WO2016097751A1 - Procédé de manipulation de génome médiée par cas9 - Google Patents

Procédé de manipulation de génome médiée par cas9 Download PDF

Info

Publication number
WO2016097751A1
WO2016097751A1 PCT/GB2015/054066 GB2015054066W WO2016097751A1 WO 2016097751 A1 WO2016097751 A1 WO 2016097751A1 GB 2015054066 W GB2015054066 W GB 2015054066W WO 2016097751 A1 WO2016097751 A1 WO 2016097751A1
Authority
WO
WIPO (PCT)
Prior art keywords
cas9
eukaryotic cell
cell
grna
nucleic acid
Prior art date
Application number
PCT/GB2015/054066
Other languages
English (en)
Inventor
Anthony Perry
Toru Suzuki
Maki Asami
Original Assignee
The University Of Bath
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by The University Of Bath filed Critical The University Of Bath
Publication of WO2016097751A1 publication Critical patent/WO2016097751A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/102—Mutagenizing nucleic acids
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; CARE OF BIRDS, FISHES, INSECTS; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K67/00—Rearing or breeding animals, not otherwise provided for; New breeds of animals
    • A01K67/027—New breeds of vertebrates
    • A01K67/0275—Genetically modified vertebrates, e.g. transgenic
    • A01K67/0276—Knockout animals
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
    • C12N15/873—Techniques for producing new embryos, e.g. nuclear transfer, manipulation of totipotent cells or production of chimeric embryos
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
    • C12N15/90—Stable introduction of foreign DNA into chromosome
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
    • C12N15/90—Stable introduction of foreign DNA into chromosome
    • C12N15/902—Stable introduction of foreign DNA into chromosome using homologous recombination
    • C12N15/907—Stable introduction of foreign DNA into chromosome using homologous recombination in mammalian cells
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; CARE OF BIRDS, FISHES, INSECTS; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2217/00—Genetically modified animals
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; CARE OF BIRDS, FISHES, INSECTS; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2217/00—Genetically modified animals
    • A01K2217/07—Animals genetically altered by homologous recombination
    • A01K2217/075—Animals genetically altered by homologous recombination inducing loss of function, i.e. knock out

Definitions

  • the present invention relates to the field of genome engineering and particularly describes a novel method to improve the efficiency and expand the applications of Cas9 mediated genome engineering.
  • Gene-targeted mice facilitate functional analysis in vivo but the manner in which they are typically produced in embryonic stem (ES) cells is laborious, time-consuming and expensive. Gene targeting in larger species, although increasingly relevant in biomedicine, is even more difficult.
  • ZFNs zinc finger nucleases
  • TALENs transcription activator-like effector nucleases
  • ZFN- or TALEN-generated breaks may be repaired by error- prone nonhomologous end joining (NHEJ) to generate insertions or deletions (indels) that produce non-functional (nail) alleles in cultured mammalian cells or single-cell embryos.
  • NHEJ error- prone nonhomologous end joining
  • Indels insertions or deletions
  • ZFN-generated double-strand breaks in cultured ceils stimulate high-fidelity homology-dependent repair (HDR) by several orders of magnitude.
  • HDR homology-dependent repair
  • ZFNs enable HDR-mediated gene targeting in single-cell mouse and rat embryos at efficiencies of 2.4-25% (Cui et al, 201 1).
  • the production of ZFNs and TALENs is complex, and pairs of each must be tailor-made for each region intended for targeting. The efficiency of targeting is also variable and animals have not been produced by simultaneous ZFN- or TALEN-mediated targeting of multiple alleles.
  • CRISPR clustered, regularly interspaced, short palindromic repeat
  • Cas9 is a DNA endonuclease whose site-specificity is determined by a single-stranded CRISPR RNA.
  • CRISPR RNAs have been modified from their original bacterial source (e.g. Streptococcus pyogenes) and Cas9 codon- optimized to function effectively in mammalian cells (Mali et al, 2013 and Cong et al, 2013).
  • the Cas9 system differs from ZFN and TALEN technologies because it utilizes a single protein - Cas9 - for all modifications, with target specificity provided by modified CRISPR guide RNA (gRNA).
  • the gRNA contains a 20 nucleotide (nt) sequence that forms a heteroduplex with its complementary DNA target, which can be any sequence upstream of the proto-spacer adjacent motif (PAM), NGG (Mali et al, 2013).
  • Typical gRNAs are relatively short (-110 nt) (Mali et al 2013) and thus easy to synthesize. With these advantages, the Cas9 system has rapidly been adopted to introduce targeted mutations in yeast, plants, Drosophila, C. elegans, zebrafish, mice, rats, pigs and macaques.
  • CRISPR-Cas9 editing of eukaryotic cells is described in WO2014/093622 and related US Patent No. 8,697,359 discloses the use of a CRISPR-Cas9 system on an immortalised human embryonic kidney cell line.
  • the present inventors have surprisingly found that the efficiency of Cas9 mediated genome engineering can be significantly enhanced and its applications extended by targeting unfertilized oocytes.
  • the present inventors have therefore developed a new method for altering one or more nucleic acid target sequences, comprising introducing into a first eukaryotic cell in meiosis: clustered regularly interspaced short palindromic repeats (CRISPR) associated protein 9 (Cas9) protein, or DNA or RNA encoding Cas9 (hereafter simply Cas9); and Cas9 guide RNA (gRNA) that hybridises to the target sequence(s).
  • CRISPR clustered regularly interspaced short palindromic repeats
  • Cas9 Cas9 guide RNA
  • the method can be used to develop recombinant cells or offspring and has been shown to result in can result in high efficiency genome targeting.
  • the present invention provides a method for altering one or more nucleic acid target sequences, comprising introducing into a first eukaryotic cell in meiosis: clustered regularly interspaced short palindromic repeats (CRISPR) associated protein 9 (Cas9) protein, or DNA or RNA encoding Cas9 (hereafter simply Cas9); and Cas9 guide RNA (gRNA) that hybridises to the target sequence(s).
  • CRISPR clustered regularly interspaced short palindromic repeats
  • Cas9 Cas9 guide RNA
  • Cas9 may originate from or be derived from S. pyogenes (spCas 9) or S. aureus (saCas 9) or another species, as is the case for Cpfl .
  • Cas9 may be substantially the same as a wild type spCas9 or saCas9 sequence, or may have a high degree of homology with a wild type spCas9 or saCas9 sequence.
  • Cas9 may be naturally derived or may be synthetic.
  • Cas9 may include one or more mutations or modifications, such as one or more of polyadenylation or 5' capping.
  • Cas9 may be encoded by a transgene expressed in the first meiotic eukaryotic cell.
  • Cas9 retains its endonuclease activity.
  • a second eukaryotic cell or a portion thereof, including its genomic DNA is introduced with the Cas9 or gRNA.
  • the Cas9 and gRNA may be combined together and introduced simultaneously into the first eukaryotic cell, together with the second eukaryotic cell or portion thereof.
  • Cas9 is introduced prior to the introduction of the second eukaryotic cell or portion thereof and gRNA.
  • Cas9-encoding cRNA may be introduced into the first eukaryotic cell at least 1 hour or at least 2 hours, preferably at least 3 hours before the second eukaryotic cell or portion thereof and gRNA are introduced into the first eukaryotic cell, so that the cRNA is expressed.
  • the present inventors have found that sequentially introducing Cas9, gRNA and the second eukaryotic cell into the first meiotic eukaryotic cell can result in high efficiency genome targeting.
  • the inventors believe that prior loading of the first eukaryotic cell with Cas9 allows time for Cas9 expression to increase, enhancing endonuclease activity by the time gRNA and a second eukaryotic cell or portion thereof are introduced.
  • the nucleic acid target sequence may without limitation be a deoxyribonucleotide or ribonucleotide polymer such as DNA or RNA and may be in single- or double- stranded form.
  • the polymers may encompass known modified nucleotides.
  • the nucleic acid target sequence may be, for example, a gene or a non-coding sequence within or adjacent to a gene.
  • the nucleic acid target sequence can be present in a chromosome, an episome, an organellar genome such as a mitochondrial genome or an infecting viral genome for example.
  • a target sequence may be within the coding sequence of a gene, within transcribed non-coding sequence, such as, for example, leader sequences, trailer sequences or introns, or within non-transcribed sequence, either upstream or downstream of the coding sequence.
  • the target sequence may be contained within the first meiotic eukaryotic cell or may be contained within the second eukaryotic cell.
  • a eukaryotic cell as used herein refers to a non-bacterial call.
  • a eukaryotic cell as used herein refers to an animal cell or a cell line derived from an animal cell.
  • the first eukaryotic cell is a haploid cell. More preferably, the first eukaryotic cell is in meiosis.
  • the first eukaryotic cell is an oocyte, such as an immature oocyte or a metaphase II oocyte. The oocyte may be enucleated.
  • the oocyte is a mammalian oocyte, more preferably the mammalian oocyte is not a human oocyte.
  • the second eukaryotic cell may be a sperm cell, preferably a spermatozoon.
  • the portion of the second eukaryotic cell includes a somatic cell nucleus.
  • the nucleus may be extracted from a somatic eukaryotic cell such as a spermatozoon and subsequently introduced into the first eukaryotic cell.
  • the second eukaryotic cell is a mammalian cell, more preferably the mammalian cell is not a human cell.
  • Cas9-mediated editing of oocytes occurs during the period of gamete-to-embryo transition involving meiotic exit, sperm decondensation and polar body cytokinesis, which typically occurs well before (usually several hours before) pronuclear formation or the onset of mitotic S-phase. This is one of the features that distinguishes Cas9-mediated editing of the present invention from that carried out on pronuclear zygotes, which have entered the mitotic cell cycle and accordingly contain mitotic chromatin.
  • Sperm decondensation provides a unique genomic opportunity for recombination with the preferential targeting during this phase making it possible prescriptively to alter a single parental allele, even if both parental alleles have identical DNA sequences.
  • the method of the invention can be used to alter the expression of one or more target genes. Genes may be knocked out, knocked-in, replaced, corrected or mutated as required.
  • one or more target nucleic acid segments may be deleted or inserted. Inserted nucleic acid segments can be integrated at a prescribed sequence in genomic DNA.
  • Cas9 gRNA can be introduced directly or indirectly into the meiotic eukaryotic cell at a concentration of from about 0.01 ng/ ⁇ or more.
  • Cas9 gRNA may be directly introduced at a concentration of about 0.01 ng/ ⁇ to about 500 ng/ ⁇ , preferably about 0.01 ng/ ⁇ to about 300 ng/ ⁇ , most preferably about 0.01 ng/ ⁇ to about 200 ng/ ⁇ .
  • Cas9 gRNA may be encoded by DNA.
  • Cas9 and Cas9 gRNA can be introduced into the first cell via micro-injection such as intracytoplasmic sperm injection (ICSI), or via a viral vector.
  • micro-injection such as intracytoplasmic sperm injection (ICSI), or via a viral vector.
  • Suitable viral vectors may include retrovirus, adenovirus, parvovirus, coronavirus, negative strand RNA viruses such as orthomyxovirus, rhabdovirus, paramyxovirus, positive strand RNA viruses such as picornavirus and alphavirus, and double-stranded DNA viruses including adenovirus, herpesvirus and poxvirus.
  • the virus is lentivirus.
  • the Cas9 protein is directly introduced into the first eukaryotic cell, or introduced indirectly via Cas9 complementary DNA (cDNA).
  • the cDNA may include one or more mutations or modifications, such as one or more of polyadenylation or 5' capping
  • Cas9 cDNA can be introduced into the first eukaryotic cell at a concentration of from about lng/ ⁇ or more.
  • Cas9 cDNA may be introduced at a concentration of about 1 ng/ ⁇ to about 500 ng/ ⁇ , preferably about 1 ng/ ⁇ to about 300 ng/ ⁇ , most preferably about 1 ng/ ⁇ to about 200 ng/ ⁇ .
  • Sequential or concurrent introduction of Cas9, gRNA and a second eukaryotic cell or portion thereof into a first eukaryotic cell in meiosis can result in the production of embryos, which may be transferred to pseudo-pregnant recipient surrogate mothers to produce offspring.
  • the method of the present invention may therefore be used to produce embryos or offspring, typically mammalian offspring such as livestock, research animals or humans.
  • Embryos or offspring produced by the method may have edited genomes, in other words, they may be transgenic embryos or transgenic offspring.
  • the method does not cause suffering to animals produced by the method.
  • Livestock can include for example, pigs, sheep, goats, cattle and horses.
  • Research animals can include mammals such as rodents, non-human primates, rabbits, dogs and cats.
  • the offspring are not human.
  • animals produced by the method are preferably mammals other than humans.
  • the method of the present invention may be used to produce a recombinant cell, preferably a mammalian recombinant cell.
  • the cell may originate from a livestock or research animal species or may be human. In embodiments of the invention the recombinant cell is not human.
  • Figure 1 shows Cas9-mediated editing in mil exit following ICS!
  • A Schematic of 1-step (upper) and sequential methods of Cas9-mediated mil editing, mil, metaphase II.
  • B Paired Hoffman modulation (upper) and eGFP expression (eGFP) images of E4.0 blastocysts produced by 1-step injection of wt mil oocytes with 129-eGFP sperm from hemizygotes, with concentrations of injected Cas9 cRNA and eGFP gRNA indicated below.
  • An asterisk indicates a presumptively phenotypic mosaic. Bar, 100 ⁇ .
  • (C) Numerical representation of embryo development and green fluorescence following injection of sperm from 129-eGFP hemizygous males. Percentages are of blastocyst development on embryonic day 4 (E4.0) (open) and of blastocysts that fluoresced green (filled) indicating 129-eGFP transgene expression in 1-step (green) or sequential (blue) methods. Starting embryo numbers and injected concentrations of Cas9 cRNA and eGFP gRNA (gRNA) are shown beneath.
  • Figure 2 shows sequence analysis of allelic asymmetry in parental genome mil editing.
  • A Sequences of reverse-transcriptase PCR products from embryonic day 4 (E4.0) blastocysts developing after the 1-step method of editing
  • Fig. 1A Sequences of reverse-transcriptase PCR products from embryonic day 4 (E4.0) blastocysts developing after the 1-step method of editing
  • Fig. 1A Sequences of reverse-transcriptase PCR products from embryonic day 4 (E4.0) blastocysts developing after the 1-step method of editing
  • Fig. 1A Sequences of reverse-transcriptase PCR products from embryonic day 4 (E4.0) blastocysts developing after the 1-step method of editing
  • Fig. 1A Sequences of reverse-transcriptase PCR products from embryonic day 4 (E4.0) blastocysts developing after the 1-step method of editing
  • Fig. 1A Sequences of reverse-transcripta
  • the proto-spacer adjacent motif (PAM) is highlighted in green. Mutations are indicated in red typeface. 5' +, mutations detected 5' (but not 3') of the displayed sequence.
  • C Sequences of editing mutants as for (A), except that the transgenic alleles were maternal; wt 129 sperm were injected into mil oocytes obtained from 129-eGFP single copy (upper) or Nanog-eGFP knock-in hemizygotes.
  • E Merged confocal immunofluorescence images of single embryos at the times indicated (h) after ICSI, showing DNA labelled with propidium iodide (red) and antibody labeling (green) of tubulin-a (Tuba, upper panels) or histone HI (HI). Both sperm and oocytes were wt. White arrowheads indicate paternal chromatin. Bar, 100 ⁇ .
  • F Schematic depicting a model for Cas9-mediated editing following injection of mil oocytes (mil). Limitted editing of maternal alleles during the gamete-to-embryo transition is inherent to the system, whereas limitted editing of paternal alleles in zygotes is because available targets have already been removed.
  • FIG. 3 shows disruption of green fluorescence in blastocysts following mil editing.
  • Figure 4 shows pedigree analysis of offspring produced after mil editing.
  • A Pedigree analyses of founder lines produced by the 1-step method of mil editing (Fig. 1A). Inset tables indicate injected concentrations (ng/ ⁇ ) of Cas9 cRNA (c) and gRNA (g) against tyrosinase (Tyr) and Foxnl, the number of 2-cell embryos transferred and term offspring, indicating perinatal mortality and survivors (number and percentage) possessing a mutant phenotype.
  • Symbols are: box, male; circle, female; black coat, filled; white coat, open; mosaic (white and black coat), half-filled; dark grey, genomic sequencing revealed one or more mutations; br, two Fl females with brown coats; wt, wild-type Tyr sequence; i, eye phenotype; CDl, the outbred strain, CDl (ICR).
  • B Pedigree analysis of founder lines as per (A), except that offspring were produced by the sequential method of mil editing (Fig. 1 A).
  • Figure 5 shows genome sequence analysis of offspring produced by native gene mil editing.
  • A Genomic sequences of offspring produced by the 1-step method of mil editing at the tyrosinase ⁇ Tyr) locus by injecting 30 ng/ml Cas9 cRNA and Tyr gRNA. The gRNA-corresponding sequence (light grey, upper line) plus adjacent 5' sequence is displayed on the top row and mutants beneath, with the proto-spacer adjacent motif (PAM) highlighted on upper right-hand side. Mutations are indicated in dark grey type-face. 5' +, mutations detected 5' (but not 3') of the displayed sequence; 3' +, mutations detected 3' of the displayed sequence. Pale highlighting indicates ambiguous calls presumptively produced by multiple targeting events.
  • the inset table indicates the corresponding phenotypic change (if any) exhibited by offspring.
  • B Founder (FO, top) and Fl offspring produced by Cas9-mediated mil editing of the Tyr locus by injecting 30 ng/ml Cas9 cRNA and Tyr gRNA as indicated. Editing to produce founders was performed in C57BL/6. White arrowheads, mosaic; grey arrowheads, apparently non-mosaic mutants. The Fl litter was produced by crossing a black coat-colour female founder (indicated) with a CDl male; the founder carried a germline Tyr mutation confirmed by sequencing, to produce white coat-colour pups (indicated). Non-white coat colour mutations associated with Tyr are likely to be responsible for the brown coat colour Fl phenotype.
  • FIG. 6 Targeting the Rexl gene by injecting mil oocytes.
  • A Rexl targeting construct showing the endogenous Rexl locus with the position of Cas9-mediated cleavage (centre) and the locus structure after successful targeting. Exons are shown to scale and intron sizes are indicated numerically. Rexl exons are represented by blue or white boxes.
  • mKOl Kusabira Orange 1
  • IRES a non- functional internal ribosome entry site-containing sequence
  • HDR homology-directed repair.
  • the result of successful Rexl targeting is that mKO (fluorescence) expression is driven by its native promoter.
  • B Schematic illustration of the 2-step protocol, mil, metaphase II, the natural state of mature unfertilised oocytes (eggs).
  • a test-bed transgenic line (129-eGFP) was generated by introducing a single copy of ubiquitously-expressed pCAG-eGFP transgene (eGFP) onto the 129/Sv background.
  • eGFP ubiquitously-expressed pCAG-eGFP transgene
  • oocytes were sequentially injected first with Cas9 cRNA and after 3-4 h, eGFP gRNA plus sperm from a 129-eGFP hemizygote (Fig. 1A).
  • eGFP gRNA eGFP gRNA plus sperm from a 129-eGFP hemizygote
  • Tyr was chosen because its null phenotype are readily detectable: Tyr mutations in C57BL/6 (black) mice result in a white coat colour and/or changes in eye morphology and pigmentation.
  • Cas9 cRNA and Tyr gRNA were coinjected with wt C57BL/6 sperm into wt C57BL/6 oocytes and resultant 2-cell embryos transferred to pseudo-pregnant recipient surrogate mothers.
  • Editing of the paternal allele removes the gRNA target, precluding subsequent editing.
  • Mixed-type paternal allelic editing was not detected under optimal, non-limiting conditions (Fig. 1B,C), suggesting that editing occurred during developmental onset, prior to S-phase.
  • edited maternal alleles were typically mixed (Fig. 2C).
  • Editing when the Cas9 system is injected into pronuclear zygotes also causes mosaicism, indicating that the same mechanism operated. This implies that, consistent with observations in transgenesis, meiotic exit and the gamete-to-embryo transition does not efficiently support maternal genome editing, plausibly because the structure of maternal chromatin during this phase is refractory to the editing machinery.
  • Genome editing during meiotic progression has several practical implications.
  • the possibility that the paternal genome is preferentially targeted during decondensation implies that it might be possible to devise strategies to alter only one parental allele prescriptively, even where both have identical DNA sequences.
  • Selective editing of the paternal allele may have utility in the study of imprinting or to alter subtle deleterious (epi)mutations.
  • the relative recombinogenicity of decondensing paternal chromatin also opens the possibility that it might support a broader repertoire of targeting strategies, including the use of 'nickases', nuclear transfer, different delivery platforms, and the efficient deletion or integration of large DNA fragments.
  • Oocytes were collected from 8—12- week-old females following standard super-ovulation by serial intraperitoneal injection of 5 IU pregnant mare serum gonadotropin (PMSG) and 5 IU human chorionic gonadotropin (hCG).
  • PMSG pregnant mare serum gonadotropin
  • hCG human chorionic gonadotropin
  • Ovi ductal metaphase II (mil) oocytes were collected in M2 medium (Specialty Media, USA) -15 h post-hCG injection essentially as described. After repeated washing in M2, denuded oocytes were incubated in kalium simplex optimized medium (KSOM; Specialty Media, USA) under mineral oil in humidified 5% C0 2 (v/v air) at 37°C, until required.
  • KSOM kalium simplex optimized medium
  • Target gRNA synthesis the pT7-gRNA backbone vector system was employed.
  • Target gRNA sequences were selected using the CRISPR gRNA design tool (DNA 2.0) and informed the design of complementary oligonucleotides of the general sequences: TAGGN 2 o (forward) and AAACN 2 o (reverse) (Eurofins MWG Operon).
  • Forward and reverse oligonucleotides (10 ⁇ each) were annealed by incubating in 20 ⁇ lx NEB buffer solution at 95 °C for 5 min, ramping down to 50°C at 0.1°C/sec followed by 50°C for 10 min then ramping to 4°C at 1°C /sec.
  • ⁇ of annealed oligonucleotides were mixed with 400 ng of pT7-gRNA vector, 0.5 ⁇ Bsm I, 0.3 ⁇ Bglll, 0.3 ⁇ SalGl, 0.5 ⁇ T4 DNA ligase, 1 ⁇ ⁇ NEB buffer 3, 1 ⁇ T4 ligase buffer and 4 ⁇ nuclease-free water.
  • One-step digestion and ligation were performed in a PCR machine using the parameters: 3 cycles of 37°C for 20 min, 16°C for 15 min, followed by incubation at 37°C for 10 min and 55°C for 15 min. Products (2 ⁇ ) were used to transform DH5a.
  • RNA and gRNA 5'-capped and polyadenylated Cas9 cRNA was synthesized in a T7 mScriptTM Standard mRNA Production System (Cellscript, USA) from the T7 P3s-Cas9HC vector. Guide RNA (gRNA) was synthesized using a MEGAshortscript T7 Transcription Kit (Invitrogen, USA) according to the instructions of the manufacturer. RNAs were dissolved in nuclease-free water, quantified on a nanophotometer (Implen, Germany) and stored in aliquots at " 80°C until required. Immediately prior to injection, RNA solutions were diluted as appropriate with nuclease-free water.
  • oocytes were first injected with Cas9 cRNA solution and following culture for 3-4 h the same oocyte was injected with a single sperm in the appropriate gRNA dilution.
  • gRNA and Cas9 cRNA were mixed with a sperm suspension to give the appropriate final injection concentrations and a single sperm injected into the oocyte.
  • embryos were cultured in vitro either to the blastocyst stage to allow evaluation of genome editing in preimplantation embryos, or transferred at the 2-cell stage to pseudopregnant recipients so that mutations could be characterised in offspring.
  • Genomic DNA analysis For standard genotyping, mouse tissue samples were digested at 55°C for 3 h in 25-100 ⁇ of a lysis buffer containing 10% (w/v) sodium dodecyl sulphate and with 2 mg/ml proteinase K (Sigma). 1 ⁇ of a 1 : 10 dilution of each sample was used for genotyping by PCR in a 20 ml reaction volume. For genomic qPCR, crude lysates were diluted 50-fold and 5 ⁇ mixed with 20 ⁇ SYBR ® Green PCR Master Mix (Life Technologies).
  • qPCR was performed on an ABI7500 Real Time PCR machine (Applied Biosystems) with the following parameters: 95°C, 10 sec (once); 95°C, 5 sec; 62°C, 31 sec (40 cycles); 72°C, 35 sec (once).
  • DNA from the Nanog-eGFP line served as a single eGFP copy reference.
  • primer target sequence (5' ⁇ 3')
  • GFP-Venus-S eGFP G AC GTAAAC G GC C AC AAGTT
  • GFP-Venus-AS2 eGFP GTCCTCCTTGAAGTCGATGC
  • Frozen samples were adjusted to 9 ⁇ with nuclease-free water and single-cell lysis and DNA fragmentation were performed by heating to 50°C for 1 h followed by 99°C for 4 min in the presence of 1 ⁇ Proteinase K (0.5 mg/ml) in the Single Cell Lysis & Fragmentation Buffer provided.
  • Library preparation was performed on fragmented DNA samples using the solution provided and incubated in a thermal cycler with the following parameters (one cycle): 16°C, 20 min; 24°C, 20 min; 37°C, 20 min; 75°C, 5 min; hold at 4°C.
  • Genome amplification was performed with the addition of 7.5 ⁇ Amplification Master Mix and 5.0 ⁇ WGA DNA polymerase in a thermal cycler with the following parameters immediately after a single denaturing step (95°C, 3 min): 94°C, 30 sec; 65°C, 5 min (25 cycles); hold at 4°C.
  • eGFP sequences were amplified by PCR (Table 2) and amplimers purified from 1.4% (w/v) agarose gels using the Wizard ® SV Gel and PCR Clean-Up System (Promega) and supplied for sequencing with mixed read sequences (Source Bioscience).

Abstract

L'invention concerne un procédé de modification d'au moins une séquence cible d'acides nucléiques, comprenant l'introduction dans une première cellule eucaryote en meïose : une protéine appelée protéine 9 (Cas9) associée à de courtes répétitions palindromiques groupées et régulièrement espacées (CRISPR), ou l'ADN ou l'ARN codant pour Cas9 (simplement dénommée ci-après Cas9); et l'ARN guide de Cas9 (ARNg) qui s'hybride à la/les séquence cible(s).
PCT/GB2015/054066 2014-12-18 2015-12-18 Procédé de manipulation de génome médiée par cas9 WO2016097751A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
GB1422636.9 2014-12-18
GB201422636 2014-12-18

Publications (1)

Publication Number Publication Date
WO2016097751A1 true WO2016097751A1 (fr) 2016-06-23

Family

ID=54937312

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/GB2015/054066 WO2016097751A1 (fr) 2014-12-18 2015-12-18 Procédé de manipulation de génome médiée par cas9

Country Status (1)

Country Link
WO (1) WO2016097751A1 (fr)

Cited By (30)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9526784B2 (en) 2013-09-06 2016-12-27 President And Fellows Of Harvard College Delivery system for functional nucleases
US9840699B2 (en) 2013-12-12 2017-12-12 President And Fellows Of Harvard College Methods for nucleic acid editing
US10077453B2 (en) 2014-07-30 2018-09-18 President And Fellows Of Harvard College CAS9 proteins including ligand-dependent inteins
WO2018195418A1 (fr) 2017-04-20 2018-10-25 Oregon Health & Science University Correction de gène humain
US10113163B2 (en) 2016-08-03 2018-10-30 President And Fellows Of Harvard College Adenosine nucleobase editors and uses thereof
US10167457B2 (en) 2015-10-23 2019-01-01 President And Fellows Of Harvard College Nucleobase editors and uses thereof
US10208317B2 (en) 2013-12-11 2019-02-19 Regeneron Pharmaceuticals, Inc. Methods and compositions for the targeted modification of a mouse embryonic stem cell genome
US10323236B2 (en) 2011-07-22 2019-06-18 President And Fellows Of Harvard College Evaluation and improvement of nuclease cleavage specificity
US10385359B2 (en) 2013-04-16 2019-08-20 Regeneron Pharmaceuticals, Inc. Targeted modification of rat genome
US10457960B2 (en) 2014-11-21 2019-10-29 Regeneron Pharmaceuticals, Inc. Methods and compositions for targeted genetic modification using paired guide RNAs
US10508298B2 (en) 2013-08-09 2019-12-17 President And Fellows Of Harvard College Methods for identifying a target site of a CAS9 nuclease
US10597679B2 (en) 2013-09-06 2020-03-24 President And Fellows Of Harvard College Switchable Cas9 nucleases and uses thereof
US10745677B2 (en) 2016-12-23 2020-08-18 President And Fellows Of Harvard College Editing of CCR5 receptor gene to protect against HIV infection
US10858639B2 (en) 2013-09-06 2020-12-08 President And Fellows Of Harvard College CAS9 variants and uses thereof
US11033584B2 (en) 2017-10-27 2021-06-15 The Regents Of The University Of California Targeted replacement of endogenous T cell receptors
US11046948B2 (en) 2013-08-22 2021-06-29 President And Fellows Of Harvard College Engineered transcription activator-like effector (TALE) domains and uses thereof
WO2021144574A1 (fr) 2020-01-14 2021-07-22 Pig Improvement Company Uk Limited Édition génique d'ovocytes porcins et bovins non fécondés
US11268082B2 (en) 2017-03-23 2022-03-08 President And Fellows Of Harvard College Nucleobase editors comprising nucleic acid programmable DNA binding proteins
US11306324B2 (en) 2016-10-14 2022-04-19 President And Fellows Of Harvard College AAV delivery of nucleobase editors
US11319532B2 (en) 2017-08-30 2022-05-03 President And Fellows Of Harvard College High efficiency base editors comprising Gam
US11447770B1 (en) 2019-03-19 2022-09-20 The Broad Institute, Inc. Methods and compositions for prime editing nucleotide sequences
US11542509B2 (en) 2016-08-24 2023-01-03 President And Fellows Of Harvard College Incorporation of unnatural amino acids into proteins using base editing
US11542496B2 (en) 2017-03-10 2023-01-03 President And Fellows Of Harvard College Cytosine to guanine base editor
US11560566B2 (en) 2017-05-12 2023-01-24 President And Fellows Of Harvard College Aptazyme-embedded guide RNAs for use with CRISPR-Cas9 in genome editing and transcriptional activation
US11661590B2 (en) 2016-08-09 2023-05-30 President And Fellows Of Harvard College Programmable CAS9-recombinase fusion proteins and uses thereof
US11732274B2 (en) 2017-07-28 2023-08-22 President And Fellows Of Harvard College Methods and compositions for evolving base editors using phage-assisted continuous evolution (PACE)
US11795443B2 (en) 2017-10-16 2023-10-24 The Broad Institute, Inc. Uses of adenosine base editors
US11814624B2 (en) 2017-06-15 2023-11-14 The Regents Of The University Of California Targeted non-viral DNA insertions
US11898179B2 (en) 2017-03-09 2024-02-13 President And Fellows Of Harvard College Suppression of pain by gene editing
US11912985B2 (en) 2020-05-08 2024-02-27 The Broad Institute, Inc. Methods and compositions for simultaneous editing of both strands of a target double-stranded nucleotide sequence

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2013176772A1 (fr) * 2012-05-25 2013-11-28 The Regents Of The University Of California Procédés et compositions permettant la modification de l'adn cible dirigée par l'arn et la modulation de la transcription dirigée par l'arn
WO2014131833A1 (fr) * 2013-02-27 2014-09-04 Helmholtz Zentrum München Deutsches Forschungszentrum Für Gesundheit Und Umwelt (Gmbh) Édition de gène dans l'ovocyte au moyen de cas9 nucléases

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2013176772A1 (fr) * 2012-05-25 2013-11-28 The Regents Of The University Of California Procédés et compositions permettant la modification de l'adn cible dirigée par l'arn et la modulation de la transcription dirigée par l'arn
WO2014131833A1 (fr) * 2013-02-27 2014-09-04 Helmholtz Zentrum München Deutsches Forschungszentrum Für Gesundheit Und Umwelt (Gmbh) Édition de gène dans l'ovocyte au moyen de cas9 nucléases

Non-Patent Citations (6)

* Cited by examiner, † Cited by third party
Title
AISSAM IKMI ET AL: "TALEN and CRISPR/Cas9-mediated genome editing in the early-branching metazoan Nematostella vectensis", NATURE COMMUNICATIONS, vol. 5, 24 November 2014 (2014-11-24), United Kingdom, pages 5486, XP055252082, ISSN: 2041-1723, DOI: 10.1038/ncomms6486 *
J. A. ARRIBERE ET AL: "Efficient Marker-Free Recovery of Custom Genetic Modifications with CRISPR/Cas9 in Caenorhabditis elegans", GENETICS, vol. 198, no. 3, 26 August 2014 (2014-08-26), US, pages 837 - 846, XP055251982, ISSN: 0016-6731, DOI: 10.1534/genetics.114.169730 *
K. M. WHITWORTH ET AL: "Use of the CRISPR/Cas9 System to Produce Genetically Engineered Pigs from In Vitro-Derived Oocytes and Embryos", BIOLOGY OF REPRODUCTION, vol. 91, no. 3, 6 August 2014 (2014-08-06), US, pages 78 - 78, XP055242497, ISSN: 0006-3363, DOI: 10.1095/biolreprod.114.121723 *
S. KONDO ET AL: "Highly Improved Gene Targeting by Germline-Specific Cas9 Expression in Drosophila", GENETICS, vol. 195, no. 3, 3 September 2013 (2013-09-03), US, pages 715 - 721, XP055248203, ISSN: 0016-6731, DOI: 10.1534/genetics.113.156737 *
TORU SUZUKI ET AL: "Asymmetric parental genome engineering by Cas9 during mouse meiotic exit", SCIENTIFIC REPORTS, vol. 4, 23 December 2014 (2014-12-23), GB, pages 7621, XP055251643, ISSN: 2045-2322, DOI: 10.1038/srep07621 *
YUXUAN WU ET AL: "Correction of a genetic disease by CRISPR-Cas9-mediated gene editing in mouse spermatogonial stem cells", CELL RESEARCH - XIBAO YANJIU, vol. 25, no. 1, 5 December 2014 (2014-12-05), GB, CN, pages 67 - 79, XP055251794, ISSN: 1001-0602, DOI: 10.1038/cr.2014.160 *

Cited By (57)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10323236B2 (en) 2011-07-22 2019-06-18 President And Fellows Of Harvard College Evaluation and improvement of nuclease cleavage specificity
US10975390B2 (en) 2013-04-16 2021-04-13 Regeneron Pharmaceuticals, Inc. Targeted modification of rat genome
US10385359B2 (en) 2013-04-16 2019-08-20 Regeneron Pharmaceuticals, Inc. Targeted modification of rat genome
US10508298B2 (en) 2013-08-09 2019-12-17 President And Fellows Of Harvard College Methods for identifying a target site of a CAS9 nuclease
US10954548B2 (en) 2013-08-09 2021-03-23 President And Fellows Of Harvard College Nuclease profiling system
US11920181B2 (en) 2013-08-09 2024-03-05 President And Fellows Of Harvard College Nuclease profiling system
US11046948B2 (en) 2013-08-22 2021-06-29 President And Fellows Of Harvard College Engineered transcription activator-like effector (TALE) domains and uses thereof
US9526784B2 (en) 2013-09-06 2016-12-27 President And Fellows Of Harvard College Delivery system for functional nucleases
US10858639B2 (en) 2013-09-06 2020-12-08 President And Fellows Of Harvard College CAS9 variants and uses thereof
US9999671B2 (en) 2013-09-06 2018-06-19 President And Fellows Of Harvard College Delivery of negatively charged proteins using cationic lipids
US11299755B2 (en) 2013-09-06 2022-04-12 President And Fellows Of Harvard College Switchable CAS9 nucleases and uses thereof
US9737604B2 (en) 2013-09-06 2017-08-22 President And Fellows Of Harvard College Use of cationic lipids to deliver CAS9
US10597679B2 (en) 2013-09-06 2020-03-24 President And Fellows Of Harvard College Switchable Cas9 nucleases and uses thereof
US10682410B2 (en) 2013-09-06 2020-06-16 President And Fellows Of Harvard College Delivery system for functional nucleases
US10912833B2 (en) 2013-09-06 2021-02-09 President And Fellows Of Harvard College Delivery of negatively charged proteins using cationic lipids
US10208317B2 (en) 2013-12-11 2019-02-19 Regeneron Pharmaceuticals, Inc. Methods and compositions for the targeted modification of a mouse embryonic stem cell genome
US11820997B2 (en) 2013-12-11 2023-11-21 Regeneron Pharmaceuticals, Inc. Methods and compositions for the targeted modification of a genome
US10711280B2 (en) 2013-12-11 2020-07-14 Regeneron Pharmaceuticals, Inc. Methods and compositions for the targeted modification of a mouse ES cell genome
US11053481B2 (en) 2013-12-12 2021-07-06 President And Fellows Of Harvard College Fusions of Cas9 domains and nucleic acid-editing domains
US10465176B2 (en) 2013-12-12 2019-11-05 President And Fellows Of Harvard College Cas variants for gene editing
US9840699B2 (en) 2013-12-12 2017-12-12 President And Fellows Of Harvard College Methods for nucleic acid editing
US11124782B2 (en) 2013-12-12 2021-09-21 President And Fellows Of Harvard College Cas variants for gene editing
US10077453B2 (en) 2014-07-30 2018-09-18 President And Fellows Of Harvard College CAS9 proteins including ligand-dependent inteins
US10704062B2 (en) 2014-07-30 2020-07-07 President And Fellows Of Harvard College CAS9 proteins including ligand-dependent inteins
US11578343B2 (en) 2014-07-30 2023-02-14 President And Fellows Of Harvard College CAS9 proteins including ligand-dependent inteins
US10457960B2 (en) 2014-11-21 2019-10-29 Regeneron Pharmaceuticals, Inc. Methods and compositions for targeted genetic modification using paired guide RNAs
US11697828B2 (en) 2014-11-21 2023-07-11 Regeneran Pharmaceuticals, Inc. Methods and compositions for targeted genetic modification using paired guide RNAs
US11214780B2 (en) 2015-10-23 2022-01-04 President And Fellows Of Harvard College Nucleobase editors and uses thereof
US10167457B2 (en) 2015-10-23 2019-01-01 President And Fellows Of Harvard College Nucleobase editors and uses thereof
US11702651B2 (en) 2016-08-03 2023-07-18 President And Fellows Of Harvard College Adenosine nucleobase editors and uses thereof
US10113163B2 (en) 2016-08-03 2018-10-30 President And Fellows Of Harvard College Adenosine nucleobase editors and uses thereof
US10947530B2 (en) 2016-08-03 2021-03-16 President And Fellows Of Harvard College Adenosine nucleobase editors and uses thereof
US11661590B2 (en) 2016-08-09 2023-05-30 President And Fellows Of Harvard College Programmable CAS9-recombinase fusion proteins and uses thereof
US11542509B2 (en) 2016-08-24 2023-01-03 President And Fellows Of Harvard College Incorporation of unnatural amino acids into proteins using base editing
US11306324B2 (en) 2016-10-14 2022-04-19 President And Fellows Of Harvard College AAV delivery of nucleobase editors
US10745677B2 (en) 2016-12-23 2020-08-18 President And Fellows Of Harvard College Editing of CCR5 receptor gene to protect against HIV infection
US11820969B2 (en) 2016-12-23 2023-11-21 President And Fellows Of Harvard College Editing of CCR2 receptor gene to protect against HIV infection
US11898179B2 (en) 2017-03-09 2024-02-13 President And Fellows Of Harvard College Suppression of pain by gene editing
US11542496B2 (en) 2017-03-10 2023-01-03 President And Fellows Of Harvard College Cytosine to guanine base editor
US11268082B2 (en) 2017-03-23 2022-03-08 President And Fellows Of Harvard College Nucleobase editors comprising nucleic acid programmable DNA binding proteins
US20210130849A1 (en) * 2017-04-20 2021-05-06 Oregon Health & Science University Human gene correction
WO2018195418A1 (fr) 2017-04-20 2018-10-25 Oregon Health & Science University Correction de gène humain
US11560566B2 (en) 2017-05-12 2023-01-24 President And Fellows Of Harvard College Aptazyme-embedded guide RNAs for use with CRISPR-Cas9 in genome editing and transcriptional activation
US11814624B2 (en) 2017-06-15 2023-11-14 The Regents Of The University Of California Targeted non-viral DNA insertions
US11732274B2 (en) 2017-07-28 2023-08-22 President And Fellows Of Harvard College Methods and compositions for evolving base editors using phage-assisted continuous evolution (PACE)
US11319532B2 (en) 2017-08-30 2022-05-03 President And Fellows Of Harvard College High efficiency base editors comprising Gam
US11932884B2 (en) 2017-08-30 2024-03-19 President And Fellows Of Harvard College High efficiency base editors comprising Gam
US11795443B2 (en) 2017-10-16 2023-10-24 The Broad Institute, Inc. Uses of adenosine base editors
US11083753B1 (en) 2017-10-27 2021-08-10 The Regents Of The University Of California Targeted replacement of endogenous T cell receptors
US11590171B2 (en) 2017-10-27 2023-02-28 The Regents Of The University Of California Targeted replacement of endogenous T cell receptors
US11331346B2 (en) 2017-10-27 2022-05-17 The Regents Of The University Of California Targeted replacement of endogenous T cell receptors
US11033584B2 (en) 2017-10-27 2021-06-15 The Regents Of The University Of California Targeted replacement of endogenous T cell receptors
US11795452B2 (en) 2019-03-19 2023-10-24 The Broad Institute, Inc. Methods and compositions for prime editing nucleotide sequences
US11643652B2 (en) 2019-03-19 2023-05-09 The Broad Institute, Inc. Methods and compositions for prime editing nucleotide sequences
US11447770B1 (en) 2019-03-19 2022-09-20 The Broad Institute, Inc. Methods and compositions for prime editing nucleotide sequences
WO2021144574A1 (fr) 2020-01-14 2021-07-22 Pig Improvement Company Uk Limited Édition génique d'ovocytes porcins et bovins non fécondés
US11912985B2 (en) 2020-05-08 2024-02-27 The Broad Institute, Inc. Methods and compositions for simultaneous editing of both strands of a target double-stranded nucleotide sequence

Similar Documents

Publication Publication Date Title
WO2016097751A1 (fr) Procédé de manipulation de génome médiée par cas9
US20220056482A1 (en) Methods for making genetic edits
AU2020286315B2 (en) Efficient non-meiotic allele introgression
JP2019047794A (ja) 動物における性成熟の制御
US20140359796A1 (en) Genetically sterile animals
WO2014193584A2 (fr) Techniques génétiques permettant l'obtention d'animaux dont le sperme peut faire l'objet d'un tri
US20190223417A1 (en) Genetically modified animals having increased heat tolerance
US20210185990A1 (en) Non-meiotic allele introgression
WO2017062756A1 (fr) Procédé de production de géniteurs terminaux stériles dans du bétail et animaux produits ainsi
US20160160238A1 (en) Heterozygous modifications of tumor suppressor genes
NZ718194B2 (en) Efficient non-meiotic allele introgression
NZ715540B2 (en) Genetically sterile animals

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 15813556

Country of ref document: EP

Kind code of ref document: A1

DPE1 Request for preliminary examination filed after expiration of 19th month from priority date (pct application filed from 20040101)
NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 15813556

Country of ref document: EP

Kind code of ref document: A1