WO2016097158A1 - Method of treating ovarian cancer - Google Patents

Method of treating ovarian cancer Download PDF

Info

Publication number
WO2016097158A1
WO2016097158A1 PCT/EP2015/080243 EP2015080243W WO2016097158A1 WO 2016097158 A1 WO2016097158 A1 WO 2016097158A1 EP 2015080243 W EP2015080243 W EP 2015080243W WO 2016097158 A1 WO2016097158 A1 WO 2016097158A1
Authority
WO
WIPO (PCT)
Prior art keywords
sequence
virus
adenovirus
cancer
day
Prior art date
Application number
PCT/EP2015/080243
Other languages
French (fr)
Inventor
John BEADLE
Christine Wilkinson BLANC
Kerry David Fisher
Original Assignee
Psioxus Therapeutics Limited
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Psioxus Therapeutics Limited filed Critical Psioxus Therapeutics Limited
Publication of WO2016097158A1 publication Critical patent/WO2016097158A1/en

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K33/00—Medicinal preparations containing inorganic active ingredients
    • A61K33/24—Heavy metals; Compounds thereof
    • A61K33/243—Platinum; Compounds thereof
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/66—Microorganisms or materials therefrom
    • A61K35/76—Viruses; Subviral particles; Bacteriophages
    • A61K35/761—Adenovirus
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/335—Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin
    • A61K31/337—Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin having four-membered rings, e.g. taxol
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/555—Heterocyclic compounds containing heavy metals, e.g. hemin, hematin, melarsoprol
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A61K45/06—Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca

Definitions

  • the present disclosure relates to a method of treating a patient with, for example a group B oncolytic adenovirus, such as a replication competent virus, in combination with a chemotherapeutic agent employing a dosing regimen designed to allow the virus to have a suitable therapeutic effect and/or minimise adverse events in vivo.
  • a group B oncolytic adenovirus such as a replication competent virus
  • Cancer is a leading cause of death and serious illness worldwide. There are over 200 different types of cancer and the type of treatment is dependent on the type of cancer. Typically, treatment will involve surgery, chemotherapy and/or radiotherapy. These treatments are often unsuccessful or are only partially successful and have significant side effects.
  • cancer cells acquire certain mutations which render them more permissive to virus infection. Cancer cells also induce the suppression of host anti-tumour activity. Changes within the tumour cells and the local micro-environment create a potential vulnerability and expose the tumour to infection by viruses (Liu et al 2007; Liu et al 2008; Roberts, 2006). Death from cancer is often the result of inaccessible tumours or metastases.
  • ovarian carcinoma differs from that of haematogenously metastasing tumours because ovarian cancer cells primarily disseminate within the peritoneal cavity and are only superficially invasive. Cancer Research UK figures indicate that ovarian cancer is responsible for 5% of female deaths in Europe. Worldwide it may be responsible for more than 150,000 female deaths a year.
  • Patients who relapse less than 6 months after first line therapy i.e. platinum sensitive
  • patients who relapse less than 6 months after first line therapy generally receive a further platinum based regimen and have overall rates of response in the range 30% to 40% with an overall survival of 12-48 months.
  • platinum-resistant patients Patients whose disease recurs within 6 months (platinum-resistant) and platinum refractory patients (i.e. those who progress during treatment with platinum are treated with non-platinum regimens. There is currently no consensus for the best treatment approach for patients with platinum-resistant disease. Thus there is a huge unmet clinical need in this patient population.
  • Oncolytic viruses administered intra-tumourally rely on systemic dissemination from the tumour to reach these secondary tumours. However, dissemination has proved transient and often ineffective (Ferguson et al 2012). Thus, intra-tumoural injection is only suitable for a limited number of cancers and is not suitable for treatment of, for example of many metastatic cancers.
  • Intra-tumoural injection may only practical for treating easily accessible tumours and in patients where the structure of the tumour, such as tissue stroma and necrotic areas therein, do not limit spread of the virus within a tumour (Ries & Korn 2002).
  • EnAd (previously known as ColoAdl) is a chimeric (Adll/Ad3) serogroup B adenovirus, which was developed using the process of directed evolution and it is thought to be suitable for the treatment of cancers of epithelial origin and metastatic forms thereof, including colorectal cancer (Kuhn, I et al. 2008).
  • WO2014/198852 discloses a dosing regimen for the treatment of colorectal cancer wheren a dose EnAd is administered intravenously on day one, three and five.
  • the present inventors have established that a combination therapy comprising a hemotherapeutic agent and a group B oncolytic adenovirus is suitable for the treatment of ovarian cancer, peritoneal cancer, and fallopian tube cancer, in particular in the treatment platin resistant cancers.
  • EnAd is able to infect ovarian cancer cells and replicate therein.
  • a method of treating a human patient with ovarian cancer, peritoneal cancer or fallopian tube cancer with a combination therapy comprising:
  • a) a first adenovirus treatment cycle comprising administering one dose of type B oncolytic adenovirus in the range of lxlO 10 to lxlO 14 viral particles approximately weekly (for example 7 days +/- 1 day) for at least three consecutive weeks, and
  • a first chemotherapy treatment cycle comprising administering a therapeutically effective amount of a chemotherapeutic agent once in 21 to 26 days
  • adenovirus treatment cycle and the chemotherapy treatment cycle either overlap or are sequential.
  • the disclosure also extends to a chemotherapeutic agent and a type B oncolytic adenovirus for use in a combination therapy for the treatment of ovarian cancer, peritoneal cancer or fallopian tube, in regimen comprising:
  • a) a first adenovirus treatment cycle comprising administering one dose of type B oncolytic adenovirus in the range of lxlO 10 to lxlO 14 viral particles approximately weekly (for example 7 days +/- 1 day) for at least three consecutive weeks, and
  • a first chemotherapy treatment cycle comprising administering a therapeutically effective amount of a chemotherapeutic agent once in 21 to 26 days
  • adenovirus treatment cycle and the chemotherapy treatment cycle either overlap or are sequential.
  • a chemotherapeutic agent and a type B oncolytic adenovirus for the manufacture of a combination therapy for the treatment of ovarian cancer, peritoneal cancer or fallopian tube, in regimen comprising:
  • a) a first adenovirus treatment cycle comprising administering one dose of type B oncolytic adenovirus in the range of lxlO 10 to lxlO 14 viral particles approximately weekly (for example 7 days +/- 1 day) for at least three consecutive weeks, and
  • a first chemotherapy treatment cycle comprising administering a therapeutically effective amount of a chemotherapeutic agent once in 21 to 26 days
  • adenovirus treatment cycle and the chemotherapy treatment cycle either overlap or are sequential.
  • a method of treating a patient with ovarian cancer and/or peritoneal cancer by administering a combination therapy comprising:
  • a combination therapy comprising a type B oncolytic adenovirus and chemotherapeutic agent, for use in a treatment regime for the treatment of ovarian cancer and/or peritoneal cancer wherein the regime comprises administering:
  • a combination therapy comprising a type B oncolytic adenovirus and chemotherapeutic agent for use in the manufacture of a medicament for the treatment of ovarian cancer and/or peritoneal cancer by a regime comprises administering:
  • each administration of virus employed in the treatment cycle of step a) is in the range 1 x 10 12 to 3 x 10 13 viral particles, such as 1 x 10 12 , 6 x 10 12 or 3 x 10 13 viral particles, in particular the (or each) virus dose employed is about lxlO 12 viral particles.
  • the total virus dose administered in the first adenovirus treatment cycle is 3 x 10 12 virus particles.
  • the first dose of the adenovirus treatment cycle is administered on day one of week 1.
  • the second dose of the adenovirus treatment cycle is administered on day 8 +/- 1 day.
  • the third dose of the adenovirus treatment is in administered on day 15 +/- 1 day.
  • the method comprises a second adenovirus treatment cycle, for example wherein the second treatment cycle comprises a dose in the range 1 x 10 12 to 3 x 10 13 viral particles (for example 1 x 10 12 , 6 x 10 12 or 3 x 10 13 viral particles) administered approximately weekly (for example 7 days +/- 1 day) for three consecutive weeks.
  • the first dose of the second adenovirus treatment cycle is administered on day 29 +/- 1 day.
  • the second dose of the second adenovirus treatment cycle is administered on day 36 +/- 1 day.
  • the third dose of the second adenovirus treatment cycle is administered on day 43 +/- 1 day.
  • the type B oncolytic adenovirus is EnAd, OvAdl or OvAd2, such as EnAd, including where EnAd, OvAdl or OvAd2 further comprise a transgene.
  • the group B oncolytic adenovirus such as EnAd has a sequence of formula (I):
  • B j comprises: El A, E1B or E1A-E1B;
  • B A comprises-E2B-Ll-L2-L3-E2A-L4;
  • B 2 is a bond or comprises: E3;
  • ⁇ is a bond or a DNA sequence comprising: a restriction site, one or more transgenes or both; ⁇ ⁇ comprises L5;
  • ⁇ comprises a transgene cassette comprising a transgene and a splice acceptor sequence
  • B3 is a bond or comprises: E4,
  • transgene cassette is under the control of an endogenous promoter selected from the group consisting of E4 and major late promoter and wherein the transgene cassette comprises a therapeutic gene encoding material selected from the group consisting of an RNAi sequence, an antibody or binding fragment thereof, chemokines, cytokines, immunomodulator and enzymes.
  • a virus employed in the present disclosure has a sequence disclosed in the sequence listing provided herein.
  • the adenovirus of the present disclosure is replication competent.
  • the viral particles are administered parenterally, for example into the intraperitoneal cavity or intravenously, for example by slow infusion.
  • the chemotherapeutic agent is a microtubule, for example vincristine sulfate, paclitaxel (taxol), docetaxel, epothilone A and ABT-751.
  • the chemotherapeutic agent is a taxane derivate, such as paclitaxel and/or docetaxel, a platin, for example cisplatin, carboplatin or combination thereof, for example a taxane such as paclitaxel or docetaxel.
  • the dose of the chemotherapeutic agent is a known dose for monotherapy or combination chemotherapy (i.e. a combination of two or more chemotherapeutic agents).
  • the paclitaxel dose is in the range 135 to 175 mg/m 2 , for example administered over a period of 3 to 24 hours.
  • the docetaxel dose is about 75 mg/m 2 , for example administered over a period of about 1 hour.
  • the dose of the chemotherapeutic agent is less than a known dose for monotherapy or combination chemotherapy (i.e. a combination of two or more chemotherapeutic agents).
  • the (or each) dose of the chemotherapeutic agent is in the range 1 to 50 mg, for example 2 to 20mg, such as 4mg.
  • the therapy comprises administering a further therapeutic agent independently selected from doxorubicin, topotecan, etoposide and gemicitabine.
  • the therapy further comprises administering a biological therapeutic agent, for example an antibody or antibody binding fragment, such as bevacizumab.
  • a biological therapeutic agent for example an antibody or antibody binding fragment, such as bevacizumab.
  • the ovarian cancer is an epithelial cancer.
  • the peritoneal cancer is an epithelial cancer.
  • the population of patients are stage III or more advanced, for example stage III or more advanced of ovarian cancer.
  • the cancer for example ovarian cancer is chemotherapy sensitive, for example sensitive to platins and/or taxanes, in particular sensitive to taxanes, such as paclitaxel and/or docetaxel.
  • the cancer for example ovarian cancer is chemotherapy resistant, for example to platin based therapy, such a cisplatin or carboplatin; and/or resistant to taxanes, such as paclitaxel or docetaxel, in particular resistant to platin based chemotherapy.
  • platin based therapy such as a cisplatin or carboplatin
  • taxanes such as paclitaxel or docetaxel
  • the cancer such as ovarian cancer is refractory to chemotherapy, for example to platin based therapy, such a cisplatin or carboplatin; and/or refractory to taxanes, such as paclitaxel or docetaxel, in particular refractory ro platin based chemotherapy.
  • platin based therapy such as a cisplatin or carboplatin
  • taxanes such as paclitaxel or docetaxel
  • "within 1 day” is 24 hours or less, for example the administration of the virus and the chemotherapy are within 23, 22, 21, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1 of each other.
  • the chemotherapy treatment cycle overlaps with the adenovirus treatment cycle. In one embodiment the chemotherapy treatment cycle is subsequent to the adenovirus treatment cycle.
  • the adenovirus treatment cycle is subsequent to the adenovirus treatment cycle.
  • the chemotherapy is administered before administration of the oncolytic virus.
  • the chemotherapy is administered concomitant with the oncolytic virus.
  • the chemotherapy is administered after administration of the oncolytic virus.
  • the oncolytic virus is administered IP and the chemotherapeutic is administered IP.
  • the oncolytic virus is administered IP and the chemotherapeutic is administered IV.
  • the chemotherapeutic is administered IP and the oncolytic virus is administered IV.
  • the chemotherapeutic is administered IV and the oncolytic virus is administered IV.
  • the combination therapy is administered after cytoreductive surgery.
  • the ascites is drained before delivery of the therapy, for example the oncolytic virus. This may be advantageous, for example by reducing anti-viral immunity and/or increasing the concentration of the therapeutic agent in the IP space. Whilst not wishing to be bound by theory draining the ascites may reduce the effect of the cancer on its surrounding microenvironment.
  • IP delivery of a fluid for example an isotonic fluid or similar diluent/carrier, such as sterile water. Whilst not wishing to be bound by theory this may assist in spreading the therapy within the IP cavity and, for example it reaches cancer cells appropriately.
  • IP delivery of at the adenovirus therapy may be beneficial because viruses such as EnAd may be cleared by the liver and other reticuloendothelial systems.
  • the cancer for example ovarian cancer growth and/or spreading is reduced or stopped. In one embodiment the cancer, for example ovarian cancer metastasis is reduced or stopped. In one embodiment the cancer, for example ovarian cancer volume, extent, number of cancerous cells or the like is reduced.
  • metasis of the cancer for example ovarian cancer outside the peritoneal cavity if reduced or stopped.
  • the therapy improves patient quality of life, for example reduces pain, reduces discomfort, reduces swelling, reduces weight loss, and/or reduces cancer associated fatigue.
  • the therapy herein increases the life expectancy of the treated patient by 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50 months or more.
  • the chemotherapeutic agent and the adenovirus may have a synergistic therapeutic effect.
  • Microtubule drugs for example Vincristine Sulfate, Paclitaxel(Taxol), Docetaxel,
  • Figure 14 Enadenotucirev binding antibody titre in serum samples
  • Figure 15 Enadenotucirev binding antibody titre in peritoneal samples
  • SEQ ID NO: 1 NG-77 virus genome sequence comprising the EnAd genome with a transgene cassette that encodes an anti-VEGF full length antibody inserted in the region ⁇ .
  • the transgene cassette contains a 5' branched splice acceptor sequence (bSA), ab heavy chain sequence with 5' leader, an IRES, an ab light chain sequence with 5' leader and a 3' poly(A) sequence.
  • SEQ ID NO: 2 NG-135 virus genome sequence comprising the EnAd genome with a transgene
  • the transgene cassette that encodes an anti-VEGF full length antibody inserted in the region By.
  • the transgene cassette contains a 5' short splice acceptor sequence (SSA), ab heavy chain sequence with 5' leader, an IRES, ab light chain sequence with 5' leader and 3' poly(A) sequence.
  • SSA 5' short splice acceptor sequence
  • IRES ab light chain sequence with 5' leader
  • 3' poly(A) sequence 3' poly(A) sequence.
  • SEQ ID NO: 3 A virus genome sequence comprising a transgene cassette that encodes an anti-VEGF full length antibody inserted in the region ⁇ .
  • the transgene cassette contains a SSA, ab heavy chain sequence with 5' leader, a SSA, and ab light chain sequence with 5' leader.
  • SEQ ID NO: 4 A virus genome sequence comprising a transgene cassette that encodes an anti-VEGF full length antibody inserted in the region ⁇ .
  • the transgene cassette contains a SSA, ab heavy chain sequence with 5' leader, a SSA, ab light chain sequence with 5' leader and 3' poly(A) sequence.
  • SEQ ID NO: 5 NG-74 virus genome sequence comprising the EnAd genome with a transgene cassette that encodes an anti-VEGF ScFv inserted in the region ⁇ .
  • the transgene cassette contains a bSA, anti-VEGF ScFv sequence with 5' leader and 3' poly(A) sequence.
  • SEQ ID NO:6 NG-78 virus genome sequence comprising the EnAd genome with a transgene cassette that encodes an anti-VEGF ScFv with a C-terminal HISG tag, inserted in the region ⁇ .
  • the transgene cassette contains a bSA, anti-VEGF ScFv sequence with 5' leader and 3' 6 x histidine sequence and a poly(A) sequence.
  • SEQ ID NO: 7 NG-76 virus genome sequence comprising the EnAd genome with a transgene cassette that encodes an anti-VEGF ScFv with a C-terminal His 6 tag, inserted in the region ⁇ .
  • the transgene cassette contains a CMV promoter, anti-VEGF ScFv sequence with 5' leader and 3' 6 x histidine sequence and a poly(A) sequence.
  • SEQ ID NO: 8 NG-73 virus genome sequence comprising the EnAd genome with a transgene cassette that encodes an anti-VEGF ScFv inserted in the region ⁇ .
  • the transgene cassette contains a CMV promoter, anti-VEGF ScFv sequence with 5' leader and 3' poly(A) sequence.
  • SEQ ID NO: 9 NG-134 virus genome sequence comprising the EnAd genome with a transgene
  • the transgene cassette encoding an anti-VEGF full length antibody inserted into the region ⁇ .
  • the transgene cassette contains a CMV promoter, ab heavy chain sequence with 5' leader, an IRES, ab light chain sequence with 5' leader and a 3' poly(A) sequence.
  • SEQ ID NO: 10 B x DNA sequence corresponding to and including bp 28166-28366 of the EnAd
  • SEQ ID NO: 12 EnAd genome.
  • SEQ ID NO: 13 CMV exogenous promoter.
  • SEQ ID NO: 15 CBA exogenous promoter.
  • SEQ ID NO: 17 splice acceptor (SA).
  • SEQ ID NO: 18 branched splice acceptor (bSA).
  • SEQ ID NO: 20 polyadenylation sequence.
  • SEQ ID NO: 21 amino acids sequence.
  • the transgene cassette contains a CMV promoter, ab heavy chain sequence with 5' leader, an IRES, ab light chain sequence with 5' leader and a 3' poly(A) sequence.
  • SEQ ID NO: 47 DNA sequence corresponding to E2B region of the EnAd genome (bp 10355-5068).
  • SEQ ID NO: 48 NG-167 virus genome sequence comprising the EnAd genome with a transgene
  • the transgene cassette that encodes an anti-VEGF ScFv with a C-terminal His 6 tag, inserted in the region ⁇ .
  • the transgene cassette contains a 5' SSA, anti-VEGF ScFv sequence with 5' leader and a 3' poly(A) sequence.
  • SEQ ID NO: 49 NG-95 virus genome sequence comprising a transgene cassette that encodes the cytokine, IFNy, inserted in the region ⁇ .
  • the transgene cassette contains a 5' CMV promoter, IFNy cDNA sequence and 3' poly(A) sequence.
  • SEQ ID NO: 50 NG-97 virus genome sequence comprising a transgene cassette that encodes the cytokine, IFNa, inserted in the region ⁇ .
  • the transgene cassette contains a 5' CMV promoter, IFNa cDNA sequence and 3' poly(A) sequence.
  • SEQ ID NO: 51 NG-92 virus genome sequence comprising the EnAd genome with a transgene cassette that encodes the cytokine, IFNy, inserted in the region ⁇ .
  • the transgene cassette contains a 5' bSA, IFNy cDNA sequence and 3' poly(A) sequence.
  • SEQ ID NO: 52 NG-96 virus genome sequence comprising the EnAd genome with a transgene cassette that encodes the cytokine, IFNa, inserted in the region ⁇ .
  • the transgene cassette contains a 5' bSA, IFNa cDNA sequence and 3' poly(A) sequence.
  • SEQ ID NO: 53 NG-139 virus genome sequence comprising the EnAd genome with a transgene
  • the transgene cassette that encodes the cytokine, TNFa, inserted in the region ⁇ .
  • the transgene cassette contains a 5' SSA, TNFa cDNA sequence and 3' poly(A) sequence.
  • SEQ ID NO: 56 NG-220 virus genome sequence comprising the EnAd genome with a transgene
  • the transgene cassette that encodes the tumour associated antigen, NY-ESO-1, inserted in the region ⁇ .
  • the transgene cassette contains a 5' PGK promoter, NY-ESO-1 cDNA sequence and
  • SEQ ID NO: 57 NG-217 virus genome sequence comprising the EnAd genome with a transgene
  • the transgene cassette that encodes the tumour associated antigen, NY-ESO-1, inserted in the region ⁇ .
  • the transgene cassette contains a 5' CMV promoter, NY-ESO-1 cDNA sequence and 3' poly(A) sequence.
  • SEQ ID NO: 58 NG-242 virus genome sequence comprising the EnAd genome with a transgene
  • the transgene cassette encoding an anti-CTLA-4 full length antibody inserted into the region ⁇ .
  • the transgene cassette contains a SSA, ab heavy chain sequence with 5' leader, an IRES, ab light chain sequence with 5' leader and a 3' poly(A) sequence.
  • SEQ ID NO: 59 NG-165 virus genome sequence comprising the EnAd genome with a transgene
  • the transgene cassette encoding an anti-VEGF full length antibody inserted into the region ⁇ .
  • the transgene cassette contains a SSA, ab heavy chain sequence with 5' leader, a P2A peptide sequence, ab light chain sequence with 5' leader and a 3' poly(A) sequence.
  • SEQ ID NO: 60 NG-190 virus genome sequence comprising the EnAd genome with a transgene
  • the transgene cassette encoding an anti-PD-Ll full length antibody inserted into the region ⁇ .
  • the transgene cassette contains a SSA, ab heavy chain sequence with 5' leader, a P2A peptide sequence, ab light chain sequence with 5' leader and a 3' poly(A) sequence.
  • SEQ ID NO: 61 NG-221 virus genome sequence comprising the EnAd genome with a transgene
  • the transgene cassette that encodes an anti-PD-Ll ScFv with a C-terminal His 6 tag, inserted in the region ⁇ .
  • the transgene cassette contains a 5' SSA, anti-PD-Ll ScFv sequence with 5' leader and 3' 6 x histidine sequence then poly(A) sequence.
  • SEQ ID NO: 62 NG-258 virus genome sequence comprising the EnAd genome with a transgene
  • the transgene cassette encoding an anti-VEGF full length antibody inserted into the region ⁇ .
  • the transgene cassette contains a CMV promoter, ab heavy chain sequence with 5' leader, a P2A peptide sequence, ab light chain sequence with 5' leader and a 3' poly(A) sequence.
  • SEQ ID NO: 63 NG-185 virus genome sequence comprising the EnAd genome with unique restriction sites inserted into the ⁇ and ⁇ regions.
  • SEQ ID NO:64 pNG-33 (pColoAd2.4) DNA plasmid, comprising a bacterial origin of replication (pl5A), an antibiotic resistance gene (KanR) and the EnAd genome sequence with inserted unique restriction sites in the By region.
  • SEQ ID NO: 65 pNG-185 (pColoAd2.6) DNA plasmid, comprising a bacterial origin of replication (pl5A), an antibiotic resistance gene (KanR) and the EnAd genome sequence with inserted unique restriction sites in the ⁇ and By regions.
  • SEQ ID NO: 66 NG-shOl virus genome sequence comprising a transgene cassette encoding an shRNA to GAPDH inserted into the region By.
  • the transgene cassette contains a U6 RNA poll ll promoter and DNA encoding a shRNA.
  • SEQ ID NO: 68 NG-280 virus genome sequence comprising a transgene cassette encoding the sodium iodide symporter (N IS) inserted into the region By.
  • the transgene cassette contains a
  • SEQ ID NO: 69 NG-272 virus genome sequence comprising the EnAd genome with a transgene
  • the transgene cassette contains a SSA, anti-PD-Ll ScFv sequence with 5' leader and 3' 6xHis tag, a P2A peptide sequence, anti-VEGF ScFv sequence with 5' leader and 3' V5- tag and a 3' poly(A) sequence.
  • SEQ ID NO: 70 anti-CTLA-4 VH chain amino acid sequence.
  • SEQ ID NO: 72 NG-257 virus genome sequence comprising the EnAd genome with a transgene
  • the transgene cassette encoding an anti-VEGF ScFv inserted into the region B x .
  • the transgene cassette contains a bSA, anti-VEGF ScFv sequence with 5' leader and 3' 6xHis tag then a
  • SEQ ID O: 73 NG-281 virus genome sequence comprising the EnAd genome with a transgene
  • the transgene cassette contains a bSA, anti-VEGF ScFv sequence with 5' leader and 3' 6xHis tag then a 3' poly(A) sequence.
  • SEQ ID NO: 75 Restriction site recognised and cut by the enzyme l-Ceul.
  • SEQ ID NO: 78-93 show primer/probe sequences
  • Each treatment cycle for the adenovirus therapy is a period of 3 weeks, i.e. about 14 or 15 days, with one dose of adenovirus therapy each week i.e. a total of 3 doses are given in one treatment cylcle. It will be understood by the skilled person that this administration is approxately day 1, day 8+/- a day and day 15 +/- a day, or as close to that protocol as possible.
  • a third cycle of adenovirus therapy is administered usually there will be a period of about 1 week without adenovirus treatment, before the next treatment cycle is initiated.
  • the second cycle will comprise 3 doses in total administered as one dose per week, for example given of day 29 +/- a day, day 36 +/- a day and 43 +/- a day and so on.
  • the days in the adenovirus treatment cycles are calculate by counting the day of administration of the first adenovirus dose of the first cycle as day one.
  • a chemotherapy treatment cycle protocol will depend on the actual chemotherapeutic agent employed. However, where the chemotherapeutic is a taxane, for example, then a dose will be administered every 21 to 29 days.
  • the adenovirus therapy cycle will be considered to overlap with the chemotherapy cycle when the 3 week virus cycle overlap temporally with the 21 to 29 days chemotherapy cycle, for example the overall is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 20 or 21 days overlap.
  • said treatment cycles overlap the adenovirus treatment and the chemotherapy treatment is given on the same day.
  • the treatment cycles overlap the adenovirus treatment and the chemotherapy treatment are give on different days.
  • the adenovirus treatment cycle and chemotherapy treatment cycle will be considered sequential when the cycles do not overlap temporally but follow each other, for example with no more than 7 days between the end of one type of treatment cycle and the beginning of the other type of treatment cycle.
  • Delivery to the IP space of EnAd is very different to IV delivery (or IP delivery of a small molecule) for one or more of the following reasons: i.
  • the IP space is relatively closed and impervious to virus egress (due to virus size), but the degree to which EnAd will pass through the diseased peritoneal cavity was not known before the work performed by the present inventors. It is likely that virus will not enter the blood stream readily. So:
  • ⁇ virus will remain in high concentrations in the IP cavity and in contact with the tumour for longer (in comparison to for example administration by the IV route).
  • the I P space can vary considerably in the volume of fluid that it contains, this is particularly true in patients with ovarian cancer and peritoneal carcinomatosis where ascites is common, thus making it difficult to ascertain dilution of the therapeutic dose at the time of delivery.
  • the immunological environment of the I P cavity differs considerably to the blood stream and so the effect of antibodies and immune cells on the virus cannot be predicted (ahead of performing the relevant experiments this could not be predicted for EnAd in humans either by animal work or clinical work with other viruses).
  • Peritoneal tumours derive some of their nutrient and oxygen supply from the blood stream and some from peritoneal fluid.
  • One agent given IP and one agent given IV may thus have a particularly synergistic.
  • v. Ovarian cancer can metastasise outside of the peritoneal cavity and it was unknown in the prior art whether IP delivered virus could impact upon extra-peritoneal lesions.
  • Patient as employed herein refers to a subject with ovarian cancer, for example a human or an animal (such as a domestic animal including cat, dog, horse), in particular a human. Patient as employed herein does not extend to an animal employed in an animal model.
  • the patient is a human.
  • Combination therapy refers to whether there are at least two elements such as active agents employed together in treatment. Whilst the two elements may be co-administered they may also may be administered on separate days. What is important is that the at least two active agents have a period where the they both acting in vivo concomitantly, for example the duration of action of the first active agent overlaps with the duration of action of the second active agent.
  • Active agent refers to an entity with a pharmacological effect and includes an oncolytic adenovirus and chemotherapeutic agents.
  • each dose administered is in the range of 1 xlO 10 to 1 x 10 13 , such as 10 12 viral particles.
  • each dose administered is lxlO 12 , 2xl0 12 , 3xl0 12 , 4xl0 12 , 5xl0 12 , 6xl0 12 , 7xl0 12 , 8xl0 12 or 9xl0 12 viral particles.
  • “Weekly for three consecutive weeks” as employed refers to administering a dose of the virus once each week, starting at week one of treatment, through week two and also in week three.
  • the doses are evenly spaced, for example:
  • ⁇ dose 1 of the virus is given on day one of week one, • dose 2 of the virus is given on day 8 (7 days after the first dose and on day one of the second week), and
  • dose 3 of the virus is given on day 15 (14 days after the first dose or 7 days after the second dose, for example on day one of the third week).
  • “Within one day” as employed herein refers to where the virus is administered one calendar day and chemotherapy is administered the previous calendar day, the same calendar day or the next calendar day, for example if the virus is administered on the 15 th December the chemotherapy is administered on the 14 th , 15 th or 16 th of December. Clearly if the chemotherapeutic is administered on the previous day or the next it may be more than 24 hours prior or post administration of the virus depending on the exact time of the day the administrations occur.
  • dose 1 of the chemotherapy is given on day two of week one
  • dose 2 of the chemotherapy is given on day nine (7 days after the first dose of chemotherapy and on day two of the second week)
  • dose 3 of the chemotherapy is given on day sixteen (14 days after the first dose or 7 days after the second dose, for example on day two of the third week).
  • the combination therapy is not administered for at least one to three week.
  • the combination therapy may, for example be initiated again at week 7, with a regime that repeats the first treatment cycle or varies same.
  • Subgroup B adenoviruses have certain inherent advantages in that they are associated with lower seroprevalence (Stone et al Journal of Virology 2005 Vol 79 No. 8 page 5090-5104) and have lower inflammatory potential. Initial dosing may thus be far more efficient than with Ad5, for example. However, the ability to avoid the immune system after systemic delivery may still become an issue with repeat dosing. Thus, even with the local suppression of the immune system by the cancer, avoidance of the immune system is still probably the biggest obstacle to the long term success of oncolytic virus therapy based on subgroup B adenoviruses.
  • the oncolytic virus is administered to the intraperitoneal cavity. This is beneficial because it avoids processing and elimination of the virus by the liver and advantageously allows the virus adequate "time" to infect cancer cells. Once an infection is established inside the tumour the virus is relatively protected from neutralising antibodies and is afforded a potentially permissive environment to replicate and to produce a therapeutic effect without dose limiting toxicities. This may also minimise side effects of the virus because the virus is concentrated in the body in the region of the cancer. It is hypothesised by the inventors that peaks in virus concentration (C max ) in the blood contribute to side effects and that a flatter pharmacological profile may be desirable. Intraperitoneal administration minimised the serum levels of the virus. In one embodiment the C max is kept below a specific value, for example 3 xlO 8 DNA copies per ml. It appears that a C level above the relevant threshold is more likely to induce serious adverse events or toxicity in some patients.
  • Inflammatory cytokines TNF, gamma interferon, IL-6 and MCP-1 may be monitored as markers of acute toxicity.
  • the chemotherapy is administered to the intraperitoneal cavity. This may also be advantageous in that this therapeutic is also concentrated in the region of the cancer. Delivery to the intraperitoneal cavity can be achieved by known mechanisms, for example a catheter inserted into the cavity.
  • the data generated by the present inventors supports the therapeutic effect of the oncolytic adenoviruses of subgroup B in the treatment of ovarian cancer and/or peritoneal cancer employing a treatment regime described herein.
  • the dosing regimens herein may also minimise side-effects, for example flu like symptoms and inflammatory responses.
  • the combination therapy is employed along with prophylactic or therapeutic agents including anti-inflammatories, steroids, antiemetics, antidiarrheals or analgesics administered during this treatment cycle, which may further enhance the tolerability of the regime.
  • prophylactic or therapeutic agents including anti-inflammatories, steroids, antiemetics, antidiarrheals or analgesics administered during this treatment cycle, which may further enhance the tolerability of the regime.
  • steroids are administered during the treatment cycle.
  • Treatment cycle as employed herein refers to the at least 3 week period over which the combination therapy is administered.
  • each agent in one embodiment three doses of each agent are employed in the treatment cycle, and in a further embodiment more than three doses are employed in the treatment cycle.
  • a patient who receives treatment according to the present disclosure shows an increased survival rate in comparison to a patient receiving the current standard treatment at the time of filing, for example a statistically significant increase in survival.
  • a patient who receives treatment according to the present disclosure shows a decreased tumour burden, in comparison to the standard treatment at the time of filing, for example a statistically significant decrease.
  • the a patient who receives treatment according to the present disclosure shows an increased likelihood of going into remission, in comparison to the standard treatment at the time of filing, for example a statistically significant increase.
  • the amount or extent of metastasis is reduced, for example is statistically significantly reduced in a patient who receives treatment according to the present disclosure in comparison to the standard treatment at the time of filing.
  • the oncolytic virus is replication capable. In one embodiment the oncolytic virus is replication competent.
  • Replication capable as employed herein is a virus that can replicate in a host cell.
  • replication capable encompasses replication competent and replication selective viruses.
  • Replication competent as employed herein is intended to mean an oncolytic adenovirus that is capable of replicating in a human cell, such as a cancer cell, without any additional complementation to that required by wild-type viruses, for example without relying on defective cellular machinery. That is, they are tumour selective by infecting tumour cells in preference to non-tumour cells. EnAd is an example of a replication competent virus.
  • Replication selective or selective replication as employed herein is intended to mean an oncolytic adenovirus that is able to replicate in cancer cells employing an element which is specific to said cancer cells or upregulated therein, for example defective cellular machinery, such as a p53 mutation, thereby allowing a degree of selectivity over healthy/normal cells.
  • Oncolytic subgroup B adenovirus refers to an adenovirus comprising at least the hexon and fiber from subgroup B (see Shenk et al and Table 1) that preferentially infects and/or lyses tumour cells compared with normal cells.
  • an oncolytic subgroup B adenovirus as employed herein includes a chimeric, a mutant or a variant, with the fiber and hexon of a group B adenovirus and which retains oncolytic properties.
  • Adenovirus or adenoviral serotype as used herein refers to any of the human adenoviral serotypes currently known (51) or isolated in the future. See for example, Strauss (1984) and Shenk (2001). Adenovirus serotypes are classified into subgroups as shown in Table 1.
  • Table 1 shows the division of adenovirus serotypes:
  • subgroup B viruses examples include Adll (wild-type) such as Adlla and Adllp (Genbank Accession No: AF532578) and the chimeric adenovirus EnAd. The latter is disclosed in WO 2005/118825 and the full sequence for the virus is provided in SEQ ID NO: 1 therein.
  • the virus employed in the method according to the present disclosure is a chimeric virus.
  • the adenovirus is enadenotucirev (also known as EnAd and formerly as ColoAdl).
  • Enadenotucirev as employed herein refers the chimeric adenovirus shown in Figure 1 herein. It is a replication competent oncolytic chimeric adenovirus which has enhanced therapeutic properties compared to wild type adenoviruses (see WO2005/118825). EnAd has a chimeric E2B region, which features DNA from Adllp and Ad3, and deletions in E3/E4. The structural changes in enadenotucirev result in a genome that is approximately 3.5kb smaller than Adllp thereby providing additional "space" for the insertion of transgenes.
  • Chimeric adenovirus as employed herein refers to adenoviruses which have DNA from two or more different adenovirus serotypes such as those generated using the method of WO2005/118825 which is incorporated herein by reference.
  • the chimeric adenovirus is EnAd.
  • EnAd is thought to kill tumour cells by a mechanism which more closely resembles necrosis than apoptosis (unpublished data produced at the University of Oxford). This has a number of potential beneficial effects (Kirn et al 2001; Small et al 2006; eid et al 2002; Liu et al 2007; Ferguson et al 2012): • EnAd has been shown to be potent in multi-drug resistant cancer cell lines and in cancer stem- cell like cells, which are known to have a resistance to apoptosis;
  • An inflammatory necrotic cell death may be more suitable for the generation of a specific anti- tumoural immune response
  • ⁇ ColoAdl exits tumour cells very rapidly, even before target cell death, and may thus have enhanced ability to spread.
  • EnAd is a chimera of Adll and Ad3 but has an outer capsule which is entirely homologous with that of Adll.
  • the viral kinetics, inflammatory potential and immunological characteristics of elM thus most closely resemble and predict those of Adll and other subgroup B adenoviruses.
  • the oncolytic virus employed in the method of the present disclosure is deleted in the E3 and/or E4 region or part thereof. This may be beneficial because it may allow more rapid replication of the virus in vivo.
  • the E3 deletion may contribute to the rapid clearance of the virus from non-cancer cells as the E3 region encoded proteins which may be relevant to avoiding the immunity of the host.
  • the virus employed in the method of the present disclosure is based on Adll or derived therefrom such that the hexon and fibre are substantially similar to Adll, such as Adllp.
  • Adll Adllp
  • the serotype designation of adenovirus is based on the exterior properties of the virus i.e. hexon and fibre properties, the present disclosure is useful in type B adenovirus which have similar surface properties.
  • the type B adenovirus is OvAdl or OvAd2 which are disclosed in SEQ ID NO: 1 and SEQ ID NO: 2 respectively in WO2008/080003, incorporated herein by reference.
  • Substantially similar as employed herein refers to an amino acid sequence for a relevant protein or proteins which is/are at least 95% identical (e.g. 96, 97, 98, 99 or 100% identical) over the "whole" of the particular protein.
  • the protein(s) being compared may be part of a larger entity but the comparison will be the whole length of the relevant fragment or component.
  • Adenovirus type 5 (Ad5) generally enter the cell via the coxsackie-adenovirus receptor (CAR).
  • Adenovirus serotype 11 (Adll) is a subgroup B adenovirus that targets a different receptor (CD46) which is expressed at low levels in all nucleated cells.
  • CD46 coxsackie-adenovirus receptor
  • CD46 receptor
  • In normal cells CD46 is often hidden on the basolateral surfaces of cells and is thus not available for virus binding (Varela JC, et al Int J Cancer 2008 Sep 15; 123(6):1357-63; Maisner et al., 1997).
  • tumour cells it typically has enhanced surface expression, particularly in more advanced and aggressive tumours (Kinugasa et al., 1999).
  • Adll efficiently infects carcinoma cell lines, for example from lung epithelial carcinoma (A549 cells), hepatoma (HepG2), prostatic cancer (DU 145 and LNCaP), laryngeal cancer (Hep2) and breast cancer (CAMA and MG7) and also to glioblastoma, medulloblastoma and neuroblastoma cells (Mei et al 2003).
  • Adll preferentially infects tumour cells and viruses derived therefrom are thought to be useful in the treatment of at least one or more of the above cancers.
  • ColoAdl shares these characteristics with Adll.
  • a virus employed in the method of the present disclosure comprises a transgene (in particular one or more transgenes), for example a therapeutic transgene, for expression in vivo.
  • a transgene gene as employed herein is intended to refer to a gene not found in the parent or wild type virus. Such genes may perform a function as a marker or reporter for tracking efficacy of viral infection. Alternatively the gene may perform a role in improving the efficacy of the virus. Alternatively the gene may deliver a cytotoxic agent to the cell.
  • the therapeutic transgene may express a therapeutic agent in the cell, for example siRNA; shRNA; a polypeptide; tumour associated antigen (TAA), cytokine; antibody; or an anti-angiogenesis factor.
  • a therapeutic agent for example siRNA; shRNA; a polypeptide; tumour associated antigen (TAA), cytokine; antibody; or an anti-angiogenesis factor.
  • therapeutic antibodies include anti-VGEF antibodies such as bevacizumab, anti-EGFR antibodies such as cetuximab, an anti-CD20 antibody such as rituximab, or an immune system activator modulator such as anti-CTLA4 (e.g. ipilimumab), anti-PD-1 and anti-PD-Ll amongst others.
  • anti-VGEF antibodies such as bevacizumab
  • anti-EGFR antibodies such as cetuximab
  • an anti-CD20 antibody such as rituximab
  • an immune system activator modulator such as anti-CTLA4 (e.g. ipilimumab)
  • anti-PD-1 e.g. ipilimumab
  • anti-PD-Ll anti-PD-1
  • Single chain antibodies, antibody subunits, antibody fragments and TRAPs may also be encoded as well as full length antibodies.
  • the inclusion of these proteins does not change the surface properties of the virus and therefore can readily be incorporated into the
  • cytokines examples include interferon-alpha, interferon-gamma and IL-2 amongst others.
  • RNA, antibody, polypeptide, TAA or cytokine will be expressed in the tumour it is thought that this presents an opportunity to change the microenvironment of the tumour but avoid systemic side effects of the delivered agent. For example, it may be possible to stimulate the local immune system to attack the cancer. It is possible to modulate this local effect by altering whether or not the RNA, antibody, polypeptide, TAA or cytokine is secreted from the cell and when during the viral life cycle it is expressed.
  • the transgene encodes thymidine kinase, for example from a non-human origin or cytosine deaminase, for example from bacterial origin or from a yeast.
  • the antibody, polypeptide or cytokine or similar is non-human in origin and is not humanised.
  • the latter is not likely to detrimentally effect the activity of the entity in the cancer cell and has the advantage that material that may escape the cancer cell will attract the attention of the immune system locally and will be rapidly cleared.
  • the virus encodes and expresses in vivo a visible or visualisable protein, for example a fluorescent protein, such as GFP or similar.
  • a visible or visualisable protein for example a fluorescent protein, such as GFP or similar.
  • the viruses may be armed with therapeutic genes capable of eliciting anti-tumour immune function, inhibition of tumour neovascularization, or prodrug activation.
  • the virus employed in the present disclosure is a construct as disclosed in WO2015/059303 incorporated herein by reference in particular a virus construct explicitly disclosed in a sequence therein, for example from the sequences there: SEQ ID NO: 1 NG-77 virus genome sequence comprising the EnAd genome with a transgene cassette that encodes an anti-VEGF full length antibody inserted in the region ⁇ .
  • the transgene cassette contains a 5' branched splice acceptor sequence (bSA), ab heavy chain sequence with 5' leader, an IRES, an ab light chain sequence with 5' leader and a 3' poly(A) sequence.
  • SEQ ID NO: 2 NG-135 virus genome sequence comprising the EnAd genome with a transgene cassette that encodes an anti-VEGF full length antibody inserted in the region ⁇ .
  • the transgene cassette contains a 5' short splice acceptor sequence (SSA), ab heavy chain sequence with 5' leader, an IRES, ab light chain sequence with 5' leader and 3' poly(A) sequence.
  • SEQ ID NO: 3 A virus genome sequence comprising a transgene cassette that encodes an anti-VEGF full length antibody inserted in the region ⁇ .
  • the transgene cassette contains a SSA, ab heavy chain sequence with 5' leader, a SSA, and ab light chain sequence with 5' leader.
  • SEQ ID NO: 4 A virus genome sequence comprising a transgene cassette that encodes an anti-VEGF full length antibody inserted in the region ⁇ .
  • the transgene cassette contains a SSA, ab heavy chain sequence with 5' leader, a SSA, ab light chain sequence with 5' leader and 3' poly(A) sequence.
  • SEQ ID NO: 5 NG-74 virus genome sequence comprising the EnAd genome with a transgene cassette that encodes an anti-VEGF ScFv inserted in the region ⁇ .
  • the transgene cassette contains a bSA, anti-VEGF ScFv sequence with 5' leader and 3' poly(A) sequence.
  • SEQ ID NO:6 NG-78 virus genome sequence comprising the EnAd genome with a transgene cassette that encodes an anti-VEGF ScFv with a C-terminal His 6 tag, inserted in the region ⁇ .
  • the transgene cassette contains a bSA, anti-VEGF ScFv sequence with 5' leader and 3' 6 x histidine sequence and a poly(A) sequence.
  • SEQ ID NO: 7 NG-76 virus genome sequence comprising the EnAd genome with a transgene cassette that encodes an anti-VEGF ScFv with a C-terminal His 6 tag, inserted in the region ⁇ .
  • the transgene cassette contains a CMV promoter, anti-VEGF ScFv sequence with 5' leader and 3' 6 x histidine sequence and a poly(A) sequence.
  • SEQ ID NO: 8 NG-73 virus genome sequence comprising the EnAd genome with a transgene cassette that encodes an anti-VEGF ScFv inserted in the region ⁇ .
  • the transgene cassette contains a CMV promoter, anti-VEGF ScFv sequence with 5' leader and 3' poly(A) sequence.
  • SEQ ID NO: 9 NG-134 virus genome sequence comprising the EnAd genome with a transgene cassette encoding an anti-VEGF full length antibody inserted into the region ⁇ .
  • the transgene cassette contains a CMV promoter, ab heavy chain sequence with 5' leader, an IRES, ab light chain sequence with 5' leader and a 3' poly(A) sequence.
  • SEQ ID NO: 46 NG-177 virus genome sequence comprising the EnAd genome with a transgene cassette, encoding an anti-PD-Ll full length antibody inserted into the region ⁇ .
  • the transgene cassette contains a CMV promoter, ab heavy chain sequence with 5' leader, an IRES, ab light chain sequence with 5' leader and a 3' poly(A) sequence.
  • ID NO: 48 NG-167 virus genome sequence comprising the EnAd genome with a transgene cassette that encodes an anti-VEGF ScFv with a C-terminal His 6 tag, inserted in the region ⁇ .
  • the transgene cassette contains a 5' SSA, anti-VEGF ScFv sequence with 5' leader and a 3' poly(A) sequence.
  • SEQ ID NO: 49 NG-95 virus genome sequence comprising a transgene cassette that encodes the cytokine, IFNy, inserted in the region ⁇ .
  • the transgene cassette contains a 5' CMV promoter, IFNy cDNA sequence and
  • SEQ ID NO: 50 NG-97 virus genome sequence comprising a transgene cassette that encodes the cytokine, IFNa, inserted in the region ⁇ .
  • the transgene cassette contains a 5' CMV promoter, IFNa cDNA sequence and 3' poly(A) sequence.
  • SEQ ID NO: 51 NG-92 virus genome sequence comprising the EnAd genome with a transgene cassette that encodes the cytokine, IFNy, inserted in the region ⁇ .
  • the transgene cassette contains a 5' bSA, IFNy cDNA sequence and 3' poly(A) sequence.
  • SEQ ID NO: 52 NG-96 virus genome sequence comprising the EnAd genome with a transgene cassette that encodes the cytokine, IFNa, inserted in the region ⁇ .
  • the transgene cassette contains a 5' bSA, I FNa cDNA sequence and 3' poly(A) sequence.
  • SEQ ID NO: 53 NG-139 virus genome sequence comprising the EnAd genome with a transgene cassette that encodes the cytokine, TNFa, inserted in the region ⁇ .
  • the transgene cassette contains a 5' SSA, TNFa cDNA sequence and 3' poly(A) sequence.
  • SEQ ID NO: 56 NG-220 virus genome sequence comprising the EnAd genome with a transgene cassette that encodes the tumour associated antigen, NY-ESO-1, inserted in the region ⁇ .
  • the transgene cassette contains a 5' PGK promoter, NY-ESO-1 cDNA sequence and 3' poly(A) sequence.
  • SEQ ID NO: 57 NG-217 virus genome sequence comprising the EnAd genome with a transgene cassette that encodes the tumour associated antigen, NY-ESO-1, inserted in the region ⁇ .
  • the transgene cassette contains a 5' CMV promoter, NY-ESO-1 cDNA sequence and 3' poly(A) sequence.
  • 58 NG-242 virus genome sequence comprising the EnAd genome with a transgene cassette encoding an anti-CTLA-4 full length antibody inserted into the region ⁇ .
  • the transgene cassette contains a SSA, ab heavy chain sequence with 5' leader, an IRES, ab light chain sequence with 5' leader and a 3' poly(A) sequence.
  • SEQ ID NO: 59 NG-165 virus genome sequence comprising the EnAd genome with a transgene cassette encoding an anti-VEGF full length antibody inserted into the region ⁇ .
  • the transgene cassette contains a SSA, ab heavy chain sequence with 5' leader, a P2A peptide sequence, ab light chain sequence with 5' leader and a 3' poly(A) sequence.
  • SEQ ID NO: 60 NG-190 virus genome sequence comprising the EnAd genome with a transgene cassette encoding an anti-PD-Ll full length antibody inserted into the region ⁇ .
  • the transgene cassette contains a SSA, ab heavy chain sequence with 5' leader, a P2A peptide sequence, ab light chain sequence with 5' leader and a 3' poly(A) sequence.
  • SEQ ID NO: 61 NG-221 virus genome sequence comprising the EnAd genome with a transgene cassette that encodes an anti-PD-Ll ScFv with a C-terminal His 6 tag, inserted in the region ⁇ .
  • the transgene cassette contains a 5' SSA, anti-PD-Ll ScFv sequence with 5' leader and 3' 6 x histidine sequence then poly(A) sequence.
  • SEQ ID NO: 62 NG-258 virus genome sequence comprising the EnAd genome with a transgene cassette encoding an anti-VEGF full length antibody inserted into the region ⁇ .
  • the transgene cassette contains a CMV promoter, ab heavy chain sequence with 5' leader, a P2A peptide sequence, ab light chain sequence with 5' leader and a 3' poly(A) sequence.
  • SEQ ID NO: 63 NG-185 virus genome sequence comprising the EnAd genome with unique restriction sites inserted into the ⁇ and ⁇ regions.
  • SEQ ID NO: 66 NG-shOl virus genome sequence comprising a transgene cassette encoding an shRNA to GAPDH inserted into the region By.
  • the transgene cassette contains a U6 RNA pollll promoter and DNA encoding a shRNA.
  • SEQ ID NO: 68 NG-280 virus genome sequence comprising a transgene cassette encoding the sodium iodide symporter (NIS) inserted into the region ⁇ .
  • the transgene cassette contains a 5' SSA, NIS cDNA sequence and 3' poly(A) sequence.
  • 69 NG-272 virus genome sequence comprising the EnAd genome with a transgene cassette encoding an anti-VEGF ScFv and an anti-PD-Ll ScFv inserted into the region ⁇ .
  • the transgene cassette contains a SSA, anti-PD-Ll ScFv sequence with 5' leader and 3' 6xHis tag, a P2A peptide sequence, anti-VEGF
  • SEQ ID NO: 72 NG-257 virus genome sequence comprising the EnAd genome with a transgene cassette encoding an anti-VEGF ScFv inserted into the region B x .
  • the transgene cassette contains a bSA, anti-VEGF ScFv sequence with 5' leader and 3' 6xHis tag then a 3' poly(A) sequence.
  • SEQ ID NO: 73 NG-281 virus genome sequence comprising the EnAd genome with a transgene cassette encoding an anti-VEGF ScFv inserted into the region B x and a second transgene cassette encoding an anti-PD-Ll ScFv inserted into the region ⁇ .
  • the transgene cassette contains a bSA, anti-VEGF ScFv sequence with 5' leader and 3' 6xHis tag then a 3' poly(A) sequence. The sequences for these viruses are incorporated herein by reference from
  • E1A from an adenovirus
  • E1B region of an adenovirus and independently part or all of E1A and E1B region of an adenovirus.
  • B ⁇ further comprises a transgene. It is known in the art that the El region can accommodate a transgene which may be inserted in a disruptive way into the El region (i.e. in the "middle" of the sequence) or part or all of the El region may be deleted to provide more room to accommodate genetic material.
  • E1A refers to the DNA sequence encoding part or all of an adenovirus E1A region. The latter here is referring to the polypeptide/protein E1A. It may be mutated such that the protein encoded by the E1A gene has conservative or non-conservative amino acid changes, such that it has: the same function as wild-type (i.e. the corresponding non-mutated protein); increased function in comparison to wild-type protein; decreased function, such as no function in comparison to wild-type protein; or has a new function in comparison to wild-type protein or a combination of the same as appropriate.
  • E1B refers to the DNA sequence encoding part or all of an adenovirus E1B region (i.e. polypeptide or protein), it may be mutated such that the protein encoded by the E1B gene/region has conservative or non-conservative amino acid changes, such that it has: the same function as wild-type (i.e. the corresponding non-mutated protein); increased function in comparison to wild-type protein; decreased function, such as no function in comparison to wild-type protein; or has a new function in comparison to wild-type protein or a combination of the same as appropriate.
  • B ⁇ can be modified or unmodified relative to a wild-type El region, such as a wild-type
  • E1A and/or E1B The skilled person can easily identify whether E1A and/or E1B are present or (part) deleted or mutated.
  • Wild-type as employed herein refers to a known adenovirus.
  • a known adenovirus is one that has been identified and named, regardless of whether the sequence is available.
  • B ⁇ has the sequence from 139bp to 3932bp of SEQ ID NO: 12.
  • sequence as employed herein refers to the DNA sequence encoding the E2B-L1-L2-L3-E2A-L4 regions including any non-coding sequences, as appropriate. Generally this sequence will not comprise a transgene. In one embodiment the sequence is substantially similar or identical to a contiguous sequence from a known adenovirus, for example a serotype shown in Table 1, in particular a group B virus, for example Ad3, Ad7, Adll, Adl4, Adl6, Ad21, Ad34, Ad35, Ad51 or a combination thereof, such as Ad3, Adll or a combination thereof.
  • adenovirus for example a serotype shown in Table 1
  • group B virus for example Ad3, Ad7, Adll, Adl4, Adl6, Ad21, Ad34, Ad35, Ad51 or a combination thereof, such as Ad3, Adll or a combination thereof.
  • E2B-L1-L2-L3-E2A-L4 refers to comprising these elements and other structural elements associated with the region, for example B will generally include the sequence encoding the protein IV2a, for example as follows: IV2A IV2a-E2B- L1-L2-L3-E2A-L4
  • the E2B region is chimeric. That is, comprises DNA sequences from two or more different adenoviral serotypes, for example from Ad3 and Adll, such as Adllp. In one embodiment the E2B region has the sequence from 5068bp to 10355bp of SEQ ID NO: 12 or a sequence
  • E2B in component B ⁇ comprises the sequences shown in SEQ I D NO: 47
  • B ⁇ has the sequence from 3933bp to 27184bp of SEQ ID NO: 12.
  • E3 refers to the DNA sequence encoding part or all of an adenovirus E3 region (i.e. protein/polypeptide), it may be mutated such that the protein encoded by the E3 gene has conservative or non-conservative amino acid changes, such that it has the same function as wild-type (the corresponding unmutated protein); increased function in comparison to wild-type protein; decreased function, such as no function in comparison to wild-type protein or has a new function in comparison to wild-type protein or a combination of the same, as appropriate.
  • adenovirus E3 region i.e. protein/polypeptide
  • the E3 region is form an adenovirus serotype given in Table 1 or a combination thereof, in particular a group B serotype, for example Ad3, Ad7, Adll (in particular Adllp), Adl4, Adl6, Ad21, Ad34, Ad35, Ad51 or a combination thereof, such as Ad3, Adll (in particular Adllp) or a combination thereof.
  • the E3 region is partially deleted, for example is 95%, 90%, 85%, 80%, 75%,
  • B2 is a bond, wherein the DNA encoding the E3 region is absent.
  • the DNA encoding the E3 region can be replaced or interrupted by a transgene.
  • E3 region replaced by a transgene as employed herein includes part or all of the E3 region is replaced with a transgene.
  • the B2 region comprises the sequence from 27185bp to 28165bp of SEQ ID NO:
  • B2 consists of the sequence from 27185bp to 28165bp of SEQ ID NO: 12.
  • ⁇ refers to the DNA sequence in the vicinity of the 5' end of the L5 gene in
  • ⁇ is joined directly to a base of L5 which represents, for example the start of a coding sequence of the L5 gene.
  • ⁇ is joined directly to a base of L5 which represents, for example the start of a non-coding sequence, or joined directly to a non-coding region naturally associated with L5.
  • a non-coding region naturally associated L5 as employed herein refers to part of all of a non-coding regions which is part of the L5 gene or contiguous therewith but not part of another gene.
  • ⁇ comprises the sequence of SEQ ID NO: 10.
  • This sequence is an artificial non-coding sequence wherein a DNA sequence, for example comprising a transgene (or transgene cassette), a restriction site or a combination thereof may be inserted therein.
  • This sequence is advantageous because it acts as a buffer in that allows some flexibility on the exact location of the transgene whilst minimising the disruptive effects on virus stability and viability.
  • the insert(s) can occur anywhere within SEQ ID NO: 10 from the 5' end, the 3' end or at any point between bp 1 to 201, for example between base pairs 1/2, 2/3, 3/4, 4/5, 5/6, 6/7, 7/8, 8/9, 9/10, 10/11, 11/12, 12/13, 13/14, 14/15, 15/16, 16/17, 17/18, 18/19, 19/20, 20/21, 21/22, 22/23, 23/24, 24/25, 25/26, 26/27, 27/28, 28/29, 29/30, 30/31, 31/32, 32/33, 33/34, 34/35, 35/36, 36/37, 37/38, 38/39, 39/40, 40/41, 41/42, 42/43, 43/44, 44/45, 45/46, 46/47, 47/48, 48/49, 49/50, 50/51, 51/52, 52/53, 53/54, 54/55, 55/56, 56/57, 57/58
  • ⁇ comprises SEQ ID NO: 10 with a DNA sequence inserted between bp 27 and bp 28 or a place corresponding to between positions 28192bp and 28193bp of SEQ ID NO: 12.
  • the insert is a restriction site insert. In one embodiment the restriction site insert comprises one or two restriction sites. In one embodiment the restriction site is a 19bp restriction site insert comprising 2 restriction sites. In one embodiment the restriction site insert is a 9bp restriction site insert comprising 1 restriction site. In one embodiment the restriction site insert comprises one or two restriction sites and at least one transgene, for example one or two transgenes. In one embodiment the restriction site is a 19bp restriction site insert comprising 2 restriction sites and at least one transgene, for example one or two transgenes. In one embodiment the restriction site insert is a 9bp restriction site insert comprising 1 restriction site and at least one transgene, for example one, two or three transgenes, such as one or two.
  • two restriction sites sandwich one or more, such as two transgenes (for example in a transgene cassette).
  • ⁇ comprises two restrictions sites the said restriction sites are different from each other.
  • said one or more restrictions sites in ⁇ are non-naturally occurring in the particular adenovirus genome into which they have been inserted.
  • said one or more restrictions sites in ⁇ are different to other restrictions sites located elsewhere in the adenovirus genome, for example different to naturally occurring restrictions sites and/or restriction sites introduced into other parts of the genome, such as a restriction site introduced into By.
  • the restriction site or sites allow the DNA in the section to be cut specifically.
  • use of "unique" restriction sites provides selectivity and control over the where the virus genome is cut, simply by using the appropriate restriction enzyme.
  • Cut specifically as employed herein refers to where use of an enzyme specific to the restriction sites cuts the virus only in the desired location, usually one location, although occasionally it may be a pair of locations.
  • a pair of locations as employed herein refers to two restrictions sites in proximity of each other that are designed to be cut by the same enzyme (i.e. cannot be differentiated from each other).
  • restriction site insert is SEQ ID NO: 55.
  • ⁇ has the sequence from 28166bp to 28366bp of SEQ ID NO: 12.
  • ⁇ is a bond
  • BQ as employed herein refers to the DNA sequence encoding the L5 region.
  • the L5 region refers to the DNA sequence containing the gene encoding the fibre polypeptide/protein, as appropriate in the context.
  • the fibre gene/region encodes the fibre protein which is a major capsid component of adenoviruses. The fibre functions in receptor recognition and contributes to the adenovirus' ability to selectively bind and infect cells.
  • the fibre can be from any adenovirus serotype and adenoviruses which are chimeric as result of changing the fibre for one of a different serotype are known.
  • the fibre is from a group B virus, in particular Adll, such as Adllp.
  • Bg has the sequence from 28367bp to 29344bp of SEQ ID NO: 12.
  • DNA sequence in relation to ⁇ refers to the DNA sequence in the vicinity of the 3' end of the L5 gene of ⁇ .
  • In the vicinity of or proximal to the 3' end of the L5 gene as employed herein refers to: adjacent (contiguous) to the 3' end of the L5 gene or a non-coding region inherently associated therewith i.e. abutting or contiguous to the 3' prime end of the L5 gene or a non- coding region inherently associated therewith (i.e. all or part of an non-coding sequence endogenous to L5).
  • in the vicinity of or proximal to may refer to being close the L5 gene, such that there are no coding sequences between the By region and the 3' end of the L5 gene.
  • This sequence is a non-coding sequence wherein a DNA sequence, for example comprising a transgene (or transgene cassette), a restriction site or a combination thereof may be inserted.
  • This sequence is advantageous because it acts a buffer in that allows some flexibility on the exact location of the transgene whilst minimising the disruptive effects on virus stability and viability.
  • the insert(s) can occur anywhere within SEQ ID NO: 11 from the 5' end, the 3' end or at any point between bp 1 to 35, for example between base pairs 1/2, 2/3, 3/4, 4/5, 5/6, 6/7, 7/8, 8/9, 9/10, 10/11, 11/12, 12/13, 13/14, 14/15, 15/16, 16/17, 17/18, 18/19, 19/20, 20/21, 21/22, 22/23, 23/24, 24/25, 25/26, 26/27, 27/28, 28/29, 29/30, 30/31, 31/32, 32/33, 33/34, or 34/35.
  • ⁇ comprises SEQ ID NO: 11 with a DNA sequence inserted between positions bp 12 and 13 or a place corresponding to 29356bp and 29357bp in SEQ I D NO: 12.
  • the insert is a restriction site insert.
  • the restriction site insert comprises one or two restriction sites.
  • the restriction site is a 19bp restriction site insert comprising 2 restriction sites.
  • the restriction site insert is a 9bp restriction site insert comprising 1 restriction site.
  • the restriction site insert comprises one or two restriction sites and at least one transgene, for example one or two or three transgenes, such as one or two transgenes.
  • the restriction site is a 19bp restriction site insert comprising 2 restriction sites and at least one transgene, for example one or two transgenes.
  • the restriction site insert is a 9bp restriction site insert comprising 1 restriction site and at least one transgene, for example one or two transgenes.
  • two restriction sites sandwich one or more, such as two transgenes (for example in a transgene cassette).
  • ⁇ comprises two restrictions sites the said restriction sites are different from each other.
  • said one or more restrictions sites in ⁇ are non-naturally occurring (such as unique) in the particular adenovirus genome into which they have been inserted.
  • said one or more restrictions sites in ⁇ are different to other restrictions sites located elsewhere in the adenovirus genome, for example different to naturally occurring restrictions sites or restriction sites introduced into other parts of the genome, such as ⁇ .
  • the restriction site or sites allow the DNA in the section to be cut specifically.
  • restriction site insert is SEQ ID NO: 54.
  • ⁇ has the sequence from 29345bp to 29379bp of SEQ I D NO: 12.
  • ⁇ is a bond
  • the insert is after bp 12 in SEQ I D NO: 11.
  • the insert is at about position 29356bp of SEQ ID NO: 12.
  • the insert is a transgene cassette comprising one or more transgenes, for example 1, 2 or 3, such as 1 or 2.
  • E4 refers to the DNA sequence encoding part or all of an adenovirus E4 region (i.e. polypeptide/protein region), which may be mutated such that the protein encoded by the E4 gene has conservative or non-conservative amino acid changes, and has the same function as wild- type (the corresponding non-mutated protein); increased function in comparison to wild-type protein; decreased function, such as no function in comparison to wild-type protein or has a new function in comparison to wild-type protein or a combination of the same as appropriate.
  • an adenovirus E4 region i.e. polypeptide/protein region
  • the E4 region is partially deleted, for example is 95%, 90%, 85%, 80%, 75%,
  • the E4 region has the sequence from 32188bp to 29380bp of SEQ ID NO: 12.
  • B3 is a bond, i.e. wherein E4 is absent.
  • B3 has the sequence consisting of from 32188bp to 29380bp of SEQ ID NO:
  • E1A, E1B, E3 and E4 as employed herein each independently refer to the wild-type and equivalents thereof, mutated or partially deleted forms of each region as described herein, in particular a wild-type sequence from a known adenovirus.
  • Insert refers to a DNA sequence that is incorporated either at the 5' end, the 3' end or within a given DNA sequence reference segment such that it interrupts the reference sequence. The latter is a reference sequence employed as a reference point relative to which the insert is located. In the context of the present disclosure inserts generally occur within either SEQ ID NO: 10 or SEQ ID NO: 11. An insert can be either a restriction site insert, a transgene cassette or both. When the sequence is interrupted the virus will still comprise the original sequence, but generally it will be as two fragments sandwiching the insert.
  • formulas herein are contiguous and may embody non-coding DNA sequences as well as the genes and coding DNA sequences (structural features) mentioned herein.
  • the formulas of the present disclosure are attempting to describe a naturally occurring sequence in the adenovirus genome.
  • the formula is referring to the major elements characterising the relevant section of genome and is not intended to be an exhaustive description of the genomic stretch of DNA.
  • intraperontoneal delivery of the virus is less immunogenic in terms of antiviral immunogenicity than sub-cutaneous or intramuscular delivery of virus.
  • Biodistribution as employed herein means the distribution in vivo.
  • Bioavailability as employed herein means the amount of virus available to perform its intended therapeutic function in vivo.
  • the method herein wherein at least three doses are administered minimises side- effects and/or toxicity in the patient.
  • the adenovirus is stealthed by coating said virus with a polymer, for example to at least partially avoid the patient's immune system.
  • Stealthed as employed herein means that the adenovirus's exterior surface has been modified to avoid the patient's immune response, for example employing a polymer.
  • suitable polymers are disclosed in WO98/19710, WO00/74722, WO2010/067041, WO2010/067081, and WO2006/008513 incorporated herein by reference.
  • the oncolytic virus is conjugated to a cytotoxic or immunomodulatory agent.
  • the oncolytic adenovirus is provided which is pegylated, for example to reduce immunogenenicity and/or increase half-life. In one embodiment the oncolytic adenovirus is employed in the treatment or prevention of metastasis. In one embodiment the virus, formulations and regimens according to the present disclosure are suitable for treating abnormal pre-cancerous cells.
  • the method or formulation herein is employed in the treatment of drug resistant cancers.
  • the method or formulation is employed in to sensitise drug resistant to cancers to said drugs.
  • the present disclosure relates to ColoAdl, a formulation of the same or a combination therapy comprising ColoAdl, for use in treating ovarian cancer, for example administering a therapeutically effective amount of ColoAdl to a patient with ovarian cancer, for example employing a dosing regimen described herein.
  • Cancerous ovarian tumours can start from three common cell types:
  • the present disclosure relates to treatment of ovarian cancer from any source, for example as described herein, in particular epithelium cells.
  • Epithelial ovarian carcinomas (EOCs) account for 85 to 90 percent of all cancers of the ovaries.
  • Epithelial ovarian tumours develop from the cells that cover the outer surface of the ovary. Most epithelial ovarian tumours are benign (noncancerous). There are several types of benign epithelial tumours, including serous adenomas, mucinous adenomas, and Brenner tumours. Cancerous epithelial tumours are carcinomas - meaning they begin in the tissue that lines the ovaries. These are the most common and most dangerous of all types of ovarian cancers. Unfortunately, almost 70 percent of women with the common epithelial ovarian cancer are not diagnosed until the disease is advanced in stage.
  • LMP tumours ovarian epithelial tumours whose appearance under the microscope does not clearly identify them as cancerous. These are called borderline tumours or tumours of low malignant potential (LMP tumours).
  • the method of the present disclosure includes treatment of the latter.
  • Germ Cell Tumours - Ovarian germ cell tumours develop from the cells that produce the ova or eggs. Most germ cell tumours are benign (non-cancerous), although some are cancerous and may be life threatening. The most common germ cell malignancies are maturing teratomas, dysgerminomas, and endodermal sinus tumours. Germ cell malignancies occur most often in teenagers and women in their twenties. Today, 90 percent of patients with ovarian germ cell malignancies can be cured and their fertility preserved.
  • Stromal Tumours - Ovarian stromal tumours are a rare class of tumours that develop from connective tissue cells that hold the ovary together and those that produce the female hormones, estrogen and progesterone. The most common types are granulosa-theca tumours and Sertoli-Leydig cell tumours. These tumours are quite rare and are usually considered low-grade cancers, with approximately 70 percent presenting as Stage I disease (cancer is limited to one or both ovaries).
  • Primary Peritoneal Carcinoma The removal of one's ovaries eliminates the risk for ovarian cancer, but not the risk for a less common cancer called Primary Peritoneal Carcinoma.
  • Primary Peritoneal Carcinoma is closely rated to epithelial ovarian cancer (most common type). It develops in cells from the peritoneum (abdominal lining) and looks the same under a microscope. It is similar in symptoms, spread and treatment.
  • stage of a tumour can be determined during surgery, when the doctor can tell if the cancer has spread outside the ovaries.
  • the treatment plan and prognosis (the probable course and outcome of your disease) will be determined by the stage of cancer you have.
  • Stage I - Growth of the cancer is limited to the ovary or ovaries.
  • Stage IA - Growth is limited to one ovary and the tumour is confined to the inside of the ovary.
  • Stage IB - Growth is limited to both ovaries without any tumour on their outer surfaces. There are no ascites present containing malignant cells. The capsule is intact.
  • Stage IC The tumour is classified as either Stage IA or IB and one or more of the following are present: (1) tumour is present on the outer surface of one or both ovaries; (2) the capsule has ruptured; and (3) there are ascites containing malignant cells or with positive peritoneal washings.
  • Stage II - Growth of the cancer involves one or both ovaries with pelvic extension.
  • Stage 11 A. The cancer has extended to and/or involves the uterus or the fallopian tubes, or both.
  • Stage M B The cancer has extended to other pelvic organs.
  • Stage IIC - The tumour is classified as either Stage IIA or M B and one or more of the following are present: (1) tumour is present on the outer surface of one or both ovaries; (2) the capsule has ruptured; and (3) there are ascites containing malignant cells or with positive peritoneal washings.
  • Stage II I - Growth of the cancer involves one or both ovaries, and one or both of the following are present: (1) the cancer has spread beyond the pelvis to the lining of the abdomen; and (2) the cancer has spread to lymph nodes.
  • the tumour is limited to the true pelvis but with histologically proven malignant extension to the small bowel or omentum.
  • Stage IMA - During the staging operation, the practitioner can see cancer involving one or both of the ovaries, but no cancer is grossly visible in the abdomen and it has not spread to lymph nodes. However, when biopsies are checked under a microscope, very small deposits of cancer are found in the abdominal peritoneal surfaces. Stage 1MB The tumour is in one or both ovaries, and deposits of cancer are present in the abdomen that are large enough for the surgeon to see but not exceeding 2 cm in diameter. The cancer has not spread to the lymph nodes.
  • Stage IIIC The tumour is in one or both ovaries, and one or both of the following is present: (1) the cancer has spread to lymph nodes; and/or (2) the deposits of cancer exceed 2 cm in diameter and are found in the abdomen.
  • Stage IV This is the most advanced stage of ovarian cancer. Growth of the cancer involves one or both ovaries and distant metastases (spread of the cancer to organs located outside of the peritoneal cavity) have occurred. Finding ovarian cancer cells in pleural fluid (from the cavity which surrounds the lungs) is also evidence of stage IV disease.
  • the ovarian cancer is: type I, for example IA, IB or IC; type II, for example MA, MB or IIC; type III, for example MIA, 1MB or IMC; or type IV.
  • the present disclosure relates to treatment of any stage of ovarian cancer, in particular as described herein.
  • the cancer is peritoneal cancer.
  • peritoneal cancer is cancer which started in the peritoneal.
  • the peritoneum is a layer of thin tissue that lines the abdomen and covers all of the organs within it, such as the bowel and the liver.
  • the peritoneum protects the organs and acts as a barrier to infection. It has 2 layers. One layer lines the abdominal wall and is called the parietal layer. The other layer covers the organs and is called the visceral layer. There is a small amount of fluid between the two layers, which separates them and allows them to slide over each other. This fluid allows us to move around without causing any friction on the layers
  • the peritoneal cancer is primary peritoneal cancer (PPC), which is a rare cancer of the peritoneum. It is very similar to the most common type of ovarian cancer called epithelial cancer. This is because the lining of the abdomen and the surface of the ovary come from the same tissue when we develop from embryos in the womb.
  • PPC primary peritoneal cancer
  • the staging system for PPCs is the same as for ovarian cancers but there is no early stage. PPC is always either stage 3 or stage 4. This is an advanced cancer. PPC does sometimes affect the ovaries but to be a PPC it must only be on the surface of the ovary.
  • PPC is a cancer that mainly affects women. There are no exact numbers for how many people get it in the UK. Research suggests that between 7 and 15 out of 100 women (7 to 15%) who have advanced ovarian cancer will actually have PPC. It is very rare in men. Most people are over the age of 60 when they are diagnosed.
  • the peritoneal cancer is mesothelioma, which is another rare type of cancer that can develop in the peritoneum.
  • the cancer is peritoneal carcinomatosis, which is the spread of metastases into the peritoneum, usually from ovarian and colorectal cancers.
  • the occurrence of peritoneal carcinomatosis has been shown to significantly decrease overall survival in patients with liver and/or extraperitoneal metastases from gastrointestinal cancer. Therefore the patient population with this cancer are generally at high risk.
  • Fallopian tube cancer is cancer which starts in this tissue as opposed to cancer that simply spreads from other tissue such as ovaries.
  • the most common form is adenocarcinoma, which is starts in epithelial cells.
  • Other forms of fallopian tube cancer include transitional cell cancer and sarcoma.
  • the virus is administered in combination with the administration of a further cancer treatment or therapy.
  • the oncolytic adenovirus is employed in combination with high intensity focused ultrasound (HIFU) treatment.
  • HIFU high intensity focused ultrasound
  • Cancer therapy includes surgery, radiation therapy, targeted therapy and/or chemotherapy.
  • Cancer treatment refers to treatment with a therapeutic compound or biological agent, for example an antibody intended to treat the cancer and/or maintenance therapy thereof.
  • the cancer treatment is selected from any other anti-cancer therapy including a chemotherapeutic agent, a targeted anticancer agent, radiotherapy, radio-isotope therapy or any combination thereof.
  • the present disclosure relates to a combination therapy comprising oncolytic type B adenovirus, such as ColoAdl, and a chemotherapeutic agent which does not interfere with the adenovirus activity.
  • Type B adenovirus, such as ColoAdl as employed herein includes formulations thereof, for example pharmaceutical formulations thereof.
  • Activity refers to any beneficial property or characteristic of the virus, for example the oncolytic activity and or the ability of the virus to replicate in cancer cells, such as viral replication in vivo.
  • the EnAd in the combination therapy is dosed according to a regimen described herein.
  • the combination therapy will be provided as a formulation of the adenovirus and a formulation of the chemotherapeutic agent.
  • the administration of the adenovirus and the chemotherapeutic will suitably be separate events. These administrations may be on the same or different days.
  • the oncolytic adenovirus may be used as a pre-treatment to the therapy, such as a surgery (neoadjuvant therapy), to shrink the tumour, to treat metastasis and/or prevent metastasis or further metastasis.
  • the oncolytic adenovirus may be used after the therapy, such as a surgery (adjuvant therapy), to treat metastasis and/or prevent metastasis or further metastasis.
  • Concurrently as employed herein is the administration of the additional cancer treatment at the same time or approximately the same time as the oncolytic adenovirus formulation.
  • the treatment may be contained within the same formulation or administered as a separate formulation.
  • the virus is administered in combination with the administration of a chemotherapeutic agent, for example as described herein, such as paclitaxel, abraxane or similar.
  • a chemotherapeutic agent for example as described herein, such as paclitaxel, abraxane or similar.
  • Chemotherapeutic agent as employed herein is intended to refer to specific antineoplastic chemical agents or drugs that are selectively destructive to malignant cells and tissues.
  • alkylating agents for example alkylating agents, antimetabolites, anthracyclines, plant alkaloids, topoisomerase inhibitors, and other antitumour agents.
  • Other examples of chemotherapy include doxorubicin, 5-fluorouracil (5-FU), paclitaxel, capecitabine, irinotecan, and platins such as cisplatin and oxaliplatin.
  • the preferred dose may be chosen by the practitioner based on the nature of the cancer being treated.
  • the present inventors have established that certain classes of therapeutic agents can inhibit viral replication, for example topoisomerase or parp inhibitors, may inhibit the replication of the virus in vivo. Given it is thought to be desirable to establish a viral infection in a cancer cell such that the virus can replicate, then co-administration of compounds that inhibit viral replication is likely to be undesirable.
  • the chemotherapeutic agent is not an enzyme inhibitor.
  • the combination therapy does not employ a topoisomerase inhibitor.
  • he chemotherapeutic agent is not a parp inhibitor.
  • the combination therapy employs a platinum containing chemotherapeutic agent, for example cisplatin, carboplatin or oxaliplatin.
  • a platinum containing chemotherapeutic agent for example cisplatin, carboplatin or oxaliplatin.
  • the combination employs a microtubule inhibitor, for example vincristine sulphate, epothilone A, N-[2-[(4-Hydroxyphenyl)amino]-3-pyridinyl]-4-methoxybenzenesulfonamide (ABT-751), ataxol derived chemotherapeutic agent, for example paclitaxel, abraxane, or docetaxel or a combination thereof.
  • a microtubule inhibitor for example vincristine sulphate, epothilone A, N-[2-[(4-Hydroxyphenyl)amino]-3-pyridinyl]-4-methoxybenzenesulfonamide (ABT-751), ataxol derived chemotherapeutic agent, for example paclitaxel, abraxane, or docetaxel or a combination thereof.
  • the combination employs an mTor inhibitor.
  • mTor inhibitors include: everolimus (RAD001), WYE-354, KU-0063794, papamycin (Sirolimus), Temsirolimus, Deforolimus(MK- 8669), AZD8055 and BEZ235(NVP-BEZ235).
  • the combination employs a Pi3 Kinase inhibitor.
  • Pi3 kinases inhibitors include: GDC-0941, ZSTK474, PIK-90, LY294002, TG100-115, XL147, GDC-0941, ZSTK474, PIK-90,
  • LY294002 TG100-115, XL147, AS-605240, PIK-293, AZD6482, PIK-93, TGX-221, IC-87114, AS-605240, PIK-293, AZD6482, PI K-93, TGX-221, IC-87114 and compounds disclosed in WO2011/048111 incorporated herein by reference including 2-((4-Amino-3-(3-hydroxyphenyl)-lH-pyrazolo[3,4- c/]pyrimidin-l-yl)methyl)-3-(2-chlorobenzyl)-5-ethynylquinazolin-4(3H)-one; 2-((4-Amino-3-(3- hydroxyphenyl)-lH-pyrazolo[3,4- ]pyrimidin-l-yl)methyl)-3-(2-chlorobenzyl)-5-(3-(2-(2- methoxyethoxy)ethoxy)prop-
  • the combination employs a MEK inhibitor.
  • MEK inhibitors include: AS703026, CI-1040 (PD184352), AZD6244 (Selumetinib), PD318088, PD0325901, AZD8330, PD98059, U0126-EtOH, BIX 02189 or BIX 02188.
  • the combination employs an AKT inhibitor.
  • AKT inhibitors include: MK-2206 and AT7867.
  • the combination employs an aurora kinase inhibitor.
  • aurora kinase inhibitors include: Aurora A Inhibitor I, VX-680, AZD1152-HQPA(Barasertib), SNS-314 Mesylate, PHA- 680632, ZM-447439, CCT129202 and Hesperadin.
  • the combination employs a p38 inhibitor, for example as disclosed in WO2010/038086, such as /V-[4-( ⁇ 4-[3-(3-tert-Butyl-l-p-tolyl-lH-pyrazol-5-yl)ureido]naphthalen-l- yloxy ⁇ methyl)pyridin-2-yl]-2-methoxyacetamide.
  • a p38 inhibitor for example as disclosed in WO2010/038086, such as /V-[4-( ⁇ 4-[3-(3-tert-Butyl-l-p-tolyl-lH-pyrazol-5-yl)ureido]naphthalen-l- yloxy ⁇ methyl)pyridin-2-yl]-2-methoxyacetamide.
  • the combination employs a Bcl-2 inhibitor.
  • Bcl-2 inhibitors include: obatoclax mesylate, ABT-737, ABT-263(navitoclax) and TW-37.
  • the combination employs an antimetabolite.
  • an antimetabolite include: capecitabine (xeloda), fludarabine phosphate, fludarabine(fludara), decitabine, raltitrexed(tomudex), gemcitabine hydrochloride and cladribine.
  • the therapeutic agent is ganciclovir, which may assist in controlling immune responses and/or tumour vasculation.
  • one or more therapies employed in the method herein are metronomic, that is a continuous or frequent treatment with low doses of anticancer drugs, often given concomitant with other methods of therapy.
  • Subgroup B oncolytic adenoviruses in particular Adll and those derived therefrom such as ColoAdl may be particularly synergistic with chemotherapeutics because they seem to have a mechanism of action that is largely independent of apoptosis, killing cancer cells by a predominantly necrolytic mechanism. Moreover, the immunosuppression that occurs during chemotherapy may allow the oncolytic virus to function with greater efficiency.
  • the chemotherapeutic agent is administered parenterally.
  • the chemotherapeutic agent is administered separately to the virus, either temporally or by an alternate method of administration or both. Treatment can be concurrent or sequential.
  • the cancer treatment is a targeted agent, for example a monoclonal antibody such as bevacizumab, cetuximab or panitumumab or antibody conjugate, such as an antibody drug conjugate, in particular of the type where the antibody or binding fragment is linked to a toxin.
  • a targeted agent for example a monoclonal antibody such as bevacizumab, cetuximab or panitumumab or antibody conjugate, such as an antibody drug conjugate, in particular of the type where the antibody or binding fragment is linked to a toxin.
  • the cancer treatment is an immunotherapeutic agent, for example ipilimumab or other anti-CTLA4, anti-PD-1, anti-PD-Ll, or other checkpoint inhibitors, or a cytokine or a cytokine analogue.
  • an immunotherapeutic agent for example ipilimumab or other anti-CTLA4, anti-PD-1, anti-PD-Ll, or other checkpoint inhibitors, or a cytokine or a cytokine analogue.
  • Checkpoint inhibitor as employed herein is intended to refer to agents that inhibit signalling from T-cell membrane proteins that act to inhibit or downregulate T-cell activation and function.
  • the virus is administered in combination with the administration of radiotherapy.
  • Radiotherapy as employed herein is intended to refer to the medical use of ionising radiation.
  • Cancer cells are generally undifferentiated and stem cell-like; they reproduce more than most healthy differentiated cells, and have a diminished ability to repair sub-lethal damage. DNA damage is then passed on through cell division; damage to the cancer cells' DNA accumulates, causing them to die or reproduce more slowly.
  • the radiotherapy is administered concurrently.
  • the radiotherapy is administered sequentially.
  • the virus is administered in combination with therapy complimentary to the cancer therapy, for example a treatment for cachexia, such as cancer cachexia, for example S-pindolol, S- mepindolol or S-bopindolol.
  • a treatment for cachexia such as cancer cachexia, for example S-pindolol, S- mepindolol or S-bopindolol.
  • Suitable doses may be in the range of 2.5mg to lOOmg, such as 2.5mg to 50mg per day provided a single dose or multiple doses given as multiple doses administered during the day.
  • the virus is administered in combination with the administration of one or more prophylactic agents, for example selected from an antipyretic, an antihistamine, an antiemetic, an antidiarrheal, steroid and an analgesic.
  • Antipyretics include aspirin and non-steroidal anti-inflammatories, for example ibuprofen, naproxen and ketoprofen.
  • Antihistamines include acrivastine, azalastine, brompheniramine, buclizine, bromodiphenhydramine, carbinoxamine, cetirizine, chlorpromazine, cyclizine, chlorpheniramine, chlorodiphenhydramine, clemastine, cyproheptadine, desloratadine, dexbrompheniramine, deschlorpheniramine, dexchlorpheniramine, dimenhydrinate, dimetindene, diphenhydramine, doxylamine, ebstine, embramine, fexofenadine, levocetirizine, loratadine, meclizine, mirtazapinem olopatadrine, pheninidamine, pheniramine, phenyltoloxamine, promethazine, pyrilamine, quetiapine, rupatadine, tripelennamine and triprolidine.
  • Antiemetics include dolasetron, granietron, ondansetron, tropisetron, palonoestron, mirtazapine, domperidone, olanzapine, droperidol, metoclopramide, alizapride, prochloperazine. In some instances antihistamines may be employed as antiemetics.
  • Antidiarrheals include methylcellulose, attapulgite, bismuth subsalicylate, atropine/diphenoxylate, loperamide and other opioids such as codeine and morphine.
  • Analgesics include non-steriodal anti-inflammatories, paracetamol, cox-2 inhibitors, opiates and morphinomimetics, such as morphine, codeine, oxycodone, hydrocodone, dihydromorphine, pethidine, buprenorphine, tramadol and the like.
  • viral treatment is employed in combination with a course of steroids.
  • Steroids include hydrocortisone, cortisone, prednisone, prednisolone, methylprednisolone, dexamethasone and the like.
  • Prophylactic as employed herein is intended to refer to preventive medicine or care, for example consisting of measures taken to prevent or ameliorate side effects during or following administration of the virus.
  • the prophylaxis is administered separately to the virus, either temporally or by an alternate method of administration or both. Treatment can be concurrent or sequential.
  • additional hydration is provided in combination with the administration of the virus, either concurrently or sequentially.
  • Additional hydration as employed herein means the patient is supplied with fluids beyond those included in the formulation.
  • This may be any form of suitable liquid, for example, a saline or glucose infusion.
  • virus therapy herein is administered in combination with an anti-inflammatory, for example a steroid or non-steroidal anti-inflammatory.
  • virus therapy according to the present disclosure is administered in combination with an anti-pyretic.
  • the viral treatment is administered in combination with hydration therapy, for example intravenous administration of fluids, in particular isotonic saline or glucose.
  • the method is suitable for treating the patient as an outpatient.
  • “comprising” is to be interpreted as “including”.
  • the control group in this study (Group 1) also received EnAd at a late time point (day 43), to see whether the virus was able to clear well established tumours.
  • the tumour burden was significantly reduced following this dose, but the animals had to be sacrificed thereafter because they met the pre-specified weight loss related humane endpoint.
  • the dose of EnAd used in this study was 5 x 10 9 viral particles per week and using the Body Surface Area conversion formula (Guidance for Industry: Estimating the Maximum Safe Starting Dose in Initial Clinical Trials for Therapeutics in Adult Healthy Volunteers, Food and Drug Administration [FDA] July 2005), this gives a human equivalent total dose of approximately 1 x 10 12 viral particles per dose, which is the starting dose in the Phase la dose escalation scheme for this study.
  • This NOAEL murine dose equates to a human equivalent total dose of 1.28 x 10 13 viral particles per dose using the Body Surface Area conversion formula (Guidance for Industry: Estimating the Maximum Safe Starting Dose in Initial Clinical Trials for Therapeutics in Adult Healthy Volunteers, FDA July 2005).
  • the safety margin provided by the GLP toxicology study is thus such that the maximum dose proposed in this clinical study is below the equivalent murine NOAEL.
  • IP intraperitioneal
  • PBS phosphate buffered saline
  • EnAd (ColoAdl) virus replication in the presence of 320 clinically approved compounds or compounds in development was assessed in the colon carcinoma cell line, HT-29.
  • HT-29 cell were seeded at a density of 3.0e4 cells per well in 96 well plates and incubated at 37°C, 5% C0 2 . After 4-6hrs incubation virus and drug compound mixtures prepared in cell media were diluted onto the cells to give final doses of 10 ColoAdl virus particles per cell (ppc) and ⁇ . ⁇ of drug compound. The cells were incubated for 18hrs and then the total virus genomes in the cells were assessed by qPC .
  • the relative fold change in ColoAdl replication, compared to ColoAdl virus alone, is plotted for all compounds in Figure 6.
  • the inset shows an increase in virus replication after 18 hrs in the presence of microtubule inhibitors and a decrease in virus replication in the presence of topoisomerase inhibitors.
  • paclitaxel or cisplatin treatment was assessed in an IP model of ovarian cancer.
  • SCID mice were implanted with 2.5e6 luciferase-expressing SKOV-3 human ovarian carcinoma cells. Tumour burden was assessed by luciferase expression.
  • Mice were imaged on day 5, on the day before each set of treatments and at least every 5-7 days for the duration of the study. All ColoAdl treatments were carried out using 5e9 virus particles delivered by intraperitoneal injection and in the combined treatment groups, paclitaxel (0.4mg) or cisplatin (0.04mg) was delivered the day after virus treatment.
  • the patients have histologically confirmed epithelial ovarian, fallopian tube or primary peritoneal cancer, who are resistant to platinum therapy or ovarian cancer who have exhausted all other treatment options.
  • phase I Key exclusion criteria for phase I included: Tumours of malignant mixed mesodermal or mucinous subtypes, or non-epithelial ovarian cancers; Symptomatic sub-acute bowel obstruction; Pregnant or lactating women; Known history or evidence of significant immunodeficiency due to underlying illness, medication, Splenectomy or prior allogeneic or autologous bone marrow or organ transplantation;
  • Level 1 A dosing cycle consisting of 3 x 10 12 viral particles fractionated as 3 separate weekly
  • I P doses administered as a slow IP injection i.e. : 1 x 10 12 viral particles on day 1 of weeks 1, 2 and 3 (i.e. day 1, day 8 [ ⁇ 1 day] and day 15 [ ⁇ 1 day]), followed by a second dosing cycle (dosing days 29, 36 and 43)
  • Level 2 A dosing cycle of 1.8 x 10 13 viral particles fractionated as 3 separate weekly I P doses administered as a slow IP injection i.e.: 6 x 10 12 viral particles on day 1 of weeks 1, 2 and 3 (i.e. day 1, day 8 [ ⁇ 1 day] and day 15 [ ⁇ 1 day]). 3 x 10 13 particles fractionated on day 1 of weeks 1, 2 and 3 is anticipated to be the highest tested dose. A second cycle of dosing planned for days 29, 36 and 43.
  • NCI CTCAE v4.03 Common Terminology Criteria for Adverse Events
  • Efficacy Response rate, duration of response, clinical benefit rate measured by RECIST vl.l, irRC and CICG criteria; Progression free survival measured by RECIST vl.l irRC, and GCIG CA-125 criteria; and - PFS rate at 4 and 6 months measured by RECIST vl.l criteria and irRC.
  • qPCR quantitative polymerase chain reaction
  • the quantities of virus in biological samples were assessed by qPC .
  • Samples were defrosted and DNA extracted from the sample. Swabs were vortexed and incubated in lysis buffer prior to DNA extraction.
  • Each sample of eluted DNA was added to two different PCR master mixes containing the Taqman probe, one containing enadenotucirev specific primers (Seq ID No's 91, 92 and 93) and one containing control bovine adenovirus specific primers. Each sample was tested in triplicate and a mean quantity value obtained for both targets.
  • a "no template" control and an exogenous internal positive control were also included in each PCR run.
  • Saliva samples were collected by swab from one side of the mouth between the lower gum area and the cheek. The swab was left to rest for 30 seconds to absorb saliva. Rectal swabs were taken with anal insertion of the tip of the swab to ensure faecal matter collection. Both swabs were air dried for fifteen minutes before returning to the container. All shedding samples were then frozen at -20°C until analysis by qPCR. Swabs were collected at the time points indicated in Tables 1 and 2.
  • the quantity of virus in blood was determined by qPCR. Samples were taken at the time points indicated in Figure 12 tifiable range in the blood samples, which contrasts with dosing intravenously where the virus has a half-life of approximately 20 mins and at a dose of lxlO 12 vp approximately 2xl0 7 vp/mL would be expected to be detected in the blood.
  • the quantity of virus in peritoneal fluid was determined by qPCR. Samples were taken prior to dosing, as part of draining the ascetic fluid prior to dosing at the time points indicated in Figure 14 and immediately frozen at -20°C. Patients were dosed on days 1, 8, 15, 29, 36 and 43. The Day 8, 15, 36 and 43 samples, therefore provide a measure of the quantity of virus in the peritoneal cavity 7 days following dosing of the virus, whereas the Day 29 sample is 14 days after the previous dose of virus.
  • the data in Figure 12 show that virus was detectable above LOQ at all time points in all subjects, often at levels that indicate that replication of the dosed virus particles may be contributing to the total detected 7 or 14 days after dosing.
  • a direct immunoassay was used to quantify the antibody concentration in the blood and peritoneal fluid samples.
  • Enadenotucirev particles were used to coat a Mesoscale Discovery (MSD) plate.
  • the serum or peritoneal samples were serially diluted and added to the coated plate. This was washed and antibodies in the samples that bound the enadenotucirev were detected with an anti-human IgG detection antibody.
  • the detection antibody contains a streptavidin-sulfo-Tag.
  • Upon electrochemical stimulation of the bound sulfo-tagged antibody a light signal is emitted and measured on the MSD platform.
  • An antibody titre was determined from the data by interpolating each sample against the calibration control.
  • EnAd qPCR Probe 6'FAM - ATCTGTGGAGTTCATCGCTCTCTTACG(SEQ ID NO: 93) - 3'TAMRA

Abstract

The present disclosure provides a method of treating a patient with ovarian cancer by administering a combination therapy comprising a dose of type B oncolytic adenovirus in the range of 1x1010 to 1x1014 viral particles weekly for at least three consecutive weeks, and administering a concomitant or sequential treatment cycle of a chemotherapeutic agent.

Description

METHOD OF TREATING OVARIAN CANCER
The present disclosure relates to a method of treating a patient with, for example a group B oncolytic adenovirus, such as a replication competent virus, in combination with a chemotherapeutic agent employing a dosing regimen designed to allow the virus to have a suitable therapeutic effect and/or minimise adverse events in vivo.
BACKGROUND
Cancer is a leading cause of death and serious illness worldwide. There are over 200 different types of cancer and the type of treatment is dependent on the type of cancer. Typically, treatment will involve surgery, chemotherapy and/or radiotherapy. These treatments are often unsuccessful or are only partially successful and have significant side effects.
During transformation, cancer cells acquire certain mutations which render them more permissive to virus infection. Cancer cells also induce the suppression of host anti-tumour activity. Changes within the tumour cells and the local micro-environment create a potential vulnerability and expose the tumour to infection by viruses (Liu et al 2007; Liu et al 2008; Roberts, 2006). Death from cancer is often the result of inaccessible tumours or metastases.
The biology of ovarian carcinoma differs from that of haematogenously metastasing tumours because ovarian cancer cells primarily disseminate within the peritoneal cavity and are only superficially invasive. Cancer Research UK figures indicate that ovarian cancer is responsible for 5% of female deaths in Europe. Worldwide it may be responsible for more than 150,000 female deaths a year.
The current standard of care for regional and distant disease is debulking surgery (cytoreductive surgery) coupled with platin based (cisplatin, carboplatin) and taxane based (paclitaxel, docetaxel) combination chemotherapy. Although, most high grade serous ovarian carcinomas respond well to chemotherapy, with initial response rates exceeding 70%, resistance develops and the majority of patients eventually relapse.
Patients who relapse less than 6 months after first line therapy (i.e. platinum sensitive) generally receive a further platinum based regimen and have overall rates of response in the range 30% to 40% with an overall survival of 12-48 months.
Patients whose disease recurs within 6 months (platinum-resistant) and platinum refractory patients (i.e. those who progress during treatment with platinum are treated with non-platinum regimens. There is currently no consensus for the best treatment approach for patients with platinum-resistant disease. Thus there is a huge unmet clinical need in this patient population.
There is a long history of using viruses to treat cancer beginning with anecdotal reports of temporary cancer remission after natural viral infections or viral vaccinations. The earliest report seems to be a 1912 account of the regression of cervical cancer in a patient vaccinated for rabies. Similar results were seen in cancer patients receiving smallpox vaccinations, or following natural virus infections such as mumps or measles. Based on these reports as well as animal data, inoculations of live viruses into patients for cancer treatment were initiated in the late 1940s and early 1950s. The usual experience, however, was that after occasional temporary tumour regression, the tumour regrew and the patient died. These inoculations seldom resulted in long-lasting complete remissions. In 1957, Albert B. Sabin, M.D., who developed the live oral polio vaccine commented, "The most disappointing aspect is the fact that even when a virus is oncolytic and it punches a hole in a tumour, the immune response of the individual to the virus occurs so fast that the effects are quickly wiped out and the tumour continues to grow."
To date, clinical studies of oncolytic viruses have primarily investigated intra-tumoural injection of the virus. In a review of clinical studies by Aghi & Martuza (2005) 25 of 36 studies used intra-tumoural injection to administer the virus.
Oncolytic viruses administered intra-tumourally rely on systemic dissemination from the tumour to reach these secondary tumours. However, dissemination has proved transient and often ineffective (Ferguson et al 2012). Thus, intra-tumoural injection is only suitable for a limited number of cancers and is not suitable for treatment of, for example of many metastatic cancers.
Intra-tumoural injection may only practical for treating easily accessible tumours and in patients where the structure of the tumour, such as tissue stroma and necrotic areas therein, do not limit spread of the virus within a tumour (Ries & Korn 2002).
EnAd (previously known as ColoAdl) is a chimeric (Adll/Ad3) serogroup B adenovirus, which was developed using the process of directed evolution and it is thought to be suitable for the treatment of cancers of epithelial origin and metastatic forms thereof, including colorectal cancer (Kuhn, I et al. 2008).
WO2014/198852 discloses a dosing regimen for the treatment of colorectal cancer wheren a dose EnAd is administered intravenously on day one, three and five.
The present inventors have established that a combination therapy comprising a hemotherapeutic agent and a group B oncolytic adenovirus is suitable for the treatment of ovarian cancer, peritoneal cancer, and fallopian tube cancer, in particular in the treatment platin resistant cancers.
The present inventors also some evidence to suggest than EnAd is able to infect ovarian cancer cells and replicate therein.
SUMMARY OF THE DISCLOSURE
Thus there is provided a method of treating a human patient with ovarian cancer, peritoneal cancer or fallopian tube cancer with a combination therapy comprising:
a) a first adenovirus treatment cycle comprising administering one dose of type B oncolytic adenovirus in the range of lxlO10 to lxlO14 viral particles approximately weekly (for example 7 days +/- 1 day) for at least three consecutive weeks, and
b) a first chemotherapy treatment cycle comprising administering a therapeutically effective amount of a chemotherapeutic agent once in 21 to 26 days,
wherein adenovirus treatment cycle and the chemotherapy treatment cycle either overlap or are sequential. The disclosure also extends to a chemotherapeutic agent and a type B oncolytic adenovirus for use in a combination therapy for the treatment of ovarian cancer, peritoneal cancer or fallopian tube, in regimen comprising:
a) a first adenovirus treatment cycle comprising administering one dose of type B oncolytic adenovirus in the range of lxlO10 to lxlO14 viral particles approximately weekly (for example 7 days +/- 1 day) for at least three consecutive weeks, and
b) a first chemotherapy treatment cycle comprising administering a therapeutically effective amount of a chemotherapeutic agent once in 21 to 26 days,
wherein adenovirus treatment cycle and the chemotherapy treatment cycle either overlap or are sequential.
Also provided is use of a chemotherapeutic agent and a type B oncolytic adenovirus for the manufacture of a combination therapy for the treatment of ovarian cancer, peritoneal cancer or fallopian tube, in regimen comprising:
a) a first adenovirus treatment cycle comprising administering one dose of type B oncolytic adenovirus in the range of lxlO10 to lxlO14 viral particles approximately weekly (for example 7 days +/- 1 day) for at least three consecutive weeks, and
b) a first chemotherapy treatment cycle comprising administering a therapeutically effective amount of a chemotherapeutic agent once in 21 to 26 days,
wherein adenovirus treatment cycle and the chemotherapy treatment cycle either overlap or are sequential.
In an independent aspect of the disclosure there is provided a method of treating a patient with ovarian cancer and/or peritoneal cancer by administering a combination therapy comprising:
a) a dose of type B oncolytic adenovirus in the range of lxlO10 to lxlO14 viral particles weekly for at least three consecutive weeks, and
b) within 1 day of one or more (for example each) of said virus doses administering a therapeutically effective amount of a chemotherapeutic agent.
In one embodiment there is provide a combination therapy comprising a type B oncolytic adenovirus and chemotherapeutic agent, for use in a treatment regime for the treatment of ovarian cancer and/or peritoneal cancer wherein the regime comprises administering:
a) a dose of type B oncolytic adenovirus in the range of lxlO10 to lxlO14 viral particles weekly for at least three consecutive weeks, and
b) within 1 day of one or more of said virus doses administering a therapeutically effective amount of a chemotherapeutic agent.
Also provided is a use of a combination therapy comprising a type B oncolytic adenovirus and chemotherapeutic agent for use in the manufacture of a medicament for the treatment of ovarian cancer and/or peritoneal cancer by a regime comprises administering:
a) a dose of type B oncolytic adenovirus in the range of lxlO10 to lxlO14 viral particles weekly for at least three consecutive weeks, and
b) within 1 day of one or more of said virus doses administering a therapeutically effective amount of a chemotherapeutic agent. In one embodiment the cancer is ovarian cancer, for example epithelial ovarian cancer. In one embodiment each administration of virus employed in the treatment cycle of step a) is in the range 1 x 1012 to 3 x 1013 viral particles, such as 1 x 1012, 6 x 1012 or 3 x 1013 viral particles, in particular the (or each) virus dose employed is about lxlO12 viral particles.
In one embodiment the total virus dose administered in the first adenovirus treatment cycle is 3 x 1012 virus particles.
In one embodiment the first dose of the adenovirus treatment cycle is administered on day one of week 1.
In one embodiment the second dose of the adenovirus treatment cycle is administered on day 8 +/- 1 day.
In one embodiment the third dose of the adenovirus treatment is in administered on day 15 +/- 1 day. In one embodiment the method comprises a second adenovirus treatment cycle, for example wherein the second treatment cycle comprises a dose in the range 1 x 1012 to 3 x 1013 viral particles (for example 1 x 1012, 6 x 1012 or 3 x 1013 viral particles) administered approximately weekly (for example 7 days +/- 1 day) for three consecutive weeks.
In one embodiment the the first dose of the second adenovirus treatment cycle is administered on day 29 +/- 1 day.
In one embodiment the second dose of the second adenovirus treatment cycle is administered on day 36 +/- 1 day.
In one embodiment the third dose of the second adenovirus treatment cycle is administered on day 43 +/- 1 day.
In one embodiment the type B oncolytic adenovirus is EnAd, OvAdl or OvAd2, such as EnAd, including where EnAd, OvAdl or OvAd2 further comprise a transgene.
In one embodiment the group B oncolytic adenovirus, such as EnAd has a sequence of formula (I):
5'ITR-B1-BA-B2-BX-BB-BY-B3-3'IT
wherein:
Bj comprises: El A, E1B or E1A-E1B;
BA comprises-E2B-Ll-L2-L3-E2A-L4;
B2 is a bond or comprises: E3;
Βχ is a bond or a DNA sequence comprising: a restriction site, one or more transgenes or both; Ββ comprises L5;
Βγ comprises a transgene cassette comprising a transgene and a splice acceptor sequence; and B3 is a bond or comprises: E4,
wherein the transgene cassette is under the control of an endogenous promoter selected from the group consisting of E4 and major late promoter and wherein the transgene cassette comprises a therapeutic gene encoding material selected from the group consisting of an RNAi sequence, an antibody or binding fragment thereof, chemokines, cytokines, immunomodulator and enzymes. In one embodiment a virus employed in the present disclosure has a sequence disclosed in the sequence listing provided herein.
In one embodiment the adenovirus of the present disclosure is replication competent.
In one embodiment the viral particles are administered parenterally, for example into the intraperitoneal cavity or intravenously, for example by slow infusion.
In one embodiment the chemotherapeutic agent is a microtubule, for example vincristine sulfate, paclitaxel (taxol), docetaxel, epothilone A and ABT-751.
In one embodiment the chemotherapeutic agent is a taxane derivate, such as paclitaxel and/or docetaxel, a platin, for example cisplatin, carboplatin or combination thereof, for example a taxane such as paclitaxel or docetaxel.
In one embodiment the dose of the chemotherapeutic agent is a known dose for monotherapy or combination chemotherapy (i.e. a combination of two or more chemotherapeutic agents).
In one embodiment the paclitaxel dose is in the range 135 to 175 mg/m2, for example administered over a period of 3 to 24 hours.
In one embodiment the the docetaxel dose is about 75 mg/m2, for example administered over a period of about 1 hour.
In one embodiment the dose of the chemotherapeutic agent is less than a known dose for monotherapy or combination chemotherapy (i.e. a combination of two or more chemotherapeutic agents).
In one embodiment the (or each) dose of the chemotherapeutic agent is in the range 1 to 50 mg, for example 2 to 20mg, such as 4mg.
In one embodiment 3 to 6 chemotherapy cycles are administered.
In one embodiment the therapy comprises administering a further therapeutic agent independently selected from doxorubicin, topotecan, etoposide and gemicitabine.
In one embodiment the therapy further comprises administering a biological therapeutic agent, for example an antibody or antibody binding fragment, such as bevacizumab.
In one embodiment the ovarian cancer is an epithelial cancer. In one embodiment the peritoneal cancer is an epithelial cancer.
Thus one aspect the population of patients are stage III or more advanced, for example stage III or more advanced of ovarian cancer.
In one embodiment the cancer, for example ovarian cancer is chemotherapy sensitive, for example sensitive to platins and/or taxanes, in particular sensitive to taxanes, such as paclitaxel and/or docetaxel.
In one embodiment the cancer, for example ovarian cancer is chemotherapy resistant, for example to platin based therapy, such a cisplatin or carboplatin; and/or resistant to taxanes, such as paclitaxel or docetaxel, in particular resistant to platin based chemotherapy.
In one embodiment the cancer, such as ovarian cancer is refractory to chemotherapy, for example to platin based therapy, such a cisplatin or carboplatin; and/or refractory to taxanes, such as paclitaxel or docetaxel, in particular refractory ro platin based chemotherapy. In one embodiment "within 1 day" is 24 hours or less, for example the administration of the virus and the chemotherapy are within 23, 22, 21, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1 of each other.
In one embodiment the chemotherapy treatment cycle overlaps with the adenovirus treatment cycle. In one embodiment the chemotherapy treatment cycle is subsequent to the adenovirus treatment cycle.
In one embodiment the adenovirus treatment cycle is subsequent to the adenovirus treatment cycle.
In one embodiment the chemotherapy is administered before administration of the oncolytic virus.
In one embodiment the chemotherapy is administered concomitant with the oncolytic virus.
In one embodiment the chemotherapy is administered after administration of the oncolytic virus.
In one embodiment the oncolytic virus is administered IP and the chemotherapeutic is administered IP.
In one embodiment the oncolytic virus is administered IP and the chemotherapeutic is administered IV.
In one embodiment the chemotherapeutic is administered IP and the oncolytic virus is administered IV.
In one embodiment the chemotherapeutic is administered IV and the oncolytic virus is administered IV. In one embodiment the combination therapy is administered after cytoreductive surgery.
In one embodiment the ascites is drained before delivery of the therapy, for example the oncolytic virus. This may be advantageous, for example by reducing anti-viral immunity and/or increasing the concentration of the therapeutic agent in the IP space. Whilst not wishing to be bound by theory draining the ascites may reduce the effect of the cancer on its surrounding microenvironment.
In one embodiment after administration of a therapy, for example the oncolytic virus to the IP cavity, there is provided IP delivery of a fluid, for example an isotonic fluid or similar diluent/carrier, such as sterile water. Whilst not wishing to be bound by theory this may assist in spreading the therapy within the IP cavity and, for example it reaches cancer cells appropriately.
IP delivery of at the adenovirus therapy may be beneficial because viruses such as EnAd may be cleared by the liver and other reticuloendothelial systems.
In one embodiment the cancer, for example ovarian cancer growth and/or spreading is reduced or stopped. In one embodiment the cancer, for example ovarian cancer metastasis is reduced or stopped. In one embodiment the cancer, for example ovarian cancer volume, extent, number of cancerous cells or the like is reduced.
In one embodiment metasis of the cancer, for example ovarian cancer outside the peritoneal cavity if reduced or stopped.
In one embodiment the therapy improves patient quality of life, for example reduces pain, reduces discomfort, reduces swelling, reduces weight loss, and/or reduces cancer associated fatigue.
In one embodiment the therapy herein increases the life expectancy of the treated patient by 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50 months or more.
In one or more embodiments the chemotherapeutic agent and the adenovirus may have a synergistic therapeutic effect. BRIEF DESCRIPTION OF THE DRAWINGS
Figure 1 Biodistribution of lell (lxlO11) particles of ColoAdl in normal BalbC mice 24
hours post injection
Figure 2 Biodistribution of ColoAdl and ColoAdlCJ132 in CD46 transgenic mice at 1 hr and 72 hrs post-injection
Figure 3 Clearance kinetics of ColoAdl from primary organs liver, spleen and lungs in CD46- expressing mice followed for 65 days
Figure 4 Kinetics of ColoAdl in mice either with or without co-administration of neutralising serum
Figure 5 320 clinically approved or developed compounds were analysed for their impact on virus replication
Figure 6 Microtubule drugs, for example Vincristine Sulfate, Paclitaxel(Taxol), Docetaxel,
Epothilone A and ABT-751
Figure 7 In vivo Model - Paclitaxel / ColoAdl combination therapy IP delivery (Day 33)
Figure 8 In vivo ColoAdl / chemotherapy combination studies IP delivery
Figure 9 In vivo EnAd / chemotherapy combination studies IP delivery
Figure 10 Clinical trial design
Figure 11 Clinical trial design
Figure 12 Concentration of virus in blood samples (vp/mL) pre- and post-dosing intraperitoneally with enadenotucirev (EnAd/ColoAdl)
Figure 13 Concentration of EnAd in peritoneal fluid samples (vp/mL) pre- and post-dosing
intraperitoneally with EnAd
Figure 14 Enadenotucirev binding antibody titre in serum samples
Figure 15 Enadenotucirev binding antibody titre in peritoneal samples
SEQ ID NO: 1 NG-77 virus genome sequence comprising the EnAd genome with a transgene cassette that encodes an anti-VEGF full length antibody inserted in the region Βγ. The transgene cassette contains a 5' branched splice acceptor sequence (bSA), ab heavy chain sequence with 5' leader, an IRES, an ab light chain sequence with 5' leader and a 3' poly(A) sequence.
SEQ ID NO: 2 NG-135 virus genome sequence comprising the EnAd genome with a transgene
cassette that encodes an anti-VEGF full length antibody inserted in the region By. The transgene cassette contains a 5' short splice acceptor sequence (SSA), ab heavy chain sequence with 5' leader, an IRES, ab light chain sequence with 5' leader and 3' poly(A) sequence.
SEQ ID NO: 3 A virus genome sequence comprising a transgene cassette that encodes an anti-VEGF full length antibody inserted in the region Βγ. The transgene cassette contains a SSA, ab heavy chain sequence with 5' leader, a SSA, and ab light chain sequence with 5' leader. SEQ ID NO: 4 A virus genome sequence comprising a transgene cassette that encodes an anti-VEGF full length antibody inserted in the region Βγ. The transgene cassette contains a SSA, ab heavy chain sequence with 5' leader, a SSA, ab light chain sequence with 5' leader and 3' poly(A) sequence.
SEQ ID NO: 5 NG-74 virus genome sequence comprising the EnAd genome with a transgene cassette that encodes an anti-VEGF ScFv inserted in the region Βγ. The transgene cassette contains a bSA, anti-VEGF ScFv sequence with 5' leader and 3' poly(A) sequence.
SEQ ID NO:6 NG-78 virus genome sequence comprising the EnAd genome with a transgene cassette that encodes an anti-VEGF ScFv with a C-terminal HISG tag, inserted in the region Βγ. The transgene cassette contains a bSA, anti-VEGF ScFv sequence with 5' leader and 3' 6 x histidine sequence and a poly(A) sequence.
SEQ ID NO: 7 NG-76 virus genome sequence comprising the EnAd genome with a transgene cassette that encodes an anti-VEGF ScFv with a C-terminal His6 tag, inserted in the region Βγ.
The transgene cassette contains a CMV promoter, anti-VEGF ScFv sequence with 5' leader and 3' 6 x histidine sequence and a poly(A) sequence.
SEQ ID NO: 8 NG-73 virus genome sequence comprising the EnAd genome with a transgene cassette that encodes an anti-VEGF ScFv inserted in the region Βγ. The transgene cassette contains a CMV promoter, anti-VEGF ScFv sequence with 5' leader and 3' poly(A) sequence.
SEQ ID NO: 9 NG-134 virus genome sequence comprising the EnAd genome with a transgene
cassette encoding an anti-VEGF full length antibody inserted into the region Βγ. The transgene cassette contains a CMV promoter, ab heavy chain sequence with 5' leader, an IRES, ab light chain sequence with 5' leader and a 3' poly(A) sequence.
SEQ ID NO: 10 Bx DNA sequence corresponding to and including bp 28166-28366 of the EnAd
genome.
SEQ ID NO: 11 Βγ DNA sequence corresponding to and including bp 29345-29379 of the EnAd
genome.
SEQ ID NO: 12 EnAd genome.
SEQ ID NO: 13 CMV exogenous promoter.
SEQ ID NO: 14 PGK exogenous promoter.
SEQ ID NO: 15 CBA exogenous promoter.
SEQ ID NO: 16 Short splice acceptor (SSA). Null sequence
SEQ ID NO: 17 splice acceptor (SA).
SEQ ID NO: 18 branched splice acceptor (bSA).
SEQ ID NO: 19 Internal Ribosome Entry sequence (IRES).
SEQ ID NO: 20 polyadenylation sequence. SEQ ID NO: 21
SEQ ID NO: 22
SEQ ID NO: 23
SEQ ID NO: 24
SEQ ID NO: 25
SEQ ID NO: 26
SEQ ID NO: 27
SEQ ID NO: 28
SEQ ID NO: 29
SEQ ID NO: 30
SEQ ID NO: 31
SEQ ID NO: 32
SEQ ID NO: 33
SEQ ID NO: 34
SEQ ID NO: 35
SEQ ID NO: 36
SEQ ID NO: 37
SEQ ID NO: 38
SEQ ID NO: 39
SEQ ID NO: 40
SEQ ID NO: 41
SEQ ID NO: 42
SEQ ID NO: 43
SEQ ID NO: 44
SEQ ID NO: 45
SEQ ID NO: 46
cassette, encoding an anti-PD-Ll full length antibody inserted into the region Βγ. The transgene cassette contains a CMV promoter, ab heavy chain sequence with 5' leader, an IRES, ab light chain sequence with 5' leader and a 3' poly(A) sequence.
SEQ ID NO: 47 DNA sequence corresponding to E2B region of the EnAd genome (bp 10355-5068).
SEQ ID NO: 48 NG-167 virus genome sequence comprising the EnAd genome with a transgene
cassette that encodes an anti-VEGF ScFv with a C-terminal His6 tag, inserted in the region Βγ. The transgene cassette contains a 5' SSA, anti-VEGF ScFv sequence with 5' leader and a 3' poly(A) sequence. SEQ ID NO: 49 NG-95 virus genome sequence comprising a transgene cassette that encodes the cytokine, IFNy, inserted in the region Βγ. The transgene cassette contains a 5' CMV promoter, IFNy cDNA sequence and 3' poly(A) sequence.
SEQ ID NO: 50 NG-97 virus genome sequence comprising a transgene cassette that encodes the cytokine, IFNa, inserted in the region Βγ. The transgene cassette contains a 5' CMV promoter, IFNa cDNA sequence and 3' poly(A) sequence.
SEQ ID NO: 51 NG-92 virus genome sequence comprising the EnAd genome with a transgene cassette that encodes the cytokine, IFNy, inserted in the region Βγ. The transgene cassette contains a 5' bSA, IFNy cDNA sequence and 3' poly(A) sequence.
SEQ ID NO: 52 NG-96 virus genome sequence comprising the EnAd genome with a transgene cassette that encodes the cytokine, IFNa, inserted in the region Βγ. The transgene cassette contains a 5' bSA, IFNa cDNA sequence and 3' poly(A) sequence.
SEQ ID NO: 53 NG-139 virus genome sequence comprising the EnAd genome with a transgene
cassette that encodes the cytokine, TNFa, inserted in the region Βγ. The transgene cassette contains a 5' SSA, TNFa cDNA sequence and 3' poly(A) sequence.
SEQ ID NO: 54 Restriction site insert (Βγ).
SEQ ID NO: 55 Restriction site insert (Bx).
SEQ ID NO: 56 NG-220 virus genome sequence comprising the EnAd genome with a transgene
cassette that encodes the tumour associated antigen, NY-ESO-1, inserted in the region Βγ. The transgene cassette contains a 5' PGK promoter, NY-ESO-1 cDNA sequence and
3' poly(A) sequence.
SEQ ID NO: 57 NG-217 virus genome sequence comprising the EnAd genome with a transgene
cassette that encodes the tumour associated antigen, NY-ESO-1, inserted in the region Βγ. The transgene cassette contains a 5' CMV promoter, NY-ESO-1 cDNA sequence and 3' poly(A) sequence.
SEQ ID NO: 58 NG-242 virus genome sequence comprising the EnAd genome with a transgene
cassette encoding an anti-CTLA-4 full length antibody inserted into the region Βγ. The transgene cassette contains a SSA, ab heavy chain sequence with 5' leader, an IRES, ab light chain sequence with 5' leader and a 3' poly(A) sequence.
SEQ ID NO: 59 NG-165 virus genome sequence comprising the EnAd genome with a transgene
cassette encoding an anti-VEGF full length antibody inserted into the region Βγ. The transgene cassette contains a SSA, ab heavy chain sequence with 5' leader, a P2A peptide sequence, ab light chain sequence with 5' leader and a 3' poly(A) sequence.
SEQ ID NO: 60 NG-190 virus genome sequence comprising the EnAd genome with a transgene
cassette encoding an anti-PD-Ll full length antibody inserted into the region Βγ. The transgene cassette contains a SSA, ab heavy chain sequence with 5' leader, a P2A peptide sequence, ab light chain sequence with 5' leader and a 3' poly(A) sequence.
SEQ ID NO: 61 NG-221 virus genome sequence comprising the EnAd genome with a transgene
cassette that encodes an anti-PD-Ll ScFv with a C-terminal His6 tag, inserted in the region Βγ. The transgene cassette contains a 5' SSA, anti-PD-Ll ScFv sequence with 5' leader and 3' 6 x histidine sequence then poly(A) sequence.
SEQ ID NO: 62 NG-258 virus genome sequence comprising the EnAd genome with a transgene
cassette encoding an anti-VEGF full length antibody inserted into the region Βγ. The transgene cassette contains a CMV promoter, ab heavy chain sequence with 5' leader, a P2A peptide sequence, ab light chain sequence with 5' leader and a 3' poly(A) sequence.
SEQ ID NO: 63 NG-185 virus genome sequence comprising the EnAd genome with unique restriction sites inserted into the Βχ and Βγ regions.
SEQ ID NO:64 pNG-33 (pColoAd2.4) DNA plasmid, comprising a bacterial origin of replication (pl5A), an antibiotic resistance gene (KanR) and the EnAd genome sequence with inserted unique restriction sites in the By region.
SEQ ID NO: 65 pNG-185 (pColoAd2.6) DNA plasmid, comprising a bacterial origin of replication (pl5A), an antibiotic resistance gene (KanR) and the EnAd genome sequence with inserted unique restriction sites in the Βχ and By regions.
SEQ ID NO: 66 NG-shOl virus genome sequence comprising a transgene cassette encoding an shRNA to GAPDH inserted into the region By. The transgene cassette contains a U6 RNA poll ll promoter and DNA encoding a shRNA.
SEQ ID NO: 67 Sodium Iodide symporter (NIS) amino acid sequence.
SEQ ID NO: 68 NG-280 virus genome sequence comprising a transgene cassette encoding the sodium iodide symporter (N IS) inserted into the region By. The transgene cassette contains a
5' SSA, NIS cDNA sequence and 3' poly(A) sequence.
SEQ ID NO: 69 NG-272 virus genome sequence comprising the EnAd genome with a transgene
cassette encoding an anti-VEGF ScFv and an anti-PD-Ll ScFv inserted into the region By.
The transgene cassette contains a SSA, anti-PD-Ll ScFv sequence with 5' leader and 3' 6xHis tag, a P2A peptide sequence, anti-VEGF ScFv sequence with 5' leader and 3' V5- tag and a 3' poly(A) sequence.
SEQ ID NO: 70 anti-CTLA-4 VH chain amino acid sequence.
SEQ ID NO: 71 anti-CTLA-4 VL chain amino acid sequence.
SEQ ID NO: 72 NG-257 virus genome sequence comprising the EnAd genome with a transgene
cassette encoding an anti-VEGF ScFv inserted into the region Bx. The transgene cassette contains a bSA, anti-VEGF ScFv sequence with 5' leader and 3' 6xHis tag then a
3' poly(A) sequence.
SEQ ID O: 73 NG-281 virus genome sequence comprising the EnAd genome with a transgene
cassette encoding an anti-VEGF ScFv inserted into the region Bx and a second transgene cassette encoding an anti-PD-Ll ScFv inserted into the region Βγ. The transgene cassette contains a bSA, anti-VEGF ScFv sequence with 5' leader and 3' 6xHis tag then a 3' poly(A) sequence.
SEQ ID NO: 74 Restriction site recognised and cut by the enzyme l-Crel.
SEQ ID NO: 75 Restriction site recognised and cut by the enzyme l-Ceul.
SEQ ID NO: 76 Restriction site recognised and cut by the enzyme l-Scel.
SEQ ID NO: 78-93 show primer/probe sequences
DETAILED DESCRIPTION
Each treatment cycle for the adenovirus therapy is a period of 3 weeks, i.e. about 14 or 15 days, with one dose of adenovirus therapy each week i.e. a total of 3 doses are given in one treatment cylcle. It will be understood by the skilled person that this administration is approxately day 1, day 8+/- a day and day 15 +/- a day, or as close to that protocol as possible.
If a second or for that matter a third cycle of adenovirus therapy is administered usually there will be a period of about 1 week without adenovirus treatment, before the next treatment cycle is initiated. Thus the second cycle will comprise 3 doses in total administered as one dose per week, for example given of day 29 +/- a day, day 36 +/- a day and 43 +/- a day and so on.
The days in the adenovirus treatment cycles are calculate by counting the day of administration of the first adenovirus dose of the first cycle as day one.
A chemotherapy treatment cycle protocol will depend on the actual chemotherapeutic agent employed. However, where the chemotherapeutic is a taxane, for example, then a dose will be administered every 21 to 29 days.
As employed herein the adenovirus therapy cycle will be considered to overlap with the chemotherapy cycle when the 3 week virus cycle overlap temporally with the 21 to 29 days chemotherapy cycle, for example the overall is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 20 or 21 days overlap. In one embodiment where said treatment cycles overlap the adenovirus treatment and the chemotherapy treatment is given on the same day.
In one embodiment where the treatment cycles overlap the adenovirus treatment and the chemotherapy treatment are give on different days.
The adenovirus treatment cycle and chemotherapy treatment cycle will be considered sequential when the cycles do not overlap temporally but follow each other, for example with no more than 7 days between the end of one type of treatment cycle and the beginning of the other type of treatment cycle. Delivery to the IP space of EnAd is very different to IV delivery (or IP delivery of a small molecule) for one or more of the following reasons: i. The IP space is relatively closed and impervious to virus egress (due to virus size), but the degree to which EnAd will pass through the diseased peritoneal cavity was not known before the work performed by the present inventors. It is likely that virus will not enter the blood stream readily. So:
· virus will remain in high concentrations in the IP cavity and in contact with the tumour for longer (in comparison to for example administration by the IV route).
• virus is unlikely to produce hepatic mediated dose limiting effects.
ii. The I P space can vary considerably in the volume of fluid that it contains, this is particularly true in patients with ovarian cancer and peritoneal carcinomatosis where ascites is common, thus making it difficult to ascertain dilution of the therapeutic dose at the time of delivery. iii. The immunological environment of the I P cavity differs considerably to the blood stream and so the effect of antibodies and immune cells on the virus cannot be predicted (ahead of performing the relevant experiments this could not be predicted for EnAd in humans either by animal work or clinical work with other viruses).
iv. Peritoneal tumours derive some of their nutrient and oxygen supply from the blood stream and some from peritoneal fluid. One agent given IP and one agent given IV may thus have a particularly synergistic.
v. Ovarian cancer can metastasise outside of the peritoneal cavity and it was unknown in the prior art whether IP delivered virus could impact upon extra-peritoneal lesions.
vi. EnAd virus kinetics, dynamics and efficacy after IP delivery are very different to IV delivery and were unknown before the work performed by the present inventors.
Patient as employed herein refers to a subject with ovarian cancer, for example a human or an animal (such as a domestic animal including cat, dog, horse), in particular a human. Patient as employed herein does not extend to an animal employed in an animal model.
In one embodiment the patient is a human.
Combination therapy as employed herein refers to whether there are at least two elements such as active agents employed together in treatment. Whilst the two elements may be co-administered they may also may be administered on separate days. What is important is that the at least two active agents have a period where the they both acting in vivo concomitantly, for example the duration of action of the first active agent overlaps with the duration of action of the second active agent.
Active agent as employed herein refers to an entity with a pharmacological effect and includes an oncolytic adenovirus and chemotherapeutic agents.
In one embodiment the dose, for example each dose administered is in the range of 1 xlO10 to 1 x 1013, such as 1012 viral particles.
In one embodiment the dose, for example each dose administered is lxlO12, 2xl012, 3xl012, 4xl012, 5xl012, 6xl012, 7xl012, 8xl012 or 9xl012 viral particles.
"Weekly for three consecutive weeks" as employed refers to administering a dose of the virus once each week, starting at week one of treatment, through week two and also in week three. In one embodiment the doses are evenly spaced, for example:
· dose 1 of the virus is given on day one of week one, • dose 2 of the virus is given on day 8 (7 days after the first dose and on day one of the second week), and
• dose 3 of the virus is given on day 15 (14 days after the first dose or 7 days after the second dose, for example on day one of the third week).
"Within one day" as employed herein refers to where the virus is administered one calendar day and chemotherapy is administered the previous calendar day, the same calendar day or the next calendar day, for example if the virus is administered on the 15th December the chemotherapy is administered on the 14th, 15th or 16th of December. Clearly if the chemotherapeutic is administered on the previous day or the next it may be more than 24 hours prior or post administration of the virus depending on the exact time of the day the administrations occur.
In one embodiment dose 1 of the chemotherapy is given on day two of week one, dose 2 of the chemotherapy is given on day nine (7 days after the first dose of chemotherapy and on day two of the second week), and dose 3 of the chemotherapy is given on day sixteen (14 days after the first dose or 7 days after the second dose, for example on day two of the third week).
In one embodiment after 3 weeks the combination therapy is not administered for at least one to three week. The combination therapy may, for example be initiated again at week 7, with a regime that repeats the first treatment cycle or varies same.
Subgroup B adenoviruses have certain inherent advantages in that they are associated with lower seroprevalence (Stone et al Journal of Virology 2005 Vol 79 No. 8 page 5090-5104) and have lower inflammatory potential. Initial dosing may thus be far more efficient than with Ad5, for example. However, the ability to avoid the immune system after systemic delivery may still become an issue with repeat dosing. Thus, even with the local suppression of the immune system by the cancer, avoidance of the immune system is still probably the biggest obstacle to the long term success of oncolytic virus therapy based on subgroup B adenoviruses.
In one embodiment the oncolytic virus is administered to the intraperitoneal cavity. This is beneficial because it avoids processing and elimination of the virus by the liver and advantageously allows the virus adequate "time" to infect cancer cells. Once an infection is established inside the tumour the virus is relatively protected from neutralising antibodies and is afforded a potentially permissive environment to replicate and to produce a therapeutic effect without dose limiting toxicities. This may also minimise side effects of the virus because the virus is concentrated in the body in the region of the cancer. It is hypothesised by the inventors that peaks in virus concentration (Cmax) in the blood contribute to side effects and that a flatter pharmacological profile may be desirable. Intraperitoneal administration minimised the serum levels of the virus. In one embodiment the Cmax is kept below a specific value, for example 3 xlO8 DNA copies per ml. It appears that a C level above the relevant threshold is more likely to induce serious adverse events or toxicity in some patients.
Inflammatory cytokines TNF, gamma interferon, IL-6 and MCP-1 may be monitored as markers of acute toxicity.
In one embodiment the chemotherapy is administered to the intraperitoneal cavity. This may also be advantageous in that this therapeutic is also concentrated in the region of the cancer. Delivery to the intraperitoneal cavity can be achieved by known mechanisms, for example a catheter inserted into the cavity.
The data generated by the present inventors supports the therapeutic effect of the oncolytic adenoviruses of subgroup B in the treatment of ovarian cancer and/or peritoneal cancer employing a treatment regime described herein.
In one embodiment the dosing regimens herein may also minimise side-effects, for example flu like symptoms and inflammatory responses.
In one embodiment the combination therapy is employed along with prophylactic or therapeutic agents including anti-inflammatories, steroids, antiemetics, antidiarrheals or analgesics administered during this treatment cycle, which may further enhance the tolerability of the regime. In one embodiment, steroids are administered during the treatment cycle.
Treatment cycle as employed herein refers to the at least 3 week period over which the combination therapy is administered.
In one embodiment three doses of each agent are employed in the treatment cycle, and in a further embodiment more than three doses are employed in the treatment cycle.
In one embodiment there is only one treatment cycle with no subsequent treatment cycles.
In one embodiment a patient who receives treatment according to the present disclosure shows an increased survival rate in comparison to a patient receiving the current standard treatment at the time of filing, for example a statistically significant increase in survival.
In one embodiment a patient who receives treatment according to the present disclosure shows a decreased tumour burden, in comparison to the standard treatment at the time of filing, for example a statistically significant decrease.
In one embodiment the a patient who receives treatment according to the present disclosure shows an increased likelihood of going into remission, in comparison to the standard treatment at the time of filing, for example a statistically significant increase.
In one embodiment the amount or extent of metastasis is reduced, for example is statistically significantly reduced in a patient who receives treatment according to the present disclosure in comparison to the standard treatment at the time of filing.
In one embodiment the oncolytic virus is replication capable. In one embodiment the oncolytic virus is replication competent.
Replication capable as employed herein is a virus that can replicate in a host cell. In one embodiment replication capable encompasses replication competent and replication selective viruses.
Replication competent as employed herein is intended to mean an oncolytic adenovirus that is capable of replicating in a human cell, such as a cancer cell, without any additional complementation to that required by wild-type viruses, for example without relying on defective cellular machinery. That is, they are tumour selective by infecting tumour cells in preference to non-tumour cells. EnAd is an example of a replication competent virus.
Replication selective or selective replication as employed herein is intended to mean an oncolytic adenovirus that is able to replicate in cancer cells employing an element which is specific to said cancer cells or upregulated therein, for example defective cellular machinery, such as a p53 mutation, thereby allowing a degree of selectivity over healthy/normal cells.
Oncolytic subgroup B adenovirus as employed herein refers to an adenovirus comprising at least the hexon and fiber from subgroup B (see Shenk et al and Table 1) that preferentially infects and/or lyses tumour cells compared with normal cells. Thus an oncolytic subgroup B adenovirus as employed herein includes a chimeric, a mutant or a variant, with the fiber and hexon of a group B adenovirus and which retains oncolytic properties.
Adenovirus or adenoviral serotype as used herein refers to any of the human adenoviral serotypes currently known (51) or isolated in the future. See for example, Strauss (1984) and Shenk (2001). Adenovirus serotypes are classified into subgroups as shown in Table 1.
Table 1 shows the division of adenovirus serotypes:
Figure imgf000017_0001
Examples of subgroup B viruses include Adll (wild-type) such as Adlla and Adllp (Genbank Accession No: AF532578) and the chimeric adenovirus EnAd. The latter is disclosed in WO 2005/118825 and the full sequence for the virus is provided in SEQ ID NO: 1 therein.
Thus in one embodiment the virus employed in the method according to the present disclosure is a chimeric virus.
In one embodiment the adenovirus is enadenotucirev (also known as EnAd and formerly as ColoAdl).
Enadenotucirev as employed herein refers the chimeric adenovirus shown in Figure 1 herein. It is a replication competent oncolytic chimeric adenovirus which has enhanced therapeutic properties compared to wild type adenoviruses (see WO2005/118825). EnAd has a chimeric E2B region, which features DNA from Adllp and Ad3, and deletions in E3/E4. The structural changes in enadenotucirev result in a genome that is approximately 3.5kb smaller than Adllp thereby providing additional "space" for the insertion of transgenes.
Chimeric adenovirus as employed herein refers to adenoviruses which have DNA from two or more different adenovirus serotypes such as those generated using the method of WO2005/118825 which is incorporated herein by reference.
In one embodiment the chimeric adenovirus is EnAd. EnAd is thought to kill tumour cells by a mechanism which more closely resembles necrosis than apoptosis (unpublished data produced at the University of Oxford). This has a number of potential beneficial effects (Kirn et al 2001; Small et al 2006; eid et al 2002; Liu et al 2007; Ferguson et al 2012): • EnAd has been shown to be potent in multi-drug resistant cancer cell lines and in cancer stem- cell like cells, which are known to have a resistance to apoptosis;
• An inflammatory necrotic cell death may be more suitable for the generation of a specific anti- tumoural immune response;
· ColoAdl exits tumour cells very rapidly, even before target cell death, and may thus have enhanced ability to spread.
EnAd is a chimera of Adll and Ad3 but has an outer capsule which is entirely homologous with that of Adll. The viral kinetics, inflammatory potential and immunological characteristics of elM thus most closely resemble and predict those of Adll and other subgroup B adenoviruses.
In one embodiment the oncolytic virus employed in the method of the present disclosure is deleted in the E3 and/or E4 region or part thereof. This may be beneficial because it may allow more rapid replication of the virus in vivo.
In addition the E3 deletion may contribute to the rapid clearance of the virus from non-cancer cells as the E3 region encoded proteins which may be relevant to avoiding the immunity of the host.
In one embodiment the virus employed in the method of the present disclosure is based on Adll or derived therefrom such that the hexon and fibre are substantially similar to Adll, such as Adllp. Furthermore since the serotype designation of adenovirus is based on the exterior properties of the virus i.e. hexon and fibre properties, the present disclosure is useful in type B adenovirus which have similar surface properties.
In one embodiment the type B adenovirus is OvAdl or OvAd2 which are disclosed in SEQ ID NO: 1 and SEQ ID NO: 2 respectively in WO2008/080003, incorporated herein by reference.
Substantially similar as employed herein refers to an amino acid sequence for a relevant protein or proteins which is/are at least 95% identical (e.g. 96, 97, 98, 99 or 100% identical) over the "whole" of the particular protein. The protein(s) being compared may be part of a larger entity but the comparison will be the whole length of the relevant fragment or component.
Adenovirus type 5 (Ad5) generally enter the cell via the coxsackie-adenovirus receptor (CAR). However, Adenovirus serotype 11 (Adll) is a subgroup B adenovirus that targets a different receptor (CD46) which is expressed at low levels in all nucleated cells. In normal cells CD46 is often hidden on the basolateral surfaces of cells and is thus not available for virus binding (Varela JC, et al Int J Cancer 2008 Sep 15; 123(6):1357-63; Maisner et al., 1997). However, in tumour cells it typically has enhanced surface expression, particularly in more advanced and aggressive tumours (Kinugasa et al., 1999). Therefore, Adll efficiently infects carcinoma cell lines, for example from lung epithelial carcinoma (A549 cells), hepatoma (HepG2), prostatic cancer (DU 145 and LNCaP), laryngeal cancer (Hep2) and breast cancer (CAMA and MG7) and also to glioblastoma, medulloblastoma and neuroblastoma cells (Mei et al 2003). Thus Adll preferentially infects tumour cells and viruses derived therefrom are thought to be useful in the treatment of at least one or more of the above cancers. As a chimera of Adll and Ad3, ColoAdl shares these characteristics with Adll.
In one embodiment a virus employed in the method of the present disclosure comprises a transgene (in particular one or more transgenes), for example a therapeutic transgene, for expression in vivo. A transgene gene as employed herein is intended to refer to a gene not found in the parent or wild type virus. Such genes may perform a function as a marker or reporter for tracking efficacy of viral infection. Alternatively the gene may perform a role in improving the efficacy of the virus. Alternatively the gene may deliver a cytotoxic agent to the cell.
The therapeutic transgene may express a therapeutic agent in the cell, for example siRNA; shRNA; a polypeptide; tumour associated antigen (TAA), cytokine; antibody; or an anti-angiogenesis factor.
Examples of therapeutic antibodies include anti-VGEF antibodies such as bevacizumab, anti-EGFR antibodies such as cetuximab, an anti-CD20 antibody such as rituximab, or an immune system activator modulator such as anti-CTLA4 (e.g. ipilimumab), anti-PD-1 and anti-PD-Ll amongst others. Single chain antibodies, antibody subunits, antibody fragments and TRAPs may also be encoded as well as full length antibodies. Importantly for the current disclosure, the inclusion of these proteins does not change the surface properties of the virus and therefore can readily be incorporated into the genome without deleterious effects upon the dosing as described herein whilst providing additional therapeutic mechanisms for attacking the cancer cells.
Examples of cytokines include interferon-alpha, interferon-gamma and IL-2 amongst others.
As the RNA, antibody, polypeptide, TAA or cytokine will be expressed in the tumour it is thought that this presents an opportunity to change the microenvironment of the tumour but avoid systemic side effects of the delivered agent. For example, it may be possible to stimulate the local immune system to attack the cancer. It is possible to modulate this local effect by altering whether or not the RNA, antibody, polypeptide, TAA or cytokine is secreted from the cell and when during the viral life cycle it is expressed.
In one embodiment the transgene encodes thymidine kinase, for example from a non-human origin or cytosine deaminase, for example from bacterial origin or from a yeast.
In one embodiment the antibody, polypeptide or cytokine or similar is non-human in origin and is not humanised. The latter is not likely to detrimentally effect the activity of the entity in the cancer cell and has the advantage that material that may escape the cancer cell will attract the attention of the immune system locally and will be rapidly cleared.
In one embodiment the virus encodes and expresses in vivo a visible or visualisable protein, for example a fluorescent protein, such as GFP or similar. Given the virus selectively infects cancerous cells, when it expresses a visible or visualisable protein then it can be used to highlight the area of cancerous tissue for resection or radiation.
In one embodiment, the viruses may be armed with therapeutic genes capable of eliciting anti-tumour immune function, inhibition of tumour neovascularization, or prodrug activation.
In one embodiment the virus employed in the present disclosure is a construct as disclosed in WO2015/059303 incorporated herein by reference in particular a virus construct explicitly disclosed in a sequence therein, for example from the sequences there: SEQ ID NO: 1 NG-77 virus genome sequence comprising the EnAd genome with a transgene cassette that encodes an anti-VEGF full length antibody inserted in the region Βγ. The transgene cassette contains a 5' branched splice acceptor sequence (bSA), ab heavy chain sequence with 5' leader, an IRES, an ab light chain sequence with 5' leader and a 3' poly(A) sequence. SEQ ID NO: 2 NG-135 virus genome sequence comprising the EnAd genome with a transgene cassette that encodes an anti-VEGF full length antibody inserted in the region Βγ. The transgene cassette contains a 5' short splice acceptor sequence (SSA), ab heavy chain sequence with 5' leader, an IRES, ab light chain sequence with 5' leader and 3' poly(A) sequence. SEQ ID NO: 3 A virus genome sequence comprising a transgene cassette that encodes an anti-VEGF full length antibody inserted in the region Βγ. The transgene cassette contains a SSA, ab heavy chain sequence with 5' leader, a SSA, and ab light chain sequence with 5' leader. SEQ ID NO: 4 A virus genome sequence comprising a transgene cassette that encodes an anti-VEGF full length antibody inserted in the region Βγ. The transgene cassette contains a SSA, ab heavy chain sequence with 5' leader, a SSA, ab light chain sequence with 5' leader and 3' poly(A) sequence. SEQ ID NO: 5 NG-74 virus genome sequence comprising the EnAd genome with a transgene cassette that encodes an anti-VEGF ScFv inserted in the region Βγ. The transgene cassette contains a bSA, anti-VEGF ScFv sequence with 5' leader and 3' poly(A) sequence. SEQ ID NO:6 NG-78 virus genome sequence comprising the EnAd genome with a transgene cassette that encodes an anti-VEGF ScFv with a C-terminal His6 tag, inserted in the region Βγ. The transgene cassette contains a bSA, anti-VEGF ScFv sequence with 5' leader and 3' 6 x histidine sequence and a poly(A) sequence. SEQ ID NO: 7 NG-76 virus genome sequence comprising the EnAd genome with a transgene cassette that encodes an anti-VEGF ScFv with a C-terminal His6 tag, inserted in the region Βγ. The transgene cassette contains a CMV promoter, anti-VEGF ScFv sequence with 5' leader and 3' 6 x histidine sequence and a poly(A) sequence. SEQ ID NO: 8 NG-73 virus genome sequence comprising the EnAd genome with a transgene cassette that encodes an anti-VEGF ScFv inserted in the region Βγ. The transgene cassette contains a CMV promoter, anti-VEGF ScFv sequence with 5' leader and 3' poly(A) sequence. SEQ ID NO: 9 NG-134 virus genome sequence comprising the EnAd genome with a transgene cassette encoding an anti-VEGF full length antibody inserted into the region Βγ. The transgene cassette contains a CMV promoter, ab heavy chain sequence with 5' leader, an IRES, ab light chain sequence with 5' leader and a 3' poly(A) sequence. SEQ ID NO: 46 NG-177 virus genome sequence comprising the EnAd genome with a transgene cassette, encoding an anti-PD-Ll full length antibody inserted into the region Βγ. The transgene cassette contains a CMV promoter, ab heavy chain sequence with 5' leader, an IRES, ab light chain sequence with 5' leader and a 3' poly(A) sequence. SEQ
ID NO: 48 NG-167 virus genome sequence comprising the EnAd genome with a transgene cassette that encodes an anti-VEGF ScFv with a C-terminal His6 tag, inserted in the region Βγ. The transgene cassette contains a 5' SSA, anti-VEGF ScFv sequence with 5' leader and a 3' poly(A) sequence. SEQ ID NO: 49 NG-95 virus genome sequence comprising a transgene cassette that encodes the cytokine, IFNy, inserted in the region Βγ. The transgene cassette contains a 5' CMV promoter, IFNy cDNA sequence and
3' poly(A) sequence. SEQ ID NO: 50 NG-97 virus genome sequence comprising a transgene cassette that encodes the cytokine, IFNa, inserted in the region Βγ. The transgene cassette contains a 5' CMV promoter, IFNa cDNA sequence and 3' poly(A) sequence. SEQ ID NO: 51 NG-92 virus genome sequence comprising the EnAd genome with a transgene cassette that encodes the cytokine, IFNy, inserted in the region Βγ. The transgene cassette contains a 5' bSA, IFNy cDNA sequence and 3' poly(A) sequence. SEQ ID NO: 52 NG-96 virus genome sequence comprising the EnAd genome with a transgene cassette that encodes the cytokine, IFNa, inserted in the region Βγ. The transgene cassette contains a 5' bSA, I FNa cDNA sequence and 3' poly(A) sequence. SEQ ID NO: 53 NG-139 virus genome sequence comprising the EnAd genome with a transgene cassette that encodes the cytokine, TNFa, inserted in the region Βγ. The transgene cassette contains a 5' SSA, TNFa cDNA sequence and 3' poly(A) sequence. SEQ ID NO: 56 NG-220 virus genome sequence comprising the EnAd genome with a transgene cassette that encodes the tumour associated antigen, NY-ESO-1, inserted in the region Βγ.
The transgene cassette contains a 5' PGK promoter, NY-ESO-1 cDNA sequence and 3' poly(A) sequence. SEQ ID NO: 57 NG-217 virus genome sequence comprising the EnAd genome with a transgene cassette that encodes the tumour associated antigen, NY-ESO-1, inserted in the region Βγ. The transgene cassette contains a 5' CMV promoter, NY-ESO-1 cDNA sequence and 3' poly(A) sequence. SEQ ID NO:
58 NG-242 virus genome sequence comprising the EnAd genome with a transgene cassette encoding an anti-CTLA-4 full length antibody inserted into the region Βγ. The transgene cassette contains a SSA, ab heavy chain sequence with 5' leader, an IRES, ab light chain sequence with 5' leader and a 3' poly(A) sequence. SEQ ID NO: 59 NG-165 virus genome sequence comprising the EnAd genome with a transgene cassette encoding an anti-VEGF full length antibody inserted into the region Βγ. The transgene cassette contains a SSA, ab heavy chain sequence with 5' leader, a P2A peptide sequence, ab light chain sequence with 5' leader and a 3' poly(A) sequence. SEQ ID NO: 60 NG-190 virus genome sequence comprising the EnAd genome with a transgene cassette encoding an anti-PD-Ll full length antibody inserted into the region Βγ. The transgene cassette contains a SSA, ab heavy chain sequence with 5' leader, a P2A peptide sequence, ab light chain sequence with 5' leader and a 3' poly(A) sequence. SEQ ID NO: 61 NG-221 virus genome sequence comprising the EnAd genome with a transgene cassette that encodes an anti-PD-Ll ScFv with a C-terminal His6 tag, inserted in the region Βγ. The transgene cassette contains a 5' SSA, anti-PD-Ll ScFv sequence with 5' leader and 3' 6 x histidine sequence then poly(A) sequence. SEQ ID NO: 62 NG-258 virus genome sequence comprising the EnAd genome with a transgene cassette encoding an anti-VEGF full length antibody inserted into the region Βγ. The transgene cassette contains a CMV promoter, ab heavy chain sequence with 5' leader, a P2A peptide sequence, ab light chain sequence with 5' leader and a 3' poly(A) sequence. SEQ ID NO: 63 NG-185 virus genome sequence comprising the EnAd genome with unique restriction sites inserted into the Βχ and Βγ regions. SEQ ID NO: 66 NG-shOl virus genome sequence comprising a transgene cassette encoding an shRNA to GAPDH inserted into the region By. The transgene cassette contains a U6 RNA pollll promoter and DNA encoding a shRNA. SEQ ID NO: 68 NG-280 virus genome sequence comprising a transgene cassette encoding the sodium iodide symporter (NIS) inserted into the region Βγ. The transgene cassette contains a 5' SSA, NIS cDNA sequence and 3' poly(A) sequence. SEQ ID NO:
69 NG-272 virus genome sequence comprising the EnAd genome with a transgene cassette encoding an anti-VEGF ScFv and an anti-PD-Ll ScFv inserted into the region Βγ. The transgene cassette contains a SSA, anti-PD-Ll ScFv sequence with 5' leader and 3' 6xHis tag, a P2A peptide sequence, anti-VEGF
ScFv sequence with 5' leader and 3' V5-tag and a 3' poly(A) sequence. SEQ ID NO: 72 NG-257 virus genome sequence comprising the EnAd genome with a transgene cassette encoding an anti-VEGF ScFv inserted into the region Bx. The transgene cassette contains a bSA, anti-VEGF ScFv sequence with 5' leader and 3' 6xHis tag then a 3' poly(A) sequence. SEQ ID NO: 73 NG-281 virus genome sequence comprising the EnAd genome with a transgene cassette encoding an anti-VEGF ScFv inserted into the region Bx and a second transgene cassette encoding an anti-PD-Ll ScFv inserted into the region Βγ. The transgene cassette contains a bSA, anti-VEGF ScFv sequence with 5' leader and 3' 6xHis tag then a 3' poly(A) sequence. The sequences for these viruses are incorporated herein by reference from
WO2015/059303filed 24 October 2014.
as employed herein refers to the DNA sequence encoding: part or all of an E1A from an adenovirus, part or all of the E1B region of an adenovirus, and independently part or all of E1A and E1B region of an adenovirus.
In one embodiment B^ further comprises a transgene. It is known in the art that the El region can accommodate a transgene which may be inserted in a disruptive way into the El region (i.e. in the "middle" of the sequence) or part or all of the El region may be deleted to provide more room to accommodate genetic material.
E1A as employed herein refers to the DNA sequence encoding part or all of an adenovirus E1A region. The latter here is referring to the polypeptide/protein E1A. It may be mutated such that the protein encoded by the E1A gene has conservative or non-conservative amino acid changes, such that it has: the same function as wild-type (i.e. the corresponding non-mutated protein); increased function in comparison to wild-type protein; decreased function, such as no function in comparison to wild-type protein; or has a new function in comparison to wild-type protein or a combination of the same as appropriate.
E1B as employed herein refers to the DNA sequence encoding part or all of an adenovirus E1B region (i.e. polypeptide or protein), it may be mutated such that the protein encoded by the E1B gene/region has conservative or non-conservative amino acid changes, such that it has: the same function as wild-type (i.e. the corresponding non-mutated protein); increased function in comparison to wild-type protein; decreased function, such as no function in comparison to wild-type protein; or has a new function in comparison to wild-type protein or a combination of the same as appropriate.
Thus B^ can be modified or unmodified relative to a wild-type El region, such as a wild-type
E1A and/or E1B. The skilled person can easily identify whether E1A and/or E1B are present or (part) deleted or mutated.
Wild-type as employed herein refers to a known adenovirus. A known adenovirus is one that has been identified and named, regardless of whether the sequence is available.
In one embodiment B^ has the sequence from 139bp to 3932bp of SEQ ID NO: 12.
as employed herein refers to the DNA sequence encoding the E2B-L1-L2-L3-E2A-L4 regions including any non-coding sequences, as appropriate. Generally this sequence will not comprise a transgene. In one embodiment the sequence is substantially similar or identical to a contiguous sequence from a known adenovirus, for example a serotype shown in Table 1, in particular a group B virus, for example Ad3, Ad7, Adll, Adl4, Adl6, Ad21, Ad34, Ad35, Ad51 or a combination thereof, such as Ad3, Adll or a combination thereof. In one embodiment is E2B-L1-L2-L3-E2A-L4 refers to comprising these elements and other structural elements associated with the region, for example B will generally include the sequence encoding the protein IV2a, for example as follows: IV2A IV2a-E2B- L1-L2-L3-E2A-L4
In one embodiment the E2B region is chimeric. That is, comprises DNA sequences from two or more different adenoviral serotypes, for example from Ad3 and Adll, such as Adllp. In one embodiment the E2B region has the sequence from 5068bp to 10355bp of SEQ ID NO: 12 or a sequence
95%, 96%, 97%, 98% or 99% identical thereto over the whole length.
In one embodiment the E2B in component B^ comprises the sequences shown in SEQ I D NO: 47
(which corresponds to SEQ ID NO: 3 disclosed in WO2005/118825).
In one embodiment B^ has the sequence from 3933bp to 27184bp of SEQ ID NO: 12.
E3 as employed herein refers to the DNA sequence encoding part or all of an adenovirus E3 region (i.e. protein/polypeptide), it may be mutated such that the protein encoded by the E3 gene has conservative or non-conservative amino acid changes, such that it has the same function as wild-type (the corresponding unmutated protein); increased function in comparison to wild-type protein; decreased function, such as no function in comparison to wild-type protein or has a new function in comparison to wild-type protein or a combination of the same, as appropriate.
In one embodiment the E3 region is form an adenovirus serotype given in Table 1 or a combination thereof, in particular a group B serotype, for example Ad3, Ad7, Adll (in particular Adllp), Adl4, Adl6, Ad21, Ad34, Ad35, Ad51 or a combination thereof, such as Ad3, Adll (in particular Adllp) or a combination thereof.
In one embodiment the E3 region is partially deleted, for example is 95%, 90%, 85%, 80%, 75%,
70%, 65%, 60%, 55%, 50%, 45%, 40%, 35%, 30%, 25%, 20%, 15%, 10%, 5% deleted.
In one embodiment B2 is a bond, wherein the DNA encoding the E3 region is absent.
In one embodiment the DNA encoding the E3 region can be replaced or interrupted by a transgene. As employed herein "E3 region replaced by a transgene as employed herein includes part or all of the E3 region is replaced with a transgene.
In one embodiment the B2 region comprises the sequence from 27185bp to 28165bp of SEQ ID
NO: 12.
In one embodiment B2 consists of the sequence from 27185bp to 28165bp of SEQ ID NO: 12. Βχ as employed herein refers to the DNA sequence in the vicinity of the 5' end of the L5 gene in
Bg. In the vicinity of or proximal to the 5' end of the L5 gene as employed herein refers to: adjacent
(contiguous) to the 5' end of the L5 gene or a non-coding region inherently associated herewith i.e. abutting or contiguous to the 5' prime end of the L5 gene or a non-coding region inherently associated therewith. Alternatively, in the vicinity of or proximal to may refer to being close the L5 gene, such that there are no coding sequences between the Βχ region and the 5' end of L5 gene.
Thus in one embodiment Βχ is joined directly to a base of L5 which represents, for example the start of a coding sequence of the L5 gene.
Thus in one embodiment Βχ is joined directly to a base of L5 which represents, for example the start of a non-coding sequence, or joined directly to a non-coding region naturally associated with L5. A non-coding region naturally associated L5 as employed herein refers to part of all of a non-coding regions which is part of the L5 gene or contiguous therewith but not part of another gene.
In one embodiment Βχ comprises the sequence of SEQ ID NO: 10. This sequence is an artificial non-coding sequence wherein a DNA sequence, for example comprising a transgene (or transgene cassette), a restriction site or a combination thereof may be inserted therein. This sequence is advantageous because it acts as a buffer in that allows some flexibility on the exact location of the transgene whilst minimising the disruptive effects on virus stability and viability.
The insert(s) can occur anywhere within SEQ ID NO: 10 from the 5' end, the 3' end or at any point between bp 1 to 201, for example between base pairs 1/2, 2/3, 3/4, 4/5, 5/6, 6/7, 7/8, 8/9, 9/10, 10/11, 11/12, 12/13, 13/14, 14/15, 15/16, 16/17, 17/18, 18/19, 19/20, 20/21, 21/22, 22/23, 23/24, 24/25, 25/26, 26/27, 27/28, 28/29, 29/30, 30/31, 31/32, 32/33, 33/34, 34/35, 35/36, 36/37, 37/38, 38/39, 39/40, 40/41, 41/42, 42/43, 43/44, 44/45, 45/46, 46/47, 47/48, 48/49, 49/50, 50/51, 51/52, 52/53, 53/54, 54/55, 55/56, 56/57, 57/58, 58/59, 59/60, 60/61, 61/62, 62/63, 63/64, 64/65, 65/66, 66/67, 67/68, 68/69, 69/70, 70/71, 71/72, 72/73, 73/74, 74/75, 75/76, 76/77, 77/78, 78/79, 79/80, 80/81, 81/82, 82/83, 83/84, 84/85, 85/86, 86/87, 87/88, 88/89, 89/90, 90/91, 91/92, 92/93, 93/94, 94/95, 95/96, 96/97, 97/98, 98/99, 99/100, 100/101, 101/102, 102/103, 103/104, 104/105, 105/106,
106/107, 107/108, 108/109, 109/110, 110/111, 111/112, 112/113, 113/114, 114/115, 115/116,
116/117, 117/118, 118/119, 119/120, 120/121, 121/122, 122/123, 123/124, 124/125, 125/126,
126/127, 127/128, 128/129, 129/130, 130/131, 131/132, 132/133, 133/134, 134/135, 135/136, 136/137, 137/138, 138/139, 139/140, 140/141, 141/142, 142/143, 143/144, 144/145, 145/146,
146/147, 147/148, 148/149, 150/151, 151/152, 152/153, 153/154, 154/155, 155/156, 156/157,
157/158, 158/159, 159/160, 160/161, 161/162, 162/163, 163/164, 164/165, 165/166, 166/167,
167/168, 168/169, 169/170, 170/171, 171/172, 172/173, 173/174, 174/175, 175/176, 176/177,
177/178, 178/179, 179/180, 180/181, 181/182, 182/183, 183/184, 184/185, 185/186, 186/187, 187/188, 189/190, 190/191, 191/192, 192/193, 193/194, 194/195, 195/196, 196/197, 197/198,
198/199, 199/200 or 200/201.
In one embodiment Βχ comprises SEQ ID NO: 10 with a DNA sequence inserted between bp 27 and bp 28 or a place corresponding to between positions 28192bp and 28193bp of SEQ ID NO: 12.
In one embodiment the insert is a restriction site insert. In one embodiment the restriction site insert comprises one or two restriction sites. In one embodiment the restriction site is a 19bp restriction site insert comprising 2 restriction sites. In one embodiment the restriction site insert is a 9bp restriction site insert comprising 1 restriction site. In one embodiment the restriction site insert comprises one or two restriction sites and at least one transgene, for example one or two transgenes. In one embodiment the restriction site is a 19bp restriction site insert comprising 2 restriction sites and at least one transgene, for example one or two transgenes. In one embodiment the restriction site insert is a 9bp restriction site insert comprising 1 restriction site and at least one transgene, for example one, two or three transgenes, such as one or two. In one embodiment two restriction sites sandwich one or more, such as two transgenes (for example in a transgene cassette). In one embodiment when Βχ comprises two restrictions sites the said restriction sites are different from each other. In one embodiment said one or more restrictions sites in Βχ are non-naturally occurring in the particular adenovirus genome into which they have been inserted. In one embodiment said one or more restrictions sites in Βχ are different to other restrictions sites located elsewhere in the adenovirus genome, for example different to naturally occurring restrictions sites and/or restriction sites introduced into other parts of the genome, such as a restriction site introduced into By. Thus in one embodiment the restriction site or sites allow the DNA in the section to be cut specifically. Advantageously, use of "unique" restriction sites provides selectivity and control over the where the virus genome is cut, simply by using the appropriate restriction enzyme.
Cut specifically as employed herein refers to where use of an enzyme specific to the restriction sites cuts the virus only in the desired location, usually one location, although occasionally it may be a pair of locations. A pair of locations as employed herein refers to two restrictions sites in proximity of each other that are designed to be cut by the same enzyme (i.e. cannot be differentiated from each other).
In one embodiment the restriction site insert is SEQ ID NO: 55.
In one embodiment Βχ has the sequence from 28166bp to 28366bp of SEQ ID NO: 12.
In one embodiment Βχ is a bond.
BQ as employed herein refers to the DNA sequence encoding the L5 region. As employed herein the L5 region refers to the DNA sequence containing the gene encoding the fibre polypeptide/protein, as appropriate in the context. The fibre gene/region encodes the fibre protein which is a major capsid component of adenoviruses. The fibre functions in receptor recognition and contributes to the adenovirus' ability to selectively bind and infect cells.
In viruses of the present disclosure the fibre can be from any adenovirus serotype and adenoviruses which are chimeric as result of changing the fibre for one of a different serotype are known. In one embodiment the fibre is from a group B virus, in particular Adll, such as Adllp.
In one embodiment Bg has the sequence from 28367bp to 29344bp of SEQ ID NO: 12.
DNA sequence in relation to Βγ as employed herein refers to the DNA sequence in the vicinity of the 3' end of the L5 gene of Ββ. In the vicinity of or proximal to the 3' end of the L5 gene as employed herein refers to: adjacent (contiguous) to the 3' end of the L5 gene or a non-coding region inherently associated therewith i.e. abutting or contiguous to the 3' prime end of the L5 gene or a non- coding region inherently associated therewith (i.e. all or part of an non-coding sequence endogenous to L5). Alternatively, in the vicinity of or proximal to may refer to being close the L5 gene, such that there are no coding sequences between the By region and the 3' end of the L5 gene.
Thus in one embodiment By is joined directly to a base of L5 which represents the "end" of a coding sequence.
Thus in one embodiment By is joined directly to a base of L5 which represents the "end" of a non-coding sequence, or joined directly to a non-coding region naturally associated with L5.
Inherently and naturally are used interchangeably herein. In one embodiment By comprises the sequence of SEQ ID NO: 11. This sequence is a non-coding sequence wherein a DNA sequence, for example comprising a transgene (or transgene cassette), a restriction site or a combination thereof may be inserted. This sequence is advantageous because it acts a buffer in that allows some flexibility on the exact location of the transgene whilst minimising the disruptive effects on virus stability and viability.
The insert(s) can occur anywhere within SEQ ID NO: 11 from the 5' end, the 3' end or at any point between bp 1 to 35, for example between base pairs 1/2, 2/3, 3/4, 4/5, 5/6, 6/7, 7/8, 8/9, 9/10, 10/11, 11/12, 12/13, 13/14, 14/15, 15/16, 16/17, 17/18, 18/19, 19/20, 20/21, 21/22, 22/23, 23/24, 24/25, 25/26, 26/27, 27/28, 28/29, 29/30, 30/31, 31/32, 32/33, 33/34, or 34/35. In one embodiment Βγ comprises SEQ ID NO: 11 with a DNA sequence inserted between positions bp 12 and 13 or a place corresponding to 29356bp and 29357bp in SEQ I D NO: 12. In one embodiment the insert is a restriction site insert. In one embodiment the restriction site insert comprises one or two restriction sites. In one embodiment the restriction site is a 19bp restriction site insert comprising 2 restriction sites. In one embodiment the restriction site insert is a 9bp restriction site insert comprising 1 restriction site. In one embodiment the restriction site insert comprises one or two restriction sites and at least one transgene, for example one or two or three transgenes, such as one or two transgenes. In one embodiment the restriction site is a 19bp restriction site insert comprising 2 restriction sites and at least one transgene, for example one or two transgenes. In one embodiment the restriction site insert is a 9bp restriction site insert comprising 1 restriction site and at least one transgene, for example one or two transgenes. In one embodiment two restriction sites sandwich one or more, such as two transgenes (for example in a transgene cassette). In one embodiment when Βγ comprises two restrictions sites the said restriction sites are different from each other. In one embodiment said one or more restrictions sites in Βγ are non-naturally occurring (such as unique) in the particular adenovirus genome into which they have been inserted. In one embodiment said one or more restrictions sites in Βγ are different to other restrictions sites located elsewhere in the adenovirus genome, for example different to naturally occurring restrictions sites or restriction sites introduced into other parts of the genome, such as Βχ. Thus in one embodiment the restriction site or sites allow the DNA in the section to be cut specifically.
In one embodiment the restriction site insert is SEQ ID NO: 54.
In one embodiment Βγ has the sequence from 29345bp to 29379bp of SEQ I D NO: 12.
In one embodiment Βγ is a bond.
In one embodiment the insert is after bp 12 in SEQ I D NO: 11.
In one embodiment the insert is at about position 29356bp of SEQ ID NO: 12.
In one embodiment the insert is a transgene cassette comprising one or more transgenes, for example 1, 2 or 3, such as 1 or 2.
E4 as employed herein refers to the DNA sequence encoding part or all of an adenovirus E4 region (i.e. polypeptide/protein region), which may be mutated such that the protein encoded by the E4 gene has conservative or non-conservative amino acid changes, and has the same function as wild- type (the corresponding non-mutated protein); increased function in comparison to wild-type protein; decreased function, such as no function in comparison to wild-type protein or has a new function in comparison to wild-type protein or a combination of the same as appropriate.
In one embodiment the E4 region is partially deleted, for example is 95%, 90%, 85%, 80%, 75%,
70%, 65%, 60%, 55%, 50%, 45%, 40%, 35%, 30%, 25%, 20%, 15%, 10% or 5% deleted. In one embodiment the E4 region has the sequence from 32188bp to 29380bp of SEQ ID NO: 12.
In one embodiment B3 is a bond, i.e. wherein E4 is absent.
In one embodiment B3 has the sequence consisting of from 32188bp to 29380bp of SEQ ID NO:
12.
As employed herein number ranges are inclusive of the end points. The skilled person will appreciate that the elements in the formulas herein, such as formula (I), (la), (lb), (lc), (Id) and (le) are contiguous and may embody non-coding DNA sequences as well as the genes and coding DNA sequences (structural features) mentioned herein. In one or more embodiments the formulas of the present disclosure are attempting to describe a naturally occurring sequence in the adenovirus genome. In this context it will be clear to the skilled person that the formula is referring to the major elements characterising the relevant section of genome and is not intended to be an exhaustive description of the genomic stretch of DNA.
E1A, E1B, E3 and E4 as employed herein each independently refer to the wild-type and equivalents thereof, mutated or partially deleted forms of each region as described herein, in particular a wild-type sequence from a known adenovirus.
"Insert" as employed herein refers to a DNA sequence that is incorporated either at the 5' end, the 3' end or within a given DNA sequence reference segment such that it interrupts the reference sequence. The latter is a reference sequence employed as a reference point relative to which the insert is located. In the context of the present disclosure inserts generally occur within either SEQ ID NO: 10 or SEQ ID NO: 11. An insert can be either a restriction site insert, a transgene cassette or both. When the sequence is interrupted the virus will still comprise the original sequence, but generally it will be as two fragments sandwiching the insert.
The skilled person will appreciate that the elements in the formulas herein, such as formula (I), are contiguous and may embody non-coding DNA sequences as well as the genes and coding DNA sequences (structural features) mentioned herein. In one or more embodiments the formulas of the present disclosure are attempting to describe a naturally occurring sequence in the adenovirus genome. In this context it will be clear to the skilled person that the formula is referring to the major elements characterising the relevant section of genome and is not intended to be an exhaustive description of the genomic stretch of DNA.
In one embodiment intraperontoneal delivery of the virus is less immunogenic in terms of antiviral immunogenicity than sub-cutaneous or intramuscular delivery of virus.
Biodistribution as employed herein means the distribution in vivo.
Bioavailability as employed herein means the amount of virus available to perform its intended therapeutic function in vivo.
In one embodiment the method herein wherein at least three doses are administered minimises side- effects and/or toxicity in the patient.
In one embodiment the adenovirus is stealthed by coating said virus with a polymer, for example to at least partially avoid the patient's immune system.
Stealthed as employed herein means that the adenovirus's exterior surface has been modified to avoid the patient's immune response, for example employing a polymer. Examples of suitable polymers are disclosed in WO98/19710, WO00/74722, WO2010/067041, WO2010/067081, and WO2006/008513 incorporated herein by reference.
In one embodiment the oncolytic virus is conjugated to a cytotoxic or immunomodulatory agent.
In one embodiment the oncolytic adenovirus is provided which is pegylated, for example to reduce immunogenenicity and/or increase half-life. In one embodiment the oncolytic adenovirus is employed in the treatment or prevention of metastasis. In one embodiment the virus, formulations and regimens according to the present disclosure are suitable for treating abnormal pre-cancerous cells.
In one embodiment the method or formulation herein is employed in the treatment of drug resistant cancers.
In one embodiment the method or formulation is employed in to sensitise drug resistant to cancers to said drugs.
OVARIAN CANCER TYPES IN MORE DETAIL
In an independent aspect the present disclosure relates to ColoAdl, a formulation of the same or a combination therapy comprising ColoAdl, for use in treating ovarian cancer, for example administering a therapeutically effective amount of ColoAdl to a patient with ovarian cancer, for example employing a dosing regimen described herein.
There are more than 30 different types of ovarian cancer which are classified according to the type of cell from which they start. Cancerous ovarian tumours can start from three common cell types:
· Surface Epithelium - cells covering the lining of the ovaries
• Germ Cells - cells that are destined to form eggs
• Stromal Cells - Cells that release hormones and connect the different structures of the ovaries The present disclosure relates to treatment of ovarian cancer from any source, for example as described herein, in particular epithelium cells. Epithelial ovarian carcinomas (EOCs) account for 85 to 90 percent of all cancers of the ovaries.
Common Epithelial Tumours - Epithelial ovarian tumours develop from the cells that cover the outer surface of the ovary. Most epithelial ovarian tumours are benign (noncancerous). There are several types of benign epithelial tumours, including serous adenomas, mucinous adenomas, and Brenner tumours. Cancerous epithelial tumours are carcinomas - meaning they begin in the tissue that lines the ovaries. These are the most common and most dangerous of all types of ovarian cancers. Unfortunately, almost 70 percent of women with the common epithelial ovarian cancer are not diagnosed until the disease is advanced in stage.
There are some ovarian epithelial tumours whose appearance under the microscope does not clearly identify them as cancerous. These are called borderline tumours or tumours of low malignant potential (LMP tumours). The method of the present disclosure includes treatment of the latter.
Germ Cell Tumours - Ovarian germ cell tumours develop from the cells that produce the ova or eggs. Most germ cell tumours are benign (non-cancerous), although some are cancerous and may be life threatening. The most common germ cell malignancies are maturing teratomas, dysgerminomas, and endodermal sinus tumours. Germ cell malignancies occur most often in teenagers and women in their twenties. Today, 90 percent of patients with ovarian germ cell malignancies can be cured and their fertility preserved.
Stromal Tumours - Ovarian stromal tumours are a rare class of tumours that develop from connective tissue cells that hold the ovary together and those that produce the female hormones, estrogen and progesterone. The most common types are granulosa-theca tumours and Sertoli-Leydig cell tumours. These tumours are quite rare and are usually considered low-grade cancers, with approximately 70 percent presenting as Stage I disease (cancer is limited to one or both ovaries).
Primary Peritoneal Carcinoma-The removal of one's ovaries eliminates the risk for ovarian cancer, but not the risk for a less common cancer called Primary Peritoneal Carcinoma. Primary Peritoneal Carcinoma is closely rated to epithelial ovarian cancer (most common type). It develops in cells from the peritoneum (abdominal lining) and looks the same under a microscope. It is similar in symptoms, spread and treatment.
Stages of Ovarian Cancer
Once diagnosed with ovarian cancer, the stage of a tumour can be determined during surgery, when the doctor can tell if the cancer has spread outside the ovaries. There are four stages of ovarian cancer - Stage I (early disease) to Stage IV (advanced disease). The treatment plan and prognosis (the probable course and outcome of your disease) will be determined by the stage of cancer you have.
Following is a description of the various stages of ovarian cancer:
Stage I - Growth of the cancer is limited to the ovary or ovaries.
Stage IA - Growth is limited to one ovary and the tumour is confined to the inside of the ovary.
There is no cancer on the outer surface of the ovary. There are no ascites present containing malignant cells. The capsule is intact.
Stage IB - Growth is limited to both ovaries without any tumour on their outer surfaces. There are no ascites present containing malignant cells. The capsule is intact.
Stage IC - The tumour is classified as either Stage IA or IB and one or more of the following are present: (1) tumour is present on the outer surface of one or both ovaries; (2) the capsule has ruptured; and (3) there are ascites containing malignant cells or with positive peritoneal washings.
Stage II - Growth of the cancer involves one or both ovaries with pelvic extension.
Stage 11 A. - The cancer has extended to and/or involves the uterus or the fallopian tubes, or both. Stage M B - The cancer has extended to other pelvic organs.
Stage IIC - The tumour is classified as either Stage IIA or M B and one or more of the following are present: (1) tumour is present on the outer surface of one or both ovaries; (2) the capsule has ruptured; and (3) there are ascites containing malignant cells or with positive peritoneal washings.
Stage II I - Growth of the cancer involves one or both ovaries, and one or both of the following are present: (1) the cancer has spread beyond the pelvis to the lining of the abdomen; and (2) the cancer has spread to lymph nodes. The tumour is limited to the true pelvis but with histologically proven malignant extension to the small bowel or omentum.
Stage IMA - During the staging operation, the practitioner can see cancer involving one or both of the ovaries, but no cancer is grossly visible in the abdomen and it has not spread to lymph nodes. However, when biopsies are checked under a microscope, very small deposits of cancer are found in the abdominal peritoneal surfaces. Stage 1MB The tumour is in one or both ovaries, and deposits of cancer are present in the abdomen that are large enough for the surgeon to see but not exceeding 2 cm in diameter. The cancer has not spread to the lymph nodes.
Stage IIIC - The tumour is in one or both ovaries, and one or both of the following is present: (1) the cancer has spread to lymph nodes; and/or (2) the deposits of cancer exceed 2 cm in diameter and are found in the abdomen.
Stage IV - This is the most advanced stage of ovarian cancer. Growth of the cancer involves one or both ovaries and distant metastases (spread of the cancer to organs located outside of the peritoneal cavity) have occurred. Finding ovarian cancer cells in pleural fluid (from the cavity which surrounds the lungs) is also evidence of stage IV disease.
In one embodiment the ovarian cancer is: type I, for example IA, IB or IC; type II, for example MA, MB or IIC; type III, for example MIA, 1MB or IMC; or type IV.
The present disclosure relates to treatment of any stage of ovarian cancer, in particular as described herein.
In one embodidment the cancer is peritoneal cancer. As employed herein peritoneal cancer is cancer which started in the peritoneal.
The peritoneum is a layer of thin tissue that lines the abdomen and covers all of the organs within it, such as the bowel and the liver. The peritoneum protects the organs and acts as a barrier to infection. It has 2 layers. One layer lines the abdominal wall and is called the parietal layer. The other layer covers the organs and is called the visceral layer. There is a small amount of fluid between the two layers, which separates them and allows them to slide over each other. This fluid allows us to move around without causing any friction on the layers
In one embodiment the peritoneal cancer is primary peritoneal cancer (PPC), which is a rare cancer of the peritoneum. It is very similar to the most common type of ovarian cancer called epithelial cancer. This is because the lining of the abdomen and the surface of the ovary come from the same tissue when we develop from embryos in the womb.
The staging system for PPCs is the same as for ovarian cancers but there is no early stage. PPC is always either stage 3 or stage 4. This is an advanced cancer. PPC does sometimes affect the ovaries but to be a PPC it must only be on the surface of the ovary.
PPC is a cancer that mainly affects women. There are no exact numbers for how many people get it in the UK. Research suggests that between 7 and 15 out of 100 women (7 to 15%) who have advanced ovarian cancer will actually have PPC. It is very rare in men. Most people are over the age of 60 when they are diagnosed.
The causes of PPC are unknown. Most cancers are caused by a number of different factors working together. Research suggests that a very small number of PPCs may be linked to an inherited faulty gene. This is the same gene that increases the risk of ovarian cancer and breast cancer. You can find out more about this gene, called the BRCA gene, on the ovarian cancer risks and causes page.
In one embodiment the peritoneal cancer is mesothelioma, which is another rare type of cancer that can develop in the peritoneum. We have separate information about mesothelioma in the cancer types section. In one embodiment the cancer is peritoneal carcinomatosis, which is the spread of metastases into the peritoneum, usually from ovarian and colorectal cancers. The occurrence of peritoneal carcinomatosis has been shown to significantly decrease overall survival in patients with liver and/or extraperitoneal metastases from gastrointestinal cancer. Therefore the patient population with this cancer are generally at high risk. Thus in one embodiment there is provided treatment of a new patient population with or at risk of peritoneal carcinomatosis.
Fallopian tube cancer is cancer which starts in this tissue as opposed to cancer that simply spreads from other tissue such as ovaries. The most common form is adenocarcinoma, which is starts in epithelial cells. Other forms of fallopian tube cancer include transitional cell cancer and sarcoma.
FURTHER THERAPY
In one embodiment the virus is administered in combination with the administration of a further cancer treatment or therapy.
"In combination" as employed herein is intended to encompass where the oncolytic virus is administered before, concurrently and/or post cancer treatment or therapy.
In one embodiment the oncolytic adenovirus is employed in combination with high intensity focused ultrasound (HIFU) treatment.
Cancer therapy includes surgery, radiation therapy, targeted therapy and/or chemotherapy.
Cancer treatment as employed herein refers to treatment with a therapeutic compound or biological agent, for example an antibody intended to treat the cancer and/or maintenance therapy thereof.
In one embodiment the cancer treatment is selected from any other anti-cancer therapy including a chemotherapeutic agent, a targeted anticancer agent, radiotherapy, radio-isotope therapy or any combination thereof.
In a further independent aspect the present disclosure relates to a combination therapy comprising oncolytic type B adenovirus, such as ColoAdl, and a chemotherapeutic agent which does not interfere with the adenovirus activity. Type B adenovirus, such as ColoAdl as employed herein includes formulations thereof, for example pharmaceutical formulations thereof.
Activity as employed herein refers to any beneficial property or characteristic of the virus, for example the oncolytic activity and or the ability of the virus to replicate in cancer cells, such as viral replication in vivo.
In one embodiment the EnAd in the combination therapy is dosed according to a regimen described herein.
Generally, the combination therapy will be provided as a formulation of the adenovirus and a formulation of the chemotherapeutic agent. Thus the administration of the adenovirus and the chemotherapeutic will suitably be separate events. These administrations may be on the same or different days.
The oncolytic adenovirus may be used as a pre-treatment to the therapy, such as a surgery (neoadjuvant therapy), to shrink the tumour, to treat metastasis and/or prevent metastasis or further metastasis. The oncolytic adenovirus may be used after the therapy, such as a surgery (adjuvant therapy), to treat metastasis and/or prevent metastasis or further metastasis. Concurrently as employed herein is the administration of the additional cancer treatment at the same time or approximately the same time as the oncolytic adenovirus formulation. The treatment may be contained within the same formulation or administered as a separate formulation.
In one embodiment the virus is administered in combination with the administration of a chemotherapeutic agent, for example as described herein, such as paclitaxel, abraxane or similar.
Chemotherapeutic agent as employed herein is intended to refer to specific antineoplastic chemical agents or drugs that are selectively destructive to malignant cells and tissues. For example alkylating agents, antimetabolites, anthracyclines, plant alkaloids, topoisomerase inhibitors, and other antitumour agents. Other examples of chemotherapy include doxorubicin, 5-fluorouracil (5-FU), paclitaxel, capecitabine, irinotecan, and platins such as cisplatin and oxaliplatin. The preferred dose may be chosen by the practitioner based on the nature of the cancer being treated.
Surprisingly the present inventors have established that certain classes of therapeutic agents can inhibit viral replication, for example topoisomerase or parp inhibitors, may inhibit the replication of the virus in vivo. Given it is thought to be desirable to establish a viral infection in a cancer cell such that the virus can replicate, then co-administration of compounds that inhibit viral replication is likely to be undesirable.
In one embodiment the chemotherapeutic agent is not an enzyme inhibitor. Thus in one embodiment the combination therapy does not employ a topoisomerase inhibitor.
In one embodiment he chemotherapeutic agent is not a parp inhibitor.
In one embodiment the combination therapy employs a platinum containing chemotherapeutic agent, for example cisplatin, carboplatin or oxaliplatin.
In one embodiment the combination employs a microtubule inhibitor, for example vincristine sulphate, epothilone A, N-[2-[(4-Hydroxyphenyl)amino]-3-pyridinyl]-4-methoxybenzenesulfonamide (ABT-751), ataxol derived chemotherapeutic agent, for example paclitaxel, abraxane, or docetaxel or a combination thereof.
In one embodiment the combination employs an mTor inhibitor. Examples of mTor inhibitors include: everolimus (RAD001), WYE-354, KU-0063794, papamycin (Sirolimus), Temsirolimus, Deforolimus(MK- 8669), AZD8055 and BEZ235(NVP-BEZ235).
In one embodiment the combination employs a Pi3 Kinase inhibitor. Examples of Pi3 kinases inhibitors include: GDC-0941, ZSTK474, PIK-90, LY294002, TG100-115, XL147, GDC-0941, ZSTK474, PIK-90,
LY294002, TG100-115, XL147, AS-605240, PIK-293, AZD6482, PIK-93, TGX-221, IC-87114, AS-605240, PIK-293, AZD6482, PI K-93, TGX-221, IC-87114 and compounds disclosed in WO2011/048111 incorporated herein by reference including 2-((4-Amino-3-(3-hydroxyphenyl)-lH-pyrazolo[3,4- c/]pyrimidin-l-yl)methyl)-3-(2-chlorobenzyl)-5-ethynylquinazolin-4(3H)-one; 2-((4-Amino-3-(3- hydroxyphenyl)-lH-pyrazolo[3,4- ]pyrimidin-l-yl)methyl)-3-(2-chlorobenzyl)-5-(3-(2-(2- methoxyethoxy)ethoxy)prop-l-yn-l-yl)quinazolin-4(3H)-one; 2-((4-Amino-3-(3-hydroxyphenyl)-lH- pyrazolo[3,4-d]pyrimidin-l-yl)methyl)-3-(2-chlorobenzyl)-5-(6-morpholino-6-oxohex-l-yn-l- yl)quinazolin-4(3H)-one; 6-(2-((4-Amino-3-(4-hydroxyphenyl)-lH-pyrazolo[3,4- /]pyrimidin-l-yl)methyl)- 3-(2-chlorobenzyl)-4-oxo-3,4-dihydroquinazolin-5-yl)hex-5-ynoic acid; 2-((4-Amino-3-(4-hydroxyphenyl) -lH-pyrazolo[3,4-ci]pyrimidin-l-yl)methyl)-3-(2-chlorobenzyl)-5-(6-morpholino-6-oxohex-l-yn-l- yl)quinazolin-4(3H)-one; 3-((2-((4-Amino-3-(3-hydroxyphenyl)-lH-pyrazolo[3,4-cf]pyrimidin-l- yl)methyl)-5-(3-(2-(2-hydroxyethoxy)ethoxy)prop-l-yn-l-yl)-4-oxoquinazolin-3(4H)-yl)methyl) benzonitrile; 2-((4-amino-3-(3-hydroxyphenyl)-lH-pyrazolo[3,4-d]pyrimidin-l-yl)methyl)-3-(2- chlorobenzyl)-5-(3-(2-morpholinoethoxy)prop-l-ynyl)quinazolin-4(3H)-one; 2-((4-Amino-3-(4- hydroxyphenyl)-lH-pyrazolo[3,4- /]pyrimidin-l-yl)methyl)-3-(2-chloro
benzyl)-5-ethynylquinazolin-4(3H)-one; 2-((4-Amino-3-(3-hydroxyphenyl)-lH-pyrazolo[3,4-cf]pyrimidin-
1- yl)methyl)-3-(3-chlorobenzyl) -5-ethynylquinazolin-4(3H)-one; 2-((4-Amino-3-(4-hydroxyphenyl)-lH- pyrazolo[3,4- /]pyrimidin-l-yl)methyl)-3-(3-chlorobenzyl) -5-ethynyl quinazolin-4(3H)-one; 2-((4-Amino- 3-(3-hydroxyphenyl)-lH-pyrazolo[3,4-cf]pyrirnidin-l-yl)methyl)-5-ethynyl-3-(2-fluorobenzyl)quinazolin- 4(3H)-one; 2-((4-Amino-3-(4-hydroxy phenyl)-lH-pyrazolo[3,4-cf]pyrimidin-l-yl)methyl)-5-ethynyl-3-(2- fluorobenzyl) quinazolin-4 (3H)-one; 2-((4-Amino-3-(4-hydroxyphenyl)-lH-pyrazolo[3,4-c ]pyrimidin-l- yl)methyl)-5-ethynyl-3-(3-methoxybenzyl)quinazolin-4(3H)-one; 2-((4-Amino-3-(3-hydroxyphenyl)-lH- pyrazolo[3,4-cf]pyrimidin-l-yl)methyl)-5-ethynyl-3-(3-methoxybenzyl) quinazolin-4(3H)-one; 2-((4- Amino-3-(4-hydroxyphenyl)-lH-pyrazolo[3,4- ]pyrimidin-l-yl)methyl)-5-ethynyl-3-(3-(tri- fluoromethyl)benzyl)quinazolin-4(3H)-one; 2-((4-Amino-3-(3-hydroxyphenyl)-lH-pyrazolo[3,4- d]pyrimidin-l-yl)methyl)-5-ethynyl-3-(3-(trifluoromethyl) benzyl )quinazolin-4(3H)-one; 2-((4-Amino-3- (4-hydroxyphenyl)-lH-pyrazolo[3,4-d]pyrimidin-l-yl)methyl)-3-(4-chlorobenzyl) -5-ethynyl quinazolin- 4(3H)-one; 2-((4-Amino-3-(3-hydroxyphenyl)-lH-pyrazolo[3,4-ci]pyrimidin-l-yl)methyl)-5-ethynyl-3-(4- (methylsulfonyl) benzyl)quinazolin-4(3H)-one; 2-((4-Amino-3-(4-hydroxyphenyl)-lH-pyrazolo[3,4- d]pyrimidin-l-yl)methyl)-5-ethynyl-3-(4-(methyl-sulfonyl)benzyl)quinazolin-4(3H)-one; 2-((4-Amino-3- (3-hydroxyphenyl)-lH-pyrazolo[3,4-d]pyrimidin-l-yl)methyl)-5-ethynyl-3-(4-(trifluoromethyl) benzyl)quinazolin-4(3H)-one; 3-((2-((4-Amino-3-(4-hydroxyphenyl)-lH-pyrazolo[3,4-cf]pyrimidin-l- yl)methyl)-5-ethynyl-4-oxo-quinazolin-3(4H)-yl)methyl) benzonitrile; 2-((4-Amino-3-(3-hydroxyphenyl)- lH-pyrazolo[3,4-cf]pyrimidin-l-yl)methyl)-5-ethynyl-3-(3-(rnethyl-sulfonyl)benzyl)quinazolin-4(3H)-one; 3-((2-((4-Arnino-3-(3-hydroxyphenyl)-lH-pyrazolo[3,4-d]pyrimidin-l-yl)rnethyl)-5-ethynyl-4-oxo- quinazolin-3(4H)-yl)methyl)benzonitrile; 2-((4-Amino-3-(3-hydroxyphenyl)-lH-pyrazolo[3,4- d]pyrimidin-l-yl)methyl)-3-(4-chlorobenzyl) -5-ethynylquinazolin-4(3H)-one; 2-((4-Amino-3-(3- hydroxyphenyl)-lH-pyrazolo[3,4-c ]pyrimidin-l-yl)methyl)-3-(4-chlorobenzyl) -5-(3-methoxy-prop-l- ynyl)quinazolin-4(3H)-one; 2-((4-Amino-3-(4-hydroxyphenyl)-lH-pyrazolo[3,4-c/]pyrimidin-l-yl)methyl)- 3-(3-methoxybenzyl)-5-(3-methoxyprop-l-ynyl) quinazolin-4(3H)-one; 2-((4-Amino-3-(4- hydroxyphenyl)-lH-pyrazolo[3,4- ]pyrimidin-l-yl)methyl)-3-(2-chlorobenzyl) -5-(3-methoxyprop-l- ynyl)quinazolin-4(3H)-one; 2-((4-Amino-3-(4-hydroxyphenyl)-lH-pyrazolo[3,4-d]pyrimidin-l-yl)methyl)- 5-ethynyl-3-(4-(trifluoro methyl)benzyl)quinazolin-4(3H)-one; 2-((4-Amino-3-(3-hydroxyphenyl)-lH- pyrazolo[3,4- /]pyrimidin-l-yl)methyl)-3-(2-chlorobenzyl)-5-(3-(2-methoxyethoxy)prop-l- ynyl)quinazolin-4(3H)-one; 2-((4-Amino-3-(3-hydroxyphenyl)-lH-pyrazolo[3,4- ]pyrimidin-l-yl)methyl)- 5-ethynyl-3-((5-methylisoxazol-3-yl)methyl)quinazolin-4(3H)-one; 2-((4-Amino-3-(4-hydroxyphenyl)-lH- pyrazolo[3,4- /]pyrimidin-l-yl)methyl)-5-ethynyl-3-((5-methylisoxazol-3-yl)rnethyl)quinazolin-4(3H)-one;
2- ((4-Amino-3-(4-hydroxyphenyl)-l/-/-pyrazolo[3,4-cf]pyrimidin-l-yl)methyl)-3-(3-chloro-2-fluoro- benzyl)-5-ethynylquinazolin-4(3H)-one; 2-((4-Amino-3-(4-hydroxyphenyl)-lH-pyrazolo[3,4-c ]pyrimidin- l-yl)methyl)-3-(2,6-difluorobenzyl)-5-ethynylquinazolin-4(3H)-one; 2-((4-Amino-3-(4-hydroxyphenyl)- lH-pyrazolo[3,4-cf]pyrimidin-l-yl)methyl)-3-(4-chloro-2-fluorobenzyl)-5-ethynylquinazolm
2- ((4-Amino-3-(3-fluoro-4-hydroxyphenyl)-lH-pyrazolo^
5-ethynylquinazolin-4(3H)-one; 2-((4-Amino-3-(3-hydroxyphenyl)-lH-pyrazolo[3,4-c/]pyrimidin-l- yl)methyl)-5-(3-methoxyprop-l-ynyl)-3-(3-(trifluoromethyl)benzyl)quinazolin-4(3H)-one; 2-((4-Amino- 3-(4-hydroxyphenyl)-lH-pyrazolo[3,4-d]pyrimidin-l-yl)methyl)-5-ethynyl-3-(4-fluorobenzyl) quinazolin- 4(3H)-one; 2-((4-Amino-3-(4-hydroxyphenyl)-lH-pyrazolo[3,4-d]pyrimidin-l-yl)methyl)-3-(2- chlorobenzyl)-5-(3-cyclopentylprop-l-ynyl)quinazolin-4(3H)-one; 2-((4-Amino-3-(4-hydroxyphenyl)-lH- pyrazolo[3,4-d]pyrimidin-l-yl)methyl)-5-(3-(benzyloxy)prop-l-ynyl)-3-(2-chloro-benzyl)quinazolin- 4(3H)-one; 2-((4-Amino-3-(4-hydroxyphenyl)-lH-pyrazolo[3,4-d]pyrimidin-l-yl)rnethyl)-3-(2- chlorobenzyl) -5-(5-hydroxypent-l-ynyl)quinazolin-4(3H)-one; 2-((4-Amino-3-(4-hydroxyphenyl)-lH- pyrazolo[3,4-d]pyrimidin-l-yl)methyl)-5-ethynyl-3-(2-fluoro-5-methoxybenzyl)quinazolin-4(3H)-on 2- ((4-Amino-3-(4-hydroxyphenyl)-lH-pyrazolo[3,4-d]pyrimidin-l-yl)methyl)-3-(3,4-dichlorobenzyl)-5- ethynylquinazolin-4(3H)-one; 2-((4-Amino-3-(4-hydroxyphenyl)-l/-/-pyrazolo[3,4-d]pyrimidin-l- yl)methyl)-3-benzyl-5-ethynylquinazolin-4(3H)-one; 2-((4-Amino-3-(4-hydroxyphenyl)-lH-pyrazolo[3,4- d]pyrimidin-l-yl)methyl)-5-ethynyl-3-(2-trifluoromethylbenzyl)quinazolin-4(3H)-one; 2-((4-Amino-3-(4- hydroxyphenyl)-lH-pyrazolo[3,4-d]pyrimidin-l-yl)methyl)-5-ethynyl-3-(4-methoxybenzyl)quinazolin 4(3H)-one; 4-((2-((4-Amino-3-(4-hydroxyphenyl)-lH-pyrazolo[3,4-ci]pyrimidin-l-yl)methyl)-5-ethynyl-4- oxoquinazolin-3(4H)-yl)methyl) benzonitrile; 2-((4-Amino-3-(4-hydroxyphenyl)-lH-pyrazolo[3,4- d]pyrimidin-l-yl)methyl)-5-ethynyl-3-(2-fluoro-4-methoxybenzyl)quinazolin-4(3H)-one; l-(3-(2-((4- Amino-3-(4-hydroxyphenyl)-lH-pyrazolo[3,4-d]pyrimidi^
dihydroquinazolin-5-yl)prop-2-ynyl)urea; 2-((4-Amino-3-(3-hydroxyphenyl)-lH-pyrazolo[3,4- d]pyrimidin-l-yl)methyl)-3-(2-fluorobenzyl)-5-(3-(2-(2-methoxyethoxy)ethoxy)prop-l-ynyl)quinazolin- 4(3H)-one; 2-((4-Amino-3-(4-fluoro-3-hydroxyphenyl)-lH-pyrazolo[3,4-d]pyrimidin-l-yl)methyl)-3-(2- chlorobenzyl)-5-ethynyl-quinazolin-4(3H)-one; 2-((4-Amino-3-(4-hydroxyphenyl)-lH-pyrazolo[3,4- d]pyrimidin-l-yl)methyl)-3-(2-chlorobenzyl)-5-(3-phenoxyprop-l-ynyl)quinazolin-4(3H)-one; 2-((4- Amino-3-(4-hydroxyphenyl)-lH-pyrazolo[3,4-d]pyrim^
morpholino-6-oxohex-l-yn-l-yl)quinazolin-4(3H)-one; 6-(2-((4-Amino-3-(3-hydroxyphenyl)-lH- pyrazolo[3,4-d]pyrimidin-l-yl)methyl)-3-(2-chlorobenzyl)-4-oxo-3,4-dihydroquinazolin-5-yl)-W^ methoxyethyl)hex-5-ynamide; 2-((4-Amino-3-(3-hydroxyphenyl)-l/-/-pyrazolo[3,4-d]pyrimidin-l- yl)methyl)-3-(2 hlorobenzyl)-5-(7-morpholino-7-oxohept-l-yn-l-yl)quinazolin-4(3H)-one; 2-((4-Amino-
3- (3-hydroxyphenyl)-lH-pyrazolo[3,4-d]pyrimidin-l-yl)methyl)-3-(2-chlorobenzyl)-5-(5-morpholin oxopent-l-yn-l-yl)quinazolin-4(3H)-one; 2-((4-Amino-3-(3-hydroxyphenyl)-lH-pyrazolo[3,4- d/pyrimidin-l-yl)methyl)-3-((5-methylpyrazin-2-yl)m
yl)quinazolin-4(3H)-one; 2-((4-Amino-3-(4-hydroxyphenyl)-lH-pyrazolo[3,4-d]pyrimidin-l-yl)methyl)-3- (2-chlorobenzyl)-5-(6-oxo-6-(piperidin-l-yl)hex-l-yn-l-yl)quinazolin-4(3H)-one; 6-(2-((4-Amino-3-(4- hydroxyphenyl)-lH-pyrazolo[3,4-d]pyrimidin-l-yl)methyl)-3-(2-chlorobenzyl)-4-oxo-3,4- dihydroquinazolin-S-ylJ-^/V-diethylhex-S-ynamide; 7-(2-((4-Amino-3-(3-hydroxyphenyl)-lH- pyrazolo[3,4-d]pyrimidin-l-yl)methyl)-3-(2-chloro-benzyl)-4-oxo-3,4-dihydroquinazolin-5-yl)h ynoic acid; 2-Acetamido-N-(3-(2-((4-amino-3-(3-hydroxyphenyl)-lH-pyrazolo[3,4- /]pyrimidin-l- yl)methyl)-3-(2-chlorobenzyl)-4-oxo-3,4-dihydroquinazolin-5-yl)prop-2-yn-l-yl)acetamide; 2-((4-Amino- 3- (4-hydroxyphenyl)-lH-pyrazolo[3,4-d]pyrimidin-l-yl)me
benzyl)-5-(6-morpholino-6-oxohex-l-yn-l-yl)quinazolin-4(3H)-one; 2-((4-Amino-3-(4-hydroxyphenyl)- lH-pyrazolo[3,4-cf]pyrimidin-l-yl)methyl)-3-(2-methoxy phenethyl)-5-(6-morpholino-6-oxohex-l-yn-l- yl)quinazolin-4(3H)-one; 2-((4-Amino-3-(4-hydroxyphenyl)-lH-pyrazolo[3,4-c/]pyrimidin-l-yl)methyl)-3- (benzo[6]thiophen-2-ylmethyl)-5-(6-morpholino-6-oxohex-l-yn-l-yl)quinazolin-4(3H)-one; 2-((4- Amino-3-(4-hydroxyphenyl)-lH-pyrazolo[3,4-ci]pyrimidin-l-yl)methyl)-3-(2-fluoro-3-methoxyb
(6-morpholino-6-oxohex-l-yn-l-yl)quinazolin-4(3H)-one; Methyl 3-((2-((4-amino-3-(3-hydroxyphenyl)- lH-pyrazolo[3,4-d]pyrimidin-l-yl)methyl)-5-(6-morph
yl)methyl)benzoate; 2-((4-Amino-3-(3-hydroxyphenyl)-lH-pyrazolo[3,4- /]pyrimidin-l-yl)methyl)-3-((l- methyl-lH-pyrazol-4-yl)methyl)-5-(6-morpholino-6-oxohex-l-yn-l-yl) quinazolin-4(3H)-one; 2-((4- Amino-3-(3-hydroxyphenyl)-lH-pyrazolo[3,4-c |pyrimidin-l-yl)methyl)-3-(benzofuran-5-ylme morpholino-6-oxohex-l-yn-l-yl)quinazolin-4(3H)-one; 2-((4-Amino-3-(3-hydroxyphenyl)-lH- pyrazolo[3,4-d]pyrimidin-l-yl)methyl)-3-((2-methylthiazol-4-yl)methyl)-5-(6-morpholino-6-ox l-yl)quinazolin-4(3H)-one; 2-((4-Amino-3-(3-hydroxyphenyl)-lH-pyrazolo[3,4-ci]pyrimidin-l-yl)methyl)- 3-(2-chlorobenzyl)-5-(6-(4-methylpiperazin-l-yl)-6-oxohex-l-yn-l-yl)quinazolin-4(3H)-one; 2-((4- Amino-3-(3-hydroxyphenyl)-lH-pyrazolo[3,4-d]pyrimidin-l-yl)methyl)-3-(2-chlorobenzyl)-5-(6-(4- morpholinopiperidin-l-yl)-6-oxohex-l-yn-l-yl)quinazolin-4(3H)-one; 5-(6-(4-Acetylpiperazin-l-yl)-6- oxohex-l-yn-l-yl)-2-((4-amino-3-(4-hydroxyphenyl)-lH-pyrazolo[3,4-c/]pyrimidin-l-yl)methyl)-3-(2- chlorobenzyl)quinazolin-4(3H)-one; /V-(4-(2-((4-Amino-3-(3-hydroxyphenyl)-lH-pyrazolo[3,4- d]pyrimidin-l-yl)methyl)-3-(2-chlorobenzyl)-4-oxo
4- carboxamide; 5-(6-(4-Acetyl-piperazin-l-yl)-6-oxohex-l-yn-l-yl)-2-((4-amino-3-(4-hydroxyphenyl)-lH- pyrazolo[3,4-d]pyrimidin-l-yl)methyl)-3-(2-chlorobenzyl)quinazolin-4(3H)-one; A/-(4-(2-((4-Amino-3-(3- hydroxyphenyl)-lH-pyrazolo[3,4- ]pyrimidin-l-yl)methyl)-3-(2-chlorobenzyl)-4-oxo-3,4- dihydroquinazolin-5-yl)but-3-yn-l-yl)morpholine-4-carboxamide; 2-((4-Amino-3-(4-hydroxy-phenyl)- lH-pyrazolo[3,4-d]pyrimidin-l-yl)methyl)-5-(5-(bis(2-methoxyethyl) amino)pent-l-ynyl)-3-(2- chlorobenzyl)quinazolin-4(3H)-one; 6-(2-((4-Amino-3-(4-hydroxyphenyl)-lH-pyrazolo[3,4-cf]pyrimidin- l-yl)methyl)-3-(2-chlorobenzyl)-4-oxo-3,4-dihydroquinazolin-5-yl)-/V-cyclopentylhex-5-ynamide; 6-(2- ((4-Amino-3-(4-hydroxyphenyl)-lH-pyrazolo[3,4-d]pyrimidin-l-yl)methyl)-3-(2-chlorobenzyl)-4-oxo-3,4- dihydroquinazolin-5-yl)-/V-(tetrahydro-2H-pyran-4-yl)hex-5-ynamide; 6-(2-((4-Amino-3-(4- hydroxyphenyl)-lH-pyrazolo[3,4-c 7pyrimidin-l-yl)methyl)-3-(2-chlorobenzyl)-4-oxo-3,4- dihydroquinazolin-5-yl)-A/-(2-morpholinoethyl)hex-5-ynamide; 2-((4-Amino-3-(4-hydroxy phenyl)-lH- pyrazolo[3,4-d]pyrimidin-l-yl)methyl)-3-(2-chlorobenzyl)-5-(6-(4-(2-methoxyethyl)piperazin-l-yl)-6- oxohex-l-ynyl)quinazolin-4(3H)-one; 6-(2-((4-Amino-3-(4-hydroxyphenyl)-lH-pyrazolo[3,4-d]pyrimidin- l-yl)methyl)-3-(2 hlorobenzyl)-4-oxo-3,4-dihydroquinazolin-5-yl)-Ay-(2-(dimethylamino)ethyl)hex-5- ynamide; 6-(2-((4-Amino-3-(4-hydroxyphenyl)-lH-pyrazolo[3,4-cf]pyrimidin-l-yl)methyl)-3-(2- chlorobenzyl)-4-oxo-3,4-dihydroquinazolin-5-yl)-A/-(pyridin-4-yl)hex-5-ynamide; 6-(2-((4-Amino-3-(3- hydroxyphenyl)-lH-pyrazolo[3,4-c ]pyrimidin-l-yl)methyl)-3-(2-chlorobenzyl)-4-oxo-3,4- dihydroquinazolin-5-yl)-A/-(pyridin-4-yl)hex-5-ynamide; 2-((4-Amino-3-(4-hydroxyphenyl)-lH- pyrazolo[3,4-d]pyrimidin-l-yl)methyl)-3-(2-chloro
oxohex-l-ynyl)quinazolin-4(3H)-one; 6-(2-((4-Amino-3-(4-hydroxyphenyl)-lH-pyrazolo[3,4- ]pyrimidin- l-yl)methyl)-3-(2 hlorobenzyl)-4-oxo
ynamide; 6-(2-((4-Amino-3-(3-hydroxyphenyl)-lH-pyrazoto
chlorobenzyl)-4-oxo-3,4-dihydroquinazolin-5-yl)-W,A/-bis(2-methoxy 6-(2-((4- Amino-3-(4-hydroxyphenyl)-lH-pyrazolo[3,4-d]pyrimidin-l-yl)methyl)-3-(2 hlorobe
dihydroquinazolin-5-yl)-A/-(2-(4-methylpiperazin-l-yl)ethyl)hex-5-ynamide; 6-(2-((4-Amino-3-(4- hydroxyphenyl)-lH-pyrazolo[3,4- ]pyrimidin-l-yl)methyl)-3-(2-chlorobenzyl)-4-oxo-3,4- dihydroquinazolin-5-yl)-A/-methyl-W-(2-(4-methylpiperazm^ 6-(2-((4-Amino-3- (4-hydroxyphenyl)-lH-pyrazolo[3,4-d]pyrimidin-l-yl)methyl)-3-(2-chlorobenzyl) -4-oxo-3,4- dihydroquinazolin-5-yl)-/V-isopropylhex-5-ynamide; 6-(2-((4-Amino-3-(3-hydroxyphenyl)-lH- pyrazolo[3,4-d]pyrimidin-l-yl)methyl)-3-(2-chto
isopropylhex-5-ynamide; 6-(2-((4-Amino-3-(4-hydroxyphenyl)-lH-pyrazolo[3,4-c ]pyrimidin-l- yl)methyl)-3-(2-chlorobenzyl)-4-oxo-3,4-dihydroquinazolin-5-yl)-/V^ 2-((4- Amino-3-(4-hydroxyphenyl)-lH-pyrazolo[3,4-c/]py^
(pyrrolidin-l-yl)hex-l-yn-l-yl)quinazolin-4(3H)-one; 6-(2-((4-Amino-3-(4-hydroxyphenyl)-lH- pyrazolo[3,4-d]pyrimidin-l-yl)methyl)-3-(2-chlorobenzyl)-4-oxo-3,4-dihydroquinazolin-^
(pyrrolidin-3-yl)hex-5-ynamide; 2-((4-Amino-3-(4-hydroxyphenyl)-lH-pyrazolo[3,4-d]pyrimidin-l- yl)methyl)-3-(2-chlorobenzyl)-5-(6-(3-(dimethylamino)pyrrol^
one; 2-((4-Amino-3-(3-hydroxyphenyl)-lH-pyrazolo[3,4-d]pyrimidin-l-yl)methyl)-3-(2-chlorobenzyl)-5- (6-(3-(dimethylamino)pyrrolidin-l-yl)-6-oxohex-l-ynyl)quinazolin-4(3H)-one; 2-((4-Amino-3-(4- hydroxyphenyl)-lH-pyrazolo[3,4-c ]pyrimidin-l-yl)methyl)-3-(2-chlorobenzyl) -5-(6-(4-methyl-l,4- diazepan-l-yl)-6-oxohex-l-ynyl)quinazolin-4(3H)-one; 2-((4-Amino-3-(3-hydroxyphenyl)-lH- pyrazolo[3,4-ci]pyrimidin-l-yl)methyl)-3-(2-chlorobenzyl) -5-(6-(4-methyl-l,4-diazepan-l-yl)-6-oxohex- l-ynyl)quinazolin-4(3H)-one, 2-((4-Amino-3-(4-hydroxy-3-methoxyphenyl)-lH-pyrazolo[3,4- d]pyrimidin-l-yl)methyl)-3-(2 hlorobenzyl)-5-(6-morpholino-6-oxohex-l-ynyl)quinazolin-4(3H)-one or a pharmaceutically acceptable salt thereof, including all stereoisomers, tautomers and isotopic derivatives thereof
In one embodiment the combination employs a MEK inhibitor. Examples of MEK inhibitors include: AS703026, CI-1040 (PD184352), AZD6244 (Selumetinib), PD318088, PD0325901, AZD8330, PD98059, U0126-EtOH, BIX 02189 or BIX 02188.
In one embodiment the combination employs an AKT inhibitor. Examples of AKT inhibitors include: MK-2206 and AT7867.
In one embodiment the combination employs an aurora kinase inhibitor. Examples of aurora kinase inhibitors include: Aurora A Inhibitor I, VX-680, AZD1152-HQPA(Barasertib), SNS-314 Mesylate, PHA- 680632, ZM-447439, CCT129202 and Hesperadin.
In one embodiment the combination employs a p38 inhibitor, for example as disclosed in WO2010/038086, such as /V-[4-({4-[3-(3-tert-Butyl-l-p-tolyl-lH-pyrazol-5-yl)ureido]naphthalen-l- yloxy}methyl)pyridin-2-yl]-2-methoxyacetamide.
In one embodiment the combination employs a Bcl-2 inhibitor. Examples of Bcl-2 inhibitors include: obatoclax mesylate, ABT-737, ABT-263(navitoclax) and TW-37. In one embodiment the combination employs an antimetabolite. Examples of an antimetabolite include: capecitabine (xeloda), fludarabine phosphate, fludarabine(fludara), decitabine, raltitrexed(tomudex), gemcitabine hydrochloride and cladribine.
In one embodiment the therapeutic agent is ganciclovir, which may assist in controlling immune responses and/or tumour vasculation.
In one embodiment one or more therapies employed in the method herein are metronomic, that is a continuous or frequent treatment with low doses of anticancer drugs, often given concomitant with other methods of therapy.
Subgroup B oncolytic adenoviruses, in particular Adll and those derived therefrom such as ColoAdl may be particularly synergistic with chemotherapeutics because they seem to have a mechanism of action that is largely independent of apoptosis, killing cancer cells by a predominantly necrolytic mechanism. Moreover, the immunosuppression that occurs during chemotherapy may allow the oncolytic virus to function with greater efficiency.
In one embodiment the chemotherapeutic agent is administered parenterally.
In one embodiment the chemotherapeutic agent is administered separately to the virus, either temporally or by an alternate method of administration or both. Treatment can be concurrent or sequential.
In one embodiment the cancer treatment is a targeted agent, for example a monoclonal antibody such as bevacizumab, cetuximab or panitumumab or antibody conjugate, such as an antibody drug conjugate, in particular of the type where the antibody or binding fragment is linked to a toxin.
In one embodiment the cancer treatment is an immunotherapeutic agent, for example ipilimumab or other anti-CTLA4, anti-PD-1, anti-PD-Ll, or other checkpoint inhibitors, or a cytokine or a cytokine analogue.
Checkpoint inhibitor as employed herein is intended to refer to agents that inhibit signalling from T-cell membrane proteins that act to inhibit or downregulate T-cell activation and function.
In one embodiment the virus is administered in combination with the administration of radiotherapy.
Radiotherapy as employed herein is intended to refer to the medical use of ionising radiation.
Cancer cells are generally undifferentiated and stem cell-like; they reproduce more than most healthy differentiated cells, and have a diminished ability to repair sub-lethal damage. DNA damage is then passed on through cell division; damage to the cancer cells' DNA accumulates, causing them to die or reproduce more slowly.
In one embodiment the radiotherapy is administered concurrently.
In one embodiment the radiotherapy is administered sequentially.
In one embodiment the virus is administered in combination with therapy complimentary to the cancer therapy, for example a treatment for cachexia, such as cancer cachexia, for example S-pindolol, S- mepindolol or S-bopindolol. Suitable doses may be in the range of 2.5mg to lOOmg, such as 2.5mg to 50mg per day provided a single dose or multiple doses given as multiple doses administered during the day. In one embodiment the virus is administered in combination with the administration of one or more prophylactic agents, for example selected from an antipyretic, an antihistamine, an antiemetic, an antidiarrheal, steroid and an analgesic.
Antipyretics include aspirin and non-steroidal anti-inflammatories, for example ibuprofen, naproxen and ketoprofen.
Antihistamines include acrivastine, azalastine, brompheniramine, buclizine, bromodiphenhydramine, carbinoxamine, cetirizine, chlorpromazine, cyclizine, chlorpheniramine, chlorodiphenhydramine, clemastine, cyproheptadine, desloratadine, dexbrompheniramine, deschlorpheniramine, dexchlorpheniramine, dimenhydrinate, dimetindene, diphenhydramine, doxylamine, ebstine, embramine, fexofenadine, levocetirizine, loratadine, meclizine, mirtazapinem olopatadrine, pheninidamine, pheniramine, phenyltoloxamine, promethazine, pyrilamine, quetiapine, rupatadine, tripelennamine and triprolidine.
Antiemetics include dolasetron, granietron, ondansetron, tropisetron, palonoestron, mirtazapine, domperidone, olanzapine, droperidol, metoclopramide, alizapride, prochloperazine. In some instances antihistamines may be employed as antiemetics.
Antidiarrheals include methylcellulose, attapulgite, bismuth subsalicylate, atropine/diphenoxylate, loperamide and other opioids such as codeine and morphine.
Analgesics include non-steriodal anti-inflammatories, paracetamol, cox-2 inhibitors, opiates and morphinomimetics, such as morphine, codeine, oxycodone, hydrocodone, dihydromorphine, pethidine, buprenorphine, tramadol and the like.
In one embodiment viral treatment is employed in combination with a course of steroids.
Steroids include hydrocortisone, cortisone, prednisone, prednisolone, methylprednisolone, dexamethasone and the like.
Prophylactic as employed herein is intended to refer to preventive medicine or care, for example consisting of measures taken to prevent or ameliorate side effects during or following administration of the virus.
In one embodiment the prophylaxis is administered separately to the virus, either temporally or by an alternate method of administration or both. Treatment can be concurrent or sequential.
In one embodiment additional hydration is provided in combination with the administration of the virus, either concurrently or sequentially.
Additional hydration as employed herein means the patient is supplied with fluids beyond those included in the formulation. This may be any form of suitable liquid, for example, a saline or glucose infusion.
In one embodiment the virus therapy herein is administered in combination with an anti-inflammatory, for example a steroid or non-steroidal anti-inflammatory.
In one embodiment the virus therapy according to the present disclosure is administered in combination with an anti-pyretic.
In one embodiment the viral treatment is administered in combination with hydration therapy, for example intravenous administration of fluids, in particular isotonic saline or glucose.
In one embodiment the method is suitable for treating the patient as an outpatient. In the context of this specification "comprising" is to be interpreted as "including".
Aspects of the invention comprising certain elements are also intended to extend to alternative embodiments "consisting" or "consisting essentially" of the relevant elements.
Embodiments and descriptions of the disclosure may and will be combined where technically appropriate.
Any positive embodiment or combination thereof described herein may be the basis of a negative exclusion i.e. a disclaimer.
EXAMPLES
Example 1
A pre-clinical study in nude mice compared the IP administration of EnAd using different treatment regimens either in combination or in sequence with paclitaxel for the treatment of platinum-resistant disseminated ovarian cancer (Figure 1). All treatment regimens (Groups 2, 3 and 4) showed significant evidence of anti-tumour efficacy compared to placebo (Group 1). EnAd administration alone had a significantly greater effect than paclitaxel alone when administered in the sequential groups (Groups 2 and 3). Although the sequential use of EnAd followed by paclitaxel or paclitaxel followed by EnAd were both significantly more efficacious than placebo, the weekly combination of EnAd with paclitaxel (Group 4) produced a trend toward better efficacy than sequential therapy (with tumour burden remaining statistically below baseline at day 59), even though the mice in this group received their last dose of active agent on day 22 (i.e. the second cycle was entirely phosphate buffered saline) whereas the sequential arms were also treated on days 43, 50 and 57. In this study, in the combination group (Group 4), EnAd was administered 24 hours before paclitaxel, and this is the regimen proposed in this clinical study. The control group in this study (Group 1) also received EnAd at a late time point (day 43), to see whether the virus was able to clear well established tumours. The tumour burden was significantly reduced following this dose, but the animals had to be sacrificed thereafter because they met the pre-specified weight loss related humane endpoint. The dose of EnAd used in this study was 5 x 109 viral particles per week and using the Body Surface Area conversion formula (Guidance for Industry: Estimating the Maximum Safe Starting Dose in Initial Clinical Trials for Therapeutics in Adult Healthy Volunteers, Food and Drug Administration [FDA] July 2005), this gives a human equivalent total dose of approximately 1 x 1012 viral particles per dose, which is the starting dose in the Phase la dose escalation scheme for this study.
In a GLP toxicology study in female cluster of differentiation 1 (CD1) mice, EnAd was administered at doses of lxlO9, 1 x 1010 and 6.6 x 1010 viral particles weekly for three weeks (days 1, 8 and 15) with a day 2 examination and a 4-week recovery period. No significant signs of toxicity were reported in this study compared to the control group. The 1 x 109 viral particles dose was described as a no observable effect level (NOEL) and the 6.6 xlO10 viral particle dose was described as a no observable adverse effect level (NOAEL). This NOAEL murine dose equates to a human equivalent total dose of 1.28 x 1013 viral particles per dose using the Body Surface Area conversion formula (Guidance for Industry: Estimating the Maximum Safe Starting Dose in Initial Clinical Trials for Therapeutics in Adult Healthy Volunteers, FDA July 2005). The safety margin provided by the GLP toxicology study is thus such that the maximum dose proposed in this clinical study is below the equivalent murine NOAEL. Group 1 - Group 2 - Group 3 - Group 4 - PBS then
Day
Combined Therapy Virus then Paclitaxel Paclitaxel then virus virus at treatment 4
0 2.5 x 10s Cells IP 2.5 x lO6 Cells IP 2.5 x lO6 Cells IP 2.5e6 cells IP
7 5 x 109 EnAd IP 5 x 109 EnAd IP 0.4 mg Paclitaxel IP PBS, 2 ml IP
8 0.4 mg Paclitaxel IP PBS, 2 ml IP PBS, 2 ml IP PBS, 2 ml IP
14 5 x 109 EnAd IP 5 x 109 EnAd IP 0.4 mg Paclitaxel IP PBS, 2 ml IP
15 0.4 mg Paclitaxel IP PBS, 2 ml IP PBS, 2 ml IP PBS, 2 ml IP
21 5 x 109 EnAd IP 5 x 109 EnAd IP 0.4mg Paclitaxel IP PBS, 2 ml IP
22 0.4 mg Paclitaxel IP PBS, 2 ml IP PBS, 2 ml IP PBS, 2 ml IP
43 PBS, 2 ml IP 0.4 mg Paclitaxel IP 5 x 109 EnAd IP 5e9 EnAd IP
50 PBS, 2 ml IP 0.4 mg Paclitaxel IP 5 x 109 EnAd IP (all mice sacrificed)
57 PBS, 2 ml IP 0.4 mg Paclitaxel IP 5 x l09 EnAd IP (all mice sacrificed)
Abbreviations: IP=intraperitioneal; PBS=phosphate buffered saline
The results are shown in Figure 1.
Example 2 Drug Combination
EnAd (ColoAdl) virus replication in the presence of 320 clinically approved compounds or compounds in development was assessed in the colon carcinoma cell line, HT-29. HT-29 cell were seeded at a density of 3.0e4 cells per well in 96 well plates and incubated at 37°C, 5% C02. After 4-6hrs incubation virus and drug compound mixtures prepared in cell media were diluted onto the cells to give final doses of 10 ColoAdl virus particles per cell (ppc) and Ο.ΙμΜ of drug compound. The cells were incubated for 18hrs and then the total virus genomes in the cells were assessed by qPC . The relative fold change in ColoAdl replication, compared to ColoAdl virus alone, is plotted for all compounds in Figure 6. The inset shows an increase in virus replication after 18 hrs in the presence of microtubule inhibitors and a decrease in virus replication in the presence of topoisomerase inhibitors.
The effect of paclitaxel or cisplatin treatment on ColoAdl efficacy in a tumour model was assessed in an IP model of ovarian cancer. SCID mice were implanted with 2.5e6 luciferase-expressing SKOV-3 human ovarian carcinoma cells. Tumour burden was assessed by luciferase expression. Mice were imaged on day 5, on the day before each set of treatments and at least every 5-7 days for the duration of the study. All ColoAdl treatments were carried out using 5e9 virus particles delivered by intraperitoneal injection and in the combined treatment groups, paclitaxel (0.4mg) or cisplatin (0.04mg) was delivered the day after virus treatment. Disease progression was assessed by luciferase imaging using an MS imaging system. Images of the relative luminescence in mice dosed via IP injection with either PBS (A), paclitaxel (B), ColoAdl (C) or paclitaxel and ColoAdl (D) is shown in Figure 8 and the relative luminescence tracked over time for each dosing group is shown in Figure 9. The relative luminescence in mice dosed via IP injection with either PBS (Group 1), EnAd then cisplatin (Group 2), cisplatin then ColoAdl (Group 3) or Paclitaxel and EnAd (Group 4) are shown in Figure 10. Dosing schedules are detailed in the Figures 9 and 10.
Example 3
A Phase l/ll, open label multi-center clinical trial in platinum-resistant epithelial ovarian cancer is in progress using the schematic shown in Figure 10. As of December 2015, 6 patients have been dosed in Cohort Al and Cohort Bl is ongoing.
The patients have histologically confirmed epithelial ovarian, fallopian tube or primary peritoneal cancer, who are resistant to platinum therapy or ovarian cancer who have exhausted all other treatment options.
Key inclusion criteria at phase I included: Histologically confirmed non-resectable epithelial ovarian, fallopian tube or primary peritoneal cancer; Confirmed relapsed within the platinum-resistant time frame or Absence of other available treatment option; Evaluable disease by ECIST vl.l; Able to undergo IP injection, including all administration procedures; Recovered to at least grade 1 from the effects (excluding alopecia) of any prior therapy; ECOG Performance Status Score of 0 - 1; Adequate renal, hepatic and bone marrow function; Adequate coagulation tests; For females of childbearing potential, a negative pregnancy test; and For women who are not postmenopausal or surgically sterile, agreement to use two adequate methods of contraception.
Key exclusion criteria for phase I included: Tumours of malignant mixed mesodermal or mucinous subtypes, or non-epithelial ovarian cancers; Symptomatic sub-acute bowel obstruction; Pregnant or lactating women; Known history or evidence of significant immunodeficiency due to underlying illness, medication, Splenectomy or prior allogeneic or autologous bone marrow or organ transplantation;
Active infections or positive serology for H IV, hepatitis B or hepatitis C; Use of anti-viral agents;
Administration of another investigational drug within 28 days; Concurrent administration of any cancer therapy other than planned study treatment; Major surgery within 2 weeks prior to first dose of virus; Symptomatic central nervous system (CNS) metastasis; Inflammatory diseases of the bowel; Concurrent congestive heart failure or prior history of significant cardiac disease; Any condition or illness that would compromise patient safety or interfere with the evaluation of the safety of the drug; Known allergy to treatment medication or its excipients; and Any other medical or psychological condition that would preclude participation in the study.
The dose escalation levels for Phase la were:
Level 1: A dosing cycle consisting of 3 x 1012 viral particles fractionated as 3 separate weekly
I P doses administered as a slow IP injection i.e. : 1 x 1012 viral particles on day 1 of weeks 1, 2 and 3 (i.e. day 1, day 8 [±1 day] and day 15 [±1 day]), followed by a second dosing cycle (dosing days 29, 36 and 43)
Level 2: A dosing cycle of 1.8 x 1013 viral particles fractionated as 3 separate weekly I P doses administered as a slow IP injection i.e.: 6 x 1012 viral particles on day 1 of weeks 1, 2 and 3 (i.e. day 1, day 8 [±1 day] and day 15 [±1 day]). 3 x 1013 particles fractionated on day 1 of weeks 1, 2 and 3 is anticipated to be the highest tested dose. A second cycle of dosing planned for days 29, 36 and 43.
Primary Endpoint Assessments: Safety endpoints:
Incidence, nature, severity and seriousness of AEs as characterised using the National Cancer Institute
Common Terminology Criteria for Adverse Events (NCI CTCAE v4.03).
Incidence, nature, and severity of changes in laboratory values, vital signs, and physical exam.
Laboratory assessments: Blood Chemistry, Haematology, Coagulation, and Urinalysis. Secondary Endpoint Assessments:
Efficacy: Response rate, duration of response, clinical benefit rate measured by RECIST vl.l, irRC and CICG criteria; Progression free survival measured by RECIST vl.l irRC, and GCIG CA-125 criteria; and - PFS rate at 4 and 6 months measured by RECIST vl.l criteria and irRC.
Kinetics and immunity: Blood kinetics of EnAd according to quantitative polymerase chain reaction (qPCR) measurement of serial blood samples for EnAd genome copies and where relevant by plaque assay to determine the presence of viable replicating virus; Viral shedding of EnAd according to qPCR measurement of buccal and rectal swabs for EnAd genome copies; Persistence of EnAd in the peritoneal cavity according to qPCR measurement of serial peritoneal samples for EnAd genome copies and where relevant by plaque assay to determine the presence of viable replicating virus; EnAd specific antibody response in blood by enzyme linked immunosorbent (ELISA) and neutralising assays; and EnAd specific antibody response in peritoneal fluid by ELISA and neutralising assays.
Study Schedule
The schedule of key events is depicted in Figure 11.
Results
Safety
Of the 6 evaluable patients administered enadenotucirev intraperitoneal^ at the dose level of 1 x 1012 viral particles (each evaluable patient received virus on at least three occasions), four patients experienced a CTCAE grade 3 or 4 toxicity, but only a single CTCAE grade 3 or 4 toxicity was considered possibly related to intraperitoneal enadenotucirev. This was a patient with Grade 4 left ventricular failure occurring approximately two weeks after the last dose of virus with Grade 3 diarrhoea in the same patient. Taking Cohort 1 as whole, the toxicities observed in all patients were considered acceptable to the study Clinical Events Committee (CEC). The CEC unanimously agreed that it was appropriate to progress to the next 2 cohorts as planned in the protocol. These cohorts will be Phase lb cohort 1 (lxlO12 vp dose of enadenotucirev + paclitaxel administered per protocol) and Phase la cohort 2 (higher dose of enadenotucirev monotherapy).
Efficacy
Of the six evaluable patients administered enadenotucirev intraperitoneal^ at the dose level of lxlO12 viral particles two patients showed some level of clinical response.
For the first patient this was with enadenotucirev monotherapy, and for the second patient the efficacy was seen following treatment with both enadenotucirev and paclitaxel.
Example 4
At the time of filing, a clinical study is being conducted to examine the safety and efficacy of enadenotucirev (EnAd; previously called ColoAdl) delivered intraperitoneally to human subjects with ovarian cancer as monotherapy or in combination with paclitaxel chemotherapy. To date, samples from 6 monotherapy patients dosed intraperitoneally on days 1, 8, 15, 29, 36 and 43 with 1 x 1012 viral particles (vp) of enadenotucirev have been taken to assess:
• The quantity of virus in the blood and peritoneal cavity.
· The quantity of virus shed in rectal and buccal samples. • The presence of antibodies capable of binding enadenotucirev in blood and ascites samples.
The quantities of virus in biological samples were assessed by qPC . Samples were defrosted and DNA extracted from the sample. Swabs were vortexed and incubated in lysis buffer prior to DNA extraction. Each sample of eluted DNA was added to two different PCR master mixes containing the Taqman probe, one containing enadenotucirev specific primers (Seq ID No's 91, 92 and 93) and one containing control bovine adenovirus specific primers. Each sample was tested in triplicate and a mean quantity value obtained for both targets. A "no template" control and an exogenous internal positive control were also included in each PCR run. Purified EnAd DNA and bovine adenovirus DNA were used as positive controls for the PCR reactions and extractions, respectively. If bovine adenovirus recovery was less than 50%, the sample extraction was repeated if a repeat sample existed. The qPCR assay has been qualified and shown to be accurate and precise in a range of 2.25xl02 to 2.25χ104νρ/μί. The limit of detection was not determined as part of the qualification study, but is taken to be Ο νρ/μί, enadenotucirev DNA detected in samples between 0 and 2.25χ102 νρ/μί. are reported as being positive. Any qPCR signal detected in these samples may represent DNA contained within: live replicating virus, non-replicating virus or viral breakdown products.
Virus Shedding
Saliva samples were collected by swab from one side of the mouth between the lower gum area and the cheek. The swab was left to rest for 30 seconds to absorb saliva. Rectal swabs were taken with anal insertion of the tip of the swab to ensure faecal matter collection. Both swabs were air dried for fifteen minutes before returning to the container. All shedding samples were then frozen at -20°C until analysis by qPCR. Swabs were collected at the time points indicated in Tables 1 and 2.
As summarised in Table 3 for buccal shedding and Table 4 for rectal shedding, no virus shedding was observed following peritoneal administration of EnAd, with the dosing regimen used in this study. These results for intraperitoneal delivery contrast with those from a study where 31 patients were dosed intravenously with EnAd on days 1, 3 and 5 where the same technique was used to monitor rectal and buccal viral shedding. Following intravenous dosing, buccal shedding was observed in the quantifiable range in 8 patients between day 4 and day 8, with no shedding observed in the quantifiable range after this date. Rectal shedding was also observed in the quantifiable range between day 3 and day 8 in 7 patients dosed intravenously.
Table 3: Buccal Shedding
Figure imgf000043_0001
Table 4: Rectal Shedding
Figure imgf000044_0001
Quantity of Virus in Blood
The quantity of virus in blood was determined by qPCR. Samples were taken at the time points indicated in Figure 12 tifiable range in the blood samples, which contrasts with dosing intravenously where the virus has a half-life of approximately 20 mins and at a dose of lxlO12 vp approximately 2xl07 vp/mL would be expected to be detected in the blood.
Quantity of Virus in Peritoneal Cavity
The quantity of virus in peritoneal fluid was determined by qPCR. Samples were taken prior to dosing, as part of draining the ascetic fluid prior to dosing at the time points indicated in Figure 14 and immediately frozen at -20°C. Patients were dosed on days 1, 8, 15, 29, 36 and 43. The Day 8, 15, 36 and 43 samples, therefore provide a measure of the quantity of virus in the peritoneal cavity 7 days following dosing of the virus, whereas the Day 29 sample is 14 days after the previous dose of virus. The data in Figure 12 show that virus was detectable above LOQ at all time points in all subjects, often at levels that indicate that replication of the dosed virus particles may be contributing to the total detected 7 or 14 days after dosing. Although the clearance rate of the virus not yet known, it is unlikely that virus would survive in the peritoneal cavity in such concentrations over this time period. Turnover of fluid from the peritoneal cavity is usually around 50 -100 mL per hour. Furthermore most of the virus, if not degraded, would be expected to bind to the large surface area of the peritoneal cavity and not be removed in the ascites.
Antibody Concentration
A direct immunoassay was used to quantify the antibody concentration in the blood and peritoneal fluid samples. Enadenotucirev particles were used to coat a Mesoscale Discovery (MSD) plate. The serum or peritoneal samples were serially diluted and added to the coated plate. This was washed and antibodies in the samples that bound the enadenotucirev were detected with an anti-human IgG detection antibody. The detection antibody contains a streptavidin-sulfo-Tag. Upon electrochemical stimulation of the bound sulfo-tagged antibody, a light signal is emitted and measured on the MSD platform. An antibody titre was determined from the data by interpolating each sample against the calibration control.
Blood samples were taken on Days 1, 29, 50 and a follow up visit (28 days following last dose) for antibody titre. Serum was processed from blood samples upon sampling and immediately frozen at -20 °C. The data is summarised in Figure 15. The antibody responses were similar to those observed with dosing intravenously, where a mean antibody titre of 3xl04 has been seen from Day 28 onwards.
Peritoneal samples were taken on Days 1, 29 and 50 for enadenotucirev binding antibody titre. Ascites were drained and a sample immediately frozen at -20 °C. The data is summarised in Figure 16. The antibody response is similar to that of the serum samples. It is of note that the virus is still present at high concentrations (Figure 13) despite the elevated antibody binding capacity present in the peritoneal cavity.
EnAd Forward Primer for qPC : ATCCATGTCTAGACTTCGACCCAG SEQ ID NO: 91
EnAd Reverse Primer: TG CTG G GTG ATAACTATGG G GT SEQ ID NO: 92
EnAd qPCR Probe: 6'FAM - ATCTGTGGAGTTCATCGCTCTCTTACG(SEQ ID NO: 93) - 3'TAMRA

Claims

1. A method of treating a patient with ovarian cancer, peritoneal cancer or fallopian tube cancer with a combination therapy comprising
a) a first adenovirus treatment cycle comprising administering a doses of type B oncolytic adenovirus in the range of lxlO10 to lxlO14 viral particles approximately weekly (for example 7 days +/- 1 day) for at least three consecutive weeks, and
b) a first chemotherapy treatment cycle comprising administering a therapeutically effective amount of a chemotherapeutic agent once in 21 to 26 days,
wherein adenovirus treatment cycle and the chemotherapy treatment cycle either overlap or are sequential.
2. A method according to claim 1, wherein the cancer is ovarian cancer, for example epithelial ovarian cancer.
3. A method of treating a patient with ovarian cancer according to claim 1 or 2, wherein the therapeutically effective amount of the chemotherapeutic agent is administered within 1 day of one or more of the said virus doses.
4. A method according to any one of claims 1, wherein each administration of virus employed in the treatment cycle of step a) is in the range 1 x 1012 to 3 x 1013 viral particles, such as 1 x 1012, 6 x 1012 or 3 x 1013 viral particles.
5. A method according to claims 4, wherein the virus dose employed in step a) is 1 x 1012 viral particles.
6. A method according to claim 5, wherein the total virus dose (three doses) in the first
treatment cycle is 3 x 1012 virus particles.
7. A method according to any one of claims 1 to 6, wherein the first dose of the adenovirus treatment cycle is administered on day one of week 1.
8. A method accoding to claim 7, wherein the second dose of the adenovirus treatment cycle is administered on day 8 +/- 1 day.
9. A method according to claim 7 or 8, wherin the third dose of the adenovirus treatment is in administered on day 15 +/- 1 day.
10. A method according to any one of claims 1 to 9, which comprises a second adenovirus
treatment cycle.
11. A method according to claim 10, wherein the second treatment cycle comprises a dose in the range 1 x 1012 to 3 x 1013 viral particles (for example 1 x 1012, 6 x 1012 or 3 x 1013 viral particles) administered approximately weekly (for example 7 days +/- 1 day) for three consecutive weeks.
12. A method according to claim 10, wherein the first dose of the second adenovirus treatment cycle is administered on day 29 +/- 1 day.
13. A method according to claim 11 or 12, wherein the second dose of the second adenovirus treatment cycle is administered on day 36 +/- 1 day.
14. A method according to any one of claims 11 to 13, wherein the third dose of the second adenovirus treatment cycle is administered on day 43 +/- 1 day.
15. A method according to any one of claim 1 to 14, wherein the virus is EnAd.
16. A method according to claim 15, wherein the EnAd further comprises a transgene.
17. A method according to claim 16, wherein EnAd has a sequence of formula (I):
5'ITR-B1-BA-B2-BX-BB-BY-B3-3'ITR
wherein:
B1 comprises: El A, E1B or E1A-E1B;
BA comprises-E2B-Ll-L2-L3-E2A-L4;
B2 is a bond or comprises: E3;
Βχ is a bond or a DNA sequence comprising: a restriction site, one or more transgenes or both; Bg comprises L5;
Βγ comprises a transgene cassette comprising a transgene and a splice acceptor sequence; and
B3 is a bond or comprises: E4,
wherein the transgene cassette is under the control of an endogenous promoter selected from the group consisting of E4 and major late promoter and wherein the transgene cassette comprises a therapeutic gene encoding material selected from the group consisting of an RNAi sequence, an antibody or binding fragment thereof, chemokines, cytokines,
immunomodulator and enzymes.
18. A method according to any one of claims 1 to 17, wherein the adenovirus is replication
competent.
19. A method according to any one of claims 1 to 18, wherein the cancer is peritoneal cancer.
20. A method according to any one of claims 1 to 19, wherein the cancer is fallopian tube cancer.
21. A method according to any one of the claims 1 to 20, whereing the viral particles are
administered parenterally.
22. A method according to claim 21, wherein the viral particles are administered into the
intraperitoneal cavity.
23. A method according to claim 21, wherein the viral particles are administered intravenously.
24. A method according to any one of claims 21 to 23, wherein the administration is by slow
infusion.
25. A method according to any one of claims 1 to 24, wherein the chemotherapeutic agent is a taxane derivate, such as paclitaxel and/or docetaxel, a platin, for example cisplatin, carboplatin or combination thereof.
26. A method according to claim 25, wherein the chemotherapeutic agent is paclitaxel or
docetaxel.
27. A method according to claim 25 or 26, wherein the paclitaxel dose is in the range 135 to 175 mg/m2.
28. A method according to claim 27, wherein the paclitaxel is administed over a period of 3 to 24 hours.
29. A method according to claim 25 or 26, wherein the docetaxel dose is 75 mg/m2.
30. A method according to claim m29, wherein the doctaxel is administered over a period of about 1 hour.
31. A method according to any one of claims 25 to 30, wherein the chemotherapeutic is
administered in to the intraperitoneal cavity.
32. A method according to any one of claims 25 to 30, wherein the chemotherapeutic is
administered intravenously.
33. A method according to any one of claims 1 to 32, wherein 3 to 6 chemotherapy treatment cycles are administered.
34. A method according to any one of claims 1 to 33, wherein the cancer, such as the ovarian cancer is chemotherapy resistant, for example resistant to platin chemotherapy.
35. A method according to any one of claims 1 to 34, wherein the chemotherapy is administered post administration of the virus.
36. A method according to any one of claims 1 to 35, wherein the wherein adenovirus treatment cycle and the chemotherapy treatment cycle.
37. A method according to any one of claims 1 to 36, wherein the combination therapy is
administered after cytoreductive surgery.
38. A chemotherapeutic agent and a type B oncolytic adenovirus for use in a combination therapy for the treatment of ovarian cancer, peritoneal cancer or fallopian tube, in regimen comprising:
a) a first adenovirus treatment cycle comprising administering a doses of type B oncolytic adenovirus in the range of lxlO10 to lxlO14 viral particles approximately weekly (for example 7 days +/- 1 day) for at least three consecutive weeks, and
b) a first chemotherapy treatment cycle comprising administering a therapeutically effective amount of a chemotherapeutic agent once in 21 to 26 days,
wherein adenovirus treatment cycle and the chemotherapy treatment cycle either overlap or are sequential.
39. Use of a chemotherapeutic agent and a type B oncolytic adenovirus for the manufacture of a combination therapy for the treatment of ovarian cancer, peritoneal cancer or fallopian tube, in regimen comprising:
a) a first adenovirus treatment cycle comprising administering a doses of type B oncolytic adenovirus in the range of lxlO10 to lxlO14 viral particles approximately weekly (for example 7 days +/- 1 day) for at least three consecutive weeks, and
b) a first chemotherapy treatment cycle comprising administering a therapeutically effective amount of a chemotherapeutic agent once in 21 to 26 days,
wherein adenovirus treatment cycle and the chemotherapy treatment cycle either overlap or are sequential.
PCT/EP2015/080243 2014-12-17 2015-12-17 Method of treating ovarian cancer WO2016097158A1 (en)

Applications Claiming Priority (6)

Application Number Priority Date Filing Date Title
GB1422540.3 2014-12-17
GB201422540 2014-12-17
GB1422599.9 2014-12-18
GB201422599 2014-12-18
GB1510197.5 2015-06-11
GBGB1510197.5A GB201510197D0 (en) 2014-06-12 2015-06-11 Method of treating ovarian cancer

Publications (1)

Publication Number Publication Date
WO2016097158A1 true WO2016097158A1 (en) 2016-06-23

Family

ID=53784516

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2015/080243 WO2016097158A1 (en) 2014-12-17 2015-12-17 Method of treating ovarian cancer

Country Status (2)

Country Link
GB (1) GB201510197D0 (en)
WO (1) WO2016097158A1 (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN107690479A (en) * 2015-04-30 2018-02-13 皮斯奥克斯治疗公司 Encode the oncolytic adenovirus of B7 protein

Citations (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1998019710A2 (en) 1996-11-06 1998-05-14 Etienne Honore Schacht Delivery of nucleic acid material to target cells in biological systems
WO2000074722A2 (en) 1999-06-09 2000-12-14 Hybrid Systems Limited Modification of biological elements
WO2005118825A2 (en) 2004-05-26 2005-12-15 Schering Aktiengesellschaft Chimeric adenoviruses for use in cancer treatment
WO2006008513A1 (en) 2004-07-23 2006-01-26 Isis Innovation Limited Modified virus
WO2008080003A2 (en) 2006-12-22 2008-07-03 Bayer Schering Pharma Aktiengesellschaft Generation of oncolytic adenoviruses and uses thereof
WO2010038086A2 (en) 2008-10-02 2010-04-08 Respivert Limited Novel compounds
WO2010067041A1 (en) 2008-12-11 2010-06-17 Hybrid Biosystems Limited Modification of nucleic acid vectors with polymers comprising charged quaternary amino groups
WO2011048111A1 (en) 2009-10-19 2011-04-28 Respivert Limited Compounds
WO2014198852A2 (en) 2013-06-14 2014-12-18 Psioxus Theraupeutics Limited A dosing regime and formulations for type b adenoviruses
WO2015059303A1 (en) 2013-10-25 2015-04-30 Psioxus Therapeutics Limited Oncolytic adenoviruses armed with heterologous genes

Patent Citations (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1998019710A2 (en) 1996-11-06 1998-05-14 Etienne Honore Schacht Delivery of nucleic acid material to target cells in biological systems
WO2000074722A2 (en) 1999-06-09 2000-12-14 Hybrid Systems Limited Modification of biological elements
WO2005118825A2 (en) 2004-05-26 2005-12-15 Schering Aktiengesellschaft Chimeric adenoviruses for use in cancer treatment
WO2006008513A1 (en) 2004-07-23 2006-01-26 Isis Innovation Limited Modified virus
WO2008080003A2 (en) 2006-12-22 2008-07-03 Bayer Schering Pharma Aktiengesellschaft Generation of oncolytic adenoviruses and uses thereof
WO2010038086A2 (en) 2008-10-02 2010-04-08 Respivert Limited Novel compounds
WO2010067041A1 (en) 2008-12-11 2010-06-17 Hybrid Biosystems Limited Modification of nucleic acid vectors with polymers comprising charged quaternary amino groups
WO2010067081A2 (en) 2008-12-11 2010-06-17 Hybrid Biosystems Limited Modification of nucleic acid vectors
WO2011048111A1 (en) 2009-10-19 2011-04-28 Respivert Limited Compounds
WO2014198852A2 (en) 2013-06-14 2014-12-18 Psioxus Theraupeutics Limited A dosing regime and formulations for type b adenoviruses
WO2015059303A1 (en) 2013-10-25 2015-04-30 Psioxus Therapeutics Limited Oncolytic adenoviruses armed with heterologous genes

Non-Patent Citations (7)

* Cited by examiner, † Cited by third party
Title
"8 th International Conference on Oncolytic Virus Therapeutics 2014 - April 10-13, 2014Lincoln College & Examination Schools - Oxford, United Kingdom", HUMAN GENE THERAPY, vol. 25, no. 12, 1 December 2014 (2014-12-01), US, pages A1 - A32, XP055253040, ISSN: 1043-0342, DOI: 10.1089/hum.2014.2538.abstracts *
"Guidance for Industry: Estimating the Maximum Safe Starting Dose in Initial Clinical Trials for Therapeutics in Adult Healthy Volunteers", July 2005, FDA
"Guidance for Industry: Estimating the Maximum Safe Starting Dose in Initial Clinical Trials for Therapeutics in Adult Healthy Volunteers", July 2005, FOOD AND DRUG ADMINISTRATION
C K INGEMARSDOTTER ET AL: "Low-dose paclitaxel synergizes with oncolytic adenoviruses via mitotic slippage and apoptosis in ovarian cancer", ONCOGENE, vol. 29, no. 45, 23 August 2010 (2010-08-23), GB, pages 6051 - 6063, XP055252734, ISSN: 0950-9232, DOI: 10.1038/onc.2010.335 *
M RAKI ET AL: "Combination of gemcitabine and Ad5/3-[Delta]24, a tropism modified conditionally replicating adenovirus, for the treatment of ovarian cancer", GENE THERAPY, vol. 12, no. 15, 1 August 2005 (2005-08-01), GB, pages 1198 - 1205, XP055252736, ISSN: 0969-7128, DOI: 10.1038/sj.gt.3302517 *
STONE ET AL., JOURNAL OF VIROLOGY, vol. 79, no. 8, 2005, pages 5090 - 5104
VARELA JC ET AL., INT J CANCER, vol. 123, no. 6, 15 September 2008 (2008-09-15), pages 1357 - 1363

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN107690479A (en) * 2015-04-30 2018-02-13 皮斯奥克斯治疗公司 Encode the oncolytic adenovirus of B7 protein

Also Published As

Publication number Publication date
GB201510197D0 (en) 2015-07-29

Similar Documents

Publication Publication Date Title
US20220054563A1 (en) Dosing regime and formulations for type b adenoviruses
Gorbet et al. Cancer immunotherapy with immunoadjuvants, nanoparticles, and checkpoint inhibitors: Recent progress and challenges in treatment and tracking response to immunotherapy
JP2020169177A (en) Neoepitope vaccine compositions and methods of use thereof
JP7305300B2 (en) Combination immunotherapy
JP7431262B2 (en) ovarian cancer vaccine
KR20170098947A (en) Methods and compositions for combined immunotherapy
JP2012001566A (en) Method for treating solid tumor and metastasis by gene therapy
JP6756609B2 (en) C. for the treatment of solid tumors in humans. novyi
Price et al. Evolution of malignant glioma treatment: from chemotherapy to vaccines to viruses
JP2003528813A5 (en)
WO2016097158A1 (en) Method of treating ovarian cancer
WO2021143799A1 (en) Use of anti-pd-1 antibody in combination with fruquintinib in preparation of medicaments for treating cancer
Phuphanich et al. ATIM-25. Ten-year follow up with long term remission in patients with newly diagnosed glioblastoma (GBM) treated with ICT-107 vaccine (phase I)
Guinn et al. 8th international conference on oncolytic virus therapeutics
Castro et al. EXTH-52. HARNESSING AB CELL THERAPY TO PROMOTE ANTI-GLIOBLASTOMA HUMORAL RESPONSE
Baumgartner et al. Future Perspectives: A Review of Therapeutic Advances in Recurrent Glioblastoma
KR101734652B1 (en) Gene related to Doxorubicin resistance and use thereof
LYMPHOMA ATIM-26. PD-1 expression by tumor infiltrating lymphocytes in glioblastoma is a marker of both activation and exhaustion
WO2022136057A1 (en) Use of a birnavirus alone or in combination therapy for the treatment of cancer
Weller et al. New Approaches to Brain Tumor Therapy
Samaranayake Gene therapy strategies to enhance anti-angiogenic therapy, chemotherapy and radiotherapy in the treatment of malignant glioma: a pre-clinical evaluation
Peerlinck Development of a WNT-selective oncolytic adenovirus for imaging the therapy of colorectal cancers.
Pantuck et al. Ad-GMCAIX: a Novel Active Cellular Therapy for Metastatic Kidney Cancer.

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 15823323

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 15823323

Country of ref document: EP

Kind code of ref document: A1