WO2016077525A2 - Anti-human thyroglobulin t cell receptors - Google Patents

Anti-human thyroglobulin t cell receptors Download PDF

Info

Publication number
WO2016077525A2
WO2016077525A2 PCT/US2015/060282 US2015060282W WO2016077525A2 WO 2016077525 A2 WO2016077525 A2 WO 2016077525A2 US 2015060282 W US2015060282 W US 2015060282W WO 2016077525 A2 WO2016077525 A2 WO 2016077525A2
Authority
WO
WIPO (PCT)
Prior art keywords
seq
tcr
amino acid
chain
nos
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2015/060282
Other languages
English (en)
French (fr)
Other versions
WO2016077525A3 (en
Inventor
Kenichi Hanada
Qiong J. Wang
James C. Yang
Zhiya Yu
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
US Department of Health and Human Services
Original Assignee
US Department of Health and Human Services
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to US15/524,869 priority Critical patent/US10450372B2/en
Priority to CA2967778A priority patent/CA2967778C/en
Priority to EP15801054.6A priority patent/EP3218404B1/en
Priority to AU2015346350A priority patent/AU2015346350C1/en
Priority to EP20208238.4A priority patent/EP3808770B1/en
Priority to JP2017525625A priority patent/JP6666342B2/ja
Application filed by US Department of Health and Human Services filed Critical US Department of Health and Human Services
Publication of WO2016077525A2 publication Critical patent/WO2016077525A2/en
Publication of WO2016077525A3 publication Critical patent/WO2016077525A3/en
Anticipated expiration legal-status Critical
Priority to US16/586,310 priority patent/US11440956B2/en
Priority to US17/817,599 priority patent/US12275786B2/en
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/26Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against hormones ; against hormone releasing or inhibiting factors
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K39/0005Vertebrate antigens
    • A61K39/0011Cancer antigens
    • A61K39/001144Hormones, e.g. calcitonin
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • A61P35/04Antineoplastic agents specific for metastasis
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/70503Immunoglobulin superfamily
    • C07K14/7051T-cell receptor (TcR)-CD3 complex
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/51Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
    • A61K2039/515Animal cells
    • A61K2039/5156Animal cells expressing foreign proteins
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/30Immunoglobulins specific features characterized by aspects of specificity or valency
    • C07K2317/34Identification of a linear epitope shorter than 20 amino acid residues or of a conformational epitope defined by amino acid residues
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/50Immunoglobulins specific features characterized by immunoglobulin fragments
    • C07K2317/56Immunoglobulins specific features characterized by immunoglobulin fragments variable (Fv) region, i.e. VH and/or VL
    • C07K2317/565Complementarity determining region [CDR]
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/70Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2318/00Antibody mimetics or scaffolds
    • C07K2318/20Antigen-binding scaffold molecules wherein the scaffold is not an immunoglobulin variable region or antibody mimetics
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide

Definitions

  • nucleotide/amino acid sequence listing submitted concurrently herewith and identified as follows: One 68,835 Byte ASCII (Text) file named "722275_ST25.txt,” dated November 1 1 , 2015.
  • An embodiment of the invention provides an isolated or purified T cell receptor (TCR) having antigenic specificity for human thyroglobulin (TG) and comprising an alpha (a) chain complementarity determining region (CDR) 1 comprising the amino acid sequence of SEQ ID NO: 3, an a chain CDR2 comprising the amino acid sequence of SEQ ID NO: 4, an a chain CDR3 comprising the amino acid sequence of SEQ ID NO: 5, a beta ( ⁇ ) chain CDR1 comprising the amino acid sequence of SEQ ID NO: 6, a ⁇ chain CDR2 comprising the amino acid sequence of SEQ ID NO: 7, and a ⁇ chain CDR3 comprising the amino acid sequence of SEQ ID NO: 8.
  • TCR T cell receptor
  • TG thyroglobulin
  • An embodiment of the invention provides an isolated or purified TCR having antigenic specificity for human TG and comprising an a chain CDR 1 comprising the amino acid sequence of SEQ ID NO: 44, an a chain CDR2 comprising the amino acid sequence of SEQ ID NO: 45, an a chain CDR3 comprising the amino acid sequence of SEQ ID NO: 46, a ⁇ chain CDR1 comprising the amino acid sequence of SEQ ID NO: 47, a ⁇ chain CDR2 comprising the amino acid sequence of SEQ ID NO: 48, and a ⁇ chain CDR3 comprising the amino acid sequence of SEQ ID NO: 49.
  • the invention further provides related polypeptides and proteins, as well as related nucleic acids, recombinant expression vectors, host cells, and populations of cells. Further provided by the invention are antibodies, or antigen binding portions thereof, and
  • compositions relating to the TCRs including functional portions and functional variants thereof) of the invention.
  • Figure 1 A is a graph showing the number of copies of TG (black bars), forkhead box El (FOXE1) (horizontally striped bars), iodotyrosine deiodinase (IYD) (slashed bars), thyroid peroxidase (TPO) (boxed bars), and pair box 8 (PAX8) (vertically striped bars) RNA relative to 1 x 10 5 (10 A 5) copies of ⁇ -actin RNA measured in two normal thyroid samples (normal thyroid 1 and 2), one primary thyroid cancer sample, and three lymph node metastasis samples (lymph node metastasis 1 , 2, and 3).
  • Figure I B is a graph showing the number of copies of TG RNA relative to 1 x 10 4 copies of ⁇ -actin RNA measured in various normal tissue samples.
  • FIG. 2 is a graph showing the amount of mouse interferon (IFN)-y (pg/ml) secreted by splenocytes from mice vaccinated with adenovirus encoding TG and stimulated twice in vitro with peptide 2 (NLFGGKFLV (SEQ ID NO: 2)) or peptide 5 (ILQRRFLAV (SEQ ID NO: 32)) when co-cultured with (identifying each bar from left to right): target T2 cells pulsed with MART-1 control peptide (T2/MART) (unshaded bars), T2 cells pulsed with TG cognate peptide (peptide 2 or 5) (grey bars), Cos7-HLA-A*0201 cells that were transfected to express control green fluorescent protein (GFP) (CosA2/GFP) (backslashed bars), Cos7-HLA-A*0201 cells that were transfected to express TG (CosA2/TG) (forward slashed bars), carcinoma cell line
  • Figure 3 A is a graph showing the amount of lFN- ⁇ (pg/ml) measured upon co- culture of effector untransduced (UN) PBL with target T2 cells pulsed with various concentrations (nM) of MART- 1 peptide (closed circles) or TG peptide NLFGGKFLV (SEQ ID NO: 2) (open triangles), effector anti-MART-1 TCR-transduced PBL with target T2 cells pulsed with various concentrations of MART- 1 peptide (open squares) or TG peptide NLFGGKFLV (SEQ ID NO: 2) (diamonds), or effector murine anti-TG TCR (mTG-TCR) (SEQ ID NOs: 1 1 and 12)-transduced PBL with target T2 cells pulsed with various concentrations of MART- 1 peptide (closed triangles) or TG peptide NLFGGKFLV (SEQ ID NO: 2) (open circles).
  • Figure 3B is a graph showing the amount of IFN- ⁇ (pg/ml) measured upon co- culture of effector untransduced (UT) PBL or PBL transduced with an anti-MART-1 TCR (MART) or the murine anti-TG TCR (mTG-TCR) (SEQ ID NOs: 1 1 and 12) with target cells CosA2/GFP cells (small checkered bars), CosA2/MART cells (large checkered bars), CosA2/TG cells (horizontally striped bars), 624Mel cells (vertically striped bars), 938Mel cells (a melanoma-derived cell line that does not express MART-1) (forward slashed bars)), XTC cells (backslashed bars), or XTC/A2 cells (boxed bars).
  • MART anti-MART-1 TCR
  • mTG-TCR murine anti-TG TCR
  • An embodiment of the invention provides an isolated or purified TCR having antigenic specificity for human TG.
  • the inventive TCR (including functional portions and functional variants thereof) may have antigenic specificity for any human TG protein, polypeptide or peptide.
  • the TCR (including functional portions and functional variants thereof) has antigenic specificity for a human TG protein comprising or consisting of the amino acid sequence of SEQ ID NO: 1.
  • the TCR (including functional portions and functional variants thereof) has antigenic specificity for a human TG470-478 peptide comprising or consisting of the amino acid sequence of NLFGGKFLV (SEQ ID NO: 2) or a human TG 3- i 1 peptide comprising or consisting of the amino acid sequence of LVLEIFTLL (SEQ ID NO: 58).
  • the TCR (including functional portions and functional variants thereof) has antigenic specificity for a human TG470-478 peptide comprising or consisting of the amino acid sequence of NLFGGKFLV (SEQ ID NO: 2).
  • the inventive TCRs are able to recognize human TG in a major histocompatibility complex (MHC) class I-dependent manner.
  • MHC class I-dependent manner means that the TCR (including functional portions and functional variants thereof) elicits an immune response upon binding to TG within the context of an MHC class I molecule.
  • the MHC class 1 molecule can be any MHC class I molecule known in the art, e.g., HLA-A molecules.
  • the MHC class I molecule is an HLA-A2 molecule.
  • the TCRs (including functional portions and functional variants thereof) of the invention provide many advantages, including when expressed by cells used for adoptive cell transfer.
  • TG has a high level of expression that is limited to differentiated thyroid cancer and normal thyroid, a dispensable tissue that may have already been removed in thyroid cancer patients.
  • TG is also expressed in neuroblastoma.
  • inventive TCRs advantageously target the destruction of cancer cells while minimizing or eliminating the destruction of normal, non-cancerous, non-thyroid cells, thereby reducing, for example,, by minimizing or eliminating, toxicity.
  • inventive TCRs may, advantageously, successfully treat or prevent TG-positive cancers that do not respond to other types of treatment such as, for example, chemotherapy, surgery, or radiation.
  • inventive TCRs (including functional portions and functional variants thereof) provide highly avid recognition of TG, which may, advantageously, provide the ability to recognize unmanipulated tumor cells (e.g., tumor cells that have not been treated with interferon (IFN)- ⁇ , trans fected with a vector encoding one or both of TG and HLA-A2, pulsed with the TG470- 478 peptide, or a combination thereof).
  • IFN interferon
  • antigenic specificity means that the TCR (including functional portions and functional variants thereof) can specifically bind to and
  • a TCR (including functional portions and functional variants thereof) may be considered to have "antigenic specificity" for TG if T cells expressing the TCR (or functional portion or functional variant thereof) secrete at least about 200 pg/mL or more (e.g., 200 pg/mL or more, 300 pg/mL or more, 400 pg/mL or more, 500 pg mL or more, 600 pg/mL or more, 700 pg/mL or more, 1000 pg/mL or more, 5,000 pg/mL or more, 7,000 pg/mL or more, 10,000 pg/mL or more, 20,000 pg/mL or more, or a range defined by any two of the foregoing values) of IFN- ⁇ upon co-culture with (a) antigen-negative HLA-A2 + target cells pulsed with a low concentration of TG peptide (e.g., about 0.05
  • a TCR (including functional portions and functional variants thereof) may be considered to have "antigenic specificity" for TG if T cells expressing the TCR (or functional portion or functional variant thereof) secrete at least twice as much IFN- ⁇ upon co-culture with (a) antigen-negative HLA-A2 + target cells pulsed with a low concentration of TG peptide or (b) HLA-A2 + target cells into which a nucleotide sequence encoding TG has been introduced such that the target cell expresses TG as compared to the amount of IFN- ⁇ expressed by a negative control.
  • the negative control may be, for example, (i) T cells expressing the TCR (or a functional portion or functional variant thereof), co-cultured with (a) antigen-negative HLA-A2 + target cells pulsed with the same concentration of an irrelevant peptide (e.g., some other peptide with a different sequence from the TG peptide) or (b) HLA-A2 + target cells into which a nucleotide sequence encoding an irrelevant peptide has been introduced such that the target cell expresses the irrelevant peptide, or (ii) untransduced T cells (e.g., derived from PBMC, which do not express the TCR, or a functional portion or functional variant thereof) co-cultured with (a) antigen- negative HLA-A2 + target cells pulsed with the same concentration of TG peptide or (b) HLA- A2 + target cells into which a nucleotide sequence encoding TG has been introduced such that the target cell expresses TG.
  • a TCR (including functional portions and functional variants thereof), may be considered to have "antigenic specificity" for TG if at least twice as many of the numbers of T cells expressing the TCR (or the functional portion or functional variant thereof), secrete IFN- ⁇ upon co-culture with (a) antigen-negative HLA-A2 + target cells pulsed with a low concentration of TG peptide or (b) HLA-A2 + target cells into which a nucleotide sequence encoding TG has been introduced such that the target cell expresses TG as compared to the numbers of negative control T cells that secrete IFN- ⁇ .
  • concentration of peptide and the negative control may be as described herein with respect to other aspects of the invention.
  • the numbers of cells secreting IFN- ⁇ may be measured by methods known in the art such as, for example, ELISPOT.
  • the invention provides a TCR comprising two polypeptides (i.e., polypeptide chains), such as an alpha (a) chain of a TCR, a beta ( ⁇ ) chain of a TCR, a gamma ( ⁇ ) chain of a TCR, a delta ( ⁇ ) chain of a TCR, or a combination thereof.
  • polypeptides of the inventive TCR can comprise any amino acid sequence, provided that the TCR has antigenic specificity for TG.
  • the TCR comprises two polypeptide chains, each of which comprises a variable region comprising a complementarity determining region (CDR)l , a CDR2, and a CDR3 of a TCR.
  • the TCR comprises a first polypeptide chain comprising a CDR1 comprising the amino acid sequence of SEQ ID NO: 3 or 44 (CDR1 of a chain), a CDR2 comprising the amino acid sequence of SEQ ID NO: 4 or 45 (CDR2 of a chain), and a CDR3 comprising the amino acid sequence of SEQ ID NO: 5 or 46 (CDR3 of a chain), and a second polypeptide chain comprising a CDR1 comprising the amino acid sequence of SEQ ID NO: 6 or 47 (CDR1 of ⁇ chain), a CDR2 comprising the amino acid sequence of SEQ ID NO: 7 or 48 (CDR2 of ⁇ chain), and a CDR3 comprising the amino acid sequence of SEQ ID
  • the inventive TCR can comprise any one or more of the amino acid sequences selected from the group consisting of SEQ ID NOs: 3-8 or SEQ ID NOs: 44-49.
  • the TCR comprises the amino acid sequences of SEQ ID NOs: 3-5, SEQ ID NOs: 6-8, SEQ ID NOs: 44-46, or SEQ ID NOs: 47-49.
  • the TCR comprises the amino acid sequences of all of SEQ ID NOs: 3-8 or all of SEQ ID NOs: 44-49.
  • the TCR comprises an amino acid sequence of a variable region of a TCR comprising the CDRs set forth above.
  • the TCR can comprise the amino acid sequence of SEQ ID NO: 9 or 50 (variable region of a chain); SEQ ID NO: 10 or 51 (variable region of ⁇ chain); both SEQ ID NOs: 9 and 10; or both SEQ ID NOs: 50 and 51.
  • the inventive TCR comprises the amino acid sequences of both SEQ ID NOs: 9 and 10 or both SEQ ID NOs: 50 and 51.
  • the TCR further comprises an amino acid sequence of a constant region of a TCR.
  • the TCR can comprise the amino acid sequence of SEQ ID NO: 13 or 52 (constant region of a chain), SEQ ID NO: 14 or 53 (constant region of ⁇ chain), both SEQ ID NOs: 13 and 14, or both SEQ ID NOs: 52 and 53.
  • the inventive TCR comprises the amino acid sequences of both SEQ ID NOs: 13 and 14 or both SEQ ID NOs: 52 and 53.
  • the inventive TCR may comprise a
  • the TCR can comprise an a chain comprising the amino acid sequences of both SEQ ID NO: 9 (variable region of a chain) and SEQ ID NO: 13 (constant region of a chain); a ⁇ chain comprising the amino acid sequences of both SEQ ID NO: 10 (variable region of ⁇ chain) and SEQ ID NO: 14 (constant region of ⁇ chain); an a chain comprising the amino acid sequences of both SEQ ID NO: 50 (variable region of a chain) and SEQ ID NO: 52 (constant region of a chain); a ⁇ chain comprising the amino acid sequences of both SEQ ID NO: 51 (variable region of ⁇ chain) and SEQ ID NO: 53 (constant region of ⁇ chain); the amino acid sequences of all of SEQ ID NOs: 9, 10, 13, and 14; or the amino acid sequences of all of SEQ ID NOs: 50-53.
  • the inventive TCR comprises the amino acid sequences of all of SEQ ID NOs: 9, 10, 13, and 14 or all of SEQ ID NOs: 50-53.
  • the inventive TCR may comprise a
  • the TCR can comprise an a chain comprising the amino acid sequences of all of SEQ ID NOs: 3-5 and 13; a ⁇ chain comprising the amino acid sequences of all of SEQ ID NOs: 6- 8 and 14; or the amino acid sequences of all of SEQ ID NOs: 3-8 and 13-14.
  • the TCR can comprise an a chain comprising the amino acid sequences of all of SEQ ID NOs: 44-46 and 52; a ⁇ chain comprising the amino acid sequences of all of SEQ ID NOs: 47-49 and 53; or the amino acid sequences of all of SEQ ID NOs: 44-49 and 52-53.
  • the inventive TCR can comprise an a chain of a TCR and a ⁇ chain of a TCR.
  • Each of the a chain and ⁇ chain of the inventive TCR can independently comprise any amino acid sequence.
  • the a chain of the inventive TCR can comprise the amino acid sequence of SEQ ID NO: 1 1 or 54.
  • An a chain of this type can be paired with any ⁇ chain of a TCR.
  • the ⁇ chain of the inventive TCR can comprise the amino acid sequence of SEQ ID NO: 12 or 55.
  • the inventive TCR therefore, can comprise the amino acid sequence of SEQ ID NO: 1 1 , SEQ ID NO: 12, SEQ ID NO: 54, SEQ ID NO: 55, both SEQ ID NOs: 1 1 and 12, or both SEQ ID NOs: 54 and 55.
  • the inventive TCR comprises the amino acid sequences of both SEQ ID NOs: 1 1 and 12 or both SEQ ID NOs: 54 and 55.
  • the TCR is a murine TCR or a human TCR.
  • CDR complementarity determining region
  • a TCR comprising (i) all of SEQ ID NOs: 3-8; (ii) SEQ ID NOs: 9 and 10; (iii) SEQ ID NOs: 1 1 and 12; (iv) all of SEQ ID NOs: 3-8 and 13-14; or (v) all of SEQ ID NOs: 9, 10, 13, and 14 is a murine TCR.
  • a TCR comprising (i) all of SEQ ID NOs: 44-49; (ii) SEQ ID NOs: 50 and 51 ; (iii) SEQ ID NOs: 54 and 55; (iv) all of SEQ ID NOs: 44-49 and 52-53; or (v) all of SEQ ID NOs: 50-53 is a human TCR.
  • the murine TCR (including functional portions and functional variants thereof) has antigenic specificity for a human TG470- 78 peptide comprising or consisting of the amino acid sequence of
  • NLFGGKFLV SEQ ID NO: 2
  • the human TCR has antigenic specificity for a human TG3-11 peptide comprising or consisting of the amino acid sequence of LVLEIFTLL (SEQ ID NO: 58).
  • мно variants include a TCR, polypeptide, or protein having substantial or significant sequence identity or similarity to a parent TCR, polypeptide, or protein, which functional variant retains the biological activity of the TCR, polypeptide, or protein of which it is a variant.
  • Functional variants encompass, for example, those variants of the TCR, polypeptide, or protein described herein (the parent TCR, polypeptide, or protein) that retain the ability to specifically bind to TG for which the parent TCR has antigenic specificity or to which the parent polypeptide or protein
  • the functional variant can, for instance, be at least about 30%, 50%, 75%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or more identical in amino acid sequence to the parent TCR, polypeptide, or protein.
  • the functional variant can, for example, comprise the amino acid sequence of the parent TCR, polypeptide, or protein with at least one conservative amino acid substitution.
  • Conservative amino acid substitutions are known in the art, and include amino acid substitutions in which one amino acid having certain physical and/or chemical properties is exchanged for another amino acid that has the same chemical or physical properties.
  • the conservative amino acid substitution can be an acidic amino acid substituted for another acidic amino acid (e.g., Asp or Glu), an amino acid with a nonpolar side chain substituted for another amino acid with a nonpolar side chain (e.g., Ala, Gly, Val, He, Leu, Met, Phe, Pro, Trp, Val, etc.), a basic amino acid substituted for another basic amino acid (Lys, Arg, etc.), an amino acid with a polar side chain substituted for another amino acid with a polar side chain (Asn, Cys, Gin, Ser, Thr, Tyr, etc.), etc.
  • an amino acid with a nonpolar side chain substituted for another amino acid with a nonpolar side chain e.g., Ala, Gly, Val, He, Leu, Met, Phe, Pro, Trp, Val, etc.
  • a basic amino acid substituted for another basic amino acid e.g., Arg, etc.
  • the functional variants can comprise the amino acid sequence of the parent TCR, polypeptide, or protein with at least one non-conservative amino acid substitution. In this case, it is preferable for the non-conservative amino acid
  • the non-conservative amino acid substitution enhances the biological activity of the functional variant, such that the biological activity of the functional variant is increased as compared to the parent TCR, polypeptide, or protein.
  • the TCR (or functional variant thereof), polypeptide, or protein can consist essentially of the specified amino acid sequence or sequences described herein, such that other components of the TCR (or functional variant thereof), polypeptide, or protein, e.g., other amino acids, do not materially change the biological activity of the TCR (or functional variant thereof), polypeptide, or protein.
  • the inventive TCR (or functional variant thereof), polypeptide, or protein can, for example, consist essentially of the amino acid sequence of SEQ ID NO: 1 1 , SEQ ID NO: 12, SEQ ID NO: 54, SEQ ID NO: 55, both SEQ ID NOs: 1 1 and 12, or both SEQ ID NOs: 54 and 55.
  • inventive TCRs (including functional variants thereof), polypeptides, or proteins can consist essentially of the amino acid sequence(s) of SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 50, SEQ ID NO: 51 , both SEQ ID NOs: 9 and 10, or both SEQ ID NOs: 50 and 51.
  • inventive TCRs can consist essentially of the amino acid sequence of SEQ ID NO: 3 or 44 (CDR1 of a chain), SEQ ID NO: 4 or 45 (CDR2 of a chain), SEQ ID NO: 5 or 46 (CDR3 of a chain), SEQ ID NO: 6 or 47 (CDR1 of ⁇ chain), SEQ ID NO: 7 or 48 (CDR2 of ⁇ chain), SEQ ID NO: 8 or 49 (CDR3 of ⁇ chain), or any combination thereof, e.g., SEQ ID NOs: 3-5; 6-8; 3-8; 44-46; 47-49; or [0031]
  • polypeptide comprising a functional portion of any of the TCRs (or functional variants thereof) described herein.
  • polypeptide as used herein includes oligopeptides and refers to a single chain of amino acids connected by one or more peptide bonds.
  • the functional portion can be any portion comprising contiguous amino acids of the TCR (or functional variant thereof) of which it is a part, provided that the functional portion specifically binds to TG.
  • the term "functional portion" when used in reference to a TCR (or functional variant thereof) refers to any part or fragment of the TCR (or functional variant thereof) of the invention, which part or fragment retains the biological activity of the TCR (or functional variant thereof) of which it is a part (the parent TCR or parent functional variant thereof).
  • Functional portions encompass, for example, those parts of a TCR (or functional variant thereof) that retain the ability to specifically bind to TG (e.g., in an HLA-A2-dependent manner), or detect, treat, or prevent cancer, to a similar extent, the same extent, or to a higher extent, as the parent TCR (or functional variant thereof).
  • the functional portion can comprise, for instance, about 10%, 25%, 30%, 50%, 68%, 80%>, 90%, 95%), or more, of the parent TCR (or functional variant thereof).
  • the functional portion can comprise additional amino acids at the amino or carboxy terminus of the portion, or at both termini, which additional amino acids are not found in the amino acid sequence of the parent TCR or functional variant thereof.
  • the additional amino acids do not interfere with the biological function of the functional portion, e.g., specifically binding to TG; and/or having the ability to detect cancer, treat or prevent cancer, etc. More desirably, the additional amino acids enhance the biological activity, as compared to the biological activity of the parent TCR or functional variant thereof.
  • the polypeptide can comprise a functional portion of either or both of the a and ⁇ chains of the TCRs or functional variant thereof of the invention, such as a functional portion comprising one of more of CDR1 , CDR2, and CDR3 of the variable region(s) of the a chain and/or ⁇ chain of a TCR or functional variant thereof of the invention.
  • the polypeptide can comprise a functional portion comprising the amino acid sequence of SEQ ID NO: 3 or 44 (CDR1 of a chain), 4 or 45 (CDR2 of a chain), 5 or 46 (CDR3 of a chain), 6 or 47 (CDR1 of ⁇ chain), 7 or 48 (CDR2 of ⁇ chain), 8 or 49 (CDR3 of ⁇ chain), or a combination thereof.
  • the inventive polypeptide comprises a functional portion comprising the amino acid sequences of SEQ ID NOs: 3-5; 6-8; 44-46; 47- 49; all of SEQ ID NOs: 3-8; or all of SEQ ID NOs: 44-49. More preferably, the polypeptide comprises a functional portion comprising the amino acid sequences of all of SEQ ID NOs: 3-8 or all of SEQ ID NOs: 44-49.
  • the inventive polypeptide can comprise, for instance, the variable region of the inventive TCR or functional variant thereof comprising a combination of the CDR regions set forth above.
  • the polypeptide can comprise the amino acid sequence of SEQ ID NO: 9 or 50 (variable region of a chain), SEQ ID NO: 10 or 51 (variable region of ⁇ chain), both SEQ ID NOs: 9 and 10, or both SEQ ID NOs: 50 and 51.
  • the polypeptide comprises the amino acid sequences of both SEQ ID NOs: 9 and 10 or both SEQ ID NOs: 50 and 51.
  • the inventive polypeptide can further comprise the constant region of the inventive TCR or functional variant thereof set forth above.
  • the polypeptide can comprise the amino acid sequence of SEQ ID NO: 13 or 52 (constant region of a chain), SEQ ID NO: 14 or 53 (constant region of ⁇ chain), both SEQ ID NOs: 13 and 14; or both SEQ ID NOs: 52 and 53.
  • the polypeptide comprises the amino acid sequences of both SEQ ID NOs: 13 and 14 or both SEQ ID NOs: 52 and 53.
  • the inventive polypeptide may comprise a combination of a variable region and a constant region of the inventive TCR or functional variant thereof.
  • the polypeptide can comprise the amino acid sequences of both SEQ ID NO: 9 (variable region of a chain) and SEQ ID NO: 13 (constant region of a chain), both SEQ ID NO: 10 (variable region of ⁇ chain) and SEQ ID NO: 14 (constant region of ⁇ chain), or all of SEQ ID NOs: 9, 10, 13, and 14.
  • the polypeptide can comprise the amino acid sequences of both SEQ ID NO: 50 (variable region of a chain) and SEQ ID NO: 52 (constant region of a chain), both SEQ ID NO: 51 (variable region of ⁇ chain) and SEQ ID NO: 53 (constant region of ⁇ chain), or all of SEQ ID NOs: 50-53.
  • the polypeptide comprises the amino acid sequences of all of SEQ ID NOs: 9, 10, 13, and 14 or all of SEQ ID NOs: 50-53.
  • the inventive polypeptide may comprise a combination of any of the CDR regions described herein and a constant region of the inventive TCR or functional variant thereof.
  • the polypeptide can comprise the amino acid sequences of all of SEQ ID NOs: 3-5 and 13, all of SEQ ID NOs: 6-8 and 14, or all of SEQ ID NOs: 3-8 and 13- 14.
  • the polypeptide can comprise the amino acid sequences of all of SEQ ID NOs: 44-46 and 52, all of SEQ ID NOs: 47-49 and 53, or all of SEQ ID NOs: 44-49 and 52-53.
  • the polypeptide comprises the amino acid sequences of all of SEQ ID NOs: 3-8 and 13-14 or all of SEQ ID NOs: 44-49 and 52-53.
  • the inventive polypeptide can comprise the entire length of an a or ⁇ chain of the TCR or functional variant thereof described herein.
  • the inventive polypeptide can comprise the amino acid sequence of SEQ ID NO:
  • polypeptide comprises the amino acid sequences of both SEQ ID NOs: 1 1 and 12 or both SEQ ID NOs: 54 and 55.
  • the invention further provides a protein comprising at least one of the polypeptides described herein.
  • protein is meant a molecule comprising one or more polypeptide chains.
  • the protein of the invention can comprise a first polypeptide chain comprising the amino acid sequences of SEQ ID NOs: 3-5 or SEQ ID NOs: 44-46 and a second polypeptide chain comprising the amino acid sequence of SEQ ID NOs: 6-8 or SEQ ID NOs: 47-49.
  • the protein of the invention can comprise a first polypeptide chain comprising the amino acid sequence of SEQ ID NO: 9 or 50 and a second polypeptide chain comprising the amino acid sequence of SEQ ID NO: 10 or 51.
  • the protein can, for example, comprise a first polypeptide chain comprising (i) the amino acid sequences of both SEQ ID NOs: 9 and 13 or all of SEQ ID NOs: 3-5 and 13 and a second polypeptide chain comprising the amino acid sequences of both SEQ ID NOs: 10 and 14 or all of SEQ ID NOs: 6-8 and 14 or (ii) the amino acid sequences of both SEQ ID NOs: 50 and 52 or all of SEQ ID NOs: 44-46 and 52 and a second polypeptide chain comprising the amino acid sequences of both SEQ ID NOs: 51 and 53 or all of SEQ ID NOs: 47-49 and 53.
  • the protein of the invention can comprise a first polypeptide chain comprising the amino acid sequence of SEQ ID NO: 1 1 or 54 and a second polypeptide chain comprising the amino acid sequence of SEQ ID NO: 12 or 55.
  • the protein of the invention can be a TCR.
  • the protein comprises a single polypeptide chain comprising the amino acid sequences of both SEQ ID NOs: 1 1 and
  • the invention also provides a fusion protein comprising at least one of the inventive polypeptides described herein along with at least one other polypeptide.
  • the other polypeptide can exist as a separate polypeptide of the fusion protein, or can exist as a polypeptide, which is expressed in frame (in tandem) with one of the inventive polypeptides described herein.
  • the other polypeptide can encode any peptidic or proteinaceous molecule, or a portion thereof, including, but not limited to an immunoglobulin, CD3, CD4, CD8, an MHC molecule, a CD1 molecule, e.g., CDla, CDlb, CDl c, CDld, etc.
  • the fusion protein can comprise one or more copies of the inventive polypeptide and/or one or more copies of the other polypeptide.
  • the fusion protein can comprise 1 , 2, 3, 4, 5, or more, copies of the inventive polypeptide and/or of the other polypeptide.
  • Suitable methods of making fusion proteins are known in the art, and include, for example, recombinant methods.
  • the TCRs (and functional portions and functional variants thereof), polypeptides, and proteins of the invention may be expressed as a single protein comprising a linker peptide linking the a chain and the ⁇ chain.
  • the linker peptide may advantageously facilitate the expression of a recombinant TCR (including functional portions and functional variants thereof),
  • the linker peptide may comprise any suitable amino acid sequence.
  • the TCR (or functional portion or variant thereof), polypeptide, or protein comprises a self-cleaving, viral linker peptide.
  • the linker peptide may comprise SEQ ID NO: 28.
  • the protein of the invention can be a recombinant antibody comprising at least one of the inventive polypeptides described herein.
  • "recombinant antibody” refers to a recombinant (e.g., genetically engineered) protein comprising at least one of the polypeptides of the invention and a polypeptide chain of an antibody, or a portion thereof.
  • the polypeptide of an antibody, or portion thereof can be a heavy chain, a light chain, a variable or constant region of a heavy or light chain, a single chain variable fragment (scFv), or an Fc, Fab, or F(ab) 2 ' fragment of an antibody, etc.
  • the polypeptide chain of an antibody, or portion thereof can exist as a separate polypeptide of the recombinant antibody.
  • polypeptide chain of an antibody, or portion thereof can exist as a polypeptide, which is expressed in frame (in tandem) with the polypeptide of the invention.
  • the polypeptide of an antibody, or portion thereof can be a polypeptide of any antibody or any antibody fragment, including any of the antibodies and antibody fragments described herein.
  • the TCRs, polypeptides, and proteins of the invention can be of any length, i.e., can comprise any number of amino acids, provided that the TCRs, polypeptides, or proteins (or functional variants thereof) retain their biological activity, e.g., the ability to specifically bind to TG; detect cancer in a mammal; or treat or prevent cancer in a mammal, etc.
  • the polypeptide can be in the range of from about 50 to about 5000 amino acids long, such as 50, 70, 75, 100, 125, 150, 175, 200, 300, 400, 500, 600, 700, 800, 900, 1000 or more amino acids in length.
  • the polypeptides of the invention also include oligopeptides.
  • the TCRs, polypeptides, and proteins of the invention (including functional variants thereof) of the invention can comprise synthetic amino acids in place of one or more naturally-occurring amino acids.
  • synthetic amino acids include, for example, aminocyclohexane carboxylic acid, norleucine, a-amino n-decanoic acid, homoserine, S-acetylaminomethyl-cysteine, trans-3- and trans-4-hydroxyproline, 4- aminophenylalanine, 4- nitrophenylalanine, 4-chlorophenylalanine, 4-carboxyphenylalanine, ⁇ -phenylserine ⁇ -hydroxyphenyl alanine, phenyl glycine, a-naphthylalanine,
  • TCRs, polypeptides, and proteins of the invention can be glycosylated, amidated, carboxylated, phosphorylated, esterified, N- acylated, cyclized via, e.g., a disulfide bridge, or converted into an acid addition salt and/or optionally dimerized or polymerized, or conjugated.
  • the TCR, polypeptide, and/or protein of the invention can be obtained by methods known in the art such as, for example, de novo synthesis.
  • polypeptides and proteins can be recombinantly produced using the nucleic acids described herein using standard recombinant methods. See, for instance, Green and Sambrook, Molecular Cloning: A Laboratory Manual, 4 th ed., Cold Spring Harbor Press, Cold Spring Harbor, NY (2012).
  • the TCRs, polypeptides, and/or proteins described herein (including functional variants thereof) can be commercially synthesized by companies, such as Synpep (Dublin, CA), Peptide Technologies Corp. (Gaithersburg, MD), and Multiple Peptide Systems (San Diego, CA).
  • the inventive TCRs can be commercially synthesized by companies, such as Synpep (Dublin, CA), Peptide Technologies Corp. (Gaithersburg, MD), and Multiple Peptide Systems (San Diego, CA).
  • the inventive TCRs can be commercially synthesized
  • polypeptides, and proteins can be synthetic, recombinant, isolated, and/or purified.
  • conjugates e.g., bioconjugates, comprising any of the inventive TCRs, polypeptides, or proteins (including any of the functional variants thereof), nucleic acids, recombinant expression vectors, host cells, populations of host cells, or antibodies, or antigen binding portions thereof.
  • Conjugates, as well as methods of synthesizing conjugates in general, are known in the art.
  • nucleic acid comprising a nucleotide sequence encoding any of the TCRs (including functional portions and functional valiants thereof), polypeptides, or proteins described herein.
  • Nucleic acid includes “polynucleotide,” “oligonucleotide,” and “nucleic acid molecule,” and generally means a polymer of DNA or RNA, which can be single-stranded or double-stranded, synthesized or obtained (e.g., isolated and/or purified) from natural sources, which can contain natural, non- natural or altered nucleotides, and which can contain a natural, non-natural or altered internucleotide linkage, such as a phosphoroamidate linkage or a phosphorothioate linkage, instead of the phosphodiester found between the nucleotides of an unmodified
  • the nucleic acid comprises complementary DNA (cDNA). It is generally preferred that the nucleic acid does not comprise any insertions, deletions, inversions, and/or substitutions. However, it may be suitable in some instances, as discussed herein, for the nucleic acid to comprise one or more insertions, deletions, inversions, and/or substitutions. [0051] Preferably, the nucleic acids of the invention are recombinant.
  • the term "recombinant” refers to (i) molecules that are constructed outside living cells by joining natural or synthetic nucleic acid segments to nucleic acid molecules that can replicate in a living cell, or (ii) molecules that result from the replication of those described in (i) above.
  • the replication can be in vitro replication or in vivo replication.
  • the nucleic acids can be constructed based on chemical synthesis and/or enzymatic ligation reactions using procedures known in the art. See, for example, Green and Sambrook et al., supra.
  • a nucleic acid can be chemically synthesized using naturally occurring nucleotides or variously modified nucleotides designed to increase the biological stability of the molecules or to increase the physical stability of the duplex formed upon hybridization (e.g., phosphorothioate derivatives and acridine substituted nucleotides).
  • modified nucleotides that can be used to generate the nucleic acids include, but are not limited to, 5-fluorouracil, 5-bromouracil, 5-chlorouracil, 5-iodouracil, hypoxanthine, xanthine, 4-acetylcytosine, 5-(carboxyhydroxymethyl) uracil, 5-carboxymethylaminomethyl- 2-thiouridine, 5-carboxymethylaminomethyluracil, dihydrouracil, beta-D-galactosylqueosine, inosine, N 6 -isopentenyladenine, 1 -methyl guanine, 1 -methylinosine, 2,2-dimethyl guanine, 2- methyladenine, 2-methylguanine, 3-methylcytosine, 5-methylcytosine, N 6 -substituted adenine, 7-methylguanine, 5-methylaminomethyluracil, 5-methoxyaminomethyl-2-thiouracil, beta-
  • the nucleic acid can comprise any nucleotide sequence which encodes any of the TCRs (including functional portions and functional variants thereof), polypeptides, or proteins described herein.
  • the nucleic acid may comprise the nucleotide sequence of SEQ ID NO: 22 (CDR1 of a chain); the nucleotide sequence of SEQ ID NO: 23 (CDR2 of a chain); the nucleotide sequence of SEQ ID NO: 24 (CDR3 of a chain); the nucleotide sequence of SEQ ID NO: 25 (CDR1 of ⁇ chain); the nucleotide sequence of SEQ ID NO: 26 (CDR2 of ⁇ chain); or the nucleotide sequence of SEQ ID NO: 27 (CDR3 of (3 chain).
  • the nucleic acid comprises the nucleotide sequences of all of SEQ ID NOs: 22-24; all of SEQ ID NOs: 25-27; or all of SEQ ID NOs: 22-27.
  • the nucleic acid comprises the nucleotide sequences of all of SEQ ID NOs: 22-27.
  • the nucleic acid may comprise the nucleotide sequence of SEQ ID NO: 15 (variable region a chain); SEQ ID NO: 16 (variable region ⁇ chain); or both SEQ ID NOs: 15 and 16.
  • the nucleic acid comprises the nucleotide sequences of both SEQ ID NOs: 15 and 16.
  • the nucleic acid may comprise the nucleotide sequence of SEQ ID NO: 17 or 56 (full-length a chain); SEQ ID NO: 18 or 57 (full length ⁇ chain); both of SEQ ID NOs: 17 and 18, or both of SEQ ID NOs: 56 and 57.
  • the nucleic acid comprises the nucleotide sequences of both of SEQ ID NOs: 17 and 18 or both of SEQ ID NOs: 56 and 57.
  • the nucleic acid further comprises a nucleotide sequence that encodes the constant region of a TCR a or ⁇ chain.
  • any of the nucleic acids described herein may further comprise the nucleotide sequence of SEQ ID NO: 19 (constant region of a chain); SEQ ID NO: 20 (constant region of ⁇ chain); or both SEQ ID NOs: 19 and 20.
  • the nucleic acid comprises the nucleotide sequence of both SEQ ID NOs: 15 and 19; both SEQ ID NOs: 16 and 20; all of SEQ ID NOs: 15-16 and 19-20; all of SEQ ID NOs: 22-24 and 19; all of SEQ ID NOs: 25-27 and 20; or all of SEQ ID NOs: 22- 27 and 19-20.
  • the nucleic acid comprises the nucleotide sequences of all of SEQ ID NOs: 15-16 and 19-20 or all of SEQ ID NOs: 22-27 and 19-20.
  • a nucleic acid comprising the nucleotide sequences of SEQ ID NOs: 56 and 57 encodes a human TCR.
  • the invention also provides a nucleic acid comprising a nucleotide sequence which is complementary to the nucleotide sequence of any of the nucleic acids described herein or a nucleotide sequence which hybridizes under stringent conditions to the nucleotide sequence of any of the nucleic acids described herein.
  • the nucleotide sequence which hybridizes under stringent conditions preferably hybridizes under high stringency conditions.
  • high stringency conditions ' ' is meant that the nucleotide sequence specifically hybridizes to a target sequence (the nucleotide sequence of any of the nucleic acids described herein) in an amount that is detectably stronger than non-specific hybridization.
  • High stringency conditions include conditions which would distinguish a polynucleotide with an exact complementary sequence, or one containing only a few scattered mismatches from a random sequence that happened to have a few small regions (e.g., 3-10 bases) that matched the nucleotide sequence. Such small regions of
  • Relatively high stringency conditions would include, for example, low salt and/or high temperature conditions, such as provided by about 0.02-0.1 M NaCl or the equivalent, at temperatures of about 50-70 °C.
  • Such high stringency conditions tolerate little, if any, mismatch between the nucleotide sequence and the template or target strand, and are particularly suitable for detecting expression of any of the inventive TCRs (including functional portions and functional variants thereof). It is generally appreciated that conditions can be rendered more stringent by the addition of increasing amounts of formamide.
  • the invention also provides a nucleic acid comprising a nucleotide sequence that is at least about 70% or more, e.g., about 80%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identical to any of the nucleic acids described herein.
  • the nucleic acid may consist essentially of any of the nucleotide sequences described herein.
  • the nucleic acids of the invention can be incorporated into a recombinant expression vector.
  • the invention provides a recombinant expression vector comprising any of the nucleic acids of the invention.
  • the recombinant expression vector comprises a nucleotide sequence encoding the a chain, the ⁇ chain, and linker peptide.
  • the recombinant expression vector comprises the nucleotide sequence of SEQ ID NO: 21 (encoding a and ⁇ chains SEQ ID NOs: 1 1 and 12 with a linker positioned between them).
  • the term "recombinant expression vector” means a genetically-modified oligonucleotide or polynucleotide construct that penults the expression of an mRNA, protein, polypeptide, or peptide by a host cell, when the construct comprises a nucleotide sequence encoding the mRNA, protein, polypeptide, or peptide, and the vector is contacted with the cell under conditions sufficient to have the mRNA, protein, polypeptide, or peptide expressed within the cell.
  • the vectors of the invention are not naturally-occurring as a whole. However, parts of the vectors can be naturally-occurring.
  • the inventive recombinant expression vectors can comprise any type of nucleotide, including, but not limited to DNA and RNA, which can be single-stranded or double-stranded, synthesized or obtained in part from natural sources, and which can contain natural, non-natural or altered nucleotides.
  • the recombinant expression vectors can comprise naturally-occurring, non- naturally-occurring internucleotide linkages, or both types of linkages.
  • the non- naturally occurring or altered nucleotides or internucleotide linkages does not hinder the transcription or replication of the vector.
  • the recombinant expression vector of the invention can be any suitable recombinant expression vector, and can be used to transform or transfect any suitable host cell.
  • Suitable vectors include those designed for propagation and expansion or for expression or both, such as plasmids and viruses.
  • the vector can be selected from the group consisting of the pUC series (Fermentas Life Sciences), the pBluescript series (Stratagene, LaJolla, CA), the pET series (Novagen, Madison, WI), the pGEX series (Pharmacia Biotech, Uppsala, Sweden), and the pEX series (Clontech, Palo Alto, CA).
  • Bacteriophage vectors such as ⁇ ⁇ , ⁇ 1 , Zapll (Stratagene), ⁇ and ⁇ 149, also can be used.
  • plant expression vectors include pB!Ol , pBH Ol .2, pBI101.3, pBI121 and pBIN19
  • the recombinant expression vector is a viral vector, e.g., a retroviral vector.
  • the recombinant expression vector is an MSGV 1 vector.
  • the recombinant expression vectors of the invention can be prepared using standard recombinant DNA techniques described in, for example, Green and Sambrook et al., supra. Constructs of expression vectors, which are circular or linear, can be prepared to contain a replication system functional in a prokaryotic or eukaryotic host cell. Replication systems can be derived, e.g., from ColEl, 2 ⁇ plasmid, ⁇ , SV40, bovine papillomavirus, and the like.
  • the recombinant expression vector comprises regulatory sequences, such as transcription and translation initiation and termination codons, which are specific to the type of host cell (e.g., bacterium, fungus, plant, or animal) into which the vector is to be introduced, as appropriate and taking into consideration whether the vector is DNA- or RNA- based.
  • the recombinant expression vector can include one or more marker genes, which allow for selection of transformed or transfected host cells. Marker genes include biocide resistance, e.g., resistance to antibiotics, heavy metals, etc., complementation in an auxotrophic host cell to provide prototrophy, and the like. Suitable marker genes for the inventive expression vectors include, for instance, neomycin/G418 resistance genes, hygromycin resistance genes, histidinol resistance genes, tetracycline resistance genes, and ampicillin resistance genes.
  • the recombinant expression vector can comprise a native or nonnative promoter operably linked to the nucleotide sequence encoding the TCR, polypeptide, or protein (including functional variants thereof), or to the nucleotide sequence which is complementary to or which hybridizes to the nucleotide sequence encoding the TCR, polypeptide, or protein (including functional variants thereof).
  • promoters e.g., strong, weak, inducible, tissue-specific and developmental-specific, is within the ordinary skill of the artisan.
  • the combining of a nucleotide sequence with a promoter is also within the skill of the artisan.
  • the promoter can be a non-viral promoter or a viral promoter, e.g., a cytomegalovirus (CMV) promoter, an SV40 promoter, an RSV promoter, and a promoter found in the long-terminal repeat of the murine stem cell virus.
  • CMV cytomegalovirus
  • the inventive recombinant expression vectors can be designed for either transient expression, for stable expression, or for both. Also, the recombinant expression vectors can be made for constitutive expression or for inducible expression. Further, the recombinant expression vectors can be made to include a suicide gene.
  • suicide gene refers to a gene that causes the cell expressing the suicide gene to die.
  • the suicide gene can be a gene that confers sensitivity to an agent, e.g., a drug, upon the cell in which the gene is expressed, and causes the cell to die when the cell is contacted with or exposed to the agent.
  • Suicide genes are known in the art and include, for example, the Herpes Simplex Virus (HSV) thymidine kinase (TK) gene, cytosine daminase, purine nucleoside phosphorylase, and nitroreductase.
  • Another embodiment of the invention further provides a host cell comprising any of the recombinant expression vectors described herein.
  • the term "host cell” refers to any type of cell that can contain the inventive recombinant expression vector.
  • the host cell can be a eukaryotic cell, e.g., plant, animal, fungi, or algae, or can be a prokaryotic cell, e.g., bacteria or protozoa.
  • the host cell can be a cultured cell or a primary cell, i.e., isolated directly from an organism, e.g., a human.
  • the host cell can be an adherent cell or a suspended cell, i.e., a cell that grows in suspension.
  • Suitable host cells are known in the art and include, for instance, DH5a E. coli cells, Chinese hamster ovarian cells, monkey VERO cells, COS cells, HEK293 cells, and the like.
  • the host cell is preferably a prokaryotic cell, e.g., a DH5a cell.
  • the host cell is preferably a mammalian cell. Most preferably, the host cell is a human cell.
  • the host cell can be of any cell type, can originate from any type of tissue, and can be of any developmental stage, the host cell preferably is a peripheral blood lymphocyte (PBL) or a peripheral blood mononuclear cell (PBMC). More preferably, the host cell is a T cell.
  • PBL peripheral blood lymphocyte
  • PBMC peripheral blood mononuclear cell
  • the T cell can be any T cell, such as a cultured T cell, e.g., a primary T cell, or a T cell from a cultured T cell line, e.g., Jurkat, SupTl , etc., or a T cell obtained from a mammal. If obtained from a mammal, the T cell can be obtained from numerous sources, including but not limited to blood, bone marrow, lymph node, the thymus, or other tissues or fluids. T cells can also be enriched for or purified. Preferably, the T cell is a human T cell.
  • the T cell can be any type of T cell and can be of any developmental stage, including but not limited to, CD4 + /CD8 + double positive T cells, CD4 + helper T cells, e.g., Th) and Th 2 cells, CD4 + T cells, CD8 + T cells (e.g., cytotoxic T cells), tumor infiltrating lymphocytes (TILs), memory T cells (e.g., central memory T cells and effector memory T cells), naive T cells, and the like.
  • CD4 + /CD8 + double positive T cells CD4 + helper T cells, e.g., Th) and Th 2 cells
  • CD4 + T cells e.g., CD8 + T cells
  • CD8 + T cells e.g., cytotoxic T cells
  • TILs tumor infiltrating lymphocytes
  • memory T cells e.g., central memory T cells and effector memory T cells
  • naive T cells e.g., naive T cells, and the like.
  • the population of cells can be a heterogeneous population comprising the host cell comprising any of the recombinant expression vectors described, in addition to at least one other cell, e.g., a host cell (e.g., a T cell), which does not comprise any of the recombinant expression vectors, or a cell other than a T cell, e.g., a B cell, a host cell (e.g., a T cell), which does not comprise any of the recombinant expression vectors, or a cell other than a T cell, e.g., a B cell, a
  • the population of cells can be a substantially homogeneous population, in which the population comprises mainly of host cells (e.g., consisting essentially of) comprising the recombinant expression vector.
  • the population also can be a clonal population of cells, in which all cells of the population are clones of a single host cell comprising a recombinant expression vector, such that all cells of the population comprise the recombinant expression vector.
  • the population of cells is a clonal population comprising host cells comprising a recombinant expression vector as described herein.
  • the numbers of cells in the population may be rapidly expanded. Expansion of the numbers of T cells can be accomplished by any of a number of methods as are known in the art as described in, for example, U.S. Patent
  • expansion of the numbers of T cells is carried out by culturing the T cells with O T3 antibody, IL-2, and feeder PBMC (e.g., irradiated allogeneic PBMC).
  • O T3 antibody, IL-2, and feeder PBMC e.g., irradiated allogeneic PBMC
  • the invention further provides an antibody, or antigen binding portion thereof, which specifically binds to a functional portion of any of the TCRs (or functional variant thereof) described herein.
  • the functional portion specifically binds to the cancer antigen, e.g., the functional portion comprising the amino acid sequence SEQ ID NO: 3 or 44 (CDRl of a chain), 4 or 45 (CDR2 of a chain), 5 or 46 (CDR3 of a chain), 6 or 47 (CDRl of ⁇ chain), 7 or 48 (CDR2 of ⁇ chain), 8 or 49 (CDR3 of ⁇ chain), SEQ ID NO: 9 or 50 (variable region of a chain), SEQ ID NO: 10 or 51 (variable region of ⁇ chain), or a combination thereof, e.g., 3-5; 44-46; 6-8; 47-49; 3-8; 44-49; 9; 10; 50; 51 ; 9-10 or 50-51.
  • the functional portion comprises the amino acid sequences of SEQ ID NOs: 3-8, SEQ ID NOs: 44-49, SEQ ID NOs: 9 and 10, or SEQ ID NOs: 50 and 51.
  • the antibody, or antigen binding portion thereof binds to an epitope which is formed by all 6 CDRs (CDRl -3 of the a chain and CDRl-3 of the ⁇ chain).
  • the antibody can be any type of immunoglobulin that is known in the art.
  • the antibody can be of any isotype, e.g., IgA, IgD, IgE, IgG, IgM, etc.
  • the antibody can be monoclonal or polyclonal.
  • the antibody can be a naturally-occurring antibody, e.g., an antibody isolated and/or purified from a mammal, e.g., mouse, rabbit, goat, horse, chicken, hamster, human, etc.
  • the antibody can be a genetically-engineered antibody, e.g., a humanized antibody or a chimeric antibody.
  • the antibody can be in monomeric or polymeric form.
  • the antibody can have any level of affinity or avidity for the functional portion of the inventive TCR (or functional variant thereof).
  • the antibody is specific for the functional portion of the inventive TCR (or functional variants thereof), such that there is minimal cross-reaction with other peptides or proteins.
  • Methods of testing antibodies for the ability to bind to any functional portion or functional variant of the inventive TCR include any antibody- antigen binding assay, such as, for example, radioimmunoassay (RIA), ELISA, Western blot, immunoprecipitation, and competitive inhibition assays.
  • RIA radioimmunoassay
  • ELISA ELISA
  • Western blot Western blot
  • immunoprecipitation immunoprecipitation
  • Suitable methods of making antibodies are known in the art. For instance, standard hybridoma methods are described in, e.g., C.A. Janeway et al. (eds.),
  • Phage display can also be used to generate the antibody of the invention.
  • phage libraries encoding antigen-binding variable (V) domains of antibodies can be generated using standard molecular biology and recombinant DNA techniques (see, e.g., Green and Sambrook et al. (eds.), Molecular Cloning, A Laboratory Manual, 4 th Edition, Cold Spring Harbor Laboratory Press, New York (2012)).
  • Phage encoding a variable region with the desired specificity are selected for specific binding to the desired antigen, and a complete or partial antibody is reconstituted comprising the selected variable domain.
  • Nucleic acid sequences encoding the reconstituted antibody are introduced into a suitable cell line, such as a myeloma cell used for hybridoma production, such that antibodies having the characteristics of monoclonal antibodies are secreted by the cell (see, e.g., Janeway et al., supra).
  • Antibodies can also be produced by transgenic mice that are transgenic for specific heavy and light chain immunoglobulin genes. Such methods are known in the art and described in, for example, Janeway et al.; supra.
  • the invention also provides antigen binding portions of any of the antibodies described herein.
  • the antigen binding portion can be any portion that has at least one antigen binding site, such as Fab, F(ab') 2 , dsFv, sFv, diabodies, and triabodies.
  • a single-chain variable region fragment (sFv) antibody fragment which consists of a truncated Fab fragment comprising the variable (V) domain of an antibody heavy chain linked to a V domain of a light antibody chain via a synthetic peptide, can be generated using routine recombinant DNA technology techniques (see, e.g., Janeway et al., supra). Similarly, disulfide-stabilized variable region fragments (dsFv) can be prepared by recombinant DNA technology.
  • Antibody fragments of the invention are not limited to these exemplary types of antibody fragments.
  • the antibody, or antigen binding portion thereof can be modified to comprise a detectable label, such as, for instance, a radioisotope, a fluorophore (e.g., fluorescein isothiocyanate (FITC), phycoerythrin (PE)), an enzyme (e.g., alkaline
  • a detectable label such as, for instance, a radioisotope, a fluorophore (e.g., fluorescein isothiocyanate (FITC), phycoerythrin (PE)), an enzyme (e.g., alkaline
  • element particles e.g., gold particles
  • inventive TCRs, polypeptides, proteins, (including functional variants thereof), nucleic acids, recombinant expression vectors, host cells (including populations thereof), and antibodies (including antigen binding portions thereof), can be isolated and/or purified.
  • isolated means having been removed from its natural environment.
  • purified means having been increased in purity, wherein “purity” is a relative term, and not to be necessarily construed as absolute purity. For example, the purity can be at least about 50%, can be greater than 60%, 70%, 80%, 90%, 95%, or can be 100%.
  • inventive TCRs, polypeptides, proteins (including functional variants thereof), nucleic acids, recombinant expression vectors, host cells (including populations thereof), and antibodies (including antigen binding portions thereof), all of which are collectively referred to as "inventive TCR materials" hereinafter, can be formulated into a composition, such as a pharmaceutical composition.
  • the invention provides a pharmaceutical composition comprising any of the TCRs, polypeptides, proteins, functional portions, functional variants, nucleic acids, expression vectors, host cells (including populations thereof), and antibodies (including antigen binding portions thereof) described herein, and a pharmaceutically acceptable carrier.
  • inventive pharmaceutical composition comprising any of the TCRs, polypeptides, proteins, functional portions, functional variants, nucleic acids, expression vectors, host cells (including populations thereof), and antibodies (including antigen binding portions thereof) described herein, and a pharmaceutically acceptable carrier.
  • compositions containing any of the inventive TCR materials can comprise more than one inventive TCR material, e.g., a polypeptide and a nucleic acid, or two or more different TCRs (including functional portions and functional variants thereof).
  • inventive TCR material e.g., a polypeptide and a nucleic acid
  • two or more different TCRs including functional portions and functional variants thereof.
  • composition can comprise an inventive TCR material in combination with another phannaceutically active agent(s) or drug(s), such as a chemotherapeutic agents, e.g., asparaginase, busulfan, carboplatin, cisplatin, daunorubicin, doxorubicin, fluorouracil, gemcitabine, hydroxyurea, methotrexate, paclitaxel, rituximab, vinblastine, vincristine, etc.
  • chemotherapeutic agents e.g., asparaginase, busulfan, carboplatin, cisplatin, daunorubicin, doxorubicin, fluorouracil, gemcitabine, hydroxyurea, methotrexate, paclitaxel, rituximab, vinblastine, vincristine, etc.
  • the earner is a pharmaceutically acceptable carrier.
  • the carrier can be any of those conventionally used for the particular inventive TCR material under consideration.
  • Such pharmaceutically acceptable carriers are well-known to those skilled in the art and are readily available to the public. It is preferred that the pharmaceutically acceptable carrier be one which has no detrimental side effects or toxicity under the conditions of use.
  • Suitable formulations may include any of those for oral, parenteral, subcutaneous, intravenous, intramuscular, intraarterial, intrathecal, or interperitoneal administration. More than one route can be used to administer the inventive TCR materials, and in certain instances, a particular route can provide a more immediate and more effective response than another route.
  • the inventive TCR material is administered by injection, e.g., intravenously.
  • the pharmaceutically acceptable carrier for the cells for injection may include any isotonic earner such as, for example, normal saline (about 0.90% w/v of NaCl in water, about 300 mOsm/L NaCl in water, or about 9.0 g NaCl per liter of water), NORMOSOL R electrolyte solution (Abbott, Chicago, IL), PLASMA-LYTE A (Baxter, Deerfield, IL), about 5% dextrose in water, or Ringer's lactate.
  • the pharmaceutically acceptable carrier is supplemented with human serum albumen.
  • the amount or dose (e.g., numbers of cells when the inventive TCR material is one or more cells) of the inventive TCR material administered should be sufficient to effect, e.g., a therapeutic or prophylactic response, in the subject or animal over a reasonable time frame.
  • the dose of the inventive TCR material should be sufficient to bind to a cancer antigen (e.g., human TG), or detect, treat or prevent cancer in a period of from about 2 hours or longer, e.g., 12 to 24 or more hours, from the time of administration. In certain embodiments, the time period could be even longer.
  • the dose will be determined by the efficacy of the particular inventive TCR material and the condition of the animal (e.g., human), as well as the body weight of the animal (e.g., human) to be treated.
  • an assay which comprises comparing the extent to which target cells are lysed or IFN- ⁇ is secreted by T cells expressing the inventive TCR (or functional variant or functional portion thereof), polypeptide, or protein upon administration of a given dose of such T cells to a mammal among a set of mammals of which is each given a different dose of the T cells, could be used to determine a starting dose to be administered to a mammal.
  • the extent to which target cells are lysed or IFN- ⁇ is secreted upon administration of a certain dose can be assayed by methods known in the art.
  • the dose of the inventive TCR material also will be determined by the existence, nature and extent of any adverse side effects that might accompany the administration of a particular inventive TCR material. Typically, the attending physician will decide the dosage of the inventive TCR material with which to treat each individual patient, taking into consideration a variety of factors, such as age, body weight, general health, diet, sex, inventive TCR material to be administered, route of administration, and the severity of the cancer being treated.
  • the inventive TCR material is a population of cells
  • the number of cells administered per infusion may vary, e.g., from about 1 x 10 6 to about 1 x 10 12 cells or more. In certain embodiments, fewer than 1 x 10 6 cells may be administered.
  • inventive TCR materials of the invention can be modified in any number of ways, such that the therapeutic or prophylactic efficacy of the inventive TCR materials is increased through the modification.
  • inventive TCR materials can be conjugated either directly or indirectly through a bridge to a targeting moiety.
  • the practice of conjugating compounds, e.g., inventive TCR materials, to targeting moieties is known in the art.
  • targeting moiety refers to any molecule or agent that specifically recognizes and binds to a cell-surface receptor, such that the targeting moiety directs the delivery of the inventive TCR materials to a population of cells on which surface the receptor is expressed.
  • Targeting moieties include, but are not limited to, antibodies, or fragments thereof, peptides, hormones, growth factors, cytokines, and any other natural or non-natural ligands, which bind to cell surface receptors (e.g., Epithelial Growth Factor Receptor (EGFR), T cell receptor (TCR), B- cell receptor (BCR), CD28, Platelet-derived Growth Factor Receptor (PDGF), nicotinic acetylcholine receptor (nAChR), etc.).
  • EGFR Epithelial Growth Factor Receptor
  • TCR T cell receptor
  • BCR B- cell receptor
  • CD28 CD28
  • PDGF Platelet-derived Growth Factor Receptor
  • nAChR nicotinic acetylcholine receptor
  • inventive TCRs (and functional variants thereof), polypeptides, proteins, nucleic acids, recombinant expression vectors, host cells, or populations of cells can be used in methods of treating or preventing cancer.
  • inventive TCRs are believed to bind specifically to TG, such that the TCR (or related inventive polypeptide or protein and functional variants thereof), when expressed by a cell, is able to mediate an immune response against a target cell expressing TG.
  • the invention provides a method of treating or preventing cancer in a mammal, comprising administering to the mammal any of the pharmaceutical compositions, TCRs (and functional variants thereof), polypeptides, or proteins described herein, any nucleic acid or recombinant expression vector comprising a nucleotide sequence encoding any of the TCRs (and functional variants thereof), polypeptides, proteins described herein, or any host cell or population of cells comprising a recombinant vector which encodes any of the TCRs (and functional variants thereof), polypeptides, or proteins described herein, in an amount effective to treat or prevent cancer in the mammal.
  • An embodiment of the invention provides any of the pharmaceutical
  • inventive methods can provide any amount of any level of treatment or prevention of cancer in a mammal.
  • the treatment or prevention provided by the inventive method can include treatment or prevention of one or more conditions or symptoms of the cancer being treated or prevented.
  • treatment or prevention can include promoting the regression of a tumor.
  • prevention can encompass delaying the onset of the cancer, or a symptom or condition thereof.
  • the method comprises (i) contacting a sample comprising one or more cells from the mammal with any of the inventive TCRs (and functional variants thereof), polypeptides, proteins, nucleic acids, recombinant expression vectors, host cells, populations of cells, antibodies, or antigen binding portions thereof, or pharmaceutical compositions described herein, thereby forming a complex, and detecting the complex, wherein detection of the complex is indicative of the presence of cancer in the mammal.
  • the sample of cells can be a sample comprising whole cells, lysates thereof, or a fraction of the whole cell lysates, e.g., a nuclear or cytoplasmic fraction, a whole protein fraction, or a nucleic acid fraction.
  • the contacting can take place in vitro or in vivo with respect to the mammal.
  • the contacting is in vitro.
  • the inventive TCRs and functional variants thereof, polypeptides, proteins, nucleic acids, recombinant expression vectors, host cells, populations of cells, or antibodies, or antigen binding portions thereof, described herein, can be labeled with a detectable label such as, for instance, a radioisotope, a fluorophore (e.g., fluorescein isothiocyanate (FITC), phycoerythrin (PE)), an enzyme (e.g., alkaline phosphatase, horseradish peroxidase), and element particles (e.g., gold particles).
  • a detectable label such as, for instance, a radioisotope, a fluorophore (e.g., fluorescein isothiocyanate (FITC), phycoerythrin (PE)), an enzyme (e.g., alkaline phosphatase, horseradish peroxidase), and element particles (e.g., gold particles).
  • the cells can be cells that are allogeneic or autologous to the mammal.
  • the cells are autologous to the mammal.
  • the cancer can be any cancer, including any of acute lymphocytic cancer, acute myeloid leukemia, alveolar rhabdomyosarcoma, bone cancer, brain cancer, breast cancer, cancer of the anus, anal canal, or anorectum, cancer of the eye, cancer of the intrahepatic bile duct, cancer of the joints, cancer of the neck, gallbladder, or pleura, cancer of the nose, nasal cavity, or middle ear, cancer of the oral cavity, cancer of the vagina, cancer of the vulva, chronic lymphocytic leukemia, chronic myeloid cancer, colon cancer, esophageal cancer, uterine cervical cancer, gastrointestinal carcinoid tumor, glioma, Hodgkin lymphoma, hypopharynx cancer, kidney cancer, larynx cancer, liver cancer, lung cancer, malignant mesothelioma, melanoma, multiple myeloma, nasophary
  • the mammal referred to in the inventive methods can be any mammal.
  • the term "mammal” refers to any mammal, including, but not limited to, mammals of the order Rodentia, such as mice and hamsters, and mammals of the order Logomorpha, such as rabbits. It is preferred that the mammals are from the order Carnivora, including Felines (cats) and Canines (dogs). It is more preferred that the mammals are from the order
  • Artiodactyla including Bovines (cows) and Swines (pigs) or of the order Perssodactyla, including Equines (horses). It is most preferred that the mammals are of the order Primates, Ceboids, or Simoids (monkeys) or of the order Anthropoids (humans and apes). An especially preferred mammal is the human.
  • the Hurthle Carcinoma Cell line XTC (Endocrine Surgery Branch, NCI) was maintained in Dulbecco's Modified Eagle's Medium (DMEM) (Life Technologies, Carlsbad, CA) including 10% fetal bovine serum (FBS; Sigma, St. Louis, MO), 10 IU/L thyroid stimulating hormone (TSH; Sigma-Aldrich), Insulin-Transferrin-Selenium (Life Technologies, NCI) was maintained in Dulbecco's Modified Eagle's Medium (DMEM) (Life Technologies, Carlsbad, CA) including 10% fetal bovine serum (FBS; Sigma, St. Louis, MO), 10 IU/L thyroid stimulating hormone (TSH; Sigma-Aldrich), Insulin-Transferrin-Selenium (Life
  • DMEM Dulbecco's Modified Eagle's Medium
  • FBS fetal bovine serum
  • TSH thyroid stimulating hormone
  • Insulin-Transferrin-Selenium Insulin-Transferrin-Selen
  • HLA-A2-expressing XTC was established by transducing XTC with retrovirus containing HLA-A*0201 (Surgery Branch, NCI).
  • Cos7, T2, and 293GP cell lines were obtained from Surgery Branch, NCI.
  • Peptides 1-8 represent the following epitopes of TG: 1- TLLASICWV (SEQ ID NO: 29), 2-NLFGGKFLV (SEQ ID NO: 2), 3-ELPEFLLFL (SEQ ID NO: 30), 4-ALVLEIFTL (SEQ ID NO: 31), 5-ILQRRFLAV (SEQ ID NO: 32), 6- ALLRSGPYM (SEQ ID NO: 33), 7-LVEIFTLL (SEQ ID NO: 34), 8-VQQVQCWCV (SEQ ID NO: 35).
  • Complementary DNA (cDNA) was synthesized by the high-capacity cDNA Reverse Transcription Kit or SUPERSCRIPT III First-Strand cDNA synthesis system (Life Technologies).
  • the following RT-PCR Taqman probes for comparison of antigens were used: 3' TG (00968047_ml), TPO (Hs00374163_Al), IYD (Hs00416923_Al), FOXE1 (Hs00915085_Sl ), and PAX8 (Hs00247586_ml), ACTB (Hs03023880_gl ) (Life Technologies).
  • TG a custom-designed Taqman primer/probe was also used to evaluate low expression of TG in a normal tissue panel. Absolute copy number was calculated based on standard curves generated by using a plasmid encoding each cDNA as a reference on the 7500 FAST Real-time PCR system (Life Technologies).
  • cytomegalovirus (CMV) promoter-TG 42-42 9 2 fragment was obtained by restriction enzyme digestion and was cloned into the pAdeno-X plasmid.
  • This plasmid was used for amplifying recombinant adenovirus according to the manufacturer's instructions (ADENO-X expression System 1 , Clontech).
  • Amplified virus was purified by ADENO-X maxi purification kit (Clontech, Mountain View, CA) and the buffer was exchanged with PBS using the PD10 gel- filtration column (GE Healthcare Life Sciences, Pittsburgh, PA). Titer of the infectious virus was measured by ADENO-X rapid titer kit (Clontech).
  • mice (Stetson et al., J. Exp. Med., 198(7): 1069-76 (2003)) were crossed to HLA-A*0201 transgenic mice to generate Yeti/HLA-A*0201 (Yeti/A2).
  • the mice were also transgenic for an IFN- ⁇ reporter gene, yellow fluorescent protein (YFP).
  • YFP yellow fluorescent protein
  • the expression of YFP is driven by the IFN- ⁇ promoter.
  • cells in these mice produce IFN- ⁇ , they also express YFP which can be visualized with a fluorescent microscope or detected by fluorescence-activated cell scan (FACS).
  • CFU colony forming units
  • FBS fetal bovine serum
  • FBS fetal bovine serum
  • 55 ⁇ 2- mercaptoethanol Life Technologies
  • 1 mM sodium pyruvate Life Technologies
  • IX MEMnon-essential amino acids Life Technologies
  • 10 g/mL gentamicin Life Technologies
  • Retroviral supematants were generated in 293GP cells by co-transfection with the retroviral vector encoding the anti-TG-TCR and an envelope protein (RD1 14) using lipofectamine 2000 (Life Technologies) as described in Robbins et al., J. Clin. Oncol, 29(7): 917-24 (201 1). On the next day of lipofection, medium was replaced with fresh medium. The supernatant was harvested after 48 hours (h) and used to transduce anti-CD3 -stimulated peripheral blood lymphocytes (PBL).
  • PBL peripheral blood lymphocytes
  • Lymphocytes were cultured as described in Cohen et al., Cancer Res., 66(17): 8878-86 (2006) using AIM-V media (Life Technologies) containing 5% human serum (Valley Biomedical Inc., Winchester, VA) and IL-2 (Prometheus, San Diego CA) at a concentration of 300 IU/ml for PBL.
  • PBL from allogeneic donors were stimulated with soluble anti-CD3 (OKT3, 50 ng/mL) and IL-2 (300 IU/mL) for two days before transduction was performed.
  • Interferon (IFN)-y release by transduced PBL was determined as previously described in Wang et al., J. Immunol Methods, 366(1 -2): 43-51 (201 1 ). Briefly, retrovirally- transduced cells (lxlO 5 ) were co-cultured with 5xl 0 4 target cells (XTC, XTC/A2, CosA2, or CosA2 transfected with TG) or control tumor cell lines for 18-22 hrs in RPMI with 10% FBS at 37 °C, 5% C0 2 . On the subsequent day, IFN- ⁇ secretion was determined by enzyme-linked immunosorbent assay (ELISA).
  • ELISA enzyme-linked immunosorbent assay
  • thyroid-specific antigens including thyroid peroxidase (TPO), paired box 8 (PAX8), forkhead box El (FOXE1 ), iodotyrosine deiodinase (IYD) and thyroglobulin (TG) (van Staveren et al., Cancer Res., 67(17): 81 13-20 (2007)), was investigated by TAQMAN quantitative RT-PCR.
  • TPO thyroid peroxidase
  • PAX8 paired box 8
  • FOXE1 forkhead box El
  • IYD iodotyrosine deiodinase
  • TG thyroglobulin
  • HLA-A0201 -restricted murine T cells were generated by vaccinating Yeti mice that were transgenic for HLA-A0201 and an IFN- ⁇ reporter gene (yellow fluorescent protein (YFP)) with an adenovirus encoding the 5' half of the TG gene (TG 42 . 42 92)-
  • the mice were vaccinated with TG-containing adenovirus on day 0, followed by a second vaccination with the same adenovirus on day 14.
  • splenocytes were collected and stimulated in vitro with TG peptide immediately at the time of harvest, followed by a second in vitro TG peptide stimulation on day 35.
  • the expression of the IFN- ⁇ reporter gene YFP by the Yeti/A2 splenocytes was measured by flow cytometry two days after the second in vitro stimulation. YFP expression in stimulated splenocytes was also evaluated by ultraviolet (UV)-microscopy after-co-culture with T2 cells pulsed with TG cognate peptide.
  • UV ultraviolet
  • This example demonstrates the isolation of the murine anti-TG TCR from the TG 4 7o-478-stimulated splenocytes of Example 2.
  • RNA was isolated from the bulk culture by an RNA isolation kit (RNeasy, Qiagen). Amplification of the 5' cDNA ends of the TCR a and ⁇ chains was done by SMARTer 5' RACE kit (Clontech) using the following primers: Universal Primer A Mix (Clonetech), a-specific primer 5' -GGCTACTTTCAGCAGGAGGA - 3' (SEQ ID NO: 36), ⁇ -specific primer 5' AGGCCTCTGCACTGATGTTC - 3' (SEQ ID NO: 37). TCR a and ⁇ cDNA molecules were then inserted into a TOPO vector by TA cloning.
  • Plasmids from 48 individual colonies for a- and ⁇ -chains were purified and sequenced. This sequence analysis revealed oligo-clonality, with 27/48 colonies of a representing TRAV3D-3*02/J22*01 , 21 /48 colonies of a representing TRAV15N- 1 *01 , and 45/47 colonies of ⁇ representing
  • This example demonstrates the generation of a retroviral recombinant expression vector encoding the murine anti-TG TCR of Example 3.
  • a self-cleaving 2A peptide sequence was introduced into the 5' of ⁇ chain using a 7:2: 1 molar ratio mix of SEQ ID NOs: 41 , 42 and 43 as the forward primer and SEQ ID NO: 40 as the reverse primer.
  • MSGV1 SEQ ID NO: 21
  • pMSGV retroviral vector
  • the plasmid encoding the mouse anti-TG TCR was a 7394 base pair (bp) sequence encoding the a and ⁇ -chains (SEQ ID NOs: 11 and 12, respectively) separated by a self-cleaving p2A region (SEQ ID:NO 28). The sequence of the plasmid was confirmed by Sanger sequencing.
  • This example demonstrates the transduction of donor PBL with a retroviral vector encoding the murine anti-TG TCR.
  • Anti-CD3 stimulated, human donor PBL were retrovirally transduced with the vector of Example 4.
  • FACS analysis was performed by labeling the T-cells with antibodies against CD3, CD8, and the mouse TCR- ⁇ chain or MART-1/HLA-A2 tetramer.
  • the efficiency of transduction of PBL from three donor patients was high (80-90%) without significant differences between CD4+ and CD8+ T-cells.
  • the experiments were performed more than five times, each of which gave similar results.
  • Anti-CD3 stimulated PBL were transduced with the retroviral vector encoding the murine anti-TG TCR of Example 4 or an anti-MART-1 TCR. Untransduced cells were used as a control. Three days after transduction, 1 x 10 5 transduced cells or control cells were co- cultured with 5 x 10 4 T2 cells that had been pulsed with either TG (NLFGGKFLV (SEQ ID NO: 2)) (T2/TG) or MART-1 (T2/MART-1) peptides.
  • PBL expressing the murine anti-TG TCR recognized the peptide at very low concentrations ( ⁇ 0.1 nM), out-perfom ing the anti-MART-1 TCR control. (Fig. 3A).
  • PBL transduced with a vector encoding the murine anti-TG TCR were analyzed for reactivity, as determined by human (h) IFN- ⁇ release, after co- culture with tumor cell lines or cell lines transfected to express TG.
  • the specificity of the murine anti-TG TCR was tested by analyzing its reactivity against XTC, XTC/A2, and a panel of cell lines and normal tissues not expressing one or both of TG and HLA-A*0201 , including H2087, BIC, BE-3, SK-OV3, S -BR3, MDA231, MDA468, four renal cell carcinoma lines, normal human fibroblasts, and small airway epithelial epithelium cells (Table 1). As shown in Table 1 , all cell lines were one or both of HLA-A*0201 " and TG " , except XTC/A2.
  • the PBL transduced with a vector encoding the murine anti-TG TCR showed reactivity only to the HLA-A2+/TG+ XTC/A2 cell line, and showed no reactivity to any TG-negative or HLA- A*0201 -negative cell lines.
  • This example demonstrates the isolation of a human anti-TG TCR and the transduction efficiency of the human anti-TG TCR into PBL.
  • PBL transduced with the human anti-TG TCR of Example 8 were co-cultured with T2 cells pulsed with various concentrations of MART-1 or TG 3 _n and IFN- ⁇ was measured (pg/ml). The results are shown in Table 2A.
  • PBL transduced with the human anti-TG TCR of Example 8 or the murine anti- TG TCR of Example 3 were co-cultured with COSA2/GFP cells, COSA2/TG cells, 624Mel cells, XTC cells, or XTC/A2 cells, and IFN- ⁇ was measured (pg/ml). The results are shown in Table 3.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Immunology (AREA)
  • Medicinal Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Biophysics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Molecular Biology (AREA)
  • Genetics & Genomics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Biochemistry (AREA)
  • Oncology (AREA)
  • Endocrinology (AREA)
  • Cell Biology (AREA)
  • Toxicology (AREA)
  • Zoology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Microbiology (AREA)
  • Mycology (AREA)
  • Epidemiology (AREA)
  • Peptides Or Proteins (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
PCT/US2015/060282 2014-11-14 2015-11-12 Anti-human thyroglobulin t cell receptors Ceased WO2016077525A2 (en)

Priority Applications (8)

Application Number Priority Date Filing Date Title
CA2967778A CA2967778C (en) 2014-11-14 2015-11-12 Anti-thyroglobulin t cell receptors
EP15801054.6A EP3218404B1 (en) 2014-11-14 2015-11-12 Human anti-thyroglobulin t cell receptors
AU2015346350A AU2015346350C1 (en) 2014-11-14 2015-11-12 Anti-thyroglobulin t cell receptors
EP20208238.4A EP3808770B1 (en) 2014-11-14 2015-11-12 Anti-thyroglobulin t cell receptors
JP2017525625A JP6666342B2 (ja) 2014-11-14 2015-11-12 抗サイログロブリンt細胞レセプター
US15/524,869 US10450372B2 (en) 2014-11-14 2015-11-12 Anti-thyroglobulin T cell receptors
US16/586,310 US11440956B2 (en) 2014-11-14 2019-09-27 Anti-thyroglobulin T cell receptors
US17/817,599 US12275786B2 (en) 2014-11-14 2022-08-04 Anti-thyroglobulin t cell receptors

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201462079713P 2014-11-14 2014-11-14
US62/079,713 2014-11-14

Related Child Applications (2)

Application Number Title Priority Date Filing Date
US15/524,869 A-371-Of-International US10450372B2 (en) 2014-11-14 2015-11-12 Anti-thyroglobulin T cell receptors
US16/586,310 Division US11440956B2 (en) 2014-11-14 2019-09-27 Anti-thyroglobulin T cell receptors

Publications (2)

Publication Number Publication Date
WO2016077525A2 true WO2016077525A2 (en) 2016-05-19
WO2016077525A3 WO2016077525A3 (en) 2016-12-29

Family

ID=54704113

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2015/060282 Ceased WO2016077525A2 (en) 2014-11-14 2015-11-12 Anti-human thyroglobulin t cell receptors

Country Status (6)

Country Link
US (3) US10450372B2 (cg-RX-API-DMAC7.html)
EP (2) EP3808770B1 (cg-RX-API-DMAC7.html)
JP (1) JP6666342B2 (cg-RX-API-DMAC7.html)
AU (1) AU2015346350C1 (cg-RX-API-DMAC7.html)
CA (1) CA2967778C (cg-RX-API-DMAC7.html)
WO (1) WO2016077525A2 (cg-RX-API-DMAC7.html)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2023213904A1 (en) * 2022-05-04 2023-11-09 Deutsches Krebsforschungszentrum Stiftung des öffentlichen Rechts T cell receptor derived binding polypeptides
WO2024097652A3 (en) * 2022-10-31 2024-06-13 Legend Biotech Ireland Limited Anti-kras t cell receptors and engineered cells

Families Citing this family (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
AU2015346350C1 (en) * 2014-11-14 2022-01-06 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Anti-thyroglobulin t cell receptors
JP7385556B2 (ja) 2017-09-01 2023-11-22 デイナ ファーバー キャンサー インスティチュート,インコーポレイテッド Bcma抗原に特異的な免疫原性ペプチドおよびその使用
EP3941938A1 (en) 2019-03-06 2022-01-26 Dana-Farber Cancer Institute, Inc. T cell receptors specific to b-cell maturation antigen for treatment of cancer

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8034334B2 (en) 2002-09-06 2011-10-11 The United States Of America As Represented By The Secretary, Department Of Health And Human Services Immunotherapy with in vitro-selected antigen-specific lymphocytes after non-myeloablative lymphodepleting chemotherapy
US20120244133A1 (en) 2011-03-22 2012-09-27 The United States of America, as represented by the Secretary, Department of Health and Methods of growing tumor infiltrating lymphocytes in gas-permeable containers
US8383099B2 (en) 2009-08-28 2013-02-26 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Adoptive cell therapy with young T cells

Family Cites Families (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4874845A (en) * 1984-06-13 1989-10-17 Massachusetts Institute Of Technology T lymphocyte receptor subunit
CA2874998A1 (en) 2011-05-27 2012-12-06 Cytocure Llc Methods, compositions, and kits for the treatment of cancer
PT3514172T (pt) * 2014-04-01 2020-04-21 Tron Translationale Onkologie An Der Univ Der Johannes Gutenberg Univ Mainz Gemeinnuetzige Gmbh Imunorrecetores específicos de claudina-6 e epítopos de células t
AU2015346350C1 (en) * 2014-11-14 2022-01-06 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Anti-thyroglobulin t cell receptors

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8034334B2 (en) 2002-09-06 2011-10-11 The United States Of America As Represented By The Secretary, Department Of Health And Human Services Immunotherapy with in vitro-selected antigen-specific lymphocytes after non-myeloablative lymphodepleting chemotherapy
US8383099B2 (en) 2009-08-28 2013-02-26 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Adoptive cell therapy with young T cells
US20120244133A1 (en) 2011-03-22 2012-09-27 The United States of America, as represented by the Secretary, Department of Health and Methods of growing tumor infiltrating lymphocytes in gas-permeable containers

Non-Patent Citations (13)

* Cited by examiner, † Cited by third party
Title
"Immunobiology", 2011, GARLAND PUBLISHING
"Molecular Cloning, A Laboratory Manual,", 2012, COLD SPRING HARBOR LABORATORY PRESS
COHEN ET AL., CANCER RES., vol. 66, no. 17, 2006, pages 8878 - 86
DAVIES ET AL., JAMA OTOLARYNGOL HEAD NECK SURG., vol. 140, no. 4, 2014, pages 317 - 322
DUDLEY ET AL., J. IMMUNOTHER., vol. 26, 2003, pages 332 - 42
GREEN; SAMBROOK: "Molecular Cloning: A Laboratory Manual", 2012, COLD SPRING HARBOR PRESS
RIDDELL ET AL., J. IMMUNOL. METHODS, vol. 128, 1990, pages 189 - 201
ROBBINS ET AL., J. CLIN. ONCOL., vol. 29, no. 7, 2011, pages 917 - 24
STETSON ET AL., J. EXP. MED., vol. 198, no. 7, 2003, pages 1069 - 76
TOPALIAN ET AL., 7. IMMUNOL., vol. 142, no. 10, 1989, pages 3714 - 25
VAN STAVEREN ET AL., CANCER RES., vol. 67, no. 17, 2007, pages 8113 - 20
WANG ET AL., J. IMMUNOL. METHODS,, vol. 366, no. 1-2, 2011, pages 43 - 51
ZHAO ET AL., J. IMMUNOL., vol. 174, no. 7, 2005, pages 4415 - 23

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2023213904A1 (en) * 2022-05-04 2023-11-09 Deutsches Krebsforschungszentrum Stiftung des öffentlichen Rechts T cell receptor derived binding polypeptides
WO2024097652A3 (en) * 2022-10-31 2024-06-13 Legend Biotech Ireland Limited Anti-kras t cell receptors and engineered cells

Also Published As

Publication number Publication date
CA2967778A1 (en) 2016-05-19
EP3218404A2 (en) 2017-09-20
AU2015346350A1 (en) 2017-05-25
US20200102383A1 (en) 2020-04-02
JP6666342B2 (ja) 2020-03-13
US20220389093A1 (en) 2022-12-08
AU2015346350A2 (en) 2017-06-22
US10450372B2 (en) 2019-10-22
AU2015346350C1 (en) 2022-01-06
EP3808770B1 (en) 2025-10-29
US20180244768A1 (en) 2018-08-30
US11440956B2 (en) 2022-09-13
EP3808770A1 (en) 2021-04-21
US12275786B2 (en) 2025-04-15
CA2967778C (en) 2024-04-16
JP2017536821A (ja) 2017-12-14
WO2016077525A3 (en) 2016-12-29
EP3218404B1 (en) 2021-01-06
AU2015346350B2 (en) 2021-06-24

Similar Documents

Publication Publication Date Title
US12312391B2 (en) Anti-mutated KRAS T cell receptors
US12187779B2 (en) Anti-human papillomavirus 16 E6 T cell receptors
US12275786B2 (en) Anti-thyroglobulin t cell receptors
HK40031837A (en) Anti-mutated kras t cell receptors
HK40031837B (en) Anti-mutated kras t cell receptors
HK40018191A (en) Anti-human papillomavirus 16 e6 t cell receptors
HK1243642B (en) Anti-mutated kras t cell receptors

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 15801054

Country of ref document: EP

Kind code of ref document: A2

REEP Request for entry into the european phase

Ref document number: 2015801054

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 15524869

Country of ref document: US

ENP Entry into the national phase

Ref document number: 2017525625

Country of ref document: JP

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 2967778

Country of ref document: CA

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2015346350

Country of ref document: AU

Date of ref document: 20151112

Kind code of ref document: A