WO2016075673A1 - Genetic markers for determining ectoparasite susceptibility to acaricides - Google Patents

Genetic markers for determining ectoparasite susceptibility to acaricides Download PDF

Info

Publication number
WO2016075673A1
WO2016075673A1 PCT/IB2015/058834 IB2015058834W WO2016075673A1 WO 2016075673 A1 WO2016075673 A1 WO 2016075673A1 IB 2015058834 W IB2015058834 W IB 2015058834W WO 2016075673 A1 WO2016075673 A1 WO 2016075673A1
Authority
WO
WIPO (PCT)
Prior art keywords
ectoparasite
markers
resistance
acaricide
dna
Prior art date
Application number
PCT/IB2015/058834
Other languages
French (fr)
Inventor
Christine MARITZ-OLIVIER
Samantha BARON
Original Assignee
University Of Pretoria
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by University Of Pretoria filed Critical University Of Pretoria
Priority to MX2017006202A priority Critical patent/MX2017006202A/en
Priority to BR112017010065A priority patent/BR112017010065A2/en
Publication of WO2016075673A1 publication Critical patent/WO2016075673A1/en
Priority to ZA201703246A priority patent/ZA201703246B/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers

Definitions

  • This invention relates to ectoparasite control. More particularly, the invention relates to a method of identifying amitraz resistance in an ectoparasite, to polymorphisms/genetic markers associated with such resistance, and to nucleotide sequences useful for detecting such resistance markers.
  • tick Rhipicephaius micropius (formaly Boophilus micropius) is a largely invasive ectoparasite of great economic importance due to the negative effect it has on agricultural livestock on a global scale. Tick-borne diseases (babesiosis and anaplasmosis) transmitted by R. micropius are alarming as it decreases the quality of livestock. In sub-Saharan Africa, cattle represent a major source of meat and milk, but this region of the world is severely affected by the Rhipicephaius micropius tick. The principal method for tick control is the use of chemical acaricides, notably amitraz, which was implemented in the 1990's after resistance to other acaricides surfaced.
  • Rhipicephaius micropius ticks are hematophagous ectoparasites of veterinary importance, and are capable of parasitizing a variety of hosts, although cattle are their primary preference (Walker et ai. 2003). These ticks are adept in transmitting a variety of tick-borne diseases to cattle, most notably Babesia bovis, which causes Asiatic babesiosis or redwater (Walker et al. 2003; Horak, Goiezardy, Uys 2007). The lack of efficient tick control strategies and management programs results in a severe economic burden, threatening the sustainability of the livestock industry in South Africa and globally.
  • Rhipicephalus microplus ticks have acquired the ability to evade the toxic effects of chemical acaricides by developing different resistance mechanisms.
  • the cuticle surrounding the tick which reduces acaricide access to the internal environment of the tick body, confers penetration resistance.
  • An additional resistance mechanism common in arthropods is target site insensitivity. This adaptive mechanism involves the alteration of the drug target site at the DNA level by alteration of the wild-type allele to a mutant form, which renders acaricide treatment ineffective.
  • metabolic resistance to acaricide treatment involves the increased ability to detoxify or sequester the acaricide.
  • Amitraz is a common formamidine acaricide, which is extensively used for tick control in South Africa.
  • the target site for amitraz in R. microplus has yet to be defined, which ultimately delays any further development with regard to screening assays for diagnostics. It was proposed that monoamine oxidase, alpha- 2-adrenceptors, and the octopamine receptor are good candidates for potential target sites, with the latter being the most probable in ticks (Jonsson, Hope 2007). It is thought that amitraz is a potential agonist of the octopaminergic system located in the tick synganglion.
  • aOCT a-adrenergic-like
  • ⁇ ⁇ -adrenergic-like
  • OCTTTyr octopamine/tyramine
  • tick DNA sequences and single nucleotide polymorphisms refer to the nucleotide sequences of the coding region only, positions from non-coding regions are excluded.
  • Insect octopamine receptors a new classification scheme based on studies of cloned Drosophila G-protein coupled receptors. Invertebrate Neuroscience 5: 1 1 1 -1 18.
  • Rosado-Aguilar Rosado-Aguilar, JA, Rl Rodriguez-Vivas, Z Garcia-Vazquez, H Fragoso-Sanchez,
  • POPGENE the user-friendly shareware for population genetic analysis. Molecular Biology and Biotechnology Centre, University of Alberta, Canada.
  • a method for detecting a genetic polymorphism associated with susceptibility, or resistance of an ectoparasite to an acaricide comprising the step of screening a DNA sample from the ectoparasite for the presence of one or more markers in the octopamine/tyramine receptor gene.
  • the method may include an additional step of determining homozygosity and heterozygosity of the ectoparasite.
  • the acaricide may be in the form of any one of pyrethroids, formamidines or the like.
  • the acaricide may be in the form of amitraz.
  • the ectoparasite may be in the form of a tick.
  • the ectoparasite may be in the form of any one of Rhipicephalus microplus, Rhipicephalus decoloratus or the like.
  • the one or more markers may be in the form of polymorphisms.
  • the one or more markers may be in the form of single nucleotide polymorphisms (SNPs).
  • SNPs single nucleotide polymorphisms
  • the markers may be in the form of any one or more of A22C and
  • T65C wherein the presence of any one or both of A22C and T65C is associated with resistance of the ectoparasite to the acaricide.
  • the one or more markers may include any one or more of C39T, G41A, G121A, T138C and C159T, wherein their presence is associated with resistance of the ectoparasite to the acaricide.
  • the one or more markers may include any one or both of T36C and G141 C, wherein the presence of T36C and/or G141 C is associated with susceptibility of the ectoparasite to the acaricide.
  • Determining homozygosity and heterozygosity of ectoparasites may include classifying ectoparasites having all markers associated with resistance, the markers being single nucleotide polymorphisms (SNP's) in the form of A22C, T65C, C39T, G41A, G121A, T138C and C159T, as homozygous resistant ectoparasites and ectoparasites having only a number of the markers associated with resistance, as heterozygous ectoparasites.
  • SNP's single nucleotide polymorphisms
  • the method may include any suitable technique for determining the presence or absence of the one or more markers in the DNA sample from the ectoparasite, the technique includes any of: restriction fragment length polymorphism mapping, amplification reactions, hybridization of nucleic acids to allele-specific probes or oligonucleotide arrays, various chip technologies, polynucleotide sequence techniques and combinations thereof.
  • the method may include the step of subjecting the DNA sample to polynucleotide amplification using a primer pair comprising SEQ. ID NO. 1 and SEQ. ID. NO. 2, and functional fragments, variants, and mutations of each.
  • a method of determining the susceptibility, or otherwise, of an ectoparasite to an acaricide comprising the steps of:
  • the method may include an additional step of determining homozygosity and heterozygosity of the ectoparasites.
  • the acaricide may be in the form of any one of pyrethroids, formamidines and the like. Specifically, the acaricide may be in the form of amitraz.
  • the ectoparasite may be in the form of a tick. Specifically, the ectoparasite may be in the form of any one of Rhipicephaius micropius, Rhipicephaius decoloratus and the like.
  • the one or more markers may be single nucleotide polymorphisms (SNPs).
  • SNPs may be any one or more of A22C and T65C wherein the presence of any one or both of A22C and T65C is associated with resistance of the ectoparasite to the acaricide.
  • the one or more SNPs may include any one or more of C39T, G41A, G121A, T138C and C159T wherein their presence is associated with resistance of the ectoparasite to the acaricide.
  • the one or more SNPs may include T36C and G141 C wherein the presence of T36C and/or G141 C is associated with susceptibility of the ectoparasite to the acaricide.
  • Determining homozygosity and heterozygosity of ectoparasites may include classifying ectoparasites having all SNP's associated with resistance (A22C, T65C, C39T, G41A, G121A, T138C and C159T) as homozygous resistant ectoparasites and ectoparasites having only a number of the SNP's associated with resistance (not all), as heterozygous ectoparasites.
  • the DNA sample may be amplified using a primer pair selected from the nucleotide sequences of SEQ. ID NO. 1 , SEQ. ID. NO. 2, and functional fragments, variants, and mutations of each.
  • the step of analyzing the amplification product for the presence of one or more markers associated with resistance of the ectoparasite to the acaricide may be by way of sequencing the amplification product, quantifying the amplification product, detecting a probe linked to the amplification product, using primer extension (PEXT) reaction visualized through a dip stick assay or the like.
  • PEXT primer extension
  • the step of analyzing the amplification product may include exposing the amplification product to restriction enzyme digestion.
  • the restriction digestion may be accomplished by using a restriction enzyme having a recognition site corresponding to at least part of the one or more markers.
  • the restriction digestion may be accomplished by a restriction enzyme having a recognition sequence comprising 5'-GGCGGA-3' (SEQ. ID. NO. 3).
  • the restriction enzyme may be Ec/ ' l.
  • the restriction may be accomplished by using a restriction enzyme having a recognition sequence comprising 5'- GGACG - 3' (SEQ. ID. NO. 4).
  • the restriction enzyme may be selected from the group consisting of any one or more of: BseG ⁇ , BstF5 ⁇ , SsfPZ418l, Fok ⁇ , Sts ⁇ and any enzyme that recognizes a site corresponding to at least part of the one or more markers.
  • the resulting fragments may be separated at least partially from one another using size-based separation techniques, such as gel electrophoresis and the like.
  • the markers may be DNA-based markers selected from the group consisting of A22C and T65C of the coding sequence of the DNA sequence amplified using the method of the invention.
  • the markers may be peptide-based markers selected from the group consisting of G14E, T8P and L22S.
  • the invention extends to the use of any one or more of genetic markers C39T, G41A, G121A, T138C and C159T as indicators of resistance of the ectoparasite to the acaricide.
  • the invention further extends to the use of any one or more of genetic markers T36C and G141 C as indicators of susceptibility of the ectoparasite to the acaricide.
  • the step of extracting a DNA sample from the ectoparasite may be in the form of extracting DNA from any one of whole ticks or larvae.
  • a modified salt based extraction method may be used for genomic DNA isolation.
  • the modified salt based extraction method includes the steps of providing whole tick samples
  • DNA extraction solution 0.4 M NaCI, 60 mM Tris-HCI, 12 mM EDTA, 0.25% SDS, pH 8.0
  • DNA extraction solution 0.4 M NaCI, 60 mM Tris-HCI, 12 mM EDTA, 0.25% SDS, pH 8.0
  • proteinase K 15 mg/ml
  • the step of amplifying the DNA sample may be accomplished by subjecting the DNA sample to the following heating, annealing, and cooling conditions, respectively:
  • the invention also extends to an isolated nucleic acid molecule selected from the group consisting of:
  • nucleic acid molecule comprising the sequence of SEQ. ID. NO. 1 ;
  • nucleic acid fragment having a sequence derived from a octopamine/tyramine receptor gene and containing any one or more of markers associated with resistance of an ectoparasite to an acaricide, the markers selected from: A22C, T65C, C39T, G41A, G121A, T138C and C159T;
  • nucleic acid fragment having a sequence derived from a octopamine/tyramine receptor gene and containing any one or more of markers associated with susceptibility of an ectoparasite to an acaricide, the markers selected from: T36C and G141 C; and
  • the isolated nucleic acid molecule may be in the form of a non- naturally occurring sequence.
  • the non-naturally occurring sequence may be in the form of c-DNA.
  • the invention further provides for an amplified polynucleotide having a polymorphism in the form of any one or more of: A22C, T65C, C39T, G41A, G121A, T138C, C159T, T36C and G141 C.
  • the invention also extends to use of an isolated nucleic acid molecule as described or an amplified polynucleotide as described, in a method for detecting a genetic polymorphism associated with susceptibility or resistance of an ectoparasite to an acaricide.
  • the invention further provides for use of any one or more of genetic markers C39T, G41A, G121A, T138C and C159T as indicators of resistance of an ectoparasite to an acaricide.
  • the invention extends to use of any one or both of genetic markers T36C and G141 C as indicators of susceptibility of an ectoparasite to an acaricide.
  • the invention also extends to use of any one or more of genetic markers in the form of peptide-based markers G14E, T8P and L22S as indicators of resistance of an ectoparasite to an acaricide.
  • the invention further provides for a kit for determining the susceptibility or otherwise of an ectoparasite or a group of parasites to an acaricide, the kit including:
  • a reagent buffer suitable for allowing the amplification of a DNA sequence to be amplified using the primers.
  • the kit may include instructions for determining the susceptibility or otherwise of an ectoparasite to an acaricide.
  • tick DNA sequences and single nucleotide polymorphisms refer to the nucleotide sequences of the coding region only, positions from non-coding regions are excluded.
  • Figure 1 shows sequence alignment of a portion of the OCT/Tyr/tyramine receptor gene for amitraz resistant and susceptible R. microplus larvae.
  • Rhipicephaius (Boophiius) microplus was the reference sequence used for the alignments (GenBank Accession: AJ010743.1 ) along with the Santa Luiza resistant strain (GenBank Accession: EF490688.1 ) and the Gonzalez susceptible strain (GenBank Accession: EF490687.1 ).
  • the five samples aligned below the Santa Luiza strain are the resistant samples, and those below the Gonzalez strain are the susceptible ones.
  • the grey blocks indicate two resistance-associated SNPs, namely A22C and T65C.
  • Figure 2 shows an amino acid sequence of a portion of the OCT/Tyr/tyramine receptor gene.
  • the non-coding region of the gene is indicated from amino acid position 1 to 45. Seven substitutions occur within the non-coding regions and six in the open reading frame. Grey blocks highlight the two resistance-associated substitutions.
  • Figure 3 shows the distribution of the mean diversity versus the number of loci for the OCT/Tyr receptor. A comparison of 22 different loci within the OCT/Tyr/tyramine receptor is shown. Plateau diversity implies there are sufficient samples for further analysis.
  • Figure 4 shows the density distribution for the OCT/Tyr/tyramine receptor.
  • the Fd values are placed on the x-axis while the relative occurrence of each of these values is displayed on the y-axis.
  • the observed value falls outside of the distribution range generated by the randomized data set.
  • Figure 5 shows the ancestral recombination graph for homozygous amitraz resistant and susceptible R. microplus ticks in South Africa.
  • H1 , H2, H3, H4 and H5 represent the infinite-sites-compatible haplotype sequences that were observed.
  • Node E represents the ancestral form of the gene with adjoining points (A-D) illustrating coalescent haplotypes.
  • the additional table indicates the sample- haplotype associations for the graph.
  • a recombination event was detected as the ancestor of haplotype H2, and 294- indicating that the recombination event took place between nucleotides 294 and 295 in the alignment.
  • Figure 6 shows an agarose gel electropherogram of the OCT/Tyr/tyramine receptor from R. decoloratus larvae digested with Ec/I restriction enzyme.
  • the lane numbers represent samples from the original set of 14 anonymous samples.
  • Figure S1 shows the subpopulation structure of ticks across South
  • tick DNA sequences and single nucleotide polymorphisms refer to the nucleotide sequences of the coding region only, positions from non-coding regions are excluded.
  • Amitraz resistant R. microplus larvae obtained from the Mnisi area in the Kruger National Park were screened for the presence of the two resistant SNPs published by Chen et al. (2007). Twenty-four nucleotide substitutions were detected among resistant larvae, susceptible larvae, and the three reference strains from NCBI ( Figure 1 ). Seven of the substitutions appeared to be associated with susceptible samples. The first four of these substitutions occurred in the non- coding region (nucleotide position 1 -135) of the gene consisting of one transversion and three transition mutations. The three remaining substitutions within the open reading frame were synonymous, having no observable effect on the amino acid sequence.
  • the sequence data obtained for all larvae was compared to the results from LPTs (Supplementary TableSI ). The comparison reveals a clear correlation between the presence of the SNP (genotypic) and the resistant phenotype determined by LPTs. The comparison was primarily made between larvae which survived the LPT assay (resistant) and those which did not (susceptible). Results clearly show that all larvae which did not survive the LPT assay display the SS or RS genotype, and those that did survive the amitraz exposure display the RR genotype.
  • Genotype was inferred based on whether or not
  • the R allele refers to the mutant form giving rise to resistance while the S allele refers to the
  • Locus 17 Locus 12 0.921 0.877 ⁇ 0.00001
  • Locus 17 Locus 19 0.803 0.803 ⁇ 0.00001 a rd value represents the gametic disequilibrium that is observed between the two SNPs being compared to one another.
  • b Aggregate value is the mean value of rd values that were obtained for loci 1 1 and 17 associated with the other loci to determine which association displayed the most gametic disequilibrium.
  • Locus 12 corresponds to nucleotide position 171 in the OCT/Tyr receptor alignment ( Figure 1 ), locus 13 to that of 174, and locus 19 to that of 273.
  • Ancestral recombination graphs were constructed by incorporating sequence information from the OCT/Tyr receptor gene of both homozygous resistant and susceptible ticks (Figure 5).
  • a recombination event took place at nucleotide position 294. No mutations occur between the recombination event and the H2 haplotype, therefore H2 is the recombinant.
  • the nucleotide substitution that occurs at this site is C to T. This substitution is synonymous and only appears in samples suspected to be resistant. This substitution occurred at a frequency of 0.61 in the South African R. microplus tick population (data not shown), especially within heterozygous samples where both susceptible and resistant alleles were present. No geographical significance was found with the haplotype-sample groupings and the area in South Africa where the samples originated from.
  • a nucleotide substitution from a C to T was present whenever the tick was phenotypically and genotypically resistant, i.e. both resistance-associated SNPs were present. This was the case for both homozygous and heterozygous SNP alleles. However, this substitution did not result in an amino acid change, due to the degeneracy of the third codon position.
  • Such tight association between loci in the gene could potentially represent a molecular marker for amitraz resistance.
  • R. decoloratus ticks with known amitraz resistance and susceptibility were used to test the effectiveness of the restriction enzyme Ec/I as a possible diagnostic tool.
  • Sample 5 (Lane 1 , Figure 6) showed a prominent band at 400 bp, indicating a homozygous genotype and resistant phenotype. This result was corroborated by an independently performed larval packet test (Supplementary TableS3). This particular sample exhibited 13.2% control at a field concentration of 250 ppm amitraz. Samples 7 and 8 (Lanes 2 and 3 respectively, Figure 6) produced identical digest products. In addition to a 400 bp digest product, a 223 bp and 186 bp product was also detected. This result signifies that these samples were heterozygous and were potentially more susceptible to amitraz treatment. Indeed, independent larval packet tests revealed that these samples were 100% susceptible to field concentrations of amitraz.
  • Sample 6 (Lane 4, Figure 6) showed resistance potential in the same fashion as Sample 5, and this was corroborated by a 30% level of control during independent larval packet tests (Supplementary TableS3).
  • Sample 9 (Lane 5, Figure 6) showed heterozygosity in the same fashion as Samples 7 and 8, and was 100% susceptible to field concentrations of amitraz (Supplementary TableS3).
  • Amitraz regarded as effective 80-90% Effective with reservation, 50-80% Indications of developing resistance, 0-50% Indications of resistance.
  • Amitraz concentration was at 250 ppm.
  • the octopaminergic receptors have been classified into three classes.
  • the a-adrenergic-like octopamine receptors display an increased affinity for octopamine rather than tyramine, which leads to an increase in intracellular Ca 2+ concentrations together with a small increase in intracellular cAMP levels (Balfanz et al. 2005; Farooqui 2012).
  • the ⁇ -adrenergic- like octopamine receptors on the other hand are specifically activated in response to octopamine directly resulting in increased intracellular cAMP levels (Maqueira, Chatwin, Evans 2005; Farooqui 2012).
  • octopaminergic/tyraminergic (OCTTTyr) receptors have shown immense similarity in terms of structure and pharmacology with the vertebrate a2-adrenergic receptors (Evans. jVlaqueira 2005). Agonistic preferences can result in receptors being stimulated by either octopamine or tyramine. In response to octopamine, there will be an increase in intracellular Ca 2+ concentrations. Conversely, a response to tyramine will result in intracellular cAMP levels to decrease (Farooqui 2012). Robb et al. (1994) also demonstrated this principle in Drosophila, where one receptor can display different pharmacological profiles with regard to second messenger systems implemented.
  • the two putative resistance-associated SNP loci were in gametic disequilibrium and they were positively associated with the resistant phenotype. Thus, if both SNP loci display specific nucleotide substitutions, it can be inferred that the tick is resistant to amitraz. Although significant gametic disequilibrium exists for these SNPs, there is a small but important deviation from complete disequilibrium. Gametic disequilibrium among loci can be generated from a variety of factors namely; mutation, population admixture, gene flow, genetic drift, some kinds of natural selection as well as genetic heterogeneity (Halliburton 2003; Gibson, Muse 2009). Coalescent interaction of these forces within the tick population are likely responsible for the incomplete disequilibrium observed.
  • a third SNP position in the OCT/Tyr receptor gene was significantly associated with the two previously mentioned SNPs. This illustrates that amitraz resistance is potentially associated with complete alleles of the gene, instead of with individual SNP positions. Therefore, associations among SNP positions could potentially be attributed to intact inheritance of alleles. This is further demonstrated by additional variable positions that seemed to distinguish resistant from susceptible phenotypes. Upon constant selection pressure, these variable positions have come to fixation in the population. Therefore, it seems as though exposure to amitraz consequently affects a wider range of loci further substantiating the probability of intact inheritance of alleles. A classic evolutionary process that could be responsible for such an observation is epistatic interaction, where these combination alleles within the gene could compensate for the fitness cost mentioned previously (Paris et al. 2008).
  • Gametic disequilibrium will be transitory in the absence of amitraz selection pressure acting to maintain it, thus facilitating recombination which will break up nonrandom allelic associations (Hartl, Clarke 1989; Halliburton 2003). This could explain the additional variable sites that were detected in heterozygotes which displayed minimal associations with other loci (data not shown). As previously mentioned, heterozygous sub-sections of the population could escape amitraz pressure thus impeding disequilibrium and assisting recombination which gives rise to these new combinations of alleles. Population differentiation studies showed that the inbreeding coefficient (F
  • S inbreeding coefficient
  • the global inbreeding coefficient was -0.137, and indicated an excess of heterozygotes over all populations analyzed (Holsinqer, Weir 2009). This could be due to several factors including disassortative mating, isolate breaking or a Wahlund effect where excess heterozygotes are observed over the HWE expectation (Hartl 2000).
  • the overall degree of genetic differentiation (F S T) revealed that 2.5% of the genetic variation was distributed among subpopulations, while the remaining 97.5% was due to variation within the subpopulations. Exploitation of the existence of associated SNPs resulted in accurate detection of amitraz resistance in anonymous samples. We have showed that molecular detection using a RFLP technique is more economical, easier and faster than traditional larval packet tests.
  • the novelty of this work includes the first confirmation of the two SNPs published by Chen et al. (2007) in amitraz resistant larvae, as well as field populations of ticks. It is also the first report of any association studies being conducted for the OCT/Tyr receptor in ticks. The discovery of a recombination event which could possibly be the 'switch' from susceptible to resistant phenotypes in amitraz exposed populations is a significant advancement towards a more complete perspective on the evolution of acaricide resistance. Lastly, this study is the first indication that heterozygous field populations are susceptible to amitraz treatment, allowing for alternative and improved strategies to be implemented on farms before full blown resistance is acquired.
  • Control samples of amitraz resistant larvae were obtained from the Mnisi area in Kruger National Park from Dr Rosalind Malan. Twelve different strains were provided, of which three were classified as resistant based on their resistance factors, which were determined by conventional larval packet tests
  • a modified salt based extraction method published by Alianabi. Martinez (1997) was used for genomic DNA isolation from whole adult ticks (predominantly female ticks). Whole ticks were homogenized in 200 ⁇ lysis buffer (0.5 M EDTA, 0.5% (w/v) Sodium lauroyi sarcosinate). An additional 400 ⁇ of DNA extraction solution (0.4 M NaCI, 60 mM Tris-HCI, 12 mM EDTA, 0.25% SDS, pH 8.0) was added to the samples along with 2 ⁇ of proteinase K (15 mg/ml), mixed well and incubated overnight at 55°C.
  • Samples were incubated for 20 min at 65°C to inactivate the proteinase K, after which 1 ⁇ of RNase A (10 mg/ml) was added. Samples were briefly vortexed and further incubated at 37°C for 15 min. Protein precipitation was performed by adding 360 ⁇ of 5 M NaCI, vortexing for 10 sec, and incubation on ice for 5 min, followed by centrifugation at 25 500xg for 20 min at room temperature. An equal volume of isopropanol was added to the supernatant, briefly vortexed, followed by an incubation of 1 hour at -20°C. Samples were then centrifuged for 20 min at 10 000xg and the supernatants discarded.
  • DNA pellets were washed three consecutive times with 500 ⁇ of 70% ethanol, centrifuged for 5 min at 10 000xg, and the supernatant discarded. The final DNA pellets were air dried and then re-suspended in 50 ⁇ of 1 x TE buffer (1 mM Tris-HCI, 0.1 mM EDTA, pH 7.0).
  • Gametic disequilibrium studies were performed to determine intragenic association (linkage) between SNP alleles within the OCT/Tyr receptor gene. This analysis was carried out using the Multilocus 1 .2b1 program (Agapow, Burt 2001 ). For these analyses, 100 000 data randomizations were performed to compare the observed data with randomized data that mimic gametic equilibrium. If the observed dataset displayed increased gametic disequilibrium compared to the randomized datasets, it was assumed that there is association between the loci. This was further supported by P-values. Functions carried out using Multilocus included analysis of genotypic diversity versus the number of loci, linkage disequilibrium and population differentiation analysis.
  • the rapid diagnostic test for amitraz resistance was evaluated in the form of a RFLP analysis.
  • Susceptible and resistant R. decoloratus larvae were obtained from the University of the Free State, South Africa (Ms. Ellie van Dalen), for the purpose of a double blind study. Larvae were labeled from one through 14, with the status of their resistance unknown until after the experiment.
  • the OCT/Tyr receptor gene was amplified from bulked larval DNA, and amplicons were subsequently treated with 4 U of Ec/I restriction enzyme. Depending on the particular pattern that was observed after digestion, samples were classified as susceptible or resistant to amitraz treatment. These tests were compared to independently assessed resistance statuses in order to confirm the accuracy of the diagnostic test.
  • the invention provides for a rapid diagnostic test to assess amitraz resistance in R. microplus.
  • the test includes the steps of
  • Samples were incubated for 20 min at 65°C to inactivate the proteinase K, after which 1 ⁇ of RNase A (10 mg/ml) was added. Samples were briefly vortexed and further incubated at 37°C for 15 min. Protein precipitation was performed by adding 360 ⁇ of 5 M NaCI, vortexing for 10 sec, and incubation on ice for 5 min, followed by centrifugation at 25 500xg for 20 min at room temperature. An equal volume of isopropanol was added to the supernatant, briefly vortexed, followed by an incubation of 1 hour at -20°C. Samples were then centrifuged for 20 min at 10 000xg and the supernatants discarded.
  • DNA pellets were washed three consecutive times with 500 ⁇ of 70% ethanol, centrifuged for 5 min at 10 000xg, and the supernatant discarded. The final DNA pellets were air dried and then re-suspended in 50 ⁇ of 1 x TE buffer (1 mM Tris-HCI, 0.1 mM EDTA, pH 7.0). Genomic DNA was extracted from individual larvae using a modification of the protocol by Hernandez et al. (2002). Briefly, individual larvae were crushed in a 1 .5 ml microcentrifuge tube containing 25 ⁇ TE buffer (10 mM Tris, 1 mM EDTA, pH 7.6). The suspension was then boiled for 5 min and centrifuged at 4000xg for 30 sec at room temperature. The supernatant was directly used for PCR.
  • a new forward primer was designed SEQ. ID. NO. 1 (OAR-F172 (5'- AGC ATT CTG CGG TTT TCT AC-3')) and a published reverse primer SEQ. ID. NO. 2 (OAR-R587 (5' - GCA GAT GAC CAG CAC GTT ACC G - 3')) was used for amplification of the gene.
  • New PCR conditions were developed for the amplification, namely: 94°C for 4 min, followed by 40 cycles of 94°C for 30 sec, 55°C for 30 sec and 72°C for 1 min, with a final extension of 72°C for 8 min.
  • Amplification of these genes was to detect the two published SNPs: a. A22C (nucleotide sequence) / T8P (amino acid sequence)
  • the mutation site is C39T.
  • the additional mutation site G41A (nucleotide) / G14E (amino acid) is novel and has never before been reported.
  • the chosen enzyme (Ec/I) will recognize mutations at both sites.
  • the G41A mutation is closely linked with the recombination mutation found at position C159T (coding region), which is also novel and suggested to be the switch from susceptible to resistant.
  • Amplified fragments of the octopamine receptor were subsequently treated with 4 U of Ec/I restriction enzyme in a 50 ⁇ reaction containing 5 ⁇ of the Cuts martTM buffer (50 mM Potassium acetate, 20 mM Tris-acetate, 10 mM Magnesium acetate and 100 pg/ml BSA, pH 7.9).
  • enzymes that could be used for diagnostics recognise the sequence 5'- GGATG -3', which would pick up a mutation at position T36C (nucleotide sequence). This mutation is closely associated with susceptibility rather than resistance, but could still be used for diagnostics.
  • List of enzymes include; BseGI, BstF5l, BstPZ418l, Fokl, Stsl.
  • An enzyme which recognises sequence 5'- GGACG -3' could also be used for the test.
  • the test may include detection of up- regulated enzymes (i.e. glutathione-s-transferases, cytochrome P450's, carboxylesterases). Detection methods of these include qPCR and Taqman assays. The test can detect resistance to pyrethroids and formamidines

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Analytical Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Immunology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention provides a method for detecting a genetic polymorphism associated with susceptibility, or resistance of an ectoparasite to an acaricide, the method comprising the step of screening a DNA sample from the ectoparasite for the presence of one or more markers in the octopamine/tyramine receptor gene.

Description

GENETIC MARKERS FOR DETERMINING ECTOPARASITE SUSCEPTIBILITY
TO ACARICIDES
FIELD OF THE INVENTION
This invention relates to ectoparasite control. More particularly, the invention relates to a method of identifying amitraz resistance in an ectoparasite, to polymorphisms/genetic markers associated with such resistance, and to nucleotide sequences useful for detecting such resistance markers.
BACKGROUND OF THE INVENTION
The tick Rhipicephaius micropius (formaly Boophilus micropius) is a largely invasive ectoparasite of great economic importance due to the negative effect it has on agricultural livestock on a global scale. Tick-borne diseases (babesiosis and anaplasmosis) transmitted by R. micropius are alarming as it decreases the quality of livestock. In sub-Saharan Africa, cattle represent a major source of meat and milk, but this region of the world is severely affected by the Rhipicephaius micropius tick. The principal method for tick control is the use of chemical acaricides, notably amitraz, which was implemented in the 1990's after resistance to other acaricides surfaced. However, the efficiency of chemical control is hindered by an increase in the frequency of mutant resistance alleles to amitraz in tick populations. Presently, the only way to assess amitraz resistance is by means of larval packet tests, but this technique is time-consuming and not particularly cost effective.
Rhipicephaius micropius ticks are hematophagous ectoparasites of veterinary importance, and are capable of parasitizing a variety of hosts, although cattle are their primary preference (Walker et ai. 2003). These ticks are adept in transmitting a variety of tick-borne diseases to cattle, most notably Babesia bovis, which causes Asiatic babesiosis or redwater (Walker et al. 2003; Horak, Goiezardy, Uys 2007). The lack of efficient tick control strategies and management programs results in a severe economic burden, threatening the sustainability of the livestock industry in South Africa and globally. The use of chemical acaricides is still the most preferred method for tick control, but has become less effective due to the emergence of resistance. To date, resistance has been reported for all the major classes of acaricides, including synthetic pyrethroids (He et ai. 1999; Aquilar-Tipacamu et al. 2008; Chen et al. 2009; Morgan et al. 2009; Jonsson et al. 2010a), organophosphates and carbamates (Guerrero, Pruett, Li 2003; Li, Davey, George 2005; Guerrero, Lovis, Martins 2012), formamidines (Soberanes et al. 2002; Fernandez-Salasa, Rodriguez-Vivas, Alonso-Diaza 2012; Guerrero, Lovis, Martins 2012) and macrocyclic lactones (Pohl et al. 201 1 ; Fernandez-Salasa, Rodriguez-Vivas, Alonso-Diaza 2012; Fernandez-Salasa et al. 2012). Resistance to acaricides has been attributed to target site insensitivity as well as metabolic detoxification, depending on the mode of action of the acaricide.
Rhipicephalus microplus ticks have acquired the ability to evade the toxic effects of chemical acaricides by developing different resistance mechanisms. The cuticle surrounding the tick, which reduces acaricide access to the internal environment of the tick body, confers penetration resistance. However, further investigations into this type of resistance in R. microplus has not been reported since 1983 (Schnitzerling, Nolan, Hughes 1983). An additional resistance mechanism common in arthropods is target site insensitivity. This adaptive mechanism involves the alteration of the drug target site at the DNA level by alteration of the wild-type allele to a mutant form, which renders acaricide treatment ineffective. Lastly, metabolic resistance to acaricide treatment involves the increased ability to detoxify or sequester the acaricide. This involves the up- regulation of common detoxifying enzymes including cytochrome P450s, esterases and glutathione-S-transferases (Guerrero, Lovis, Martins 2012). All of the aforementioned mechanisms have been shown to play a vital role in tick resistance to chemical acaricides.
Amitraz is a common formamidine acaricide, which is extensively used for tick control in South Africa. The target site for amitraz in R. microplus has yet to be defined, which ultimately delays any further development with regard to screening assays for diagnostics. It was proposed that monoamine oxidase, alpha- 2-adrenceptors, and the octopamine receptor are good candidates for potential target sites, with the latter being the most probable in ticks (Jonsson, Hope 2007). It is thought that amitraz is a potential agonist of the octopaminergic system located in the tick synganglion. It was shown that in the presence of amitraz, the octopamine receptor is activated and this overstimulation at synapses has lethal effects on the tick (Booth 1989; Lees, Bowman 2007). The octopaminergic receptors have been classified into three distinct classes namely, a-adrenergic-like (aOCT), β-adrenergic-like (βΟΟΤ), and octopamine/tyramine (OCTTTyr) or tyraminergic (Evans, Maqueira 2005).
Resistance to amitraz is complex and suggested to be multigenic in nature, involving recessive inheritance of resistance alleles (Li et al. 2004; Li et al. 2005; Fragoso-Sanchez et ai. 201 1 ). To date, no adequate resistance mechanisms against amitraz have been shown for R. microplus, but several such mechanisms have been suggested. Li et al. (2004) illustrated, by means of synergistic studies with enzyme inhibitors, that metabolic detoxification plays a role in amitraz resistance. However, these results were variable across different R. microplus strains, and the overall contributions of detoxifying enzymes were difficult to evaluate. The Mexican Pesqueria tick strain was confirmed to convey metabolic resistance to amitraz by up-regulation of glutathione-S-transferase (Saldivar et al. 2008). It was further suggested that target site insensitivity could perhaps be the main mechanism of amitraz resistance. Unfortunately, conclusive studies to illustrate this mechanism have been unsuccessful (Fragoso-Sanchez et al. 201 1 ; Guerrero. Lovis. Martins 2012).
Baxter, Barker (1999) sequenced the putative octopamine receptor from an amitraz resistant and susceptible R. microplus Australian strain. Sequence analysis revealed no differentiation between the two. It was later proposed that two single nucleotide polymorphisms (SNPs) in the octopamine receptor were linked to amitraz resistance (Chen, He, Davey 2007). However, these SNPs were inferred only by sequence alignment between a susceptible Australian strain, the susceptible American Gonzalez strain, and the resistant Santa Luiza strain (Chen, He, Davey 2007). Sequencing of the octopamine receptor gene from these strains revealed 37 SNPs, of which nine were non-synonymous substitutions. Seven of these were attributed to geographical differences between the strains, while the remaining two SNPs were potentially linked to amitraz resistance. These two SNPs occur at amino acid position 8 (threonine to proline) and 22 (leucine to serine) of the octopamine receptor protein (Chen, He, Davey 2007). Recent studies then indicated that previous work was most likely conducted on a OCT/Tyr-like receptor rather than the native octopamine receptor (Corlev, Piper, Jonsson 2012). This consequently led to the discovery of an SNP (161 F) in the β- adrenergic-like octopamine receptor of R. microplus (Corley et al. 2013). This particular SNP was only localized to central Queensland (Australia) region and absent in north and southeast regions, thus minimizing its probability of being the major causative reason for amitraz resistance in Australia. Currently, the only way to effectively evaluate amitraz resistance is by means of larval packet tests (LPTs) (Stone, Haydock 1962), however, these assays are limited in practicality as it takes approximately six weeks to obtain results.
All references to tick DNA sequences and single nucleotide polymorphisms (SNP's) refer to the nucleotide sequences of the coding region only, positions from non-coding regions are excluded.
References Agapow, P-M, A Burt. 2001 . Indices of multilocus linkage disequilibrium. Molecular ecology notes 1 : 101 -102.
Aguilar-Tipacamu, G, RJ Miller, R Hernandez-Ortiz, Rl Rodriguez-Vivas, C Vasquez-Pelaez, Z Garcia-Vazquez, F Olvera-Valencia, R Rosario-Cruz. 2008. Inheritance of pyrethroid resistance and a sodium channel gene mutation in the cattle tick Boophilus microplus. Parasitol Res 103:633-639.
Aljanabi, SM, I Martinez. 1997. Universal and rapid salt-extraction of high quality genomic DNA for PCR-based techniques. Nucleic Acids Research 25:4692-4693. Balfanz, S, T Strunker, S Frings, A Baumann. 2005. A family of octopamine receptors that specifically induce cyclic AMP production or Ca2+ release in Drosophila melanogaster. Journal of Neurochemistry 93:440-451 .
Baxter, GD, SC Barker. 1999. Isolation of a cDNA for an octopamine-like, G- protein coupled receptor from the cattle tick, Boophilus microplus. . Insect Biochemistry and Molecular Biology 29:461 -467. Booth, TF. 1989. Effects of biogenic amines and adrenergic drugs on oviposition in the cattle tick Boophilus: evidence for octopaminergic innervation of the oviduct. Experimental and Applied Acarology 7:259-266.
Chen, AC, H He, RB Davey. 2007. Mutations in a putative octopamine receptor gene in amitraz-resistant cattle ticks. Veterinary Parasitology 148:379-383.
Chen, AC, H He, KB Temeyer, S Jones, P Green, SC Barker. 2009. A Survey of Rhipicephalus microplus Populations for Mutations Associated With Pyrethroid Resistance. J Econ Entomol 102:373-380.
Corley, SW, NN Jonsson, EK Piper, C Cutulle, MJ Stear, JM Seddon. 2013. Mutation in the RmβAOR gene is associated with amitraz resistance in the cattle tick Rhipicephalus microplus. PNAS 1 10: 16772-16777.
Corley, SW, EK Piper, NN Jonsson. 2012. Generation of full-length cDNAs for eight putative GPCnR from the cattle tick, R. microplus using a targeted degenerate PCR and sequencing strategy. . Plos One 7:e32480.
Evans, PD, B Maqueira. 2005. Insect octopamine receptors: a new classification scheme based on studies of cloned Drosophila G-protein coupled receptors. Invertebrate Neuroscience 5: 1 1 1 -1 18.
Farooqui, T. 2012. Review of octopamine in insect nervous systems. Insect Physiology 4: 1 -17.
Faza, AP, IS Pinto, I Fonseca, GR Antunes, CM Monteiro, E Daemon, S Muniz Mde, MF Martins, J Furlong, MC Prata. 2013. A new approach to characterization of the resistance of populations of Rhipicephalus microplus (Acari: Ixodidae) to organophosphate and pyrethroid in the state of Minas Gerais, Brazil. Experimental Parasitology 134:519-523.
Fernandez-Salasa, A, Rl Rodriguez-Vivas, MA Alonso-Diaza. 2012. First report of a Rhipicephalus microplus tick population multi-resistant to acaricides and ivermectin in the Mexican tropics. Veterinary Parasitology 183:338- 342.
Fernandez-Salasa, A, Rl Rodriguez-Vivas, MA Alonso-Diaza, H Basurto- Camberosa. 2012. Ivermectin resistance status and factors associated in Rhipicephalus microplus (Acari: Ixodidae) populations from Veracruz, Mexico. Vet Parasitol.
Fragoso-Sanchez, H, Z Garcia-Vazquez, A Tapia-Perez, A Ortiz-Najera, R Rosario-Cruz, I Rodriguez-Vivas. 201 1 . Response of Mexican Rhipicephalus (Boophilus) micropius Ticks to Selection by Amitraz and Genetic Analysis of Attained Resistance. Journal of Entomology 8:218-228.
Gibson, G, SP Muse. 2009. A primer of Genome Science. Sunderland, Massachusetts USA: Sinauer Associates, Inc. Pubishers.
Guerrero, FD, L Lovis, JR Martins. 2012. Acaricide resistance mechanisms in Rhipicephalus (Boophilus) micropius. Revista Brasileira de Parasitologia Veterinaria 21 : 1 -6.
Guerrero, FD, JH Pruett, AY Li. 2003. Molecular and biochemical diagnosis of esterase-mediated pyrethroid resistance in a Mexican strain of Boophilus micropius (Acari: Ixodidae). Exp Appl Acarol 28:257-264.
Hall, T. 2007. BioEdit: Biological sequence alignment editor for Win95/98/NT/2K/XP [Online].
Halliburton, R. 2003. Introduction to population genetics: Benjamin-Cummings Publishing Company.
Hartl, D, A Clarke. 1989. Principles of population genetics theory: Sinauer, Sunderland.
Hartl, DL. 2000. A Primer of Population Genetics Sunderland, MA. : Sinauer Associates,.
He, H, AC Chen, RB Davey, GW Ivie, JE George. 1999. Identification of a Point Mutation in the para-Type Sodium Channel Gene from a Pyrethroid-Resistant Cattle Tick. Biochemical and Biophysical Research Communications 261 :558-561 . Hernandez, R, FD Guerrero, JE George, GG Wagner. 2002. Allele frequency and gene expression of a putative carboxylesterase-encoding gene in a pyrethroid resistant strain of the tick Boophilus micropius. Insect Biochemistry and Molecular Biology 32: 1009-1016.
Holsinger, KE, BS Weir. 2009. Genetics in geographically structured populations: defining, estimating and interpreting FST. Nature Reviews, Genetics 10:639-650. Horak, IG, H Golezardy, AC Uys. 2007. Ticks associated with the three largest wild ruminant species in southern Africa. Onderstepoort J Vet Res 74:231 -242. Jonsson, NN, C Cutulle, SW Corley, JM Seddon. 2010a. Identification of a mutation in the para-sodium channel gene of the cattle tick Rhipicephalus micropius associated with resistance to flumethrin but not to cypermethrin. International Journal for Parasitology 40: 1659-1664. Jonsson, NN, M Hope. 2007. Progress in the epidemiology and diagnosis of amitraz resistance in the cattle tick Boophiius micropius. Veterinary Parasitology 146: 193-198.
Jonsson, NN, RJ Miller, DH Kemp, A Knowles, AE Ardila, RG Verrall, JT Rothwell. 2010b. Rotation of treatments between spinosad and amitraz for the control of Rhipicephalus (Boophiius) micropius populations with amitraz resistance. Veterinary Parasitology 169: 157-164.
Katoh, Standley. 2013. MAFFT multiple sequence alignment software version 7: improvements in performance and usability, (outlines version 7). Molecular Biology and Evolution 30:772-780.
Kliot, A, M Ghanim. 2012. Fitness costs associated with insecticide resistance. Pest Management Science 68: 1431 -1437.
Lees, K, AS Bowman. 2007. Tick neurobiology: recent advances and the post- genomic era. Invertebrate Neuroscience 7: 183-198.
Lempereur, L, D Geysen, M Madder. 2010. Development and validation of a PCR- RFLP test to identify African Rhipicephalus (Boophiius) ticks. Acta Tropica 1 14:55- 58.
Li, AY, RB Davey, JE George. 2005. Carbaryl Resistance in Mexican Strains of the Southern Cattle Tick (Acari: Ixodidae). J Econ Entomol 98:552-556.
Li, AY, RB Davey, RJ Miller, JE George. 2004. Detection and Characterization of Amitraz Resistance in the Southern Cattle Tick, Boophiius micropius (Acari: Ixodidae). JOURNAL OF MEDICAL ENTOMOLOGY 41 .
Li, AY, RB Davey, RJ Miller, JE George. 2005. Mode of inheritance of amitraz resistance in a Brazilian strain of the southern cattle tick, Boophiius micropius (Acari: Ixodidae). Experimental and Applied Acarology 37: 183-198.
Lyngs0, RB, YS Song, J Hein. 2005. Minimum Recombination Histories by Branch and Bound.239-250.
M'diaye, K, M Bounias. 1991. Sublethal effects of the formamidine amitraz on honeybees gut lipids, following in vivo injections. Biomedical and Environmental Science 4:376-383.
Madder, M, IG Horak. 2010. Tick Photodatabase. Tick Species. Belgium and Pretoria: Institute of Tropical Medicine Antwerpen-Belgium and the University of Pretoria, p. Rhipicephalus, Amblyomma, Hyalomma. Maqueira, B, H Chatwin, PD Evans. 2005. Identification and characterization of a novel family of Drosophila β-adrenergic-like octopamine G-protein coupled receptors. Journal of Neurochemistry 94:547-560.
Morgan, JAT, SW Corley, LA Jackson, AE Lew-Tabor, PM Moolhuijzen, NN Jonsson. 2009. Identification of a mutation in the para-sodium channel gene of the cattle tick Rhipicephalus (Boophilus) microplus associated with resistance to synthetic pyrethroid acaricides. International Journal for Parasitology 39:775-779. Nachman, MW. 2006. Detecting selection at the molecular level. Evolutionary Genetics, Concepts and Case Studies.
Paris, M, F Roux, A Berard, X Reboud. 2008. The effects of the genetic background on herbicide resistance fitness cost and its associated dominance in Arabidopsis thaliana. Heredity (Edinb) 101 :499-506.
Pohl, PC, GM Klafke, DD Carvalho, JR Martins, S Daffre, IdSV Jr., A Masuda. 201 1 . ABC transporter efflux pumps: A defense mechanism against ivermectin in Rhipicephalus (Boophilus) microplus. International Journal for Parasitology 41 : 1323-1333.
Price, EW, I Carbone. 2005. SNAP: workbench management tool for evolutionary population genetic analysis. Bioinformatics 21 :402-404.
Robb, S, TR Cheek, FL Hannan, LM Hall, JM Midgley, PD Evans. 1994. Agonist- specific coupling of cloned Drosophila octopamine/tyramine receptor to multiple second messenger systems. EMBO Journal 16: 1325-1330.
Rosado-Aguilar, JA, Rl Rodriguez-Vivas, Z Garcia-Vazquez, H Fragoso-Sanchez,
A Ortiz-Najera, R Rosario-Cruz. 2008. Development of amitraz resistance in field populations of Boophilus microplus (Acari: Ixodidae) undergoing typical amitraz exposure in the Mexican tropics. Veterinary Parasitology 152:349-353.
Saldivar, L, FD Guerrero, RJ Miller, KG Bendele, C Gondro, KA Brayton. 2008.
Microarray analysis of acaricide-inducible gene expression in the southern cattle tick, Rhipicephalus (Boophilus) microplus. Insect Molecular Biology 17:597-606.
Schnitzerling, HJ, J Nolan, S Hughes. 1983. Toxicology and metabolism of some synthetic pyrethroids in larvae of susceptible and resistant strains of the cattle tick
Boophilus microplus (Can.). Pesticide Science 14:64-72.
Shin, DH, WH Hsu. 1994. Influence of the formamidine pesticide amitraz and its metabolites on porcine myometrial contractility: involvement of alpha 2- adrenoceptors and Ca2+ channels. Toxicology and Applied Pharmacology 128:45- 49.
Soberanes, N, MS Vargas, HF Sanchez, ZG Vazquez. 2002. First case reported of amitraz resistance in the cattle tick Boophilus microplus in Mexico. Tecnica Pecuaria en Mexico 40:81 -92.
Stone, BF, KP Haydock. 1962. A method for measuring the acaricide susceptibility of the cattle tick Boophilus microplus (Can.). Bulletin of Entomological Research:563-578.
Walker, AR, A Bouattour, JL Camicas, A Estrada-Pena, IG Horak, AA Latif, RG Pegram, PM Preston. 2003. Ticks of Domestic Animals in Africa: a Guide to Identification of Species. Edinburgh: Bioscience Reports.
Yeh, FC, RC Yang, T Boyle, ZH Ye, JX Mao. 1997. POPGENE: the user-friendly shareware for population genetic analysis. Molecular Biology and Biotechnology Centre, University of Alberta, Canada.
SUMMARY OF THE INVENTION
Broadly according to one aspect of the invention, there is provided a method for detecting a genetic polymorphism associated with susceptibility, or resistance of an ectoparasite to an acaricide, the method comprising the step of screening a DNA sample from the ectoparasite for the presence of one or more markers in the octopamine/tyramine receptor gene.
The method may include an additional step of determining homozygosity and heterozygosity of the ectoparasite.
The acaricide may be in the form of any one of pyrethroids, formamidines or the like. The acaricide may be in the form of amitraz. The ectoparasite may be in the form of a tick. The ectoparasite may be in the form of any one of Rhipicephalus microplus, Rhipicephalus decoloratus or the like. The one or more markers may be in the form of polymorphisms. The one or more markers may be in the form of single nucleotide polymorphisms (SNPs). The markers may be in the form of any one or more of A22C and
T65C, wherein the presence of any one or both of A22C and T65C is associated with resistance of the ectoparasite to the acaricide.
The one or more markers may include any one or more of C39T, G41A, G121A, T138C and C159T, wherein their presence is associated with resistance of the ectoparasite to the acaricide.
The one or more markers may include any one or both of T36C and G141 C, wherein the presence of T36C and/or G141 C is associated with susceptibility of the ectoparasite to the acaricide.
Determining homozygosity and heterozygosity of ectoparasites, may include classifying ectoparasites having all markers associated with resistance, the markers being single nucleotide polymorphisms (SNP's) in the form of A22C, T65C, C39T, G41A, G121A, T138C and C159T, as homozygous resistant ectoparasites and ectoparasites having only a number of the markers associated with resistance, as heterozygous ectoparasites.
The method may include any suitable technique for determining the presence or absence of the one or more markers in the DNA sample from the ectoparasite, the technique includes any of: restriction fragment length polymorphism mapping, amplification reactions, hybridization of nucleic acids to allele-specific probes or oligonucleotide arrays, various chip technologies, polynucleotide sequence techniques and combinations thereof.
The method may include the step of subjecting the DNA sample to polynucleotide amplification using a primer pair comprising SEQ. ID NO. 1 and SEQ. ID. NO. 2, and functional fragments, variants, and mutations of each. Primers for SEQ.ID. OAR-F172: SEQ.ID. OAR-R587:
use in NO.1 5'- agcattctgcggttttctac NO. 2 5'- amplification -3' gcagatgaccagcacgttaccg- of the 3'
octopamine/
tyramine
receptor
Further, according to the invention, there is provided a method of determining the susceptibility, or otherwise, of an ectoparasite to an acaricide, the method comprising the steps of:
extracting a DNA sample from the ectoparasite;
amplifying a sequence of the DNA sample corresponding to at least part of a coding sequence of an octopamine/tyramine receptor of the ectoparasite;
obtaining an amplification product; and
analyzing the amplification product for the presence of one or more markers associated with susceptibility or resistance of the ectoparasite to the acaricide.
The method may include an additional step of determining homozygosity and heterozygosity of the ectoparasites. The acaricide may be in the form of any one of pyrethroids, formamidines and the like. Specifically, the acaricide may be in the form of amitraz.
The ectoparasite may be in the form of a tick. Specifically, the ectoparasite may be in the form of any one of Rhipicephaius micropius, Rhipicephaius decoloratus and the like.
The one or more markers may be single nucleotide polymorphisms (SNPs). The SNPs may be any one or more of A22C and T65C wherein the presence of any one or both of A22C and T65C is associated with resistance of the ectoparasite to the acaricide. The one or more SNPs may include any one or more of C39T, G41A, G121A, T138C and C159T wherein their presence is associated with resistance of the ectoparasite to the acaricide. The one or more SNPs may include T36C and G141 C wherein the presence of T36C and/or G141 C is associated with susceptibility of the ectoparasite to the acaricide. Determining homozygosity and heterozygosity of ectoparasites, may include classifying ectoparasites having all SNP's associated with resistance (A22C, T65C, C39T, G41A, G121A, T138C and C159T) as homozygous resistant ectoparasites and ectoparasites having only a number of the SNP's associated with resistance (not all), as heterozygous ectoparasites.
The DNA sample may be amplified using a primer pair selected from the nucleotide sequences of SEQ. ID NO. 1 , SEQ. ID. NO. 2, and functional fragments, variants, and mutations of each. The step of analyzing the amplification product for the presence of one or more markers associated with resistance of the ectoparasite to the acaricide may be by way of sequencing the amplification product, quantifying the amplification product, detecting a probe linked to the amplification product, using primer extension (PEXT) reaction visualized through a dip stick assay or the like.
The step of analyzing the amplification product may include exposing the amplification product to restriction enzyme digestion.
Typically, the restriction digestion may be accomplished by using a restriction enzyme having a recognition site corresponding to at least part of the one or more markers. In one embodiment, the restriction digestion may be accomplished by a restriction enzyme having a recognition sequence comprising 5'-GGCGGA-3' (SEQ. ID. NO. 3). The restriction enzyme may be Ec/'l. Alternatively, or additionally, the restriction may be accomplished by using a restriction enzyme having a recognition sequence comprising 5'- GGACG - 3' (SEQ. ID. NO. 4). Accordingly, the restriction enzyme may be selected from the group consisting of any one or more of: BseG\, BstF5\, SsfPZ418l, Fok\, Sts\ and any enzyme that recognizes a site corresponding to at least part of the one or more markers.
Following digestion, the resulting fragments may be separated at least partially from one another using size-based separation techniques, such as gel electrophoresis and the like.
The markers may be DNA-based markers selected from the group consisting of A22C and T65C of the coding sequence of the DNA sequence amplified using the method of the invention.
The markers may be peptide-based markers selected from the group consisting of G14E, T8P and L22S. The invention extends to the use of any one or more of genetic markers C39T, G41A, G121A, T138C and C159T as indicators of resistance of the ectoparasite to the acaricide. The invention further extends to the use of any one or more of genetic markers T36C and G141 C as indicators of susceptibility of the ectoparasite to the acaricide.
The step of extracting a DNA sample from the ectoparasite may be in the form of extracting DNA from any one of whole ticks or larvae.
In an embodiment in which the DNA is extracted from whole adult ticks, a modified salt based extraction method may be used for genomic DNA isolation.
The modified salt based extraction method includes the steps of providing whole tick samples;
homogenizing the whole ticks in 200 μΙ lysis buffer (0.5 M EDTA, 0.5% (w/v)
Sodium lauroyl sarcosinate).
adding an additional 400 μΙ of DNA extraction solution (0.4 M NaCI, 60 mM Tris-HCI, 12 mM EDTA, 0.25% SDS, pH 8.0) to the samples along with 2 μΙ of proteinase K (15 mg/ml), mixed well and incubated overnight at 55°C; incubating the samples for 20 min at 65°C to inactivate the proteinase K, after which 1 μΙ of RNase A (10 mg/ml) is added;
vortexing the samples briefly;
incubating the samples at 37°C for 15 min;
performing protein precipitation by adding 360 μΙ of 5 M NaCI, vortexing for
10 sec, and incubation on ice for 5 min, followed by centrifugation at 25 500xg for 20 min at room temperature, to provide a supernatant;
adding an equal volume of isopropanol to the supernatant, briefly vortexing, followed by an incubation of 1 hour at -20°C;
centrifuging the samples for 20 min at 10 OOOxg and discarding the supernatants; washing DNA pellets three consecutive times with 500 μΙ of 70% ethanol, centrifuged for 5 min at 10 OOOxg, and discarding the supernatant; and air drying the final DNA pellets; and
re-suspended the air dried DNA pellets in 50 μΙ of 1 x TE buffer (1 mM Tris- HCI, 0.1 mM EDTA, pH 7.0).
In an embodiment in which the Genomic DNA is extracted from individual larvae the extraction method includes
crushing individual larvae in a 1 .5 ml microcentrifuge tube containing 25 μΙ TE buffer (10 mM Tris, 1 mM EDTA, pH 7.6) to form a suspension;
boiling the suspension for 5 min
centrifuging at 4000xg for 30 sec at room temperature to provide a supernatant; and
using the supernatant for PCR.
The step of amplifying the DNA sample may be accomplished by subjecting the DNA sample to the following heating, annealing, and cooling conditions, respectively:
heat to 94°C for 4 min;
followed by 40 cycles of 94°C for 30 sec, 55°C for 30 sec and 72°C for 1 min; and
with a final extension of 72°C for 8 min. The invention also extends to an isolated nucleic acid molecule selected from the group consisting of:
(i) a nucleic acid molecule comprising the sequence of SEQ. ID. NO. 1 ;
(ii) a nucleic acid fragment having a sequence derived from a octopamine/tyramine receptor gene and containing any one or more of markers associated with resistance of an ectoparasite to an acaricide, the markers selected from: A22C, T65C, C39T, G41A, G121A, T138C and C159T;
(iii) a nucleic acid fragment having a sequence derived from a octopamine/tyramine receptor gene and containing any one or more of markers associated with susceptibility of an ectoparasite to an acaricide, the markers selected from: T36C and G141 C; and
(iv) sequences complementary thereto.
The isolated nucleic acid molecule may be in the form of a non- naturally occurring sequence.
The non-naturally occurring sequence may be in the form of c-DNA.
The invention further provides for an amplified polynucleotide having a polymorphism in the form of any one or more of: A22C, T65C, C39T, G41A, G121A, T138C, C159T, T36C and G141 C.
The invention also extends to use of an isolated nucleic acid molecule as described or an amplified polynucleotide as described, in a method for detecting a genetic polymorphism associated with susceptibility or resistance of an ectoparasite to an acaricide.
The invention further provides for use of any one or more of genetic markers C39T, G41A, G121A, T138C and C159T as indicators of resistance of an ectoparasite to an acaricide.
The invention extends to use of any one or both of genetic markers T36C and G141 C as indicators of susceptibility of an ectoparasite to an acaricide. The invention also extends to use of any one or more of genetic markers in the form of peptide-based markers G14E, T8P and L22S as indicators of resistance of an ectoparasite to an acaricide.
The invention further provides for a kit for determining the susceptibility or otherwise of an ectoparasite or a group of parasites to an acaricide, the kit including:
primers in the form of SEQ. ID. NO.1 and SEQ. ID. NO. 2; and
a reagent buffer suitable for allowing the amplification of a DNA sequence to be amplified using the primers.
The kit may include instructions for determining the susceptibility or otherwise of an ectoparasite to an acaricide.
All references to tick DNA sequences and single nucleotide polymorphisms (SNP's) refer to the nucleotide sequences of the coding region only, positions from non-coding regions are excluded.
Further aspects of the invention will now be described by way of non- limiting examples only with reference to the following drawings.
DRAWINGS
Figure 1 shows sequence alignment of a portion of the OCT/Tyr/tyramine receptor gene for amitraz resistant and susceptible R. microplus larvae. Rhipicephaius (Boophiius) microplus was the reference sequence used for the alignments (GenBank Accession: AJ010743.1 ) along with the Santa Luiza resistant strain (GenBank Accession: EF490688.1 ) and the Gonzalez susceptible strain (GenBank Accession: EF490687.1 ). The five samples aligned below the Santa Luiza strain are the resistant samples, and those below the Gonzalez strain are the susceptible ones. The grey blocks indicate two resistance-associated SNPs, namely A22C and T65C. Figure 2 shows an amino acid sequence of a portion of the OCT/Tyr/tyramine receptor gene. The non-coding region of the gene is indicated from amino acid position 1 to 45. Seven substitutions occur within the non-coding regions and six in the open reading frame. Grey blocks highlight the two resistance-associated substitutions.
Figure 3 shows the distribution of the mean diversity versus the number of loci for the OCT/Tyr receptor. A comparison of 22 different loci within the OCT/Tyr/tyramine receptor is shown. Plateau diversity implies there are sufficient samples for further analysis.
Figure 4 shows the density distribution for the OCT/Tyr/tyramine receptor. The Fd values are placed on the x-axis while the relative occurrence of each of these values is displayed on the y-axis. The observed value falls outside of the distribution range generated by the randomized data set.
Figure 5 shows the ancestral recombination graph for homozygous amitraz resistant and susceptible R. microplus ticks in South Africa. H1 , H2, H3, H4 and H5 represent the infinite-sites-compatible haplotype sequences that were observed. Node E represents the ancestral form of the gene with adjoining points (A-D) illustrating coalescent haplotypes. The additional table indicates the sample- haplotype associations for the graph. A recombination event was detected as the ancestor of haplotype H2, and 294- indicating that the recombination event took place between nucleotides 294 and 295 in the alignment. The symbol S means that the suffix for the recombinant was provided by the ancestor of the recombinant and H3, while P means the prefix (the first 294 nucleotides) was provided by the ancestor of the recombinant and H5. Samples from South Africa are labeled with a number indicating the farm of origin, and MF indicates R. microplus females.
Figure 6 shows an agarose gel electropherogram of the OCT/Tyr/tyramine receptor from R. decoloratus larvae digested with Ec/I restriction enzyme. The lane numbers represent samples from the original set of 14 anonymous samples. Lane 1 -sample 5, lane 2-samle 7, lane 3-sample 8, lane 4- sample 6 and lane 5- sample 9 (Supplementary TableS3).
Figure S1 shows the subpopulation structure of ticks across South
Africa.
DETAILED DESCRIPTION OF THE INVENTION
All references to tick DNA sequences and single nucleotide polymorphisms (SNP's) refer to the nucleotide sequences of the coding region only, positions from non-coding regions are excluded.
1. RESULTS
Screen for SNPs in amitraz resistant and susceptible larvae
Amitraz resistant R. microplus larvae obtained from the Mnisi area in the Kruger National Park were screened for the presence of the two resistant SNPs published by Chen et al. (2007). Twenty-four nucleotide substitutions were detected among resistant larvae, susceptible larvae, and the three reference strains from NCBI (Figure 1 ). Seven of the substitutions appeared to be associated with susceptible samples. The first four of these substitutions occurred in the non- coding region (nucleotide position 1 -135) of the gene consisting of one transversion and three transition mutations. The three remaining substitutions within the open reading frame were synonymous, having no observable effect on the amino acid sequence. Four substitutions occurred in all resistant samples (Figure 1 ) and contained two non-synonymous sites at nucleotide positions 157 and 200 (Figure 2, T8P and L22S). These two substitutions correspond with the two published SNPs. There are seven nucleotide substitutions differentiating Boophilus microplus G-protein coupled receptor (GenBank Accession AJ010743.1 ) from the other sequences, three of which occur in the non-coding region and two non-synonymous changes in the coding region (115V and T20A) (Figure 2). Lastly, there are several other SNPs that seem to appear, with two non- synonymous substitutions occurring at nucleotide positions 176 and 256 (Figure 1 ). Samples containing these additional SNPs were resistant.
The sequence data obtained for all larvae was compared to the results from LPTs (Supplementary TableSI ). The comparison reveals a clear correlation between the presence of the SNP (genotypic) and the resistant phenotype determined by LPTs. The comparison was primarily made between larvae which survived the LPT assay (resistant) and those which did not (susceptible). Results clearly show that all larvae which did not survive the LPT assay display the SS or RS genotype, and those that did survive the amitraz exposure display the RR genotype.
Table S1. Correlation between phenotypic (LPT) and genotypic (sequencing)
amitraz resistance status
Larvae that survived LPT
Sample % Amitraz RF of strain0 Genotype0 Phenotype
5AM2(4)A2 0.4 100 RR Amitraz Resistant
5AM2(4)A3 0.4 100 RR Amitraz Resistant
5AM3(8)A1 0.08 100 RR Amitraz Resistant
5AM3(8)A3 0.08 100 RR Amitraz Resistant
3AM2(4)A3 0.4 100 RR Amitraz Resistant
2AM3(16)A3 0.016 28 RR Amitraz Resistant
1AM3(8)A3 0.08 10 RR Amitraz Resistant
Larvae that did not survive LPTsb
Sample % Amitraz RF of strain0 Genotype0 Phenotype
2AM3(16)A1 0.016 28 SS Amitraz susceptible
2AM3(16)A2 0.016 28 SS Amitraz susceptible
1AM3(8)A2 0.08 10 SS Amitraz susceptible
1AM3(8)A3 0.08 10 SS Amitraz susceptible
1AM3(8)1 0.08 10 RS Amitraz susceptible
1AM3(16)1 0.016 10 RS Amitraz susceptible
a Larvae that were alive after the larval packet test assay was complete, meaning they were
resistant to the amitraz concentrations applied. b Larvae that were susceptible to the
concentrations of amitraz used and were dead after the assay was completed. 0 RF is the
resistance factor, and RF of 100 implies that the strain in amitraz resistant. RF of 10 and 28
means the strain is susceptible to amitraz. d Genotype was inferred based on whether or not
the sequenced larvae contained the two SNPs published by Chen et al. (2007). RR - homozygous resistant, SS - homozygous susceptible, RS - heterozygous. Country-wide screen for SNPs in adult ticks
Adult ticks from 108 different farms showed a 50% incidence of R. microplus. The majority of the ticks collected were from the Kwa-Zulu Natal Province. Therefore, a total of 218 alleles (109 adult ticks from across South Africa) were screened for the two published SNPs.
Several additional SNPs were found within the field samples across South Africa, mainly within the non-coding region of the OCT/Tyr receptor gene (data not shown). The frequencies of susceptible (S) and resistance (R) alleles were calculated for the resistance-linked SNPs occurring in the OCT/Tyr receptor gene for all adult ticks. Almost half of the population (48.2%) displayed the resistance alleles for amitraz, and the majority of the population was heterozygous at these nucleotide positions (Supplementary Table S2).
Table S2.Allele frequencies for the octopamine receptor gene from field samples of R.
microplus.
Sample Alleles1 Sample Alleles1 Sample Alleles
44.2MF ss 45.1 MF SS 70.2MF RS
46.2MF RS 45.4MF SS 7.5MF RS
46.3MF RS 45.5MF RR 7.6MF SS
46.5MF RS 21.1 MF SS 37.2MF RS
44.3MF SS 50.3MF SS 41.2MF RS
44.5MF RS 66.1 MF SS 41.1 1 MF RS
44.4MF RS 66.2MF SS 41.12MF RS
71.1 MF RS 66.3MF RS 41.13MF RS
17.1 MF RR 66.5MF RR 49.1 MF SS
20.1 MF SS 66.6MF RS 49.6MF RS
20.2MF ss 67.1 MF RS 49.8MF RR
20.3MF ss 67.2MF RR 49.1 OMF RS
26.7MF RS 67.3MF SS 58.1 MF RS
26.8MF RS 67.4MF RS 58.3MF RS
26.1 MF RS 67.5MF RR 58.7MF RR
26.6MF RR 67.7MF SS 58.1 1 MF RR
47.2MF RS 51.1 MF RS 58.13MF RS
54.1 MF RR 51.2MF RR 93.1 MF RS
54.7MF RS 51.3MF RS 93.2MF RS
54.9MF RS 51.4MF RS 93.3MF RS
54.10MF RR 51.5MF RR 93.4MF RS
73.1 MF RR 69.3MF RS 93.5MF RS
73.2MF RS 69.4MF RS 93.7MF RR
73.3MF RS 69.5MF RS 93.8MF RS
73.9MF RS 9.2MF RR 95.1 MF RS
73.4MF RS 9.1 MF RR 95.3MF RS
73.5MF RS 9.3MF RS 95.4MF RS
73.7MF RS 77.1 MF RS 95.6MF RS
73.8MF SS 9.6MF RR 37.4MF RS
86.1 MF SS 62.1 MF SS 40.3MM SS
86.2MF SS 62.2MF SS 42.1 MF RS
86.3MF RS 62.3MF SS 18.2MF SS
86.4MF RR 62.4MF SS 18.1 MF RS
86.5MF RS 62.5MF RS
86.6MF RS 65.1 MF RR
86.7MF SS 65.2MF RR
86.8MF RS 65.3MF SS R allele 0.482
70.1 MF RS 79.1 MF RS S allele 0.518 The R allele refers to the mutant form giving rise to resistance while the S allele refers to the
wild-type susceptible form of the gene.
Gametic disequilibrium between SNPs
In this study, all SNPs that were present in the OCT/Tyr receptor were analyzed to determine whether they were in gametic disequilibrium. First, diversity was modeled against the number of loci (variable positions in the sequences) (Figure 3). This is essential to determine if there are sufficient samples for the proposed analysis. The graphical plot of mean diversity versus the number of loci should reach a plateau, signifying that there are sufficient samples for further analysis (which is evident in Figure 3). Thus, additional samples or loci would not have changed the diversity that was observed in the sample set.
An analysis of gametic disequilibrium revealed a graphical plot with a bell shaped curve, with the observed rd value falling outside of the general distribution (Figure 4). This implies that the observed rd value was significantly higher (P < 0.00001 ; H0 = random association or gametic equilibrium) than what was generated by the randomized data set, thus emphasizing a deviation from random association. Therefore, the observed data displayed a significant level of gametic disequilibrium (non-random association), while gametic equilibrium (random association) was absent.
Initial comparisons were done for the two SNP loci shown to be involved in amitraz resistance (loci 1 1 and 17). Locus 1 1 corresponds to nucleotide position 157, and locus 17 with that of 200. A pair-wise comparison of these two loci resulted in a rd value of 0.804 (P < 0.00001 ), indicating that these two sites are in gametic disequilibrium. Homozygous resistant samples showed that both substitutions were present. Pair-wise comparisons were then done for all variable loci within the gene (data not shown). Table 1 only shows the results of loci that were significantly associated with the two resistant loci.
Table Loci significantly associated with resistant loci 1 1 and 17.
SNP 1 SNP 2 fd va|uea Aggregate" P-value
Locus 1 1 Locus 12 0.834 < 0.00001
Locus 17 Locus 12 0.921 0.877 < 0.00001
Locus 1 1 Locus 13 0.872 < 0.00001
Locus 17 Locus 13 0.884 0.878 < 0.00001
Locus 17 Locus 19 0.803 0.803 < 0.00001 a rd value represents the gametic disequilibrium that is observed between the two SNPs being compared to one another. b Aggregate value is the mean value of rd values that were obtained for loci 1 1 and 17 associated with the other loci to determine which association displayed the most gametic disequilibrium. Locus 12 corresponds to nucleotide position 171 in the OCT/Tyr receptor alignment (Figure 1 ), locus 13 to that of 174, and locus 19 to that of 273.
The aggregate value of rd was calculated to determine which of the three loci were most strongly associated with the two resistant loci (1 1 and 17). The results showed that the resistant loci are equally associated with both 12 and 13. When comparing sequence data, it is evident that a nucleotide substitution at locus 12 only takes place when the tick is suspected to be susceptible to amitraz. A substitution at locus 13, however, occurs every time the tick is suspected to be resistant. Therefore, perhaps one could consider this particular association as a molecular marker for resistance in the gene.
Population structure was also analyzed by Wright's FST measure of differentiation for the data set, and generated a value of 0.0253 (Holsinger, Weir 2009). This value implies that subdivision of the population accounts for 2.5% of the total genetic variation seen within the total population. Additionally, the observed (H0) and expected (He) heterozygosity for each subpopulation was calculated, along with the inbreeding coefficient (F|S) (Table 2). All F|S values were negative, with the exception of population 3. Global analysis across populations was also done and generated a global inbreeding coefficient of -0.137 indicating excess heterozygosity in comparison to what was expected.
Table 2. Genetic variation among tick populations in South Africa
Population n H0 He F\s HWE
1 8 0.7500 0.5000 -0.6000
2 31 0.5161 0.5034 -0.0420
3 21 0.4762 0.51 10 0.0455
4 5 0.4000 0.3556 -0.2500
5 39 0.6410 0.5052 -0.2854
Overall 104 0.5670 0.4982 -0.1370 Excess heterozygotes Observed (H0) and expected (He) heterozygosity, and fixation indices (F|S) for each subpopulation.
Recombination in the OCT/Tyr receptor gene
Ancestral recombination graphs were constructed by incorporating sequence information from the OCT/Tyr receptor gene of both homozygous resistant and susceptible ticks (Figure 5). A recombination event took place at nucleotide position 294. No mutations occur between the recombination event and the H2 haplotype, therefore H2 is the recombinant. When looking at the sequence data, the nucleotide substitution that occurs at this site is C to T. This substitution is synonymous and only appears in samples suspected to be resistant. This substitution occurred at a frequency of 0.61 in the South African R. microplus tick population (data not shown), especially within heterozygous samples where both susceptible and resistant alleles were present. No geographical significance was found with the haplotype-sample groupings and the area in South Africa where the samples originated from.
RFLP based diagnostic tool for amitraz resistance:
Locus 13, corresponding to nucleotide position 174, was significantly associated with the two resistant loci in the OCT/Tyr receptor gene (Table 1 ). A nucleotide substitution from a C to T was present whenever the tick was phenotypically and genotypically resistant, i.e. both resistance-associated SNPs were present. This was the case for both homozygous and heterozygous SNP alleles. However, this substitution did not result in an amino acid change, due to the degeneracy of the third codon position. Such tight association between loci in the gene could potentially represent a molecular marker for amitraz resistance.
R. decoloratus ticks with known amitraz resistance and susceptibility were used to test the effectiveness of the restriction enzyme Ec/I as a possible diagnostic tool. Fourteen anonymous samples, each containing multiple larvae, were obtained. Of these, five samples were used for RFLP analyses (Figure 6).
Sample 5 (Lane 1 , Figure 6) showed a prominent band at 400 bp, indicating a homozygous genotype and resistant phenotype. This result was corroborated by an independently performed larval packet test (Supplementary TableS3). This particular sample exhibited 13.2% control at a field concentration of 250 ppm amitraz. Samples 7 and 8 (Lanes 2 and 3 respectively, Figure 6) produced identical digest products. In addition to a 400 bp digest product, a 223 bp and 186 bp product was also detected. This result signifies that these samples were heterozygous and were potentially more susceptible to amitraz treatment. Indeed, independent larval packet tests revealed that these samples were 100% susceptible to field concentrations of amitraz. Sample 6 (Lane 4, Figure 6) showed resistance potential in the same fashion as Sample 5, and this was corroborated by a 30% level of control during independent larval packet tests (Supplementary TableS3). Lastly, Sample 9 (Lane 5, Figure 6) showed heterozygosity in the same fashion as Samples 7 and 8, and was 100% susceptible to field concentrations of amitraz (Supplementary TableS3).
Table S3. Rhipicephalus microplus larval packet test results
Sample Collection Tick % Control at field
number date Species Concentration2
1 03-Mar-09 R. dec 0
2 ?? Apr-09 R. dec 100
3 02-Feb-10 R. dec 100
4 18-Mar-10 R. dec 1 1.8
5 06-May-1 1 R. dec 13.2
6 16-Feb-1 1 R. dec 30
7 26-May-10 R. dec 100
8 19-Feb-13 R. dec 100
9 21 -Feb-13 R. dec 100
10 30-Jan-09 R. dec 1 1.8
1 1 29- Apr-09 R. dec 100
12 25-May-10 R. dec 100
13 13- Apr- 12 R. dec 10.9
14 20-Feb-09 R. dec 34.7
2 90-100% Amitraz regarded as effective, 80-90% Effective with reservation, 50-80% Indications of developing resistance, 0-50% Indications of resistance. Amitraz concentration was at 250 ppm.
2. DISCUSSION
In this study, we have investigated the evolution of amitraz resistance in South African Rhipicephalus microplus ticks. Two previously known SNP loci in the OCT/Tyr receptor (Chen et al., 2007) were significantly associated with each other, and with amitraz resistance. Lastly, we exploited the high level of gametic disequilibrium between these two SNPs and an additional SNP, which changes a restriction enzyme binding site, in order to devise an affordable an easy restriction enzyme based assessment tool for amitraz resistance in field samples of ticks.
As previously mentioned, the octopaminergic receptors have been classified into three classes. The a-adrenergic-like octopamine receptors display an increased affinity for octopamine rather than tyramine, which leads to an increase in intracellular Ca2+ concentrations together with a small increase in intracellular cAMP levels (Balfanz et al. 2005; Farooqui 2012). The β-adrenergic- like octopamine receptors on the other hand are specifically activated in response to octopamine directly resulting in increased intracellular cAMP levels (Maqueira, Chatwin, Evans 2005; Farooqui 2012). Lastly, the octopaminergic/tyraminergic (OCTTTyr) receptors have shown immense similarity in terms of structure and pharmacology with the vertebrate a2-adrenergic receptors (Evans. jVlaqueira 2005). Agonistic preferences can result in receptors being stimulated by either octopamine or tyramine. In response to octopamine, there will be an increase in intracellular Ca2+ concentrations. Conversely, a response to tyramine will result in intracellular cAMP levels to decrease (Farooqui 2012). Robb et al. (1994) also demonstrated this principle in Drosophila, where one receptor can display different pharmacological profiles with regard to second messenger systems implemented.
Previous studies done in honeybees (M'diave, Bounias 1991 ) and mammals (Shin. Hsu 1994) suggested that the proposed target site for amitraz is the a-adrenergic-like receptors and the a2-adrenergic receptors respectively. This along with the SNPs discovered by Chen, He, Davev (2007) strongly suggest the involvement of OCT/Tyr like receptors in amitraz resistance. The mutation reported by Corley et al. (2013) in the β-adrenergic-like octopamine receptor seems promising, however, its restricted localization to only the central part of Queensland in Australia further substantiated our notion to investigate the OCT/Tyr receptor instead.
A country-wide screening of the two resistance-associated SNPs in the OCT/Tyr receptor gene revealed a high level of heterozygosity. We hypothesize that positive balancing selection is acting on the population in order to maintain the high prevalence of heterozygosity (Nachman 2006). Selection pressure is imposed on the tick population by the application of amitraz, and this drives resistance-conferring alleles to homozygosity (Soberanes et al. 2002; Rosado-Aquilar et al. 2008). On the other hand, the potential advantages of heterozygosity without amitraz selection pressure can cause subsections of the population, which escape amitraz treatment, to remain heterozygous. This observation could be further explained by a slow rate of fixation during constant selective pressure, such as in tick populations that were under pyrethroid selection pressure (Faza et al. 2013). Studies have also shown that there is a lack of fitness with amitraz-resistant strains (Jonsson et al. 2010b), thus providing insight into the possible selective disadvantage that may be associated with homozygous resistant ticks. This particular fitness cost would largely contribute to the excess heterozygotes found within the study. Such interactions between selection pressure and fitness cost will determine the observed resistance-associated allele frequency, and may occur through direct or pleiotropic effects (Kliot, Ghanim 2012).
The two putative resistance-associated SNP loci were in gametic disequilibrium and they were positively associated with the resistant phenotype. Thus, if both SNP loci display specific nucleotide substitutions, it can be inferred that the tick is resistant to amitraz. Although significant gametic disequilibrium exists for these SNPs, there is a small but important deviation from complete disequilibrium. Gametic disequilibrium among loci can be generated from a variety of factors namely; mutation, population admixture, gene flow, genetic drift, some kinds of natural selection as well as genetic heterogeneity (Halliburton 2003; Gibson, Muse 2009). Coalescent interaction of these forces within the tick population are likely responsible for the incomplete disequilibrium observed.
A third SNP position in the OCT/Tyr receptor gene was significantly associated with the two previously mentioned SNPs. This illustrates that amitraz resistance is potentially associated with complete alleles of the gene, instead of with individual SNP positions. Therefore, associations among SNP positions could potentially be attributed to intact inheritance of alleles. This is further demonstrated by additional variable positions that seemed to distinguish resistant from susceptible phenotypes. Upon constant selection pressure, these variable positions have come to fixation in the population. Therefore, it seems as though exposure to amitraz consequently affects a wider range of loci further substantiating the probability of intact inheritance of alleles. A classic evolutionary process that could be responsible for such an observation is epistatic interaction, where these combination alleles within the gene could compensate for the fitness cost mentioned previously (Paris et al. 2008).
It was then investigated whether intragenic recombination could be inferred from a population sample of the OCT/Tyr receptor gene. Indeed, recombination was detected, and it is unlikely that it is an analysis artifact since the inferred recombination site is 294 bp into the sequenced section of the gene. Recombination in the OCT/Tyr receptor gene would allow new combinations of the prefix and the suffix of the gene, which could allow for new SNP combinations, as well as the emergence of double homozygotes in the population. Our results also showed that such double homozygotes displayed a very high level of resistance to amitraz. Therefore, it is likely that under constant amitraz selection pressure, recombination in the OCT/Tyr receptor gene could play an important role in the emergence of resistance to this acaricide. Additionally, recombination may act to generate or decay allelic combinations (Halliburton 2003), with natural selection acting on these combinations of alleles they may be retained in the population (Gibson, Muse 2009). This explains the complete allele inheritance observed within this population. The relative strength of these two processes will determine the strength of the disequilibrium among loci (Halliburton 2003).
Gametic disequilibrium will be transitory in the absence of amitraz selection pressure acting to maintain it, thus facilitating recombination which will break up nonrandom allelic associations (Hartl, Clarke 1989; Halliburton 2003). This could explain the additional variable sites that were detected in heterozygotes which displayed minimal associations with other loci (data not shown). As previously mentioned, heterozygous sub-sections of the population could escape amitraz pressure thus impeding disequilibrium and assisting recombination which gives rise to these new combinations of alleles. Population differentiation studies showed that the inbreeding coefficient (F|S) within subpopulations was negative for all but one population, meaning that majority of the individuals are heterozygous. The global inbreeding coefficient was -0.137, and indicated an excess of heterozygotes over all populations analyzed (Holsinqer, Weir 2009). This could be due to several factors including disassortative mating, isolate breaking or a Wahlund effect where excess heterozygotes are observed over the HWE expectation (Hartl 2000). The overall degree of genetic differentiation (FST) revealed that 2.5% of the genetic variation was distributed among subpopulations, while the remaining 97.5% was due to variation within the subpopulations. Exploitation of the existence of associated SNPs resulted in accurate detection of amitraz resistance in anonymous samples. We have showed that molecular detection using a RFLP technique is more economical, easier and faster than traditional larval packet tests. Heterozygotes were characterized as susceptible, substantiating previous claims that amitraz resistance is recessively inherited (Fragoso-Sanchez et al. 201 1 ). Majority of the population displayed heterozygosity, by extrapolating the results obtained from the RFLP assessments, it can be suggested that this population is still susceptible to amitraz (with the exception of homozygous resistant samples). This protocol will play an important future role in monitoring the emergence of amitraz resistance in Southern African R. microplus and R. decoloratus ticks. Such information could aid in guiding the use of effective control chemicals, as well as predicting when and where amitraz resistance might appear.
The novelty of this work includes the first confirmation of the two SNPs published by Chen et al. (2007) in amitraz resistant larvae, as well as field populations of ticks. It is also the first report of any association studies being conducted for the OCT/Tyr receptor in ticks. The discovery of a recombination event which could possibly be the 'switch' from susceptible to resistant phenotypes in amitraz exposed populations is a significant advancement towards a more complete perspective on the evolution of acaricide resistance. Lastly, this study is the first indication that heterozygous field populations are susceptible to amitraz treatment, allowing for alternative and improved strategies to be implemented on farms before full blown resistance is acquired.
3. MA TERIALS AND METHODS
Tick collections, identification and DNA extraction
Adult ticks were collected by Zoetis (Pty) Ltd. from 108 different farms across South Africa, of which 53 farms contained R. microplus ticks. Classification of collected ticks into their respective genera was done according to previous authors (Walker et al. 2003; Madder, Horak 2010). Further differentiation between Rhipicephalus (Boophilus) species was done using microscopy techniques. To distinguish between R. microplus and R. decoloratus females, the hypostome dentition was examined, along with the adanal spurs for the male ticks (Walker et al 2003; Madder. Horak 2010). Molecular identification of ticks was also performed based on restriction fragment length polymorphism (RFLP) analyses (Lempereur, Geysen, Madder 2010).
Control samples of amitraz resistant larvae were obtained from the Mnisi area in Kruger National Park from Dr Rosalind Malan. Twelve different strains were provided, of which three were classified as resistant based on their resistance factors, which were determined by conventional larval packet tests
(Stone, Havdock 1982).
A modified salt based extraction method published by Alianabi. Martinez (1997) was used for genomic DNA isolation from whole adult ticks (predominantly female ticks). Whole ticks were homogenized in 200 μΙ lysis buffer (0.5 M EDTA, 0.5% (w/v) Sodium lauroyi sarcosinate). An additional 400 μΙ of DNA extraction solution (0.4 M NaCI, 60 mM Tris-HCI, 12 mM EDTA, 0.25% SDS, pH 8.0) was added to the samples along with 2 μΙ of proteinase K (15 mg/ml), mixed well and incubated overnight at 55°C. Samples were incubated for 20 min at 65°C to inactivate the proteinase K, after which 1 μΙ of RNase A (10 mg/ml) was added. Samples were briefly vortexed and further incubated at 37°C for 15 min. Protein precipitation was performed by adding 360 μΙ of 5 M NaCI, vortexing for 10 sec, and incubation on ice for 5 min, followed by centrifugation at 25 500xg for 20 min at room temperature. An equal volume of isopropanol was added to the supernatant, briefly vortexed, followed by an incubation of 1 hour at -20°C. Samples were then centrifuged for 20 min at 10 000xg and the supernatants discarded. DNA pellets were washed three consecutive times with 500 μΙ of 70% ethanol, centrifuged for 5 min at 10 000xg, and the supernatant discarded. The final DNA pellets were air dried and then re-suspended in 50 μΙ of 1 x TE buffer (1 mM Tris-HCI, 0.1 mM EDTA, pH 7.0).
Genomic DNA was extracted from individual larvae using a modification of the protocol by Hernandez et al. (2002). Briefly, individual larvae were crushed in a 1 .5 ml microcentrifuge tube containing 25 μΙ TE buffer (10 mM Tris, 1 mM EDTA, pH 7.6). The suspension was then boiled for 5 min and centrifuged at 4000xg for 30 sec at room temperature. The supernatant was directly used for PCR.
PCR amplification and sequencing of the OCT/Tyr receptor gene
Published primers (Chen et al. 2007) were used for PCR amplification of a 417 bp fragment of the OCT/Tyr receptor gene at an annealing temperature of 55°C. This method worked sufficiently for a few samples, but due to tick strain differences, a new forward primer was designed. The new forward primer, OAR-F172 (5'- AGC ATT CTG CGG TTT TCT AC-3'), was designed based on sequence data from the few samples that amplified successfully. This forward primer was used for the majority of the tick samples with the same reaction conditions. Use was made of the following reverse primer: OAR-R587 (5' - GCA GAT GAC CAG CAC GTT ACC G - 3').
All PCR products were sequenced by Macrogen Inc. (Netherlands) in a 96-well plate according to the standard dye terminator sequencing strategy. The sequences were analyzed using BioEdit sequence alignment editor version 7.2.0 (Hall 2007), and multiple sequence alignments were performed using the online MAFFT program (http://mafft.cbrc.ip/alignnient/software/) (Katoh. Standley 2013). Sequences were aligned with published NCBI sequences to determine if any SNPs were present. The inferred amino acid sequences were used to identify synonymous and non-synonymous mutations.
Population structure and analysis
All samples from the country-wide survey were effectively placed into subpopulations relative to the area they were collected from. Subpopulations were established by sectioning the country into blocks of 300 x 300 km. Subpopulations were then designated with numbers 1 through 15 (Supplementary FigureSI ). Only subpopulations 2, 7, 8, 1 1 and 12 were used for determining population structure due to the lack of sequence data available in the other subpopulations. Population genetic parameters were estimated using POPGENE version 1 .31 (Yeh et al. 1997).
Gametic disequilibrium and ancestral recombination
Gametic disequilibrium studies were performed to determine intragenic association (linkage) between SNP alleles within the OCT/Tyr receptor gene. This analysis was carried out using the Multilocus 1 .2b1 program (Agapow, Burt 2001 ). For these analyses, 100 000 data randomizations were performed to compare the observed data with randomized data that mimic gametic equilibrium. If the observed dataset displayed increased gametic disequilibrium compared to the randomized datasets, it was assumed that there is association between the loci. This was further supported by P-values. Functions carried out using Multilocus included analysis of genotypic diversity versus the number of loci, linkage disequilibrium and population differentiation analysis.
To determine the evolutionary histories within resistance genes, ancestral recombination graphs were constructed using SNAP Workbench (Price, Carbone 2005). Sequence alignments were converted into haplotypes by excluding indels and infinite site violations. The branch and bound Beagle algorithm in SNAP Workbench was implemented to infer the minimal number of recombination events within the gene that could explain the data (Lvngs0, Song, Hein 2005).
RFLP based diagnostic assay
The rapid diagnostic test for amitraz resistance was evaluated in the form of a RFLP analysis. Susceptible and resistant R. decoloratus larvae (confirmed through larval packet tests) were obtained from the University of the Free State, South Africa (Ms. Ellie van Dalen), for the purpose of a double blind study. Larvae were labeled from one through 14, with the status of their resistance unknown until after the experiment. The OCT/Tyr receptor gene was amplified from bulked larval DNA, and amplicons were subsequently treated with 4 U of Ec/I restriction enzyme. Depending on the particular pattern that was observed after digestion, samples were classified as susceptible or resistant to amitraz treatment. These tests were compared to independently assessed resistance statuses in order to confirm the accuracy of the diagnostic test.
5 The aim of this study was to evaluate SNPs in the OCT/Tyr receptor
Figure imgf000035_0001
iinn SSoouutthh AAffrriiccaann ffiieelldd ppooppuullaattiioonnss ooff RR.. mmiiccrroopplluuss.. AAmmiittrraazz rreessiissttaanntt aanndd ssuusscceeppttiibbllee llaarrvvaaee ffrroomm aa ccoonnttrroolllleedd,, cclloosseedd ooffff aarreeaa iinn tthhee KKrruuggeerr NNaattiioonnaall PPaarrkk iinn SSoouutthh AAffrriiccaa wweerree ssccrreeeenneedd ffoorr tthheessee ttwwoo SSNNPPss.. AA ccoorrrreellaattiioonn wwaass tthheenn mmaaddee bbeettwweeeenn tthhee pprreesseennccee ooff tthheessee SSNNPPss aanndd LLPPTT rreessuullttss.. 1100 CCoonnsseeqquueennttllyy,, aa ccoouunnttrryy--wwiiddee ssuurrvveeyy ttoo ddeetteecctt tthhee pprreesseennccee ooff tthheessee SSNNPPss wwaass tthheenn ccoonndduucctteedd.. IInn oorrddeerr ttoo bbeetttteerr uunnddeerrssttaanndd tthhee ccoommpplleexx nnaattuurree ooff aammiittrraazz rreessiissttaannccee iinn ttiicckkss,, ffuurrtthheerr aannaallyyssiiss wwaass ddoonnee ttoo tteesstt ffoorr tthhee pprreesseennccee ooff ggaammeettiicc ddiisseeqquuiilliibbrriiuumm bbeettwweeeenn tthheessee SSNNPPss,, aanndd ttoo iinnvveessttiiggaattee tthhee ccoonnttrriibbuuttiioonn ooff rreeccoommbbiinnaattiioonn ttoowwaarrddss tthhee eemmeerrggeennccee ooff aammiittrraazz rreessiissttaannccee.. FFiinnaallllyy,, tthhee rreessuullttss 1155 ffrroomm tthheessee aannaallyysseess lleedd ttoo tthhee ddeevveellooppmmeenntt ooff aann RRFFLLPP bbaasseedd ddiiaaggnnoossttiicc ttooooll ffoorr aasssseessssiinngg aammiittrraazz rreessiissttaannccee iinn SSoouutthh AAffrriiccaann ttiicckk ppooppuullaattiioonnss..
The main aims of this study were three-fold. First, an attempt was made to correlate two known SNPs in the octopaminergic receptor with amitraz 20 resistance in South African field samples of R. microplus. Second, gametic disequilibrium for these SNPs were calculated to determine whether they are randomly associated. Lastly, an investigation was launched to assess the evolutionary effects of recombination within the octopaminergic receptor. The results presented herein confirmed that the two SNPs of the invention are 25 associated with amitraz resistance, and that they are in gametic disequilibrium.
Additionally, recombination in the octopaminergic receptor can be correlated to the emergence of resistance to amitraz. These results are of use to farmers in sub- Saharan Africa, and the emergence of amitraz resistance should be closely monitored in future. Therefore, the Applicant presents a quick and affordable 30 RFLP based diagnostic technique to assess amitraz resistance in field samples of R. microplus. 4. CONCLUSION
The invention provides for a rapid diagnostic test to assess amitraz resistance in R. microplus. The test includes the steps of
extracting a DNA sample from the ectoparasite;
amplifying a sequence of the DNA sample corresponding to at least part of a coding sequence of an octopamine/tyramine receptor of the ectoparasite;
obtaining an amplification product; and
analyzing the amplification product for the presence of one or more markers associated with resistance of the ectoparasite to the acaricide.
Genomic DNA extraction from ticks and larvae
A modified salt based extraction method published by Aljanabi, Martinez (1997) was used for genomic DNA isolation from whole adult ticks (predominantly female ticks). Whole ticks were homogenized in 200 μΙ lysis buffer (0.5 M EDTA, 0.5% (w/v) Sodium lauroyl sarcosinate). An additional 400 μΙ of DNA extraction solution (0.4 M NaCI, 60 mM Tris-HCI, 12 mM EDTA, 0.25% SDS, pH 8.0) was added to the samples along with 2 μΙ of proteinase K (15 mg/ml), mixed well and incubated overnight at 55°C. Samples were incubated for 20 min at 65°C to inactivate the proteinase K, after which 1 μΙ of RNase A (10 mg/ml) was added. Samples were briefly vortexed and further incubated at 37°C for 15 min. Protein precipitation was performed by adding 360 μΙ of 5 M NaCI, vortexing for 10 sec, and incubation on ice for 5 min, followed by centrifugation at 25 500xg for 20 min at room temperature. An equal volume of isopropanol was added to the supernatant, briefly vortexed, followed by an incubation of 1 hour at -20°C. Samples were then centrifuged for 20 min at 10 000xg and the supernatants discarded. DNA pellets were washed three consecutive times with 500 μΙ of 70% ethanol, centrifuged for 5 min at 10 000xg, and the supernatant discarded. The final DNA pellets were air dried and then re-suspended in 50 μΙ of 1 x TE buffer (1 mM Tris-HCI, 0.1 mM EDTA, pH 7.0). Genomic DNA was extracted from individual larvae using a modification of the protocol by Hernandez et al. (2002). Briefly, individual larvae were crushed in a 1 .5 ml microcentrifuge tube containing 25 μΙ TE buffer (10 mM Tris, 1 mM EDTA, pH 7.6). The suspension was then boiled for 5 min and centrifuged at 4000xg for 30 sec at room temperature. The supernatant was directly used for PCR.
PCR amplification of the octopamine/tyramine receptor
A new forward primer was designed SEQ. ID. NO. 1 (OAR-F172 (5'- AGC ATT CTG CGG TTT TCT AC-3')) and a published reverse primer SEQ. ID. NO. 2 (OAR-R587 (5' - GCA GAT GAC CAG CAC GTT ACC G - 3')) was used for amplification of the gene.
New PCR conditions were developed for the amplification, namely: 94°C for 4 min, followed by 40 cycles of 94°C for 30 sec, 55°C for 30 sec and 72°C for 1 min, with a final extension of 72°C for 8 min.
Amplification of these genes was to detect the two published SNPs: a. A22C (nucleotide sequence) / T8P (amino acid sequence)
b. T65C (nucleotide sequence) / L22S (amino acid sequence)
These two SNPs were found along with a variety of others as well. Linkage disequilibrium studies showed that certain variable positions were closely associated with the two resistant SNPs, and could therefore potentially be good resistance diagnostic marker/s.
Restriction enzyme digestion of amplified gene product with Eci\
(All mutation naming is based on nucleotide sequences from the coding region only, positions from non-coding region are excluded.)
One of the mutation sites that are targeted was reported by Chen et al. 2007, but disregarded because it didn't result in an amino acid change. The mutation site is C39T. The additional mutation site G41A (nucleotide) / G14E (amino acid) is novel and has never before been reported. The chosen enzyme (Ec/I) will recognize mutations at both sites. Additionally, the G41A mutation is closely linked with the recombination mutation found at position C159T (coding region), which is also novel and suggested to be the switch from susceptible to resistant.
Amplified fragments of the octopamine receptor were subsequently treated with 4 U of Ec/I restriction enzyme in a 50 μΙ reaction containing 5 μΙ of the Cuts mart™ buffer (50 mM Potassium acetate, 20 mM Tris-acetate, 10 mM Magnesium acetate and 100 pg/ml BSA, pH 7.9).
Other enzymes that could be used for diagnostics recognise the sequence 5'- GGATG -3', which would pick up a mutation at position T36C (nucleotide sequence). This mutation is closely associated with susceptibility rather than resistance, but could still be used for diagnostics. List of enzymes include; BseGI, BstF5l, BstPZ418l, Fokl, Stsl. An enzyme which recognises sequence 5'- GGACG -3' could also be used for the test.
These changes in sequence can be detected or diagnosed by sequencing as well as by RFLP as mentioned above. It may further be detected with a 'dip stick' assay detection method. The test may include detection of up- regulated enzymes (i.e. glutathione-s-transferases, cytochrome P450's, carboxylesterases). Detection methods of these include qPCR and Taqman assays. The test can detect resistance to pyrethroids and formamidines
(amitraz). Pyrethroid resistance is already well documented. We have also shown that this test can be applied to Rhipicephalus microplus, Rhipicephalus decoloratus, and other tick species. The inventor believes that the invention provides a new method of testing whether a tick has become resistant to amitraz.

Claims

1 . A method for detecting a genetic polymorphism associated with susceptibility, or resistance of an ectoparasite to an acaricide, the method comprising the step of screening a DNA sample from the ectoparasite for the presence of one or more markers in the octopamine/tyramine receptor gene.
2. The method as claimed in claim 1 , which includes an additional step of determining homozygosity and heterozygosity of the ectoparasite.
3. The method as claimed in claim 1 , in which the acaricide is in the form of any one of pyrethroids and formamidines.
4. The method as claimed in claim 1 , in which the acaricide is in the form of amitraz.
5. The method as claimed in claim 1 , in which the ectoparasite is in the form of a tick.
6. The method as claimed in claim 1 , in which the ectoparasite is in the form of any one of Rhipicephalus microplus and Rhipicephalus decoloratus.
7. The method as claimed in claim 1 , in which the one or more markers are in the form of polymorphisms.
8. The method as claimed in claim 7, in which the one or more markers are in the form of single nucleotide polymorphisms (SNPs).
9. The method as claimed in claim 8, in which the markers are in the form of any one or more of A22C and T65C, wherein the presence of any one or both of A22C and T65C is associated with resistance of the ectoparasite to the acaricide.
10. The method as claimed in claim 8 or 9, in which the one or more markers include any one or more of C39T, G41A, G121A, T138C and C159T, wherein their presence is associated with resistance of the ectoparasite to the acaricide.
1 1 . The method as claimed in claim 8, in which the one or more markers include any one or both of T36C and G141 C, wherein the presence of T36C and/or G141 C is associated with susceptibility of the ectoparasite to the acaricide.
12. The method as claimed in claim 2, in which determining homozygosity and heterozygosity of ectoparasites, includes classifying ectoparasites having all markers associated with resistance, the markers being single nucleotide polymorphisms (SNP's) in the form of A22C, T65C, C39T, G41A, G121A, T138C and C159T, as homozygous resistant ectoparasites and ectoparasites having only a number of the markers associated with resistance, as heterozygous ectoparasites.
13. The method as claimed in claim 1 , in which the method includes any suitable technique for determining the presence or absence of the one or more markers in the DNA sample from the ectoparasite, the technique includes any of: restriction fragment length polymorphism mapping, amplification reactions, hybridization of nucleic acids to allele-specific probes or oligonucleotide arrays, various chip technologies, polynucleotide sequence techniques and combinations thereof.
14. The method as claimed in claim 1 , which includes the step of subjecting the DNA sample to polynucleotide amplification using a primer pair comprising SEQ. ID NO. 1 and SEQ. ID. NO. 2, and functional fragments, variants, and mutations of each.
The method as claimed in claim 1 , the method comprising the steps extracting a DNA sample from the ectoparasite; amplifying a sequence of the DNA sample corresponding to at least part of a coding sequence of an octopamine/tyramine receptor of the ectoparasite;
obtaining an amplification product; and
analyzing the amplification product for the presence of one or more markers associated with susceptibility or resistance of the ectoparasite to the acaricide.
16. The method as claimed in claim 15, which includes an additional step of determining homozygosity and heterozygosity of the ectoparasite.
17. The method as claimed in claim 15, in which the acaricide is in the form of any one of pyrethroids and formamidines.
18. The method as claimed in claim 15, in which the acaricide is in the form of amitraz.
19. The method as claimed in claim 15, in which the ectoparasite is in the form of a tick.
20. The method as claimed in claim 15, in which the ectoparasite is in the form of any one of Rhipicephalus microplus and Rhipicephalus decoloratus.
21 . The method as claimed in claim 15, in which the one or more markers are in the form of polymorphisms.
22. The method as claimed in claim 21 , in which the markers are in the form of single nucleotide polymorphisms (SNPs).
23. The method as claimed in claim 22, in which the SNPs are in the form of any one or more of A22C and T65C, wherein the presence of any one or both of A22C and T65C is associated with resistance of the ectoparasite to the acaricide.
24. The method as claimed in claim 22 or 23, in which the one or more SNPs may include any one or more of C39T, G41A, G121A, T138C and C159T wherein their presence is associated with resistance of the ectoparasite to the acaricide.
25. The method as claimed in claim 22, in which the one or more SNPs may include any one or both of T36C and G141 C, wherein the presence of T36C and/or G141 C is associated with susceptibility of the ectoparasite to the acaricide.
26. The method as claimed in claim 16, in which determining homozygosity and heterozygosity of ectoparasites, includes classifying ectoparasites having all markers associated with resistance, the markers being single nucleotide polymorphisms (SNP's) A22C, T65C, C39T, G41A, G121A, T138C and C159T, as homozygous resistant ectoparasites and ectoparasites having only a number of the SNP's associated with resistance, as heterozygous ectoparasites.
27. The method as claimed in claim 15, in which the amplifying is in the form of polynucleotide amplification using a primer pair comprising SEQ. ID NO. 1 and SEQ. ID. NO. 2, and functional fragments, variants, and mutations of each.
28. The method as claimed in claim 15, in which the step of analyzing the amplification product for the presence of one or more markers associated with resistance of the ectoparasite to the acaricide is by way of any one of: sequencing the amplification product, quantifying the amplification product, detecting a probe linked to the amplification product and using primer extension (PEXT) reaction visualized through a dip stick assay.
29. The method as claimed in claim 15, in which the step of analyzing the amplification product includes exposing the amplification product to restriction enzyme digestion.
30. The method as claimed in claim 29, in which the restriction digestion is accomplished by using a restriction enzyme having a recognition site corresponding to at least part of the one or more markers.
31 . The method as claimed in claim 30, in which the restriction digestion is accomplished by a restriction enzyme having a recognition sequence comprising SEQ. ID. NO. 3.
32. The method as claimed in claim 31 , in which the restriction enzyme is
Ec/'l.
33. The method as claimed in claim 30, in which the restriction is accomplished by using a restriction enzyme having a recognition sequence comprising SEQ. ID. NO. 4.
34. The method as claimed in claim 30, the restriction enzyme is selected from the group consisting of any one or more of: BseG\, BstF5\, SsfPZ418l, Fok\, Sts\ and any enzyme that recognizes a site corresponding to at least part of the one or more markers.
35. The method as claimed in claim 29, in which following digestion, the resulting fragments are separated at least partially from one another using size- based separation techniques.
36. The method as claimed in claim 35, in which the size-based separation techniques are in the form of gel electrophoresis.
37. The method as claimed in claim 15, in which the step of extracting a DNA sample from the ectoparasite is in the form of extracting DNA from any one or both of whole ticks and larvae.
38. The method as claimed in claim 37, in which the DNA is extracted from whole adult ticks, a modified salt based extraction method is used for genomic DNA isolation.
39. The method as claimed in claim 38, in which the modified salt based extraction method includes the steps of:
providing whole tick samples; homogenizing the whole ticks in 200 μΙ lysis buffer (0.5 M EDTA, 0.5% (w/v) Sodium lauroyl sarcosinate).
adding an additional 400 μΙ of DNA extraction solution (0.4 M NaCI, 60 mM Tris-HCI, 12 mM EDTA, 0.25% SDS, pH 8.0) to the samples along with 2 μΙ of proteinase K (15 mg/ml), mixed well and incubated overnight at 55°C;
incubating the samples for 20 min at 65°C to inactivate the proteinase K, after which 1 μΙ of RNase A (10 mg/ml) is added;
vortexing the samples briefly;
incubating the samples at 37°C for 15 min;
performing protein precipitation by adding 360 μΙ of 5 M NaCI, vortexing for
10 sec, and incubation on ice for 5 min, followed by centrifugation at 25 500xg for 20 min at room temperature, to provide a supernatant;
adding an equal volume of isopropanol to the supernatant, briefly vortexing, followed by an incubation of 1 hour at -20°C;
centrifuging the samples for 20 min at 10 000xg and discarding the supernatants; washing DNA pellets three consecutive times with 500 μΙ of 70% ethanol, centrifuged for 5 min at 10 OOOxg, and discarding the supernatant; and air drying the final DNA pellets; and
re-suspended the air dried DNA pellets in 50 μΙ of 1 x TE buffer (1 mM Tris- HCI, 0.1 mM EDTA, pH 7.0).
40. The method as claimed in claim 37, in which the Genomic DNA is extracted from individual larvae the extraction method includes:
crushing individual larvae in a 1 .5 ml microcentrifuge tube containing 25 μΙ TE buffer (10 mM Tris, 1 mM EDTA, pH 7.6) to form a suspension;
boiling the suspension for 5 min
centrifuging at 4000xg for 30 sec at room temperature to provide a supernatant; and
using the supernatant for PCR.
41 . The method as claimed in claim 15, in which the step of amplifying a sequence of the DNA sample is accomplished by subjecting the DNA sample to the following heating, annealing, and cooling conditions, respectively:
heat to 94°C for 4 min; followed by 40 cycles of 94°C for 30 sec, 55°C for 30 sec and 72°C for 1 min; and
with a final extension of 72°C for 8 min.
42. An isolated nucleic acid molecule selected from the group consisting of:
(i) a nucleic acid molecule comprising the sequence of SEQ. ID. NO. 1 ;
(ii) a nucleic acid fragment having a sequence derived from a octopamine/tyramine receptor gene and containing any one or more of markers associated with resistance of an ectoparasite to an acaricide, the markers selected from: A22C, T65C, C39T, G41A, G121A, T138C and C159T;
(iii) a nucleic acid fragment having a sequence derived from a octopamine/tyramine receptor gene and containing any one or more of markers associated with susceptibility of an ectoparasite to an acaricide, the markers selected from: T36C and G141 C; and
(iv) sequences complementary thereto.
43. The isolated nucleic acid molecule as claimed in claim 42, in which the isolated nucleic acid molecule is in the form of a non-naturally occurring sequence.
44. The isolated nucleic acid molecule as claimed in claim 43, in which the non-naturally occurring sequence is in the form of c-DNA.
45. An amplified polynucleotide having a polymorphism in the form of any one or more of: A22C, T65C, C39T, G41A, G121A, T138C, C159T, T36C and G141 C.
46. Use of an isolated nucleic acid molecule as claimed in claim 43 or an amplified polynucleotide as claimed in claim 45, in a method for detecting a genetic polymorphism associated with susceptibility or resistance of an ectoparasite to an acaricide.
47. Use of any one or more of genetic markers C39T, G41A, G121A, T138C and C159T as indicators of resistance of an ectoparasite to an acaricide.
48. Use of any one or both of genetic markers T36C and G141 C as indicators of susceptibility of an ectoparasite to an acaricide.
49. Use of any one or more of genetic markers in the form of peptide- based markers G14E, T8P and L22S as indicators of resistance of an ectoparasite to an acaricide.
50. A kit for determining the susceptibility or otherwise of an ectoparasite or a group of parasites to an acaricide, the kit including:
primers in the form of SEQ. ID. N0.1 and SEQ. ID. NO. 2; and
a reagent buffer suitable for allowing the amplification of a DNA sequence to be amplified using the primers.
51 . The kit as claimed in claim 51 , in which the kit includes instructions for determining the susceptibility or otherwise of an ectoparasite to an acaricide.
52. A method for detecting a genetic polymorphism, an isolated nucleic acid molecule, an amplified polynucleotide, use and a kit substantially as herein described and illustrated according to the accompanying examples.
PCT/IB2015/058834 2014-11-14 2015-11-16 Genetic markers for determining ectoparasite susceptibility to acaricides WO2016075673A1 (en)

Priority Applications (3)

Application Number Priority Date Filing Date Title
MX2017006202A MX2017006202A (en) 2014-11-14 2015-11-16 Genetic markers for determining ectoparasite susceptibility to acaricides.
BR112017010065A BR112017010065A2 (en) 2014-11-14 2015-11-16 method for detecting a genetic polymorphism associated with susceptibility or resistance of a tick, c-dna isolated nucleic acid molecule, amplified polynucleotide, use of an isolated nucleic acid molecule or amplified polynucleotide, use of genetic markers and kit for determination of the susceptibility of a tick to amitraz
ZA201703246A ZA201703246B (en) 2014-11-14 2017-05-10 Genetic markers for determining ectoparasite susceptibility to acaricides

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
ZA2014/08330 2014-11-14
ZA201408330 2014-11-14

Publications (1)

Publication Number Publication Date
WO2016075673A1 true WO2016075673A1 (en) 2016-05-19

Family

ID=55027787

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/IB2015/058834 WO2016075673A1 (en) 2014-11-14 2015-11-16 Genetic markers for determining ectoparasite susceptibility to acaricides

Country Status (4)

Country Link
BR (1) BR112017010065A2 (en)
MX (1) MX2017006202A (en)
WO (1) WO2016075673A1 (en)
ZA (1) ZA201703246B (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110133091A (en) * 2019-04-29 2019-08-16 中国科学院武汉物理与数学研究所 05SAR-PAGE and its preparation method and application

Non-Patent Citations (60)

* Cited by examiner, † Cited by third party
Title
AGAPOW, P-M; A BURT.: "Indices of multilocus linkage disequilibrium", MOLECULAR ECOLOGY NOTES, vol. 1, 2001, pages 101 - 102
AGUILAR-TIPACAMU, G; RJ MILLER; R HERNANDEZ-ORTIZ; RI RODRIGUEZ-VIVAS; C VASQUEZ-PELAEZ; Z GARCIA-VAZQUEZ; F OLVERA-VALENCIA; R RO: "Inheritance of pyrethroid resistance and a sodium channel gene mutation in the cattle tick Boophilus microplus", PARASITOL RES, vol. 103, 2008, pages 633 - 639
ALJANABI, SM; I MARTINEZ: "Universal and rapid salt-extraction of high quality genomic DNA for PCR-based techniques", NUCLEIC ACIDS RESEARCH, vol. 25, 1997, pages 4692 - 4693
BALFANZ, S; T STRUNKER; S FRINGS; A BAUMANN: "A family of octopamine receptors that specifically induce cyclic AMP production or Ca2+ release in Drosophila melanogaster", JOURNAL OF NEUROCHEMISTRY, vol. 93, 2005, pages 440 - 451
BAXTER G D ET AL: "ISOLATION OF A CDNA FOR AN OCTOPAMINE-LIKE, G-PROTEIN COUPLED RECEPTOR FROM THE CATTLE TICK, BOOPHILUS MICROPLUS", INSECT BIOCHEMISTRY AND MOLECULAR BIOLOGY, ELSEVIER SCIENCE LTD, GB, vol. 29, 1 January 1999 (1999-01-01), pages 461 - 467, XP002928982, ISSN: 0965-1748, DOI: 10.1016/S0965-1748(99)00023-5 *
BAXTER, GD; SC BARKER: "Isolation of a cDNA for an octopamine-like, G-protein coupled receptor from the cattle tick, Boophilus microplus.", INSECT BIOCHEMISTRY AND MOLECULAR BIOLOGY, vol. 29, 1999, pages 461 - 467
BOOTH, TF.: "Effects of biogenic amines and adrenergic drugs on oviposition in the cattle tick Boophilus: evidence for octopaminergic innervation of the oviduct", EXPERIMENTAL AND APPLIED ACAROLOGY, vol. 7, 1989, pages 259 - 266
CHEN ET AL: "Mutations in a putative octopamine receptor gene in amitraz-resistant cattle ticks", VETERINARY PARASITOLOGY, ELSEVIER SCIENCE, AMSTERDAM, NL, vol. 148, no. 3-4, 30 September 2007 (2007-09-30), pages 379 - 383, XP022208156, ISSN: 0304-4017, DOI: 10.1016/J.VETPAR.2007.06.026 *
CHEN, AC; H HE; KB TEMEYER; S JONES; P GREEN; SC BARKER: "A Survey of Rhipicephalus microplus Populations for Mutations Associated With Pyrethroid Resistance", J ECON ENTOMOL, vol. 102, 2009, pages 373 - 380
CHEN, AC; H HE; RB DAVEY: "Mutations in a putative octopamine receptor gene in amitraz-resistant cattle ticks", VETERINARY PARASITOLOGY, vol. 148, 2007, pages 379 - 383
CORLEY, SW; EK PIPER; NN JONSSON: "Generation of full-length cDNAs for eight putative GPCnR from the cattle tick, R. microplus using a targeted degenerate PCR and sequencing strategy", PLOS ONE, vol. 7, 2012, pages E32480
CORLEY, SW; NN JONSSON; EK PIPER; C CUTULLE; MJ STEAR; JM SEDDON: "Mutation in the Rm/SAOR gene is associated with amitraz resistance in the cattle tick Rhipicephalus microplus", PNAS, vol. 110, 2013, pages 16772 - 16777
DATABASE EMBL [online] 28 August 2007 (2007-08-28), "Rhipicephalus microplus strain Gonzalez putative octopamine receptor (OAR) mRNA, complete cds.", XP002754078, retrieved from EBI accession no. EM_STD:EF490687 Database accession no. EF490687 *
DATABASE EMBL [online] 6 October 1998 (1998-10-06), "Boophilus microplus mRNA for G-protein coupled receptor", XP002754077, retrieved from EBI accession no. EM_STD:AJ010743 Database accession no. AJ010743 *
EVANS, PD; B MAQUEIRA: "Insect octopamine receptors: a new classification scheme based on studies of cloned Drosophila G-protein coupled receptors", INVERTEBRATE NEUROSCIENCE, vol. 5, 2005, pages 111 - 118
FAROOQUI, T.: "Review of octopamine in insect nervous systems", INSECT PHYSIOLOGY, vol. 4, 2012, pages 1 - 17
FAZA, AP; IS PINTO; I FONSECA; GR ANTUNES; CM MONTEIRO; E DAEMON; S MUNIZ MDE; MF MARTINS; J FURLONG; MC PRATA: "A new approach to characterization of the resistance of populations of Rhipicephalus microplus (Acari: Ixodidae) to organophosphate and pyrethroid in the state of Minas Gerais", BRAZIL. EXPERIMENTAL PARASITOLOGY, vol. 134, 2013, pages 519 - 523
FERNANDEZ-SALASA, A; RI RODRIGUEZ-VIVAS; MA ALONSO-DIAZA: "First report of a Rhipicephalus microplus tick population multi-resistant to acaricides and ivermectin in the Mexican tropics", VETERINARY PARASITOLOGY, vol. 183, 2012, pages 338 - 342
FERNANDEZ-SALASA, A; RI RODRIGUEZ-VIVAS; MA ALONSO-DIAZA; H BASURTO-CAMBEROSA: "Ivermectin resistance status and factors associated in Rhipicephalus microplus (Acari: Ixodidae) populations from Veracruz, Mexico", VET PARASITOL, 2012
GIBSON, G; SP MUSE: "A primer of Genome Science", 2009, SINAUER ASSOCIATES, INC. PUBISHERS
GUERRERO, FD; JH PRUETT; AY LI: "Molecular and biochemical diagnosis of esterase-mediated pyrethroid resistance in a Mexican strain of Boophilus microplus (Acari: Ixodidae", EXP APPL ACAROL, vol. 28, 2003, pages 257 - 264
GUERRERO, FD; L LOVIS; JR MARTINS: "Acaricide resistance mechanisms in Rhipicephalus (Boophilus) microplus", REVISTA BRASILEIRA DE PARASITOLOGIA VETERINARIA, vol. 21, 2012, pages 1 - 6
HALL, T.: "BioEdit: Biological sequence alignment", 2007
HALLIBURTON, R: "Introduction to population genetics", 2003, CUMMINGS PUBLISHING COMPANY
HARTL, D; A CLARKE: "Principles of population genetics theory", 1989, SINAUER
HARTL, DL: "A Primer of Population Genetics Sunderland", 2000, SINAUER ASSOCIATES
HE, H; AC CHEN; RB DAVEY; GW IVIE; JE GEORGE: "Identification of a Point Mutation in the para-Type Sodium Channel Gene from a Pyrethroid-Resistant Cattle Tick", BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS, vol. 261, 1999, pages 558 - 561
HERNANDEZ, R; FD GUERRERO; JE GEORGE; GG WAGNER: "Insect Biochemistry and Molecular Biology", vol. 32, 2002, article "Allele frequency and gene expression of a putative carboxylesterase-encoding gene in a pyrethroid resistant strain of the tick Boophilus microplus", pages: 1009 - 1016
HOLSINGER, KE; BS WEIR: "Genetics in geographically structured populations: defining, estimating and interpreting FST", NATURE REVIEWS, GENETICS, vol. 10, 2009, pages 639 - 650
HORAK, IG; H GOLEZARDY; AC UYS: "Ticks associated with the three largest wild ruminant species in southern Africa", ONDERSTEPOORT J VET RES, vol. 74, 2007, pages 231 - 242
JONSSON, NN; C CUTULLE; SW CORLEY; JM SEDDON: "Identification of a mutation in the para-sodium channel gene of the cattle tick Rhipicephalus microplus associated with resistance to flumethrin but not to cypermethrin", INTERNATIONAL JOURNAL FOR PARASITOLOGY, vol. 40, 2010, pages 1659 - 1664
JONSSON, NN; M HOPE: "Progress in the epidemiology and diagnosis of amitraz resistance in the cattle tick Boophilus microplus", VETERINARY PARASITOLOGY, vol. 146, 2007, pages 193 - 198
JONSSON, NN; RJ MILLER; DH KEMP; A KNOWLES; AE ARDILA; RG VERRALL; JT ROTHWELL: "Rotation of treatments between spinosad and amitraz for the control of Rhipicephalus (Boophilus) microplus populations with amitraz resistance", VETERINARY PARASITOLOGY, vol. 169, 2010, pages 157 - 164
JOURNAL OF ENTOMOLOGY, vol. 8, pages 218 - 228
KATOH, STANDLEY: "MAFFT multiple sequence alignment software version 7: improvements in performance and usability, (outlines version 7", MOLECULAR BIOLOGY AND EVOLUTION, vol. 30, 2013, pages 772 - 780
KLIOT, A; M GHANIM: "Fitness costs associated with insecticide resistance", PEST MANAGEMENT SCIENCE, vol. 68, 2012, pages 1431 - 1437
LEES, K; AS BOWMAN: "Tick neurobiology: recent advances and the post-genomic era", INVERTEBRATE NEUROSCIENCE, vol. 7, 2007, pages 183 - 198
LEMPEREUR, L; D GEYSEN; M MADDER: "Development and validation of a PCR-RFLP test to identify African Rhipicephalus (Boophilus) ticks", ACTA TROPICA, vol. 114, 2010, pages 55 - 58
LI, AY; RB DAVEY; JE GEORGE: "Carbaryl Resistance in Mexican Strains of the Southern Cattle Tick (Acari: Ixodidae", J ECON ENTOMOL, vol. 98, 2005, pages 552 - 556
LI, AY; RB DAVEY; RJ MILLER; JE GEORGE: "Detection and Characterization of Amitraz Resistance in the Southern Cattle Tick, Boophilus microplus (Acari: Ixodidae", JOURNAL OF MEDICAL ENTOMOLOGY, vol. 41, 2004
LI, AY; RB DAVEY; RJ MILLER; JE GEORGE: "Mode of inheritance of amitraz resistance in a Brazilian strain of the southern cattle tick, Boophilus microplus (Acari: Ixodidae", EXPERIMENTAL AND APPLIED ACAROLOGY, vol. 37, 2005, pages 183 - 198
LYNGSO, RB; YS SONG; J HEIN, MINIMUM RECOMBINATION HISTORIES BY BRANCH AND BOUND, 2005, pages 239 - 250
MADDER, M; IG HORAK: "Tick Photodatabase", TICK SPECIES. BELGIUM AND PRETORIA: INSTITUTE OF TROPICAL MEDICINE ANTWERPEN-BELGIUM AND THE UNIVERSITY OF PRETORIA, 2010
MAQUEIRA, B; H CHATWIN; PD EVANS: "Identification and characterization of a novel family of Drosophila 13-adrenergic-like octopamine G-protein coupled receptors", JOURNAL OF NEUROCHEMISTRY, vol. 94, 2005, pages 547 - 560
M'DIAYE; K, M BOUNIAS: "Sublethal effects of the formamidine amitraz on honeybees gut lipids, following in vivo injections", BIOMEDICAL AND ENVIRONMENTAL SCIENCE, vol. 4, 1991, pages 376 - 383
MORGAN, JAT; SW CORLEY; LA JACKSON; AE LEW-TABOR; PM MOOLHUIJZEN; NN JONSSON: "Identification of a mutation in the para-sodium channel gene of the cattle tick Rhipicephalus (Boophilus) microplus associated with resistance to synthetic pyrethroid acaricides", INTERNATIONAL JOURNAL FOR PARASITOLOGY, vol. 39, 2009, pages 775 - 779
NACHMAN, MW: "Detecting selection at the molecular level. Evolutionary Genetics", CONCEPTS AND CASE STUDIES, 2006
PARIS, M; F ROUX; A BERARD; X REBOUD: "The effects of the genetic background on herbicide resistance fitness cost and its associated dominance in Arabidopsis thaliana", HEREDITY (EDINB, vol. 101, 2008, pages 499 - 506
POHL, PC; GM KLAFKE; DD CARVALHO; JR MARTINS; S DAFFRE; IDSV JR.; A MASUDA: "ABC transporter efflux pumps: A defense mechanism against ivermectin in Rhipicephalus (Boophilus) microplus", INTERNATIONAL JOURNAL FOR PARASITOLOGY, vol. 41, 2011, pages 1323 - 1333
PRICE, EW; I CARBONE: "SNAP: workbench management tool for evolutionary population genetic analysis", BIOINFORMATICS, vol. 21, 2005, pages 402 - 404
ROBB, S; TR CHEEK; FL HANNAN; LM HALL; JM MIDGLEY; PD EVANS: "Agonist-specific coupling of cloned Drosophila octopamine/tyramine receptor to multiple second messenger systems", EMBO JOURNAL, vol. 16, 1994, pages 1325 - 1330
ROSADO-AGUILAR, JA; RI RODRIGUEZ-VIVAS; Z GARCIA-VAZQUEZ; H FRAGOSO-SANCHEZ; A ORTIZ-NAJERA; R ROSARIO-CRUZ: "Development of amitraz resistance in field populations of Boophilus microplus (Acari: Ixodidae) undergoing typical amitraz exposure in the Mexican tropics", VETERINARY PARASITOLOGY, vol. 152, 2008, pages 349 - 353
S. W. CORLEY ET AL: "Mutation in the Rm AOR gene is associated with amitraz resistance in the cattle tick Rhipicephalus microplus", PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES, vol. 110, no. 42, 30 September 2013 (2013-09-30), US, pages 16772 - 16777, XP055248781, ISSN: 0027-8424, DOI: 10.1073/pnas.1309072110 *
SALDIVAR, L; FD GUERRERO; RJ MILLER; KG BENDELE; C GONDRO; KA BRAYTON: "Microarray analysis of acaricide-inducible gene expression in the southern cattle tick, Rhipicephalus (Boophilus) microplus", INSECT MOLECULAR BIOLOGY, vol. 17, 2008, pages 597 - 606
SCHNITZERLING, HJ; J NOLAN; S HUGHES: "Toxicology and metabolism of some synthetic pyrethroids in larvae of susceptible and resistant strains of the cattle tick Boophilus microplus (Can.", PESTICIDE SCIENCE, vol. 14, 1983, pages 64 - 72
SHIN, DH; WH HSU: "Influence of the formamidine pesticide amitraz and its metabolites on porcine myometrial contractility: involvement of alpha 2- adrenoceptors and Ca2+ channels", TOXICOLOGY AND APPLIED PHARMACOLOGY, vol. 128, 1994, pages 45 - 49
SOBERANES, N; MS VARGAS; HF SANCHEZ; ZG VAZQUEZ.: "First case reported of amitraz resistance in the cattle tick Boophilus microplus in Mexico", TECNICA PECUARIA EN MEXICO, vol. 40, 2002, pages 81 - 92
STONE, BF; KP HAYDOCK: "A method for measuring the acaricide susceptibility of the cattle tick Boophilus microplus (Can.", BULLETIN OF ENTOMOLOGICAL RESEARCH, 1962, pages 563 - 578
WALKER, AR; A BOUATTOUR; JL CAMICAS; A ESTRADA-PENA; IG HORAK; AA LATIF; RG PEGRAM; PM PRESTON: "Ticks of Domestic Animals in Africa: a Guide to Identification of Species", EDINBURGH: BIOSCIENCE REPORTS, 2003
YEH, FC; RC YANG; T BOYLE; ZH YE; JX MAO: "POPGENE: the user-friendly shareware for population genetic analysis", MOLECULAR BIOLOGY AND BIOTECHNOLOGY CENTRE, 1997

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110133091A (en) * 2019-04-29 2019-08-16 中国科学院武汉物理与数学研究所 05SAR-PAGE and its preparation method and application

Also Published As

Publication number Publication date
MX2017006202A (en) 2017-11-17
BR112017010065A2 (en) 2019-12-10
ZA201703246B (en) 2020-11-25

Similar Documents

Publication Publication Date Title
Baron et al. SNP analysis infers that recombination is involved in the evolution of amitraz resistance in Rhipicephalus microplus
Kadam et al. Genomic-assisted phylogenetic analysis and marker development for next generation soybean cyst nematode resistance breeding
Simko et al. Linkage disequilibrium mapping of a Verticillium dahliae resistance quantitative trait locus in tetraploid potato (Solanum tuberosum) through a candidate gene approach
Alon et al. Multiple origins of pyrethroid resistance in sympatric biotypes of Bemisia tabaci (Hemiptera: Aleyrodidae)
Robbertse et al. Genetic diversity, acaricide resistance status and evolutionary potential of a Rhipicephalus microplus population from a disease-controlled cattle farming area in South Africa
Vaseeharan et al. Molecular markers and their application in genetic diversity of penaeid shrimp
Abdul Muneer et al. Genetic variation and population structure of endemic yellow catfish, Horabagrus brachysoma (Bagridae) among three populations of Western Ghat region using RAPD and microsatellite markers
Lu et al. Three EST-SSR markers associated with QTL for the growth of the clam Meretrix meretrix revealed by selective genotyping
La Rosa et al. Development of a single larva microsatellite analysis to investigate the population structure of Trichinella spiralis
Zhang et al. Major histocompatibility complex alleles associated with parasite susceptibility in wild giant pandas
Wang et al. Role of a gamma‐aminobutryic acid (GABA) receptor mutation in the evolution and spread of D iabrotica virgifera virgifera resistance to cyclodiene insecticides
Délye et al. Variation in the gene encoding acetolactate‐synthase in Lolium species and proactive detection of mutant, herbicide‐resistant alleles
Broders et al. Discovery of single‐nucleotide polymorphisms (SNPs) in the uncharacterized genome of the ascomycete Ophiognomonia clavigignenti‐juglandacearum from 454 sequence data
Aoki et al. Method for rapid detection of the PvCesA3 gene allele conferring resistance to mandipropamid, a carboxylic acid amide fungicide, in Plasmopara viticola populations
Bendele et al. Acetylcholinesterase 1 in populations of organophosphate-resistant North American strains of the cattle tick, Rhipicephalus microplus (Acari: Ixodidae)
Obbard et al. Population genetics of Plasmodium resistance genes in Anopheles gambiae: no evidence for strong selection
Eoche‐Bosy et al. Experimentally evolved populations of the potato cyst nematode Globodera pallida allow the targeting of genomic footprints of selection due to host adaptation
Baker et al. Species limits and population differentiation in New Zealand snipes (Scolopacidae: Coenocorypha)
WO2016075673A1 (en) Genetic markers for determining ectoparasite susceptibility to acaricides
CA2920752C (en) Screening and identification of resistant markers in crustacean
DK179775B1 (en) Method for detection of pyrethroid resistance in crustaceans and oligonucleotide sequences useful in detection of pyrethroid resistance
Dixit et al. Multilocus nuclear DNA markers and genetic parameters in an Indian Anopheles minimus population
Chen et al. A high‐throughput multilocus‐amplicon sequencing panel to monitor insecticide resistance in fall armyworm (FAW) Spodoptera frugiperda (Lepidoptera: Noctuidae)
Arias et al. Identification, inheritance, and variation of microsatellite markers in the black scallop Mimachlamys varia
CA2921148C (en) Detection of organophosphate resistance in crustaceans

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 15817547

Country of ref document: EP

Kind code of ref document: A1

WWE Wipo information: entry into national phase

Ref document number: MX/A/2017/006202

Country of ref document: MX

NENP Non-entry into the national phase

Ref country code: DE

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112017010065

Country of ref document: BR

122 Ep: pct application non-entry in european phase

Ref document number: 15817547

Country of ref document: EP

Kind code of ref document: A1

REG Reference to national code

Ref country code: BR

Ref legal event code: B01E

Ref document number: 112017010065

Country of ref document: BR

Free format text: COMO FORAM SOLICITADOS 2 SERVICOS ATRAVES DA PETICAO 870170044737 E, DE ACORDO COM A RESOLUCAO NO189/2017 DEVEM SER PAGAS RETRIBUICOES ESPECIFICAS PARA CADA UM DOS SERVICOS SOLICITADOS, SE FAZ NECESSARIA A COMPLEMENTACAO DO PAGAMENTO.

ENP Entry into the national phase

Ref document number: 112017010065

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20170512