WO2016092508A1 - Treatment of breast cancer brain metastases - Google Patents
Treatment of breast cancer brain metastases Download PDFInfo
- Publication number
- WO2016092508A1 WO2016092508A1 PCT/IB2015/059525 IB2015059525W WO2016092508A1 WO 2016092508 A1 WO2016092508 A1 WO 2016092508A1 IB 2015059525 W IB2015059525 W IB 2015059525W WO 2016092508 A1 WO2016092508 A1 WO 2016092508A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- seq
- substituted
- unsubstituted
- her3
- antibody
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
- C07K16/18—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
- C07K16/32—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against translation products of oncogenes
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/33—Heterocyclic compounds
- A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
- A61K31/535—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with at least one nitrogen and one oxygen as the ring hetero atoms, e.g. 1,2-oxazines
- A61K31/5375—1,4-Oxazines, e.g. morpholine
- A61K31/5377—1,4-Oxazines, e.g. morpholine not condensed and containing further heterocyclic rings, e.g. timolol
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/395—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum
- A61K39/39533—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum against materials from animals
- A61K39/39558—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum against materials from animals against tumor tissues, cells, antigens
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
- A61K45/06—Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
- A61P35/04—Antineoplastic agents specific for metastasis
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
- C07K16/18—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
- C07K16/28—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
- C07K16/30—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants from tumour cells
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/505—Medicinal preparations containing antigens or antibodies comprising antibodies
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/545—Medicinal preparations containing antigens or antibodies characterised by the dose, timing or administration schedule
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
- C07K2317/56—Immunoglobulins specific features characterized by immunoglobulin fragments variable (Fv) region, i.e. VH and/or VL
- C07K2317/565—Complementarity determining region [CDR]
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/70—Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
- C07K2317/73—Inducing cell death, e.g. apoptosis, necrosis or inhibition of cell proliferation
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/70—Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
- C07K2317/76—Antagonist effect on antigen, e.g. neutralization or inhibition of binding
Definitions
- the present invention relates to a pharmaceutical combination which comprises (a) a phosphatidylinositol 3-kinase inhibitor or pharmaceutically acceptable salt thereof, and (b) a Her3 antagonist, for simultaneous, separate or sequential administration for the treatment of metastatic breast cancer in the brain (referred to herein as breast cancer brain metastases).
- HER2 -targeted therapies for breast cancer.
- FDA-approved drugs with significant clinical efficacy for metastatic disease include the anti-HER2 antibody trastuzumab, the dual EGFR-HER2 kinase inhibitor lapatinib, the anti- HER2-HER3 dimerization inhibitor pertuzumab, and the antibody-drug conjugate T-DM1 (Krop, I.E., et al. Lancet Oncol (2014); Slamon, D.J., et al. The New England journal of medicine 344, 783-792 (2001)).
- Established BM often exhibit resistance to trastuzumab, a phenomenon which has been mostly attributed to inadequate penetration of the antibody through the blood-brain barrier (BBB) (Lampson, L.A. mAbs 3, 153-160 (2011).
- BBB blood-brain barrier
- the efficacy of small molecules on BM is also very limited and can only be marginally increased through the addition of further therapeutic modalities (Lin, N.U., et al. Journal of clinical oncology 26, 1993-1999 (2008); Lin, N.U., et al. Clinical cancer research : an official journal of the American Association for Cancer Research 15, 1452-1459 (2009); Bachelot, T., et al. The lancet oncology 14, 64-71 (2013)).
- Brain metastases is a devastating progression of breast cancer. Treatment options are limited, and the same anti-HER2 therapies that slow growth systemically do not typically control brain metastases. Thus, there is a need to identify a drug(s) that can be useful for treating breast cancer brain metastases.
- the present invention pertains to a pharmaceutical combination comprising (a) a phosphatidylinositol 3-kinase inhibitor selected from the group consisting of a compound of formula (I)
- W is CR W or N, wherein
- R w is selected from the group consisting of:
- Ri is selected from the group consisting of:
- Ri a , and R 3 ⁇ 4 are independently selected from the group consisting of:
- R 2 is selected from the group consisting of:
- R 2a , and R 3 ⁇ 4 are independently selected from the group consisting of
- R 3 is selected from the group consisting of:
- R 3a , and R 3b are independently selected from the group consisting of
- R 4 is selected from the group consisting of
- a Her3 antagonist such as a Her3 antibody or fragment thereof, wherein the antibody or fragment recognizes a conformational epitope of a HER3 receptor comprising amino acid residues 265-277, and 315 within domain 2 and amino acid residues 571, 582-584, 596-597, 600-602, and 609-615 within domain 4 of the HER3 receptor of SEQ ID NO: 1, and wherein the antibody or fragment thereof blocks both ligand -dependent and ligand -independent signal transduction, for simultaneous, separate or sequential administration for the treatment of breast cancer brain metastases.
- a Her3 antagonist such as a Her3 antibody or fragment thereof, wherein the antibody or fragment recognizes a conformational epitope of a HER3 receptor comprising amino acid residues 265-277, and 315 within domain 2 and amino acid residues 571, 582-584, 596-597, 600-602, and 609-615 within domain 4 of the HER3 receptor of SEQ ID NO: 1, and wherein the antibody or fragment thereof blocks both lig
- the compound of formula (I) is 5-(2,6-di-morpholin-4-yl-pyrimidin-4-yl)-4- trifluoromethyl-pyridin-2-ylamine or its hydrochloride salt.
- the Her3 antibody or fragment comprises a heavy chain variable region and a light chain variable region as shown in Table 1 below.
- the Her3 antibody or fragment comprises a heavy chain variable region CDR1 of SEQ ID NO: 128; CDR2 of SEQ ID NO: 129; CDR3 of SEQ ID NO: 130; and a light chain variable region CDR1 of SEQ ID NO: 131; CDR2 of SEQ ID NO: 132; and CDR3 of SEQ ID NO: 133.
- the HER3 antagonist can be MOR10703, the sequence of which is shown in Table 1 below.
- the pharmaceutical combination of the invention includes 5-(2,6-di- morpholin-4-yl-pyrimidin-4-yl)-4-trifluoromethyl-pyridin-2-ylamine or its hydrochloride salt and an antibody or fragment thereof that recognizes a conformational epitope of a HER3 receptor comprising amino acid residues 265-277, and 315 within domain 2 and amino acid residues 571, 582-584, 596-597, 600-602, and 609-615 within domain 4 of the HER3 receptor of SEQ ID NO: 1, and wherein the antibody or fragment thereof blocks both ligand -dependent and ligand-independent signal transduction.
- the pharmaceutical combination of the invention includes 5-(2,6-di- morpholin-4-yl-pyrimidin-4-yl)-4-trifluoromethyl-pyridin-2-ylamine or its hydrochloride salt and an Her3 antibody or fragment comprising a heavy chain variable region CDR1 of SEQ ID NO: 128; CDR2 of SEQ ID NO: 129; CDR3 of SEQ ID NO: 130; and a light chain variable region CDR1 of SEQ ID NO: 131 ; CDR2 of SEQ ID NO: 132; and CDR3 of SEQ ID NO: 133.
- the present invention relates to the use of a pharmaceutical combination comprising (a) a phosphatidylinositol 3-kinase selected from the group consisting of a compound of formula (I) or pharmaceutically acceptable salt thereof, and (b) a Her3 antagonist such as a Her3 antibody or fragment thereof, for the treatment of breast cancer brain metastases and/or for the preparation of a medicament for the treatment of a breast cancer brain metastases.
- a pharmaceutical combination comprising (a) a phosphatidylinositol 3-kinase selected from the group consisting of a compound of formula (I) or pharmaceutically acceptable salt thereof, and (b) a Her3 antagonist such as a Her3 antibody or fragment thereof, for the treatment of breast cancer brain metastases and/or for the preparation of a medicament for the treatment of a breast cancer brain metastases.
- the breast cancer brain metastases is a HER2 -positive breast cancer brain metastases.
- the present invention pertains to a method of treating breast cancer brain metastases comprising administering (a) a phosphatidylinositol 3 -kinase inhibitor is selected from the group consisting of a compound of formula (I)
- W is CR W or N, wherein R w is selected from the group consisting (1 ) hydrogen,
- Ri is selected from the group consisting (1 ) hydrogen, (2) cyano,
- Ri a , and R 3 ⁇ 4 are independently selected from the group consisting of: (a) hydrogen,
- R 2 is selected from the group consisting of:
- R 2a , and R 3 ⁇ 4 are independently selected from the group consisting of
- R 3 is selected from the group consisting of:
- R 3a , and R 3b are independently selected from the group consisting of:
- R 4 is selected from the group consisting of
- a Her3 antibody or fragment thereof wherein the antibody or fragment recognizes a conformational epitope of a HER3 receptor comprising amino acid residues 265-277, and 315 within domain 2 and amino acid residues 571, 582-584, 596-597, 600-602, and 609-615 within domain 4 of the HER3 receptor of SEQ ID NO: 1, and wherein the antibody or fragment thereof blocks both ligand -dependent and ligand -independent signal transduction.
- the phosphatidylinositol 3-kinase inhibitor is 5-(2,6-di-morpholin-4-yl-pyrimidin-4-yl)-4- trifluoromethyl-pyridin-2-ylamine or its hydrochloride salt and the Her3 antibody or fragment comprises a heavy chain variable region CDR1 of SEQ ID NO: 128; CDR2 of SEQ ID NO: 129; and CDR3 of SEQ ID NO: 130; and a light chain variable region CDR1 of SEQ ID NO: 131; CDR2 of SEQ ID NO: 132; and CDR3 of SEQ ID NO: 133.
- the HER3 antibody can be any antibody shown in Table 1 such as MORI 0703, the sequence of which is shown in Table 1 below. The combination can be administered simultaneous, separate or sequential.
- the present invention pertains to a method of treating breast cancer brain metastases comprising administering (a) a phosphatidylinositol 3-kinase inhibitor is 5-(2,6-di-morpholin- 4-yl-pyrimidin-4-yl)-4-trifluoromethyl-pyridin-2-ylamine or or a pharmaceutically acceptable salt thereof and (b) an Her3 antibody or fragment thereof, wherein the antibody or fragment recognizes a conformational epitope of a HER3 receptor comprising amino acid residues 265-277, and 315 within domain 2 and amino acid residues 571, 582-584, 596-597, 600-602, and 609-615 within domain 4 of the HER3 receptor of SEQ ID NO: 1, and wherein the antibody or fragment thereof blocks both ligand- dependent and ligand-independent signal transduction.
- a phosphatidylinositol 3-kinase inhibitor is 5-(2,6-di-morpholin- 4-yl-pyrimidin-4-y
- the phosphatidylinositol 3- kinase inhibitor is 5-(2,6-di-morpholin-4-yl-pyrimidin-4-yl)-4-trifluoromethyl-pyridin-2-ylamine or its hydrochloride salt and the Her3 antibody or fragment comprises a heavy chain variable region CDR1 of SEQ ID NO: 128; CDR2 of SEQ ID NO: 129; CDR3 of SEQ ID NO: 130; and a light chain variable region CDR1 of SEQ ID NO: 131; CDR2 of SEQ ID NO: 132; and CDR3 of SEQ ID NO: 133.
- the HER3 antibody is MORI 0703, the sequence of which is shown in Table 1 below.
- the present invention provides a commercial package comprising as therapeutic agents of (a) a phosphatidylinositol 3 -kinase inhibitor selected from the group consisting of a compound of formula (I) or pharmaceutically acceptable salt thereof, and (b) a Her3 antagonist such as antibody or fragment thereof, together with instructions for the simultaneous, separate or sequential administration thereof in the treatment of a breast cancer brain metastases.
- a phosphatidylinositol 3 -kinase inhibitor selected from the group consisting of a compound of formula (I) or pharmaceutically acceptable salt thereof
- a Her3 antagonist such as antibody or fragment thereof
- the HER3 antagonist useful in the invention can be an antibody or fragment thereof that recognizes a conformational epitope of a HER3 receptor comprising amino acid residues 265-277, and 315 within domain 2 and amino acid residues 571, 582-584, 596-597, 600-602, and 609-615 within domain 4 of the HER3 receptor of SEQ ID NO: 1, and wherein the antibody or fragment thereof blocks both ligand -dependent and ligand-independent signal
- the HER3 antagonist comprises a heavy chain variable region CDR1 of SEQ ID NO: 128; CDR2 of SEQ ID NO: 129; CDR3 of SEQ ID NO: 130; and a light chain variable region CDR1 of SEQ ID NO: 131; CDR2 of SEQ ID NO: 132; and CDR3 of SEQ ID NO: 133.
- the HER3 antagonist can be MOR10703, the sequence of which is shown in Table 1 below.
- Fig. 1 shows a differential response of BT474-Gluc tumors growing in the MFP (FiglA) and BT474-Gluc tumors growing in the brain (Fig IB) despite similar target inhibition and drug penetration.
- Fig. 2 shows a tumor growth curve (2A) and survival analysis (2B) of BT474-Gluc brain tumors untreated or treated with COMPOUND A, MOR10703, or COMPOUND A and MORI 0703.
- Fig. 3 shows a tumor growth curve (3 A) and survival analysis (3B) of MDA-MB-361-Gluc brain tumors untreated or treated with COMPOUND A, MOR10703, or COMPOUND A and MOR10703.
- Brain metastases is a devastating progression of breast cancer.
- treatment options are limited.
- the present invention is based on the finding that the lack of response to HER2 pathway inhibition in the brain is not due to impaired drug delivery and exposure but that HER3 is hyperactivated by the brain microenvironment and that therapeutic targeting of this pathway overcomes the resistance of HER2 -positive breast cancer brain metastases to PI3K inhibition and significantly improves survival.
- the present invention pertains to a pharmaceutical combination comprising (a) a
- brain metastases from breast cancer can be from a Her2 positive breast cancer.
- brain metastases from breast cancer can be from a Her2 positive breast cancer which has also been determined to have one more PIK3CA mutations, e.g., in exon 1, 2, 5, 7, 9 or 20 (e.g., in exon 9 E545K or exon 20 H1047R).
- the HER3 antagonist can be an antibody or fragment thereof that recognizes a conformational epitope of a HER3 receptor comprising amino acid residues 265-277, and 315 within domain 2 and amino acid residues 571, 582-584, 596-597, 600-602, and 609-615 within domain 4 of the HER3 receptor of SEQ ID NO: 1, and wherein the antibody or fragment thereof blocks both ligand-dependent and ligand- independent signal transduction.
- the HER3 antagonist comprises a heavy chain variable region CDR1 of SEQ ID NO: 128; CDR2 of SEQ ID NO: 129; CDR3 of SEQ ID NO: 130; and a light chain variable region CDR1 of SEQ ID NO: 131; CDR2 of SEQ ID NO: 132; and CDR3 of SEQ ID NO: 133.
- the HER3 antagonist can be MOR10703, the sequence of which is shown in Table 1 below.
- combination or “pharmaceutical combination” is defined herein to refer to either a fixed combination in one dosage unit form, a non-fixed combination or a kit of parts for the combined administration where the phosphatidylinositol 3-kinase inhibitor and the Her3 antagonist may be administered independently at the same time or separately within time intervals that allow that the therapeutic agents show a cooperative, e.g., synergistic, effect.
- non-fixed combination means that the therapeutic agents, e.g. the phosphatidylinositol 3-kinase inhibitor and the Her3 antagonist or pharmaceutically acceptable salt thereof, are both administered to a patient as separate entities or dosage forms either simultaneously, concurrently or sequentially with no specific time limits, wherein such administration provides therapeutically effective levels of the compounds in the body of the subject, e.g., a mammal or human, in need thereof.
- PI3k inhibitor is administered daily and the Her3 antagonist is administered weekly.
- kit of parts refers to the therapeutic agents (a) and (b) as defined above that are dosed independently or by use of different fixed combinations with distinguished amounts of the therapeutic agents (a) and (b), i.e., simultaneously or at different time points.
- the parts of the kit of parts can then e.g., be administered simultaneously or chronologically staggered, that is at different time points and with equal or different time intervals for any part of the kit of parts.
- the ratio of the total amounts of the therapeutic agent (a) to the therapeutic agent (b) to be administered in the combined preparation can be varied, e.g., in order to cope with the needs of a patient sub-population to be treated or the needs of the single patient.
- a phosphatidylinositol 3-kinase inhibitor or "PI3K inhibitor” is defined herein to refer to a compound which targets, decreases or inhibits phosphatidylinositol 3-kinase.
- Phosphatidylinositol 3- kinase activity has been shown to increase in response to a number of hormonal and growth factor stimuli, including insulin, platelet-derived growth factor, insulin-like growth factor, epidermal growth factor, colony-stimulating factor, and hepatocyte growth factor, and has been implicated in processes related to cellular growth and transformation.
- Her3 antagonist is defined herein to refer to an inhibitor which targets, decreases, or inhibitor activity of Her3.
- HER3 or "HER3 receptor” also known as "ErbB3” as used herein refers to mammalia HER3 protein and refers to mammalia HER3 gene.
- the preferred HER3 protein is huma HER3 protein present in the cell membrane of a cell.
- the huma HER3 gene is described in U.S. Pat. No. 5,480,968 and Plowman et al., (1990) Proc. Natl. Acad. Sci. USA, 87:4905-4909.
- Huma HER3 is well known and defined in Accession No. NP 001973 (human), and represented below as SEQ ID NO: 1.
- HER3 ligand refers to polypeptides which bind and activate HER3.
- HER3 ligands include, but are not limited to neuregulin 1 (NRG) and neuregulin 2, betacellulin, heparin-binding epidermal growth factor, and epiregulin.
- NRG neuregulin 1
- neuregulin 2 betacellulin
- betacellulin betacellulin
- epiregulin epiregulin
- the term includes biologically active fragments and/or variants of a naturally occurring polypeptide.
- HER3 activity refers to an increase in oligomerization (e.g. an increase in HER3 containing complexes), HER3 phosphorylation, conformational rearrangements (for example those induced by ligands), and HER3 mediated downstream signaling.
- ligand-dependent signaling refers to the activation of HER (e.g., HER3) via ligand.
- HER3 activation is evidenced by increased oligomerization (e.g. heterodimerization) and/ or HER3 phosphorylation such that downstream signaling pathways (e.g. PI3K) are activated.
- the antibody or fragment thereof can statistically significantly reduce the amount of phosphorylated HER3 in a stimulated cell exposed to the antigen binding protein (e.g., an antibody) relative to an untreated (control) cell, as measured using the assays described in the Examples.
- the cell which expresses HER3 can be a naturally occurring cell line (e.g. MCF7) or can be recombinantly produced by introducing nucleic acids encoding HER3 protein into a host cell. Cell stimulation can occur either via the exogenous addition of an activating HER3 ligand or by the endogenous expression of an activating ligand.
- ligand-independent signaling refers to cellular HER3 activity (e.g phosphorylation) in the absence of a requirement for ligand binding.
- ligand-independent HER3 activation can be a result of HER2 overexpression or activating mutations in HER3 heterodimer partners such as EGFR and HER2.
- the antibody or fragment thereof can statistically significantly reduce the amount of phosphorylated HER3 in a cell exposed to the antigen binding protein (e.g., an antibody) relative to an untreated (control) cell.
- the cell which expresses HER3 can be a naturally occurring cell line (e.g. SK-Br-3) or can be recombinantly produced by introducing nucleic acids encoding HER3 protein into a host cell.
- blocks refers to stopping or preventing an interaction or a process, e.g., stopping ligand-dependent or ligand-independent signaling.
- antibody refers to whole antibodies that interact with (e.g., by binding, steric hindrance, stabilizing/destabilizing, spatial distribution) a HER3 epitope and inhibit signal transduction.
- a naturally occurring "antibody” is a glycoprotein comprising at least two heavy (H) chains and two light (L) chains inter-connected by disulfide bonds.
- Each heavy chain is comprised of a heavy chain variable region (abbreviated herein as VH) and a heavy chain constant region.
- the heavy chain constant region is comprised of three domains, CHI, CH2 and CH3.
- Each light chain is comprised of a light chain variable region (abbreviated herein as VL) and a light chain constant region.
- the light chain constant region is comprised of one domain, CL.
- the VH and VL regions can be further subdivided into regions of hypervariability, termed complementarity determining regions (CDR), interspersed with regions that are more conserved, termed framework regions (FR).
- CDR complementarity determining regions
- FR framework regions
- Each VH and VL is composed of three CDRs and four FRs arranged from amino -terminus to carboxy -terminus in the following order: FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4.
- the variable regions of the heavy and light chains contain a binding domain that interacts with an antigen.
- the constant regions of the antibodies may mediate the binding of the immunoglobulin to host tissues or factors, including various cells of the immune system (e.g., effector cells) and the first component (Clq) of the classical complement system.
- antibody includes for example, monoclonal antibodies, human antibodies, humanized antibodies, camelised antibodies, chimeric antibodies, single-chain Fvs (scFv), disulfide-linked Fvs (sdFv), Fab fragments, F (ab 1 ) fragments, and anti-idiotypic (anti-Id) antibodies (including, e.g., anti-Id antibodies to antibodies of the invention), and epitope-binding fragments of any of the above.
- scFv single-chain Fvs
- sdFv disulfide-linked Fvs
- Fab fragments fragments
- F (ab 1 ) fragments fragments
- anti-idiotypic (anti-Id) antibodies including, e.g., anti-Id antibodies to antibodies of the invention, and epitope-binding fragments of any of the above.
- the antibodies can be of any isotype (e.g., IgG, IgE, IgM, IgD, IgA and IgY), class (e.g., IgGl, IgG2, IgG3, IgG4, IgAl and IgA2) or subclass.
- variable domains of both the light (VL) and heavy (VH) chain portions determine antigen recognition and specificity.
- the constant domains of the light chain (CL) and the heavy chain (CHI, CH2 or CH3) confer important biological properties such as secretion, transplacental mobility, Fc receptor binding, complement binding, and the like.
- the N-terminus is a variable region and at the C-terminus is a constant region; the CH3 and CL domains actually comprise the carboxy -terminus of the heavy and light chain, respectively.
- antibody fragment refers to one or more portions of an antibody that retain the ability to specifically interact with (e.g., by binding, steric hindrance, stabilizing/destabilizing, spatial distribution) a HER3 epitope and inhibit signal transduction.
- binding fragments include, but are not limited to, a Fab fragment, a monovalent fragment consisting of the VL, VH, CL and CHI domains; a F(ab)2 fragment, a bivalent fragment comprising two Fab fragments linked by a disulfide bridge at the hinge region; a Fd fragment consisting of the VH and CHI domains; a Fv fragment consisting of the VL and VH domains of a single arm of an antibody; a dAb fragment (Ward et al., (1989) Nature 341 :544-546), which consists of a VH domain; and an isolated complementarity determining region (CDR).
- a Fab fragment a monovalent fragment consisting of the VL, VH, CL and CHI domains
- F(ab)2 fragment a bivalent fragment comprising two Fab fragments linked by a disulfide bridge at the hinge region
- a Fd fragment consisting of the VH and CHI domains
- the two domains of the Fv fragment, VL and VH are coded for by separate genes, they can be joined, using recombinant methods, by a synthetic linker that enables them to be made as a single protein chain in which the VL and VH regions pair to form monovalent molecules (known as single chain Fv (scFv); see e.g., Bird et al., (1988) Science 242:423-426; and Huston et al., (1988) Proc. Natl. Acad. Sci. 85:5879-5883).
- single chain Fv single chain Fv
- Such single chain antibodies are also intended to be encompassed within the term "antibody fragment”.
- antibody fragments are obtained using conventional techniques known to those of skill in the art, and the fragments are screened for utility in the same manner as are intact antibodies.
- a HER3 binding antibody refers to a binding reaction that is determinative of the presence of a cognate antigen (e.g., a huma HER3) in a heterogeneous population of proteins and other biologies.
- a HER3 binding antibody of the invention typically also has a dissociation rate constant (KD) (koff/kon) of less than 5xlO-2M, less than 10-2M, less than 5xlO-3M, less than 10-3 M, less than 5xlO-4M, less than 10-4M, less than 5xl0-5M, less than 10-5M, less than 5xlO-6M, less than 10-6M, less than 5xlO-7M, less than 10-7M, less than 5xl0-8M, less than 10-8M, less than 5xlO-9M, less than 10-9M, less than 5xl0-10M, less than 10-lOM, less than 5x10-11M, less than 10-11M, less than 5xlO-12M, less than 10-12M, less than 5xlO-13M, less than 10-13M, less than 5xlO-14M, less than 10- 14M, less than 5xl0-15M, or less than 10-15M or lower, and
- the antibody or fragment thereof has dissociation constant (Kd) of less than 3000 pM, less than 2500 pM, less than 2000 pM, less than 1500 pM, less than 1000 pM, less than 750 pM, less than 500 pM, less than 250 pM, less than 200 pM, less than 150 pM, less than 100 pM, less than 75 pM, less than 10 pM, less than 1 pM as assessed using a method described herein or known to one of skill in the art (e.g., a BIAcore assay, ELISA, FACS, SET) (Biacore International AB, Uppsala, Sweden).
- Kd dissociation constant
- Kassoc refers to the association rate of a particular antibody-antigen interaction
- Kdis refers to the dissociation rate of a particular antibody-antigen interaction
- KD refers to the dissociation constant, which is obtained from the ratio of Kd to Ka (i.e. Kd/Ka) and is expressed as a molar concentration (M).
- KD values for antibodies can be determined using methods well established in the art. A method for determining the KD of an antibody is by using surface plasmon resonance, or using a biosensor system such as a Biacore® system.
- an antibody that "inhibits" one or more of these HER3 functional properties e.g., biochemical, immunochemical, cellular, physiological or other biological activities, or the like
- these HER3 functional properties e.g., biochemical, immunochemical, cellular, physiological or other biological activities, or the like
- an antibody that inhibits HER3 activity effects such a statistically significant decrease by at least 10% of the measured parameter, by at least 50%, 80% or 90%, and in certain embodiments an antibody of the invention may inhibit greater than 95%, 98% or 99% of HER3 functional activity as evidenced by a reduction in the level of cellular HER3 phosphorylation.
- HER3 antagonists include antibodies or fragments thereof that bind to a conformational epitope of a HER3 receptor comprising amino acid residues within domain 2 and domain 4 of HER3. This binding of the antibodies or fragments thereof with domain 2 and domain 4 stabilizes the HER3 receptor in an inactive or closed conformation such that HER3 activation is inhibited.
- Such antibodies block both ligand-dependent (e.g. neuregulin) and ligand-independent HER3 signaling pathways.
- isolated antibody refers to an antibody that is substantially free of other antibodies having different antigenic specificities (e.g., an isolated antibody that specifically binds HER3 is substantially free of antibodies that specifically bind antigens other tha HER3).
- An isolated antibody that specifically binds HER3 may, however, have cross-reactivity to other antigens.
- an isolated antibody may be substantially free of other cellular material and/or chemicals.
- composition is defined herein to refer to a mixture or solution containing at least one therapeutic agent to be administered to a subject, e.g., a mammal or human, in order to treat a particular disease or condition affecting the subject thereof.
- pharmaceutically acceptable is defined herein to refer to those compounds, materials, compositions and/or dosage forms, which are, within the scope of sound medical judgment, suitable for contact with the tissues a subject, e.g., a mammal or human, without excessive toxicity, irritation allergic response and other problem complications commensurate with a reasonable benefit / risk ratio.
- treating comprises a treatment relieving, reducing or alleviating at least one symptom in a subject or effecting a delay of progression of a disease.
- treatment can be the diminishment of one or several symptoms of a disorder or complete eradication of a disorder, such as cancer.
- the term “treat” also denotes to arrest, delay the onset (i.e., the period prior to clinical manifestation of a disease) and/or reduce the risk of developing or worsening a disease.
- jointly therapeutically active or “joint therapeutic effect” as used herein means that the therapeutic agents may be given separately (in a chronologically staggered manner, especially a sequence-specific manner) in such time intervals that they prefer, in the warm-blooded animal, especially human, to be treated, still show a (preferably synergistic) interaction (joint therapeutic effect). Whether this is the case can, inter alia, be determined by following the blood levels, showing that both therapeutic agents are present in the blood of the human to be treated at least during certain time intervals.
- pharmaceutical combination of therapeutic agents is an amount sufficient to provide an observable improvement over the baseline clinically observable signs and symptoms of the breast cancer brain metastases treated with the combination.
- synergistic effect refers to action of two therapeutic agents such as, for example, (a) a compound of formula (I) or a pharmaceutically acceptable salt thereof, and a Her3 antagonist producing an effect, for example, slowing the symptomatic progression of a breast cancer brain metastases or symptoms thereof, which is greater than the simple addition of the effects of each therapeutic agent administered by themselves.
- a synergistic effect can be calculated, for example, using suitable methods such as the Sigmoid-Emax equation (Holford, N. H. G. and Scheiner, L. B., Clin. Pharmacokinet. 6: 429-453 (1981)), the equation of Loewe additivity (Loewe, S. and Muischnek, H., Arch.
- subject or “patient” as used herein includes animals, which are capable of suffering from or afflicted with a breast cancer brain metastases.
- subjects include mammals, e.g., humans, dogs, cows, horses, pigs, sheep, goats, cats, mice, rabbits, rats and transgenic non-human animals.
- the subject is a human, e.g., a human suffering from, at risk of suffering from, or potentially capable of suffering from a breast cancer brain metastases.
- the invention includes an antibody or fragment thereof is as described in WO2012022814, which publication is hereby incorporated into the present
- phrase ⁇ taken Trcm i i presently disclosed method includes an antibody or fragment thereof which recognizes a specific conformational state of HER3 such that the antibody or fragment thereof prevents HER3 from interacting with a co-receptor (including, but not limited to, HER1, HER2 and HER4).
- the antibody or fragment thereof prevents HER3 from interacting with a co -receptor by stabilizing the HER3 receptor in an inactive or closed state.
- the antibody or fragment thereof stabilizes the HER3 receptor by binding to amino acid residues within domain 2 and domain 4 of HER3.
- the dimerization loop located within domain 2 is not exposed and therefore unavailable for dimerization with other co-receptors (including, but not limited to, HER1, HER2 and HER4).
- the antibody recognizes a conformational epitope of a HER3 receptor, wherein the
- conformational epitope comprises amino acid residues within domain 2 and domain 4 of the HER3 receptor, and wherein the antibody or fragment thereof blocks both ligand-dependent and ligand- independent signal transduction.
- the conformational epitope comprises amino acid residues 265-277, 315 (of domain 2), 571, 582-584, 596-597, 600-602, 609-615 (of domain 4), or a subset thereof.
- the VH of the antibody or fragment thereof binds to at least one of the following HER3 residues: Asn266, Lys267, Leu268, Thr269, Gln271, Glu273, Pro274, Asn275, Pro276, His277, Asn315, Asp571, Pro583, His584, Ala596, Lys597.
- the VL of the antibody or fragment thereof binds to at least one of the following HER3 residues: Tyr265, Lys267, Leu268, Phe270, Gly582, Pro583, Lys597, Ile600, Lys602, Glu609, Arg611, Pro612, Cys613, His614, Glu615.
- the isolated antibody or fragment thereof can be a monoclonal antibody, a polyclonal antibody, a chimeric antibody, a humanized antibody, and a synthetic antibody.
- the isolated antibody or fragment thereof can recognize a conformational epitope of a HER3 receptor, wherein the conformational epitope comprises amino acid residues within domain 2 and domain 4 of the HER3 receptor, and wherein the antibody or fragment thereof inhibits phosphorylation of HER3 as assessed by HER3 ligand-dependent phosphorylation assay (e.g., an assay uses stimulated MCF7 cells in the presence of neuregulin (NRG)).
- NRG neuregulin
- the antibody or fragment thereof to a HER3 receptor can have a dissociation (KO) of at least lxlO 7 M-l, 10 8 M-l, 10 9 M-l, 10 10 M-l, 10 11 M- 1, 10 12 M-l, or 10 13 M-l .
- the isolated antibody or fragment thereof can bind to the same conformational epitope as an antibody described in Table 1.
- the antibody or fragment thereof binds to human HER3 protein having a conformational epitope comprising (i) HER3 amino acid residues 265-277 and 315 (of domain 2) and (ii) HER3 amino acid residues 571, 582-584, 596-597, 600-602, 609-615 (of domain 4) of SEQ ID NO: 1, or a subset thereof.
- the antibody or fragment thereof binds to amino acids within or overlapping amino acid residues 265-277 and 315 (of domain 2) and (ii) HER3 amino acid residues 571, 582-584, 596-597, 600-602, 609-615 (of domain 4) of SEQ ID NO: 1.
- the antibody or fragment thereof binds to amino acids within (and/or amino acid sequences consisting of) amino acids 265-277 and 315 (of domain 2) and (ii) HER3 amino acid residues 571, 582-584, 596-597, 600-602, 609-615 (of domain 4) of SEQ ID NO: 1 , or a subset thereof.
- the antibody or fragment thereof binds to the conformational epitope such that it restricts the mobility of domain 2 and domain 4, stabilizing it in an inactive or closed conformation. The failure to form the active conformation results in failure to activate signal transduction.
- the antibody or fragment thereof binds to the conformational epitope such that it occludes the dimerization loop within domain 2, thereby rendering it unavailable for receptor-receptor interaction.
- the failure to form homo- or heterodimers results in failure to activate signal transduction.
- the present invention can utilize HER3 antibodies that recognize a conformational epitope of HER3 such that they block both ligand-dependent and ligand-independent HER3 signal transduction pathways. Such a class of antibodies are disclosed in Table 1.
- the present invention provides antibodies that specifically bind a HER3 protein (e.g., human and/or cynomologus HER3), said antibodies comprising a VH domain having an amino acid sequence of SEQ ID NO: 15, 33, 51, 69, 87, 105, 123, 141, 159, 177, 195, 213, 231, 249, 267, 285, 303, 321, 339, 357, and 375.
- HER3 protein e.g., human and/or cynomologus HER3
- VH domain having an amino acid sequence of SEQ ID NO: 15, 33, 51, 69, 87, 105, 123, 141, 159, 177, 195, 213, 231, 249, 267, 285, 303, 321, 339, 357, and 375.
- the present invention provides antibodies that specifically bind a HER3 protein (e.g., human and/or cynomologus HER3), said antibodies comprising a VL domain having an amino acid sequence of SEQ ID NO: 14, 32, 50, 68, 86, 104, 122, 140, 158, 176, 194, 212, 230, 248, 266, 284, 302, 320, 338, 356, and 374.
- the present invention also provides antibodies that specifically bind to a HER3 protein (e.g., human and/or cynomologus HER3), said antibodies comprising a VH CDR having an amino acid sequence of any one of the VH CDRs listed in Table 1, infra.
- the invention provides antibodies that specifically bind to a HER3 protein (e.g., human and/or cynomologus HER3), said antibodies comprising (or alternatively, consisting of) one, two, three, four, five or more VH CDRs having an amino acid sequence of any of the VH CDRs listed in Table 1 , infra.
- a HER3 protein e.g., human and/or cynomologus HER3
- said antibodies comprising (or alternatively, consisting of) one, two, three, four, five or more VH CDRs having an amino acid sequence of any of the VH CDRs listed in Table 1 , infra.
- antibodies of the invention include amino acids that have been mutated, yet have at least 60, 70, 80, 90, 95, or 98 percent identity in the CDR regions with the CDR regions depicted in the sequences described in Table 1. In some embodiments, it includes mutant amino acid sequences wherein no more than 1, 2, 3, 4 or 5 amino acids have been mutated in the CDR regions when compared with the CDR regions depicted in the sequence described Table 1 , while still maintaining their specificity for the original antibody's epitope
- antibodies of the invention include amino acids that have been mutated, yet have at least 60, 70, 80, 90, 95, or 98 percent identity in the framework regions with the framework regions depicted in the sequences described in Table 1. In some embodiments, it includes mutant amino acid sequences wherein no more than 1, 2, 3, 4, 5, 6, or 7 amino acids have been mutated in the framework regions when compared with the framework regions depicted in the sequence described Table 1, while still maintaining their specificity for the original antibody's epitope.
- the present invention also provides nucleic acid sequences that encode VH, VL, the full length heavy chain, and the full length light chain of the antibodies that specifically bind to a HER3 protein (e.g., human and/or cynomologus HER3).
- HER3 protein e.g., human and/or cynomologus HER3
- the HER3 antibodies of the invention useful in the methods of the invention can bind to the
- conformational epitope of HER3 comprising amino acid residues from domain 2 and domain 4 of HER3.
- Table 1 Examples of HER3 Antibodies useful in the methods of the Present Invention
- SEQ ID NO: 16 DNA VL GATATCCAGATGACCCAGAGCCCGTCTAGCCTGAG
- SEQ ID NO: 70 DNA VL GATATCCAGATGACCCAGAGCCCGTCTAGCCTGAG
- SEQ ID NO: 160 DNA VL GATATCCAGATGACCCAGAGCCCCAGCAGCCTGAG
- SEQ ID NO: 161 DNA VH GAGGTGCAATTGCTGGAAAGCGGCGGAGGCCTGG
- DC ⁇ rCTT7DDCr>T7r>T V CIT A T Tm T ⁇ 7 VDD ⁇ A WfXWV VDNALQSGNSQESVTEQDSKDSTYSLSSTLTLSKADY
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Medicinal Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Veterinary Medicine (AREA)
- Public Health (AREA)
- Animal Behavior & Ethology (AREA)
- Pharmacology & Pharmacy (AREA)
- Immunology (AREA)
- Epidemiology (AREA)
- Oncology (AREA)
- Engineering & Computer Science (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Molecular Biology (AREA)
- Genetics & Genomics (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- Biomedical Technology (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- General Chemical & Material Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Mycology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Microbiology (AREA)
- Cell Biology (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Peptides Or Proteins (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Priority Applications (5)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| JP2017531626A JP6847835B2 (ja) | 2014-12-12 | 2015-12-10 | 乳がん脳転移の処置 |
| CN201580075191.0A CN108367003B (zh) | 2014-12-12 | 2015-12-10 | 乳腺癌脑转移的治疗 |
| EP15816534.0A EP3229803B1 (en) | 2014-12-12 | 2015-12-10 | Treatment of breast cancer brain metastases |
| ES15816534T ES2784900T3 (es) | 2014-12-12 | 2015-12-10 | Tratamiento de metástasis cerebrales del cáncer de mama |
| US15/535,405 US10689459B2 (en) | 2014-12-12 | 2015-12-10 | Treatment of breast cancer brain metastases |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201462091200P | 2014-12-12 | 2014-12-12 | |
| US62/091,200 | 2014-12-12 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2016092508A1 true WO2016092508A1 (en) | 2016-06-16 |
| WO2016092508A9 WO2016092508A9 (en) | 2018-01-11 |
Family
ID=55024190
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/IB2015/059525 Ceased WO2016092508A1 (en) | 2014-12-12 | 2015-12-10 | Treatment of breast cancer brain metastases |
Country Status (6)
| Country | Link |
|---|---|
| US (1) | US10689459B2 (cg-RX-API-DMAC7.html) |
| EP (1) | EP3229803B1 (cg-RX-API-DMAC7.html) |
| JP (1) | JP6847835B2 (cg-RX-API-DMAC7.html) |
| CN (1) | CN108367003B (cg-RX-API-DMAC7.html) |
| ES (1) | ES2784900T3 (cg-RX-API-DMAC7.html) |
| WO (1) | WO2016092508A1 (cg-RX-API-DMAC7.html) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2019149172A1 (zh) * | 2018-02-05 | 2019-08-08 | 中山大学 | Pik3ip1蛋白在调节t细胞反应和制备抗肿瘤药物中的应用 |
Citations (24)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US4522811A (en) | 1982-07-08 | 1985-06-11 | Syntex (U.S.A.) Inc. | Serial injection of muramyldipeptides and liposomes enhances the anti-infective activity of muramyldipeptides |
| US4880078A (en) | 1987-06-29 | 1989-11-14 | Honda Giken Kogyo Kabushiki Kaisha | Exhaust muffler |
| WO1992019244A2 (en) | 1991-05-01 | 1992-11-12 | Henry M. Jackson Foundation For The Advancement Of Military Medicine | A method for treating infectious respiratory diseases |
| US5374548A (en) | 1986-05-02 | 1994-12-20 | Genentech, Inc. | Methods and compositions for the attachment of proteins to liposomes using a glycophospholipid anchor |
| US5399331A (en) | 1985-06-26 | 1995-03-21 | The Liposome Company, Inc. | Method for protein-liposome coupling |
| US5416016A (en) | 1989-04-03 | 1995-05-16 | Purdue Research Foundation | Method for enhancing transmembrane transport of exogenous molecules |
| US5480968A (en) | 1989-12-01 | 1996-01-02 | The United States Of America As Represented By The Department Of Health And Human Services | Isolated polypeptide erbB-3, related to the epidermal growth factor receptor and antibody thereto |
| WO1997032572A2 (en) | 1996-03-04 | 1997-09-12 | The Penn State Research Foundation | Materials and methods for enhancing cellular internalization |
| WO1997044013A1 (en) | 1996-05-24 | 1997-11-27 | Massachusetts Institute Of Technology | Aerodynamically light particles for pulmonary drug delivery |
| WO1998031346A1 (en) | 1997-01-16 | 1998-07-23 | Massachusetts Institute Of Technology | Preparation of particles for inhalation |
| US5855913A (en) | 1997-01-16 | 1999-01-05 | Massachusetts Instite Of Technology | Particles incorporating surfactants for pulmonary drug delivery |
| US5934272A (en) | 1993-01-29 | 1999-08-10 | Aradigm Corporation | Device and method of creating aerosolized mist of respiratory drug |
| US5985309A (en) | 1996-05-24 | 1999-11-16 | Massachusetts Institute Of Technology | Preparation of particles for inhalation |
| WO1999066903A2 (en) | 1998-06-24 | 1999-12-29 | Advanced Inhalation Research, Inc. | Large porous particles emitted from an inhaler |
| US6019968A (en) | 1995-04-14 | 2000-02-01 | Inhale Therapeutic Systems, Inc. | Dispersible antibody compositions and methods for their preparation and use |
| US6316024B1 (en) | 1996-10-11 | 2001-11-13 | Sequus Pharmaceuticals, Inc. | Therapeutic liposome composition and method of preparation |
| US6350466B1 (en) | 1994-08-05 | 2002-02-26 | Targesome, Inc. | Targeted polymerized liposome diagnostic and treatment agents |
| US20050008625A1 (en) | 2003-02-13 | 2005-01-13 | Kalobios, Inc. | Antibody affinity engineering by serial epitope-guided complementarity replacement |
| WO2006122806A2 (en) | 2005-05-20 | 2006-11-23 | Novartis Ag | 1,3-dihydro-imidazo [4,5-c] quinolin-2-ones as lipid kinase inhibitors |
| WO2007084786A1 (en) | 2006-01-20 | 2007-07-26 | Novartis Ag | Pyrimidine derivatives used as pi-3 kinase inhibitors |
| WO2009036082A2 (en) | 2007-09-12 | 2009-03-19 | Genentech, Inc. | Combinations of phosphoinositide 3-kinase inhibitor compounds and chemotherapeutic agents, and methods of use |
| WO2009055730A1 (en) | 2007-10-25 | 2009-04-30 | Genentech, Inc. | Process for making thienopyrimidine compounds |
| WO2012022814A1 (en) | 2010-08-20 | 2012-02-23 | Novartis Ag | Antibodies for epidermal growth factor receptor 3 (her3) |
| WO2014177915A1 (en) * | 2013-05-01 | 2014-11-06 | Piramal Enterprises Limited | Cancer combination therapy using imidazo[4,5-c]quinoline derivatives |
Family Cites Families (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20110033453A1 (en) * | 2008-03-05 | 2011-02-10 | Carlos Garcia-Echeverria | Use of pyrimidine derivatives for the treatment of egfr dependent diseases or diseases that have acquired resistance to agents that target egfr family members |
| EP3590538A1 (en) * | 2011-12-05 | 2020-01-08 | Novartis AG | Antibodies for epidermal growth factor receptor 3 (her3) |
| WO2014028566A1 (en) | 2012-08-16 | 2014-02-20 | Novartis Ag | Combination of pi3k inhibitor and c-met inhibitor |
| EP3539990B1 (en) | 2014-07-16 | 2021-09-08 | Dana-Farber Cancer Institute, Inc. | Her3 inhibition in low-grade serous cancers |
-
2015
- 2015-12-10 ES ES15816534T patent/ES2784900T3/es active Active
- 2015-12-10 US US15/535,405 patent/US10689459B2/en not_active Expired - Fee Related
- 2015-12-10 WO PCT/IB2015/059525 patent/WO2016092508A1/en not_active Ceased
- 2015-12-10 CN CN201580075191.0A patent/CN108367003B/zh not_active Expired - Fee Related
- 2015-12-10 EP EP15816534.0A patent/EP3229803B1/en active Active
- 2015-12-10 JP JP2017531626A patent/JP6847835B2/ja not_active Expired - Fee Related
Patent Citations (27)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US4522811A (en) | 1982-07-08 | 1985-06-11 | Syntex (U.S.A.) Inc. | Serial injection of muramyldipeptides and liposomes enhances the anti-infective activity of muramyldipeptides |
| US5399331A (en) | 1985-06-26 | 1995-03-21 | The Liposome Company, Inc. | Method for protein-liposome coupling |
| US5374548A (en) | 1986-05-02 | 1994-12-20 | Genentech, Inc. | Methods and compositions for the attachment of proteins to liposomes using a glycophospholipid anchor |
| US4880078A (en) | 1987-06-29 | 1989-11-14 | Honda Giken Kogyo Kabushiki Kaisha | Exhaust muffler |
| US5416016A (en) | 1989-04-03 | 1995-05-16 | Purdue Research Foundation | Method for enhancing transmembrane transport of exogenous molecules |
| US5480968A (en) | 1989-12-01 | 1996-01-02 | The United States Of America As Represented By The Department Of Health And Human Services | Isolated polypeptide erbB-3, related to the epidermal growth factor receptor and antibody thereto |
| US5290540A (en) | 1991-05-01 | 1994-03-01 | Henry M. Jackson Foundation For The Advancement Of Military Medicine | Method for treating infectious respiratory diseases |
| WO1992019244A2 (en) | 1991-05-01 | 1992-11-12 | Henry M. Jackson Foundation For The Advancement Of Military Medicine | A method for treating infectious respiratory diseases |
| US5934272A (en) | 1993-01-29 | 1999-08-10 | Aradigm Corporation | Device and method of creating aerosolized mist of respiratory drug |
| US6350466B1 (en) | 1994-08-05 | 2002-02-26 | Targesome, Inc. | Targeted polymerized liposome diagnostic and treatment agents |
| US6019968A (en) | 1995-04-14 | 2000-02-01 | Inhale Therapeutic Systems, Inc. | Dispersible antibody compositions and methods for their preparation and use |
| WO1997032572A2 (en) | 1996-03-04 | 1997-09-12 | The Penn State Research Foundation | Materials and methods for enhancing cellular internalization |
| US5985320A (en) | 1996-03-04 | 1999-11-16 | The Penn State Research Foundation | Materials and methods for enhancing cellular internalization |
| US5874064A (en) | 1996-05-24 | 1999-02-23 | Massachusetts Institute Of Technology | Aerodynamically light particles for pulmonary drug delivery |
| US5985309A (en) | 1996-05-24 | 1999-11-16 | Massachusetts Institute Of Technology | Preparation of particles for inhalation |
| WO1997044013A1 (en) | 1996-05-24 | 1997-11-27 | Massachusetts Institute Of Technology | Aerodynamically light particles for pulmonary drug delivery |
| US6316024B1 (en) | 1996-10-11 | 2001-11-13 | Sequus Pharmaceuticals, Inc. | Therapeutic liposome composition and method of preparation |
| US5855913A (en) | 1997-01-16 | 1999-01-05 | Massachusetts Instite Of Technology | Particles incorporating surfactants for pulmonary drug delivery |
| WO1998031346A1 (en) | 1997-01-16 | 1998-07-23 | Massachusetts Institute Of Technology | Preparation of particles for inhalation |
| WO1999066903A2 (en) | 1998-06-24 | 1999-12-29 | Advanced Inhalation Research, Inc. | Large porous particles emitted from an inhaler |
| US20050008625A1 (en) | 2003-02-13 | 2005-01-13 | Kalobios, Inc. | Antibody affinity engineering by serial epitope-guided complementarity replacement |
| WO2006122806A2 (en) | 2005-05-20 | 2006-11-23 | Novartis Ag | 1,3-dihydro-imidazo [4,5-c] quinolin-2-ones as lipid kinase inhibitors |
| WO2007084786A1 (en) | 2006-01-20 | 2007-07-26 | Novartis Ag | Pyrimidine derivatives used as pi-3 kinase inhibitors |
| WO2009036082A2 (en) | 2007-09-12 | 2009-03-19 | Genentech, Inc. | Combinations of phosphoinositide 3-kinase inhibitor compounds and chemotherapeutic agents, and methods of use |
| WO2009055730A1 (en) | 2007-10-25 | 2009-04-30 | Genentech, Inc. | Process for making thienopyrimidine compounds |
| WO2012022814A1 (en) | 2010-08-20 | 2012-02-23 | Novartis Ag | Antibodies for epidermal growth factor receptor 3 (her3) |
| WO2014177915A1 (en) * | 2013-05-01 | 2014-11-06 | Piramal Enterprises Limited | Cancer combination therapy using imidazo[4,5-c]quinoline derivatives |
Non-Patent Citations (58)
| Title |
|---|
| "Cancer Chemotherapy and Biotherapy", 2001, LIPPINCOTT, WILLIAMS & WILKINS |
| "Goodman and Gilman's The Pharmacological Basis of Therapeutics", 2001, MCGRAW-HILL |
| "Monoclonal Antibodies and Peptide Therapy in Autoimmune Diseases", 1993, MARCEL DEKKER |
| "Monoclonal Antibodies, Cytokines and Arthritis", 1991, MARCEL DEKKER |
| "Pharmaceutical Dosage Forms: Disperse Systems", 1990, MARCEL DEKKER |
| "Pharmaceutical Dosage Forms: Parenteral Medications", 1993, MARCEL DEKKER |
| "Pharmaceutical Dosage Forms: Tablets", 1990, MARCEL DEKKER |
| "Pharmacotherapeutics for Advanced Practice:A Practical Approach", 2001, LIPPINCOTT, WILLIAMS & WILKINS |
| AL-LAZIKANI ET AL., J. MOL. BIOL., vol. 273, 1997, pages 927 - 948 |
| BACHELOT, T. ET AL., THE LANCET ONCOLOGY, vol. 14, 2013, pages 64 - 71 |
| BAERT ET AL., NEW ENGL. J. MED., vol. 348, 2003, pages 601 - 608 |
| BENIAMINOVITZ ET AL., NEW ENGL. J. MED., vol. 342, 2000, pages 613 - 619 |
| BIRD ET AL., SCIENCE, vol. 242, 1988, pages 423 - 426 |
| BLOEMAN ET AL., FEBS LETT, vol. 357, 1995, pages 140 |
| BRISCOE ET AL., AM. J. PHYSIOL., vol. 1233, 1995, pages 134 |
| CHOTHIA ET AL., J. MOL. BIOL., vol. 196, 1987, pages 901 - 917 |
| CHOTHIA ET AL., NATURE, vol. 342, 1989, pages 877 - 883 |
| CHOU, T. C.; TALALAY, P., ADV. ENZYME REGUL., vol. 22, 1984, pages 27 - 55 |
| DENT: "Good Laboratory and Good Clinical Practice", 2001, URCH PUBL. |
| EPSTEIN ET AL., PROC. NATL. ACAD. SCI. USA, vol. 82, 1985, pages 3688 - 3692 |
| GENNARO: "Remington: The Science and Practice of Pharmacy", 2000, LIPPINCOTT, WILLIAMS, AND WILKINS |
| GHOSH ET AL., NEW ENGL. J. MED., vol. 348, 2003, pages 24 - 32 |
| HARDMAN ET AL.: "Goodman and Gilman's The Pharmacological Basis of Therapeutics", 2001, MCGRAW-HILL |
| HEROLD ET AL., NEW ENGL. J. MED., vol. 346, 2002, pages 1692 - 1698 |
| HOLFORD, N. H. G.; SCHEINER, L. B., CLIN. PHARMACOKINET, vol. 6, 1981, pages 429 - 453 |
| HUSTON ET AL., PROC. NATL. ACAD. SCI., vol. 85, 1988, pages 5879 - 5883 |
| HWANG ET AL., PROC. NATL. ACAD. SCI. USA, vol. 77, 1980, pages 4030 - 4034 |
| J LI ET AL.: "Dual inhibition of EGFR at protein and activity level via combinatorial blocking of PI4KIIalpha as antitumor strategy", PROTEIN & CELL, vol. 5, no. 6, June 2014 (2014-06-01), Springer, Berlin, Germany, pages 457 - 468, XP002755587, ISSN: 1078-0432 * |
| J. J. KILLION; I. J. FIDLER, IMMUNOMETHODS, vol. 4, 1994, pages 273 |
| K ALTUNDAG ET AL.: "Rationale for the use of trastuzumab in patients with cerebral metastases who previously receive trastuzumab-based therapy for metastatic breast cancer", BREAST, vol. 14, 2005, EDINBURGH, pages 425, XP002755586, ISSN: 0960-9776 * |
| K. KEINANEN; M. L. LAUKKANEN, FEBS LETT., vol. 346, 1994, pages 123 |
| KABAT ET AL.: "Sequences of Proteins of Immunological Interest", 1991, NIH PUBLICATION NO. 91-3242 |
| KROP, I.E. ET AL., LANCET ONCOL, 2014 |
| LAMPSON, L.A., MABS, vol. 3, 2011, pages 153 - 160 |
| LANGER ET AL., J. BIOMED. MATER. RES., vol. 15, 1981, pages 167 - 277 |
| LANGER, CHEM. TECH., vol. 12, 1982, pages 98 - 105 |
| LIN, N.U. ET AL., CLINICAL CANCER RESEARCH : AN OFFICIAL JOURNAL OF THE AMERICAN ASSOCIATION FOR CANCER RESEARCH, vol. 15, 2009, pages 1452 - 1459 |
| LIN, N.U. ET AL., JOURNAL OF CLINICAL ONCOLOGY, vol. 26, 2008, pages 1993 - 1999 |
| LIPSKY ET AL., NEW ENGL. J. MED., vol. 343, 2000, pages 1594 - 1602 |
| LIU ET AL., J. NEUROL. NEUROSURG. PSYCH., vol. 67, 1999, pages 451 - 456 |
| LOEWE, S.; MUISCHNEK, H., ARCH. EXP. PATHOL PHARMACOL, vol. 114, 1926, pages 313 - 326 |
| MAYNARD ET AL.: "A Handbook of SOPs for Good Clinical Practice", 1996, INTERPHARM PRESS |
| MILGROM ET AL., NEW ENGL. J. MED., vol. 341, 1999, pages 1966 - 1973 |
| OLSON, E.M. ET AL.: "Annals of oncology : official journal of the European Society for Medical Oncology", ESMO, vol. 24, 2013, pages 1526 - 1533 |
| OWAIS ET AL., ANTIMICROB. AGENTS CHEMOTHER, vol. 39, 1995, pages 180 |
| PLOWMAN ET AL., PROC. NATL. ACAD. SCI. USA, vol. 87, 1990, pages 4905 - 4909 |
| PORTIELJI ET AL., CANCER IMMUNOL. IMMUNOTHER, vol. 52, 2003, pages 133 - 144 |
| Q SHE ET AL.: "Resistance to gefitinib in PTEN-Null Her-overexpressing tumor cells can be overcome through restoration of PTEN function or pharmacologic modulation of constitutive phosphatidylinositol 3'-kinase/Akt pathway signaling", CLINICAL CANCER RESEARCH, vol. 9, 1 October 2003 (2003-10-01), THE AMERICAN ASSOCIATION FOR CANCER RESEARCH., pages 4340 - 4346, XP002755585, ISSN: 1078-0432 * |
| RANADE, J. CLIN. PHARMACOL, vol. 29, 1989, pages 685 |
| SCHREIER ET AL., J. BIOL. CHEM., vol. 269, 1994, pages 9090 |
| SIDMAN ET AL., BIOPOLYMERS, vol. 22, 1983, pages 547 - 556 |
| SLAMON ET AL., NEW ENGL. J. MED., vol. 344, 2001, pages 783 - 792 |
| SLAMON, D.J. ET AL., THE NEW ENGLAND JOURNAL OF MEDICINE, vol. 344, 2001, pages 783 - 792 |
| UMEZAWA ET AL., BIOCHEM. BIOPHYS. RES. COMMUN., vol. 153, 1988, pages 1038 |
| WARD ET AL., NATURE, vol. 341, 1989, pages 544 - 546 |
| WAWRZYNCZAK: "Antibody Therapy", 1996, BIOS SCIENTIFIC PUB. LTD |
| WEINER; KOTKOSKIE: "Excipient Toxicity and Safety", 2000, MARCEL DEKKER, INC. |
| YANG ET AL., NEW ENGL. J. MED., vol. 349, 2003, pages 427 - 434 |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2019149172A1 (zh) * | 2018-02-05 | 2019-08-08 | 中山大学 | Pik3ip1蛋白在调节t细胞反应和制备抗肿瘤药物中的应用 |
Also Published As
| Publication number | Publication date |
|---|---|
| JP6847835B2 (ja) | 2021-03-24 |
| CN108367003B (zh) | 2022-01-21 |
| ES2784900T3 (es) | 2020-10-01 |
| EP3229803B1 (en) | 2020-01-29 |
| US20190211110A1 (en) | 2019-07-11 |
| EP3229803A1 (en) | 2017-10-18 |
| US10689459B2 (en) | 2020-06-23 |
| JP2018506511A (ja) | 2018-03-08 |
| WO2016092508A9 (en) | 2018-01-11 |
| CN108367003A (zh) | 2018-08-03 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| AU2022202796B2 (en) | Combination of an anti-CD19 antibody and a Bruton's tyrosine kinase inhibitor and uses thereof | |
| EP2729172B1 (en) | Antibodies against epidermal growth factor receptor (egfr) and uses thereof | |
| CN102812045B (zh) | 用于治疗或预防人表皮生长因子受体‑3(her‑3)相关疾病的材料和方法 | |
| KR102080535B1 (ko) | Her3에 특이적인 결합 분자 및 이의 용도 | |
| EA031184B1 (ru) | БИСПЕЦИФИЧЕСКИЕ К EGFR/c-Met АНТИТЕЛА | |
| KR20220140794A (ko) | c-MET 엑손 14 스킵핑 돌연변이를 갖는 환자의 치료 | |
| JP2023548064A (ja) | 抗cd20/抗cd3二重特異性抗体及び抗cd79b抗体薬物コンジュゲートによる処置のための投与 | |
| KR20240112963A (ko) | 대장암을 치료하기 위한 아미반타맙의 용도 | |
| JP7094329B2 (ja) | 低悪性度漿液性癌におけるher3阻害 | |
| JP2016515132A (ja) | Mek阻害剤化合物のher3/egfr阻害剤化合物との組み合わせ及び使用方法 | |
| TW202342057A (zh) | 用於減少用egfr/met雙特異性抗體治療之患者的輸注相關反應之方法 | |
| US10689459B2 (en) | Treatment of breast cancer brain metastases | |
| TWI881519B (zh) | 使用抗ccr8抗體、化學療法、及免疫療法組合之抗癌療法 | |
| TW202313033A (zh) | 組合療法 | |
| HK40116078A (zh) | 用於减少使用egfr/met双特异性抗体治疗的患者的输注相关反应的方法 | |
| JP2022550325A (ja) | 抗ミュラー管抑制物質抗体およびその使用 |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 15816534 Country of ref document: EP Kind code of ref document: A1 |
|
| ENP | Entry into the national phase |
Ref document number: 2017531626 Country of ref document: JP Kind code of ref document: A |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| REEP | Request for entry into the european phase |
Ref document number: 2015816534 Country of ref document: EP |