingly, the present invention provides a process for the cloning of the 224 base pair nucleotide Seq Id No.2 encoding the premature α-amylase inhibitor (PMAI) having 100% sequence identity with Seq ID No.3 in an appropriate expression vector and expression and purification of recombinant PMAI proteins. The mature Alpha-amylase inhibitor (32 amino acids) is expressed in the mature seeds of Amaranthus hypochondriacus and is the smallest insect a-amylase inhibitor known till now. The present inventors provide its amplification using degenerate primers, elucidation of complete nucleotide sequence of full length gene by using 5' and 3' RACE reaction and cloning the nucleotide construct encoding the premature α-amylase inhibitor protein (PMAI).

The nucleotide sequence represented by Seq Id No.2 is introduced in a recombinant plasmid such as pET-28-a. This recombinant plasmid pET-28-a comprising Seq Id No.2 is transfected in a host cell which serves as an expression vector system.

Accordingly, the expression vector systems employed for the cloning process are mainly the bacterial expression system, yeast expression system and the adenoviral expression vector system. More preferably, the expression of premature amylase inhibitors (without the signal peptide) was carried out in bacterial expression system. Primers were designed (Table 1) to clone nucleotide constructs encoding AI in pET 28-a expression vector (Novagen, USA). The expression cassette of cloned Constructs was confirmed by sequencing and constructs were transformed into BL 21 cells (E.coli).

Further, colony PCR was carried out to select BL21 clones carrying desired construct. Three clones were selected for premature AI construct and induced with IPTG for desired protein expression. Brief protocol for induction and expression is as follows, clones were grown in LB media at 37°C containing Kanamycin (3( g/ml) until optical density of the culture would reached to ~ 0.5. Culture was induced by adding isopropyl-beta-D- thiogalactopyranoside (IPTG) to 0.4mM final concentration and transferred to 16 °C for 4 hours. Each parameter was optimized for maximum protein expression. Cells were then pelleted by centrifugation, suspended in lysis buffer and sonicated. Premature AI was found to be expressed in the insoluble fraction of the lysate.

Inclusion bodies were extracted, dissolved in buffer and refolding of the premature AI was done using urea. This protein has 6X histidine tag on its N-terminal end. As Ni+ ion has affinity towards histidine, refolded Premature AI was further purified by loading on Ni-NTA column (Figure 2). Molecular weight of expressed Premature AI was determined my mass spectrometry. Mass spectrometric analysis was performed using AB SCIEX TOF/TOFTM 5800 system.

In another preferred embodiment, the present invention provides evaluation of the inhibitory action of the present recombinant protein (PMAI) on α-amylases produced by insects, pests, bacteria and fungi.

Specific a-amylase inhibitory activity of the protein was observed against digestive a- amylases of insects such as Tribolium castaneum , and Callosobruchus chinensis and also against fungal α-amylases (Aspergillus oryzae). Higher amylase inhibitory activity was seen specifically for storage pests from order Coleoptera. According to this embodiment, recombinant premature AI comprising 75 amino acids as depicted in Figure 1 showed differential amylase inhibitory activity against bacterial amylases compared to human amylases. Premature AI was unable to inhibit human salivary amylases even at higher concentrations (5μg), thereby indicating its potential as an effective tool for inhibiting crop or grain invading pests without adversely affecting human functioning.

The inhibitory activity of the recombinant protein (PMAI) was determined against insect pests selected from Tribolium castaneum and Callosobruchus chinensis.

Human saliva was collected before meal, centrifuged and used as a crude source. The adults and larvae forms of Tribolium castaneum were reared on wheat flour, and freshly emerged adults and larvae were crushed in liquid nitrogen and 100 mg of tissue was incubated in 600μ1 of phosphate buffer, pH7 at 4°C overnight, centrifuged and the supernatant was used as a crude source for determining the inhibition activity of the recombinant protein.

Similarly, Callosobruchus chinensis was reared on Mung bean and the crude amylase was collected using an identical procedure as described above. On evaluation of enzyme inhibitory action of premature AI (PMAI) against coleopteran insect α-amylases showed complete inhibition of activity of adult Tribolium α-amylases at a concentration of 3μg. Activity of larval α-amylases was reduced to the half at higher concentration of 5μg of Premature AI. A Maximum of 50% and 13% inhibition of enzyme activity of fungal and bacterial a- amylases respectively was observed using the recombinant amylase inhibitors (PMAI) at 5μg concentration (Figure 3). Inhibitory activity of the recombinant amylase inhibitors is effective against fungi belonging to but not restricted to species selected from Aspergillus, Alternaria, and Fusarium, and Giberella.

In yet another embodiment, inhibitory activity of recombinant Premature AI (PMAI) was evaluated at different concentrations ranging from 0.01- 0.4nM against insect a- amylases such from Tribolium castaneum (adult), fungal amylases such as those produced by Aspergillus oryzae (diastase) and bacterial amylases such as those produced by Bacillus licheniformis . Percent inhibition of activity for T. castaneum a-amylase from adult forms of the insect was increased from 18% to 100% on addition of recombinant amylase in the range of 0.01 to 0.22 nM while inhibition against A. oryzae diastase was saturated to 50 % at 0.06 nM concentration of PMAI. Titration curve of inhibitory activity of premature AI was carried out against T. castaneum amylases (Adult) and A. oryzae diastase. Activity of T. Castaneum amylase (Adult) was inhibited from 18% to 100% by the 0.01-.0.22 nM concentration of Premature AI.

Premature AI was effective in total inhibition of activity of T. castaneum digestive a- amylase from adults and can be further tested for its use in retarding the growth of this pest (Figure 4).

Thus the gene cloned in the instant invention is 'specific inhibitor' of digestive a- amylases of stored grain insect pests but having no activity against human. In an optional embodiment, the present invention provides the present composition in association with one or more agriculturally acceptable insecticidal excipients/ingredients or carriers for use in inhibiting a-amylases of stored grain insect pests as well as amylase of sucking insect pests. The composition according to the invention may be in the form of solid forms such as granules, powders, pellets; liquid forms such as solutions, sprays, aerosols etc.

An agriculturally acceptable carrier employed in the present formulation may be solid, liquid or both. Solid carriers are essentially: mineral earth such as kaolin, silicas, silica gels, silicates, talc, kaolin, attapulgite, pumice, limestone, polysaccharides and other organic and inorganic solid carriers.

Liquid mediums are preferable so as to provide formulations that may be used in non- pressurized, hand-actuated spray pumps. Liquid mediums or diluent used is preferably water. The amount of diluent used would depend upon the particular mode of administration of the formulation and to the hectare of agricultural field or the foliage or grains that it is to be applied or sprayed. In one more embodiment, the present invention provides a signal peptide having Seq

Id No.4, wherein the said peptide is fused to thethe reporter protein and directs the transportation of the functional peptide fused to it to the extracellular matrix of a host cell. (Figure 6) In yet another preferred embodiment, the present invention provides a method for treating storage insect pest as well as sucking insect pests, fungi or bacteria with the present composition comprising Seq Id No. 2 encoding a protein having 100% identity with Seq Id No. 3 by either spraying or injecting the said composition in a standing crop plant to inhibit the aforesaid invading species and to maintain the quality of the stored grains.

Accordingly, in yet another embodiment, the invention provides compositions comprising recombinant premature amylase inhibitor (PMAI) having sequence ID-3, for use in inhibiting amylase of stored grain insect pests as well as amylase of sucking insect pests. In yet another embodiment, the invention provides methods of treating stored grain insect pests as well as sucking insect pests, with methods comprising admixing the composition comprising Seq Id No. 2 encoding a protein having 100% identity with Seq Id No. 3 with the stored grains to maintain the quality of the grains. In yet another embodiment, the invention provides methods of treating stored grain insect pests as well as sucking insect pests, with methods comprising spraying the composition comprising Seq Id No. 2 encoding a protein having 100% identity with Seq Id No. 3 over the stored grains to maintain the quality of the grains.

In yet another embodiment, the invention provides compositions, wherein the amount of recombinant premature amylase inhibitor (PMAI) having sequence ID No. -3 may varies from 0.001 to 99% of the composition. Examples: Following examples are given by way of illustration therefore should not be construed to limit the scope of the invention.

Example 1: Cloning of mature and premature amylase inhibitor peptides

The expression of premature amylase inhibitor (without signal peptide) was carried out in bacterial expression system. Primers were designed to clone PMAI in a pET 28-a expression vector (Novagen, USA). The expression cassette of cloned construct was confirmed by sequencing and these constructs were transformed into E. coli BL 21 cells.

Table 1: Primers designed for cloning Premature AI into E.coli (BL21) cells. Underlined and bold Sequences indicate restriction enzyme sites.

Name Sequence Length pET28_PreMatureAI_F AAAAAAGCGGCCGCGTGCGCGATGACATTGCC

ATTGC 37 pET28_PrematAI_R AAAAAACTCGAGTCAAGAGCAATTTCCATAGTA

GTCTG 38

Colony PCR was carried out to select BL21clones carrying desired construct. Three clones were selected for premature AI construct and induced with IPTG for premature AI protein expression. Brief protocol for induction and expression employed was as follows, clones were grown in LB media at 37°C containing Kanamycin (3( g/ml) until optical density of the culture would reached to -0.5. Culture was induced by adding isopropyl-beta- D-thiogalactopyranoside (IPTG) to 0.4mM final concentration and transferred to 16 °C for 4 hours. Each parameter was optimized for maximum protein expression. Cells were then pelleted by centrifugation, suspended in lysis buffer and sonicated. Premature AI was found to be expressed in insoluble fraction of the lysate. Inclusion bodies were extracted, dissolved in buffer and refolding of the Premature AI was done using urea. This protein has 6X histidine tag on its N-terminal end. As Ni+ ion has affinity towards histidine, refolded Premature AI was further purified by loading on Ni-NTA column (Figure 2). Molecular weight of expressed Premature AI was determined my mass spectrometry. Mass spectrometric analysis was done on AB SCIEX TOF/TOFTM 5800 system.

Example 2:

Inhibitory potential of the recombinant a-amylase inhibitor protein (PMAI)

Human saliva was collected before meal, centrifuged and used as a crude source. Adults and larvae of Tribolium castaneum were reared on wheat flour, freshly emerged adults and larvae were crushed in liquid nitrogen and 100 mg of tissue was incubated in 600μ1 of phosphate buffer pH7 at 4°C overnight, centrifuged and supernatant was used as a crude source. Similarly, Callosobruchus chinensis was reared on Mung bean and crude a-amylase was collected using identical procedure. On evaluation of the enzyme inhibitory action of the recombinant protein against the above a-amylases, it was observed that Premature AI showed complete inhibition of activity of adult Tribolium a-amylases at 3μg concentration. Activity of larval amylases was reduced to the half at higher concentration of 5μg of Premature AI. Maximum inhibition of activity of fungal and bacterial amylases was found to be 50% and 13% respectively at 5μg concentration (Figure 3).

Inhibitory activity of recombinant Premature AI (PMAI) was carried out at different concentrations ranging from 0.01- 0.4nM against T. castaneum α-amylase (adult) and A. oryzae diastase. Percent inhibition of activity for T. castaneum crude α-amylase from adults was increased from 18% to 100% for the range of 0.01 to 0.22 nM AI while percent inhibition against A. oryzae diastase was saturated to 50 % at 0.06 nM concentration of AI. Premature AI was effective in total inhibition of T. castaneum a-amylase activity from adults and can be further tested for its use in retarding the growth of this pest (Figure 4).

Example 3:

Real-time analysis for quantification of amylase inhibitor transcripts in different tissues of plants from Amaranthaceae family.

Transcript abundance of amylase inhibitor (Premature AI; 75 a.a.( 43+32 amino acid sequence)) in different parts/tissues of plants from Amaranthaceae family was evaluated using Real-time PCR analysis.

Three species viz- A. hypochondriacus, C. argentea and A. aspera from three different sub-families were selected for analysis. Variable expression pattern was observed in plant parts of all three species. Highest accumulation of AI transcripts was observed in A. hypochondriacus in florescence. Being a reproductive part, accumulation of AI in inflorescence might serve as a defence strategy of the plant to mitigate herbivory. Negligible AI transcripts were observed although abundant AI protein was present in A. hypochondriacus seeds suggesting that this protein is being transported and accumulated in mature seeds. Identical AI transcript was present in all three species indicating a common ancestral origin of the present AI gene. Total RNA was extracted from young and mature leaves, young and mature inflorescence and seeds of Amaranthus hypochondriacus, Celosia argentea and Achyranthes aspera using Trizol reagent (Invitrogen, CA, USA). Crude RNA samples were treated with RQ1 DNase (Promega, USA), followed by phenol/chloroform/isoamyl alcohol (25:24: 1) extraction and ethanol precipitation. Two microgram of the DNA-free RNA samples was reverse-transcribed using oligo dT primers and reverse transcriptase (Promega, USA) following the manufacturer's recommendations. Real Time PCR primers pairs were designed in non-homologous regions of amylase inhibitor (Table 2). cDNA was diluted (1: 10) before use in a PCR reaction and quantitative Real Time PCR reactions were performed using AB 7900 Fast Start Real Time PCR System (Applied Biosystems, USA; cycler conditions: 95 °C for lOmin; 40 cycles of 3 s at 95 °C and 30 s at 55 °C with an additional dissociation stage of 15 s each at 95 °C, 55 °C and 95 °C) and SYBR Green PCR master mix (Roche Applied Science, Germany). Each plate was run with a standard curve and no template control. Relative quantification was carried out using the standard curve method with Elongation factor la (EFla) as a reference gene (Table 2). Amplification efficiency of each gene was assessed by plotting a standard curve using five serial dilutions of cDNA from a template pool and similar efficiencies were calculated by LinRegPCR software used for comparisons. (http://www.hartfaalcentrum.nl/index.php ?main=files&sub=LinRegPCR) The target gene expression levels of samples were then normalized using EF1.

Table 2: Primers used in Real-time analysis for quantification of amylase inhibitor transcripts in different tissues of plants from Amaranthaceae family.

Primer name Accession Primer sequence Length no. (bp)

AI_Forward P80403 5 ' TTGCGGACCT AAGATGGATGGAG3 ' 23

AI_Reverse P80403 5 ' AGAGC AATTTCCGT AGTATC AGA AG3 ' 26

EF1 Forward ΒΓ75Π66 5 GGTGTCATCAAGCCTGGTATGGT3' 24

EF1 Reverse ΒΓ75Π66 5'ACTCATGGTGCATCTCAACGGACT3' 24

Example 4:

Localization of signal-peptide-mediated transport of fused Green Fluorescent Protein (GFP).

This 26 amino acid signal peptide fused at the N terminal end of the protein of interest viz. in the present invention, to a reporter protein such as a Green fluorescent protein (GFP) was targeted to the extra-cellular matrix of the plant cell. In plants, the protein fused to the signal peptide was secreted into the phloem, thereby rendering the ready availability of the required protein to all the tissues. The protein on coming in contact with sucking insect pest in the vicinity readily facilitated the inhibition of a- amylases of the insect pests. Using bioinformatics tools, function of the signal peptide (26 amino acids) of AI from A. hypochondriacus (43+32 amino acid sequence) was predicted to be protein transport to the extracellular matrix/tissues. This signal peptide was fused with a reporter protein (Green florescent protein; GFP) and was transiently expressed in tobacco epithelial cells through agro-infiltration. Only GFP construct was used as a control. Expression of only GFP construct showed abundant GFP protein in cytoplasm and nucleus of tobacco epithelial cells. When fused with signal peptide, GFP protein was observed in inter-cellular spaces called apoplasts but not in nucleus and cytoplasm. Present result supports the prediction of involvement of this signal peptide in extracellular transport of fused protein.

Example 5:

Process for synthesis of signal peptide fused to the Glucose Fluorescent Protein (GFP)

A long forward primer was designed (114bp) including restriction site, complete signal peptide sequence and few initial bases (23bp) of GFP open reading frame (ORF). Reverse primer was designed on opposite strand of GFP ORF and restriction site was incorporated. Another primer pair was designed to amplify only GFP ORF (Table 3). A PCR product was generated using above primers and was RE-digested with respective restriction enzymes. A binary vector pRI 101-AN was also digested with same restriction enzymes and ligated with RE-digested PCR product. Resulted ligated product was transformed in E. coli top 10 cells (Invitrogen, Massachusetts, USA) and colony PCR was carried out to select positive clones. Constructs i) pRI 101-AN + GFP and ii) pRI 101-AN + SP-GFP were purified from positive clones and transformed into Agrobacterium tumefaciens strain 3101 cells using Rifampicin and Kanamycin as a selection markers. Young tobacco leaves were agroinfiltrated with Agrobacterium clones carrying both the constructs. Expression of GFP was visualized after 72 hrs through fluorescence microscope using GFP filter (Leica, Wetzler, Germany).

In Figure 6A), B) and C) localization of only GFP protein was depicted by white arrows indicating nuclear accumulation of GFP protein in multiple nuclei, GFP was also accumulated in cytosol. Figure 6 D), E) and F) indicates the localization of the signal peptide fused with GFP protein in intercellular space (apoplasts) indicating extracellular secretory function of signal peptide.

Table 3: Primers designed to amplify only GFP and SP-GFP sequences. Primer name Primer sequence Length (bp)

AhS PGFP_NdeI_F 1 5 ' AAAAAAC ATATGATGGATATGGC AAGGAGC A 114

TTCTAGGTCTCATGGCAGCCTTGATGTTGGTAG CCACCATAGCTCCTCCAACCATGGCTCTGTCTA AAGGTGAAGAACTGTTC3 '

GFP_ _BamHI_Rl 5 ' AAAAAAGGATCCTTTGTAGAGCTC ATCC ATGC 34

CG3'

GFP_ _NdeI_Fl 5'AAAAAACATATGCTGTCTAAAGGTGAAGAAC 36

TGTTC3'

Claims

An insecticidal composition comprising a nucleotide sequence represented by Seq Id No. 2 cloned in an expression vector system, wherein the said sequence encodes a recombinant protein represented by Seq Id No. 5 wherein the said Seq Id No. 5 comprises a signal peptide of Seq Id No. 4 useful to facilitate transport of the said recombinant protein to the extra-cellular matrix of the plant cell.

The composition according to claim 1, wherein Seq Id No. 2 is inserted in a recombinant plasmid.

The composition according to claim 1, wherein the signal peptide having Seq Id No.4, is fused to reporter proteins.

The composition according to claim 1, wherein the recombinant plasmid is pET-28-a.

The composition according to claim 3, wherein the recombinant plasmid pET-28-a comprising Seq Id No.2 is transfected in a host cell wherein the host cell is a bacterial expression system.

The composition according to claim 1, wherein the composition optionally comprises agriculturally acceptable excipients and carriers selected from solid carriers and liquid carriers wherein the solid carriers are selected from the group consisting of mineral earth such as kaolin, silica, silica gels, silicates, talc, kaolin, attapulgite, pumice, limestone, polysaccharides.

The composition according to claim 9, wherein the amino acid sequence is represented by Seq Id No.5 exhibits inhibitory activity against insect species selected from Tribolium castaneum, Callosobruchus chinensis, Bacillus licheniformis and Aspergillus oryzae.

The composition according to claim 1, wherein concentration ranging from O.OlnM to 0.4nM of the recombinant a-amylase inhibitor protein represented by Seq Id No.5 has inhibitory activity against crop and grain damaging insect, pest, fungal and bacterial species.

The composition according to claim 1, comprising Seq Id No. 5 for use against digestive a-amylases of insect pest as well as against a-amylases of invading fungi and bacteria.

A method for treating storage insect pest as well as sucking insect pests, fungi or bacteria with the composition as claimed in claim 1-7 by spraying or injecting the said composition in a standing crop plant to inhibit the aforesaid invading species and to maintain the quality of the grain.