WO2016051154A1

WO2016051154A1 - Anti-microbial polypeptide vaccine

Info

Publication number: WO2016051154A1
Application number: PCT/GB2015/052820
Authority: WO
Inventors: Simon Foster; Jorge Garcia Lara
Original assignee: Absynth Biologics Limited
Priority date: 2014-09-30
Filing date: 2015-09-29
Publication date: 2016-04-07
Also published as: GB201417214D0

Abstract

The invention relates to an antigenic polypeptide[s], vaccines comprising said polypeptide[s] and the use of the vaccine in protecting subjects from microbial infection, in particular microbial infections caused by Staphylococcus spp, Clostridium spp and Streptococcus spp.

Description

ANTI-MICROBIAL POLYPEPTIDE VACCINE

Field of the Invention The invention relates to an antigenic polypeptide^], vaccines comprising said polypeptide^] and the use of the vaccine in protecting subjects from microbial infection, in particular microbial infections caused by Staphylococcus spp, Clostridium spp and Streptococcus spp. Background to the Invention

Vaccines protect against a wide variety of infectious diseases. Many vaccines are produced by inactivated or attenuated pathogens which are injected into a subject. The immunised subject responds by producing both a humoral (e.g. antibody) and cellular (e.g. cytolytic T cells) responses. For example, some influenza vaccines are made by inactivating the virus by chemical treatment with formaldehyde. For many pathogens chemical or heat inactivation, while it may give rise to vaccine immunogens that confer protective immunity, also gives rise to side effects such as fever and injection site reactions. In the case of bacteria, inactivated organisms tend to be so toxic that side effects have limited the application of such crude vaccine immunogens (e.g. the cellular pertussis vaccine) and therefore vaccine development has lagged behind drug- development. Moreover, effective vaccine development using whole cell inactivated organisms suffers from problems of epitope masking, immunodominance, low antigen concentration and antigen redundancy. This is unfortunate as current antibiotic treatments are now prejudiced by the emergence of drug-resistant bacteria.

Many modern vaccines are therefore made from protective antigens of the pathogen, isolated by molecular cloning and purified from the materials that give rise to side-effects. These latter vaccines are known as 'subunit vaccines'. The development of subunit vaccines has been the focus of considerable research in recent years. The emergence of new pathogens and the growth of antibiotic resistance have created a need to develop new vaccines and to identify further candidate molecules useful in the development of subunit vaccines. Likewise the discovery of novel vaccine antigens from genomic and proteomic studies is enabling the development of new subunit vaccine candidates, particularly against bacterial pathogens. However, although subunit vaccines tend to avoid the side effects of killed or attenuated pathogen vaccines, their 'pure' status means that subunit vaccines do not always have adequate immunogenicity to confer protection. An example of a pathogenic organism which has developed resistance to antibiotics is Staphylococcus aureus. S. aureus is a bacterium whose normal habitat is the epithelial lining of the nose in about 20-40% of normal healthy people and is also commonly found on people's skin usually without causing harm. However, in certain circumstances, particularly when skin is damaged, this pathogen can cause infection. This is a particular problem in hospitals where patients may have surgical procedures and/or be taking immunosuppressive drugs. These patients are much more vulnerable to infection with S. aureus because of the treatment they have received. Antibiotic resistant strains of S. aureus have arisen since their wide spread use in controlling microbial infection. Methicillin resistant strains are prevalent and many of these resistant strains are also resistant to several other antibiotics. Currently there is no effective vaccination procedure for S. aureus.

Our co-pending application WO2011/042681 discloses the identification of an antigenic polypeptide, DivlB, isolated and characterized from the gram positive bacterium S. aureus. DivlB is an integral membrane protein comprising an intracellular domain [amino acids 1-171] and intermembrane domain [amino acids 172-192] and an extracellular domain [ECD amino acids 193-439].

This disclosure illustrates that DivlB is a peptidoglycan-binding protein. The binding domain has been mapped to the β subdomain. Conditional mutational studies show that divlB is essential for Staphylococcus aureus growth, whilst phenotypic analyses following depletion of DivlB results in a block in the completion, but not initiation, of septum formation. Localisation studies suggest that DivlB only transiently localises to the division site and may mark previous sites of septation. It is proposed that DivlB acts as a molecular checkpoint during division to ensure the correct assembly of the divisome at midcell and to prevent hydrolytic growth of the cell in the absence of a completed septum. Orthologous genes from Streptococcus and Clostridium are also disclosed Statements of Invention

According to an aspect of the invention there is provided a monovalent or multivalent vaccine or immunogenic composition comprising a polypeptide characterized by:

i) a domain that binds bacterial cell wall peptidoglycan;

ii) is not a polypeptide that comprises the amino acid sequences as set forth in SEQ ID NO: 1 or 2; iii) has an amino acid sequence comprising or consisting essentially of the amino acid sequence set forth in SEQ ID NO: 3, 4 or 5; and iv) a polypeptide comprising an amino acid sequence as set forth in SEQ ID NO: 3, 4 or 5 which sequence is modified by addition, deletion or substitution of at least one amino acid residue wherein said modified sequence retains or has enhanced peptidoglycan binding.

i) a domain that binds bacterial cell wall peptidoglycan;

ii) is not a polypeptide that comprises the amino acid sequences as set forth in SEQ ID NO: 6 or 7;

iii) has an amino acid sequence comprising or consisting essentially of the amino acid sequence set forth in SEQ ID NO: 8, 9 or 10; and iv) a polypeptide comprising an amino acid sequence as set forth in SEQ ID

NO: 8, 9 or 10 which sequence is modified by addition, deletion or substitution of at least one amino acid residue wherein said modified sequence retains or has enhanced peptidoglycan binding. According to an aspect of the invention there is provided a monovalent or multivalent vaccine or immunogenic composition comprising a polypeptide characterized by:

i) a domain that binds bacterial cell wall peptidoglycan;

ii) is not a polypeptide that comprises the amino acid sequences as set forth in SEQ ID NO: 11 or 12;

iii) has an amino acid sequence comprising or consisting essentially of the amino acid sequence set forth in SEQ ID NO: 13, 14 or 15; and

iv) a polypeptide comprising an amino acid sequence as set forth in SEQ ID NO: 13, 14 or 15 which sequence is modified by addition, deletion or substitution of at least one amino acid residue wherein said modified sequence retains or has enhanced peptidoglycan binding.

A modified polypeptide or variant polypeptide may differ in amino acid sequence by one or more substitutions, additions, deletions, truncations that may be present in any combination. Among preferred variants are those that vary from a reference polypeptide by conservative amino acid substitutions. Such substitutions are those that substitute a given amino acid by another amino acid of like characteristics. The following non-limiting list of amino acids are considered conservative replacements (similar): a) alanine, serine, and threonine; b) glutamic acid and aspartic acid; c) asparagine and glutamine d) arginine and lysine; e) isoleucine, leucine, methionine and valine and f) phenylalanine, tyrosine and tryptophan. Most highly preferred are variants that retain or enhance the same biological function and activity as the reference polypeptide from which it varies. In one embodiment, the variant polypeptides have at least 20% identity, more preferably 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70% or 75% identity over the polypeptide fragments disclosed herein.

In an alternative embodiment, the variant polypeptides have at least 80% identity, more preferably at least, 81 %, 82%, 82%, 84%, 85%, 86%, 87%, 88%, 89% or 90% identity, even more preferably at least 91 %, 92%, 93%, 94% or 95% identity, still more preferably at least 97%, 98% identity, and most preferably at least 99% identity with the polypeptide fragments disclosed herein.

In a preferred embodiment of the invention said polypeptide comprises the amino acid sequence set forth in SEQ ID NO: 3, 4 or 5.

In a preferred embodiment of the invention said polypeptide comprises the amino acid sequence set forth in SEQ ID NO: 8, 9 or 10. In a preferred embodiment of the invention said polypeptide comprises the amino acid sequence set forth in SEQ ID NO: 13, 14 or 15.

In a preferred embodiment of the invention said composition includes an adjuvant and/or carrier.

In a preferred embodiment of the invention said adjuvant is selected from the group consisting of: cytokines selected from the group consisting of GMCSF, interferon gamma, interferon alpha, interferon beta, interleukin 12, interleukin 23, interleukin 17, interleukin 2, interleukin 1 , TGF, TNFa, and ΤΝΡβ.

In a further alternative embodiment of the invention said adjuvant is a TLR agonist such as CpG oligonucleotides, flagellin, monophosphoryl lipid A, poly l:C and derivatives thereof.

In a preferred embodiment of the invention said adjuvant is a bacterial cell wall derivative such as muramyl dipeptide (MDP) and/or trehalose dicorynomycolate (TDM). In a preferred embodiment of the invention said adjuvant is an aluminium based adjuvant comprising one or more aluminium salts. Preferably said aluminium salt is aluminium phosphate or aluminium hydroxide.

In a preferred embodiment of the invention said adjuvant is a gel based adjuvant.

Adjuvants (immune potentiators or immunomodulators) have been used for decades to improve the immune response to vaccine antigens. The incorporation of adjuvants into vaccine formulations is aimed at enhancing, accelerating and prolonging the specific immune response to vaccine antigens. Advantages of adjuvants include the enhancement of the immunogenicity of weaker antigens, the reduction of the antigen amount needed for a successful immunisation, the reduction of the frequency of booster immunisations needed and an improved immune response in elderly and immunocompromised vaccinees. Selectively, adjuvants can also be employed to optimise a desired immune response, e.g. with respect to immunoglobulin classes and induction of cytotoxic or helper T lymphocyte responses. In addition, certain adjuvants can be used to promote antibody responses at mucosal surfaces. Aluminium hydroxide and aluminium or calcium phosphate has been used routinely in human vaccines. Examples of commercially available adjuvants that are aluminium based include Adju- Phos™ and Alhydrogel™ which are aluminium phosphate based gels and Imject® which is a combination of aluminium hydroxide and magnesium hydroxide. More recently, antigens incorporated into IRIV's (immunostimulating reconstituted influenza virosomes) and vaccines containing the emulsion-based adjuvant MF59 have been licensed in countries. Adjuvants can be classified according to their source, mechanism of action and physical or chemical properties. The most commonly described adjuvant classes are gel-type, microbial, oil-emulsion and emulsifier-based, particulate, synthetic and cytokines. More than one adjuvant may be present in the final vaccine product. They may be combined together with a single antigen or all antigens present in the vaccine, or each adjuvant may be combined with one particular antigen or combination of antigens.

Other examples include: "virosomes" derived from disparate viral particles, MDP is derived from bacterial cell walls; saponins are of plant origin, squalene is derived from shark liver [for example AddaVax™ which is a combination of sorbitan triolate in squalene oil with Tween 80 and a citrate buffer] and recombinant endogenous immunomodulators are derived from recombinant bacterial, yeast or mammalian cells. There are several adjuvants licensed for veterinary vaccines, such as mineral oil emulsions that are too reactive for human use. Similarly, complete Freund's adjuvant, although being one of the most powerful adjuvants known, is not suitable for human use.

A carrier is an immunogenic molecule which, when bound to a second molecule augments immune responses to the latter. The term carrier is construed in the following manner. A carrier is an immunogenic molecule which, when bound to a second molecule augments immune responses to the latter. Some antigens are not intrinsically immunogenic yet may be capable of generating antibody responses when associated with a foreign protein molecule such as keyhole-limpet haemocyanin or tetanus toxoid. Such antigens contain B-cell epitopes but no T cell epitopes. The protein moiety of such a conjugate (the "carrier" protein) provides T-cell epitopes which stimulate helper T-cells that in turn stimulate antigen-specific B-cells to differentiate into plasma cells and produce antibody against the antigen.

The vaccine compositions of the invention can be administered by any conventional route, including injection, intranasal spray by inhalation of for example an aerosol or nasal drops. The administration may be, for example, intravenous, intraperitoneal, intramuscular, intracavity, subcutaneous, or intradermally. The vaccine compositions of the invention are administered in effective amounts. An "effective amount" is that amount of a vaccine composition that alone or together with further doses, produces the desired response. In the case of treating a particular bacterial disease the desired response is providing protection when challenged by an infective agent.

In a preferred embodiment of the invention said vaccine composition is adapted for administration as a nasal spray. In a preferred embodiment of the invention said vaccine composition is provided in an inhaler and delivered as an aerosol.

The amounts of vaccine will depend, of course, on the individual patient parameters including age, physical condition, size and weight, the duration of the treatment, the nature of concurrent therapy (if any), the specific route of administration and like factors within the knowledge and expertise of the health practitioner. These factors are well known to those of ordinary skill in the art and can be addressed with no more than routine experimentation. It is generally preferred that a maximum dose of the individual components or combinations thereof be used sufficient to provoke immunity; that is, the highest safe dose according to sound medical judgment. It will be understood by those of ordinary skill in the art, however, that a patient may insist upon a lower dose or tolerable dose for medical reasons, psychological reasons or for virtually any other reasons.

The doses of vaccine administered to a subject can be chosen in accordance with different parameters, in particular in accordance with the mode of administration used and the state of the subject. In the event that a response in a subject is insufficient at the initial doses applied, higher doses (or effectively higher doses by a different, more localized delivery route) may be employed to the extent that patient tolerance permits. In general, doses of vaccine are formulated and administered in effective immunizing doses according to any standard procedure in the art. Other protocols for the administration of the vaccine compositions will be known to one of ordinary skill in the art, in which the dose amount, schedule of injections, sites of injections, mode of administration and the like vary from the foregoing. Administration of the vaccine compositions to mammals other than humans, (e.g. for testing purposes or veterinary therapeutic purposes), is carried out under substantially the same conditions as described above. A subject, as used herein, is a mammal, preferably a human, and including a non-human primate, cow, horse, pig, sheep or goat. In a preferred embodiment of the invention there is provided a vaccine composition according to the invention that includes at least one additional anti-bacterial agent.

In a preferred embodiment of the invention said agent is a second different vaccine and/or immunogenic agent (for example a bacterial polypeptide and/or polysaccharide antigen).

According to a further aspect of the invention there is provided a composition according to the invention for use in the treatment of microbial infections or conditions that result from microbial infections.

In a preferred embodiment of the invention said microbial infection is a staphylococcal infection. In a preferred embodiment of the invention said microbial infection is a streptococcal infection. In a preferred embodiment of the invention said microbial infection is a Clostridium infection.

According to a further aspect of the invention there is provided a method to immunize a subject comprising vaccinating said subject with an effective amount of the vaccine composition according to the invention.

In a preferred method of the invention said subject is a human.

In an alternative preferred method of the invention said subject is a non-human animal, preferably a livestock animal, for example cattle.

In a preferred method of the invention said livestock animal is vaccinated against bacterial mastitis caused by staphylococcal bacterial cells. In a preferred method of the invention said livestock animal is a caprine animal (e.g. sheep, goat).

In a preferred method of the invention said livestock animal is a bovine animal (e.g. a cow).

Staphylococcal mastitis is a serious condition that affects livestock and can result in considerable expense with respect to controlling the disease through administration of antibiotics and in terms of lost milk yield. The vaccine according to the invention provides cost effective control of bacterial, in particular staphylococcal mastitis.

According to a further aspect of the invention there is provided an immunogenic or vaccine composition comprising two or more different polypeptides selected from the group consisting of:

i) a polypeptide comprising or consisting essentially of the amino acid sequence set forth in SEQ ID NO: 3, 4 or 5; a polypeptide comprising an amino acid sequence as set forth in SEQ ID NO: 3, 4 or 5 which sequence is modified by addition deletion or substitution of at least one amino acid residue wherein said modified sequence retains or has enhanced peptidoglycan binding; a polypeptide comprising or consisting of the amino acid sequence as set forth in SEQ ID NO: 16 or 17.

In a preferred embodiment of the invention said composition comprises:

i) a polypeptide comprising or consisting essentially of the amino acid sequence set forth in SEQ ID NO: 3, 4 or 5; and

ii) a polypeptide comprising or consisting essentially of the amino acid sequence set forth in SEQ ID NO: 16 or 17.

In a preferred embodiment of the invention said composition is for use in the treatment of a staphylococcal infection.

Preferably said staphylococcal infection is a Staphylococcus aureus or Staphylococcus epidermidis infection.

In a preferred embodiment of the invention the immunogenic or vaccine compositions herein disclosed is for use in the treatment of a staphylococcal infection caused by an antibiotic resistant staphylococcal cell.

i) a polypeptide comprising or consisting essentially of the amino acid sequence set forth in SEQ ID NO: 8, 9 or 10 ;

ii) a polypeptide comprising an amino acid sequence as set forth in SEQ ID NO: 8, 9 or 10 which sequence is modified by addition deletion or substitution of at least one amino acid residue wherein said modified sequence retains or has enhanced peptidoglycan binding; iii) a polypeptide comprising or consisting of the amino acid sequence as set forth in SEQ ID NO: 19 or 20.

In a preferred embodiment of the invention said composition comprises: i) a polypeptide comprising or consisting essentially of the amino acid sequence set forth in SEQ ID NO: 8, 9 or 10; and

ii) a polypeptide comprising or consisting essentially of the amino acid sequence set forth in SEQ ID NO: 19 or 20.

i) a polypeptide comprising or consisting essentially of the amino acid sequence set forth in SEQ ID NO: 13, 14 or 15;

ii) a polypeptide comprising an amino acid sequence as set forth in SEQ ID NO: 13, 14 or 15 which sequence is modified by addition deletion or substitution of at least one amino acid residue wherein said modified sequence retains or has enhanced peptidoglycan binding; iii) a polypeptide comprising or consisting of the amino acid sequence as set forth in SEQ ID NO: 18.

In a preferred embodiment of the invention said composition comprises:

i) a polypeptide comprising or consisting essentially of the amino acid sequence set forth in SEQ ID NO: 13, 14 or 15; and

ii) a polypeptide comprising or consisting essentially of the amino acid sequence set forth in SEQ ID NO: 18.

Throughout the description and claims of this specification, the words "comprise" and "contain" and variations of the words, for example "comprising" and "comprises", means "including but not limited to", and is not intended to (and does not) exclude other moieties, additives, components, integers or steps. "Consisting essentially" means having the essential integers but including integers which do not materially affect the function of the essential integers.

Throughout the description and claims of this specification, the singular encompasses the plural unless the context otherwise requires. In particular, where the indefinite article is used, the specification is to be understood as contemplating plurality as well as singularity, unless the context requires otherwise.

Features, integers, characteristics, compounds, chemical moieties or groups described in conjunction with a particular aspect, embodiment or example of the invention are to be understood to be applicable to any other aspect, embodiment or example described herein unless incompatible therewith.

An embodiment of the invention will now be described by example only and with reference to the following figures:

Figure 1 : A Schematic representation of the domain architecture of B. subtilis and S. aureus DivlB. The extracytoplasmic region is separated into 3 domains, α, β and γ. The numbers correspond to the domain boundaries. Sedimentation analysis of SaDivlB and BsDivlB binding to S. aureus (B.) and B. subtilis (C.) purified peptidoglycan. Recombinant protein was incubated with increasing concentrations of purified peptidoglycan for 2 h at 37 °C. Samples were then separated into supernatant (S) and pellet (P) fractions prior to separation using SDS-PAGE. D. Sedimentation analysis of truncated SaDivlB proteins binding to S. aureus purified peptidoglycan. Schematics of the truncations with corresponding amino acid residues are shown on the left, whilst Coomassie-stained gels of the separated supernatant (S) and pellet (P) fractions are shown on the right;

Figure 2 A The effect of pH on Cy-SaDivlB peptidoglycan binding kinetics. Varying concentrations of Cy2-labelled SaDivlB were incubated with S. aureus purified peptidoglycan using binding buffer at pH5 + MgCI₂ (♦), pH 5 (■), pH5 + 1 M NaCI ( A), pH7.2 (X) and pH9.5 (·). B. Cy2-SaDivlB binding to S. aureus purified peptidoglycan in the absence (■) or presence (♦) of teichoic acids (TA), and to purified S. aureus AtagO cell walls ( A). All binding is displayed as three independent measurements of the concentration of bound Cy2-SaDivlB. Error bars represent the standard deviation≥ 10 nM;

Figure 3 A Subcellular localisation of DivlB in ALB1 (SH1000 atl::ery spa kari). Equal amounts of cellular material corresponding to the cytoplasmic (Cyt), membrane (M) or cell wall (CW) fraction were loaded. As a control, fractions were probed with rabbit a- YneS, a known membrane-bound protein. Arrows indicate the position of detected protein. B. Localisation of DivlB-GFP in ALB2 (SH1000 divlB-gfp pGL485). Scale bar = 1 μηι C. Localisation of YFP-DivlB in cells (SH1000 AdivlB geh::P_Spac eYFP-divlB pGL485). The frequencies of different localisation patterns are shown (n = 207) with a representative cell for each localisation; Figure 4 A. Schematic of chromosomal location of S. aureus divlB. A putative transcription terminator (ter) after ftsZ is highlighted. B. Representation of the ALB26 (geh::P_Spac-divlB AdivlB) chromosomal construct. Integration of pALB47 at S. aureus lipase (geh) resulted in an ectopic copy of divlB under the control of P_{S a}c- Resolution of a double crossover event of pALB29 could then be achieved to allow in frame deletion of divlB from its native chromosomal location. C. DivlB is required for the growth of S.aureus. Growth of ALB27 {geh::P_Spac-divlB AdivlB pGL485) on BHI plates in the presence (1 mM) or absence (0 mM) of IPTG is shown on the left. D. Growth of strains VF17 (SH1000 pGL485;♦) and ALB27 (geh::P_Spac-divlB AdivlB pGL485) in the presence (■) or absence (A ) of 1 mM IPTG as detected by OD₆₀₀. Strain VF17 (SH1000 pGL485) was unaffected by addition by IPTG and so only growth in the absence of inducer is shown;

Figure 5 A. Microscopic analysis of the phenotype of ALB27 (geh::P_Spac-divlB AdivlB pGL485). Top panels show phase-contrast images of VF17 (WT; SH1000 pGL485) and ALB27 after 120 min growth in the presence (1) or absence (0) of 1 mM IPTG, whilst bottom panels show cell membrane staining with FM4-64 and DNA staining with DAPI. Scale bar = 4 μηι. B. Frequency of cell diameter of ALB27 (geh::P_Spac-divlB AdivlB pGL485) grown in different inducer concentrations. VF17 (SH1000 pGL485) and ALB27 were grown for 120 min in the presence of 0 - 1 mM IPTG. VF17 cell diameter was unaffected by addition of IPTG and therefore only measurements for 0 mM IPTG is shown. Diameter was measured across the longest axis of the cell. C. Levels of DivlB in ALB28 {spa::kan pGL485) and ALB29 {spa::kan geh::P_Spac-divlB AdivlB pGL485) following 120 min growth in the presence (1) or absence (0) of 1 mM IPTG were detected by Western blot of total protein extract using a-DivlB. An equal number of cells, as determined by OD₆₀₀, were loaded;

Figure 6 A. Van-FI labelling of nascent cell wall synthesis in VF17 (WT; SH1000 pGL485) and ALB27 (geh::P_Spac-divlB AdivlB pGL485) grown for 120 in the presence (1) or absence (0) of 1 mM IPTG. Scale bar = 4 μηι. B. Frequency of Van-FI staining cellular phenotypes of VF17 (WT; SH1000 pGL485) and ALB27 {geh::P_Spac-divlB AdivlB pGL485) grown for 120 in the presence (1) or absence (0) of 1 mM IPTG. Cells were given one of five Van-FI staining phenotypes in relation to cell diameter. The number of cells measured was 278, 362 and 421 , respectively. C. Frequency of midcell Van-FI staining cellular phenotypes of VF17 (WT; SH1000 pGL485) and ALB27 {geh::P_Spac-divlB AdivlB pGL485) grown for 120 in the presence (1) or absence (0) of 1 mM IPTG. Midcell Van-FI staining phenotypes were assigned as a plate or ring of nascent peptidoglycan as determined by analysis of Z stacks of cells. The number of cells measured was 134, 153 and 306, respectively;

Figure 7 Scanning (A) and transmission (B) electron micrographs of VF17 (WT, SH1000 pGL485) and ALB27 (geh::P_Spac-divlB AdivlB pGL485) grown for 120 min in the presence (1) or absence (0) of 1 mM IPTG. Scale bar in A = 2 μηι. White arrowheads in A depict bands of peptidoglycan observed at midcell. Black arrowheads in B show sites aberrant sites of septum initiation. C. AFM height (H) and phase (P) images of ALB27 cell walls grown in the absence (0) of IPTG. Scale bar = 1 μηι. Scales: WT; middle panel H 250 nm, P 20°; right hand panel H 150 nm, P 50°;

Figure 8 A. Localisation of EzrA-GFP+ in VF104 (WT; SH1000 ezrA-GFP+ pGL485) and ALB30 (ezrA-GFP+ geh::P_Spac-divlB AdivlB pGL485) grown for 120 min in the presence (1) or absence (0) of 1 mM IPTG. Scale bar = 4 μηι.Β. Frequency of EzrA-GFP+ localisation in VF104 (WT; SH1000 ezrA-GFP+ pGL485) and ALB30 (ezrA-GFP+ geh::P_Spac-divlB AdivlB pGL485) grown for 120 in the presence (1) or absence (0) of 1 mM IPTG. Localisation patterns were classified as midcell, dispersed or aberrant rings in relation to cell size. The number of cells measured was 249, 265 and 312, respectively. C. Colonialization of EzrA-GFP+ (green) and FtsZ (red) in ALB32 (SH1000 spa::kan ezrA-GFP+ pGL485) and ALB33 {spa::kan ezrA-GFP+ geh::P_Spac-divlB AdivlB pGL485) grown for 120 min in the presence (1) or absence (0) of 1 mM IPTG. FtsZ was detected by immunofluorescence. Cell diameter could not be measured due to the treatment of cells with lysostaphin to allow access of antibodies to intracellular protein. D. Localisation of GpsB-GFP+ in VF94 (WT; SH1000 gpsB-GFP+ pGL485) and ALB31 (gpsB-GFP+ geh::P_Spac-divlB AdivlB pGL485) grown for 120 min in the presence (1) or absence (0) of 1 mM IPTG. Scale bar = 4 μηι. E. Frequency of GpsB-GFP+ localisation in VF94 (WT; SH1000 gpsB-GFP+ pGL485) and ALB31 (gpsB-GFP+ geh::P_Spac-divlB AdivlB pGL485) grown for 120 in the presence (1) or absence (0) of 1 mM IPTG. Localisation patterns were classified as midcell, foci between recently divided cells, dispersed or aberrant rings in relation to cell size. The number of cells measured was 298, 242 and 292, respectively. F. Colonialization of Pbps and nascent peptidoglycan synthesis in VF17 (SH1000 pGL485) and ALB27 {geh::P_Spac-divlB AdivlB pGL485) grown for 120 min in the presence (1) or absence (0) of 1 mM IPTG. Pbps were stained with 1 μΜ bocillin 650/665 (red) and nascent peptidoglycan was stained with Van-FI (green). Due to the weak fluorescence signal of bocillin 650/665 only single z-slices were taken. Scale bar = 4 μηι; Figure 9 Model for the role of DivlB in septum formation. The divisome assembles at midcell independently of DivlB (left), although DivlB may still be recruited to midcell through protein interactions. This complex of proteins is sufficient to initiate septation, resulting in the formation of the piecrust, a thick band of peptidoglycan (PG, centre). DivlB is required for the initiation of septum completion (right), perhaps through direct interaction with the piecrust, or recruitment of division proteins;

Figure 10 A. Coomassie stained gel of nickel affinity-purified recombinant DivlB protein. 1 , SaDivlB; 2, BsDivlB; 3, 58βγ; 4, ε8βγ Δ263-279; 5, ε8βγ Δ263-291 ; 6, ε8βγ Δ263- 315; 7, Safiy Δ263-333; 8, Sa$; 9, Sa$ Δ345-372. B.Sedimentation analysis of Cytochrome C (left hand gel) and BSA (right hand gel) binding to S. aureus purified peptidoglycan. Protein was incubated with increasing concentrations of purified peptidoglycan for 2 h at 37 °C. Samples were then separated into supernatant (S) and pellet (P) fractions prior to separation using SDS-PAGE. C. Optimisation of binding buffer composition to reduce non-specific binding of Cy2-BSA to S. aureus purified peptidoglycan. Binding buffer (pH5; ♦) and buffer + 0.1 M NaCI (■) facilitated nonspecific binding of Cy2-BSA, whilst buffer + 0.05 % Tween 20 ( A ) reduced non-specific binding; and Figure 11 Investigation of protonation of S. aureus cell walls using the method of Calamita et al. (2001). B. subtilis cells were included as a control. FITC is a pH- sensitive probe which binds to free amines at an optimal pH range of 7.0 to 9.0; thus, if the cell wall is protonated and has a pH <7.0, FITC coupling will be unfavourable. Furthermore, if cells are de-energised using DCCD, they will take on the pH of the surrounding environment. FITC-labelling of B. subtilis or S. aureus cells was carried out at pH 5 or pH 8 in the presence or absence of 100 μΜ DCCD (filled bars) and measured as fluorescence at 525 nm (A). As a control, no FITC was added to cells under each condition investigated (empty bars). Error bars represent the standard deviation of three independent measurements. B Fluorescence micrographs of B. subtilis or S. aureus energised (- DCCD) or de-energised (+ DCCD) cells coupled to FITC at pH8 are also shown (B). Scale bar = 2 μηι.

Materials and Methods

Bacterial strains, plasmids, and oligonucleotides The bacterial strains and plasmids used in this study are shown in Table 1 , whilst oligonucleotide sequences used are shown in Table 2.

Growth conditions and media E.coli, B. subtilis and S. aureus strains were grown in Luria-Bertani broth (LB; Oxoid), nutrient broth (NB; Oxoid) or brain heart infusion broth (BHI; Oxoid), respectively, at 37°C unless otherwise stated. For growth on solid media, 1.5 % (w/v) agar was added. When necessary, the medium was supplemented with erythromycin (5 μg ml^"1), chloramphenicol (30 μg ml^"1), tetracycline (5 μg ml^"1), ampicillin (100 μg ml^"1), kanamycin (50 μg ml^"1), spectinomycin (100 μg ml^"1), 5-bromo-4-chloro-3-indolyl β-D- thiogalactopyranoside (X-Gal, 80 μg ml^"1) or isopropyl β-D-thiogalactopyranoside (IPTG, 1 mM).

Transformations of S. aureus RN4220 were carried out as previously described (Schenk and Laddaga, 1992). Phage transductions of S. aureus using Φ11 were carried out as described by Novick and Morse (1967). General DNA manipulation and transformation of E.coli was performed using the method of Sambrook and Russell (2001).

Construction of an S. aureus divlB inducible strain To create a divlB inducible strain at the native locus, a fragment of 803 bp containing the ribosomal binding site and the first 778 codons of the divlB gene from SH1000 was amplified by PCR using primers ALB9 and ALB11. To investigate the potential polar downstream effects on ftsA and ftsZ, a full length copy of divlB, including RBS, was also amplified from SH1000 using primers ALB9 and ALB10. The PCR fragments were cloned into pAISHI using EcoRI and Eagl cut sites. The resulting plasmids, pALB21 (pAISHI-d/V/β) and pALB22 (pAISH1-d/V/B5') were introduced into RN4220 by electroporation and subsequently transferred to SH1000 by φ1 1 transduction. Resulting strains contained either a full copy of divlB under the control of a native promoter and a second full length copy under the control of P_{S a}c (ALB1 1 ; SH1000 P_Spac-divlB) or only one full copy of divlB under the control of P_Spac (ALB12; SH1000 P_Sp_ac-divlB5').

Attempts to make a DivlB null mutant were carried out using the thermosensitive plasmid pMAD (Arnaud et al., 2004). PCR fragments containing ~1 kb flanking regions of divlB were amplified from genomic DNA of SH1000 using primers ALB27/ALB28 and ALB29/ALB30 which encoded an internal Kpn\ restriction site to allow in frame fusion of the upstream and downstream regions. After Kpn\ digestion and ligation of the two PCR products the resulting DNA fragment underwent a second PCR reaction using primers ALB27/ALB30. This resulting DNA fragment was digested with SamHI and EcoRI and cloned into pMAD to create pALB29. The plasmid was electroporated into RN4220 at 30°C and subsequently transduced into SH1000 to produce strain ALB16. Several attempts were carried out to isolate a colony in which the deletion of divlB was completed due to a two-step homologous recombination event by passaging of ALB16 at 42°C. However, only a single crossover event, resulting in the integration of pALB29 into the chromosome, was achieved. Deletion of genes by two-step homologous recombination of pMAD relies of the assumption that deletion of the target gene does not affect cell viability. To ensure resolution of pALB29 from the chromosome was not being hindered by the essentiality of divlB for cell growth, a chromosomal ectopic copy of divlB under the control of P_{S a}c was introduced to allow inducible expression of divlB during growth at the permissive temperature. The DNA fragment corresponding to the RBS and coding region of divlB under the control of P_{S a}c was PCR amplified from pALB21 using primers ALB127/ALB128. The PCR product was digested with Smal and BarnHI and cloned into pCL84 (Lee et al, 1991). The resulting plasmid, pALB49, was transformed into RN4220 containing pCL112Al9, a constitutively expressed multi-copy plasmid containing the integrase gene without the a#P site (Lee et al., 1991). Correct integration of the plasmid into the chromosome was verified by PCR using primers ALB127/ALB128 and by disruption of lipase production on Baird-Parker medium (Oxoid). The chromosomal region, including the plasmid insertion, was then transferred to ALB16 via φ11 transduction at 30°C. The resulting strain contained pALB29 inserted in the chromosome due to a single crossover event and P_Spac-divlB inserted ectopically at lipase. Colonies in which the deletion of divlB due to a double crossover event, resulting in the excision of the integrated plasmid, were then selected by passaging recombinants at 42°C in the absence of erythromycin. Colonies that showed erythromycin sensitivity and were not blue on X-gal were screened by PCR using primers ALB27/ALB30, and deletion of divlB was confirmed by Southern blotting to produce strain ALB26. To allow controlled expression of divlB from P_S ac, pGL485, a multi-copy plasmid carrying lad (Cooper et al, 2009), was introduced into ALB26 by φ11 transduction in the presence of 1 mM IPTG to create strain ALB27.

Construction of fluorescent derivatives of S. aureus DivlB To create an N terminal YFP fusion of DivlB, yfp was amplified from pMUTIN-YFP (Kaltwasser et al, 2002) using primers ALB137 and ALB138 and ligated to divlB, which had been amplified from SH1000 genomic DNA using primers ALB139 and ALB140, using an Xhol cut site that had been introduced during PCR amplification. The product was digested with Hindi 11 and BamHI and inserted into pMUTIN4 (Vagner et al., 1998) resulting in plasmid pALB53. A PCR fragment including yfp-divlB under control of the Spac promoter was then amplified from pALB53 using primers ALB141 and ALB140. To insert P_Spac-y p-divlB ectopically at the lipase gene of the S. aureus chromosome, a high copy-number of pCL84 (Lee et al., 1991) was created by amplifying a DNA fragment containing attP and the tet cassette from pCL84 and inserting into pUC18 using Sphl and EcoRI cut sites. The resulting plasmid, pKASBAR, was then digested with EcoRI and BamHI to allow insertion of P_Spac-y p-divlB to create plasmid pALB54.

The resultant plasmid, pALB54, was then used to transform S. aureus RN4220 to allow integration of the plasmid at the chromosomal geh locus. The resulting strain expressed yfp-divlB under control of the IPTG-inducible Spac promoter.

Generation of antibodies

Anti-DivlB and anti-FtsZ polyclonal antibodies were obtained from a rabbit immunised with purified his-tagged recombinant S. aureus DivlB and FtsZ (BioServ UK, UK). Fluorescence imaging

For fluorescence microscopy, cells from a mid-exponential-phase culture were fixed with formaldehyde and glutaraldehyde as previously described (Pinho and Errington, 2003). For phenotypic imaging of IPTG-inducible strains, cells were depleted of the appropriate protein as described in Steele et al. (201 1) before fixation of cells. Immunofluorescence imaging was carried out as basically described in Pinho and Errington (2003). Permeabilisation of the cell wall was carried out by lysostaphin digestion at a range of concentrations (20 - 200 ng ml^"1) for 1 min. Primary antibodies were used at the following dilutions: rabbit anti-FtsZ at 1 :2000 and rabbit anti-DivlB at 1 : 100. The secondary antibody used was anti-rabbit IgG AlexaFluor 594 conjugate (Invitrogen). Fluorescence images were acquired using an Olympus IX70 deconvolution microscope and SoftWoRx 3.5.0 software (Applied Precision).

Electron microscopy

The DivlB conditional mutant strain (ALB27) was grown with 0.2 mM IPTG until mid- exponential phase. The culture was washed three times with BHI, diluted in pre-warmed BHI to an initial OD₆oo of 0.01 and grown with or without 1 mM IPTG for 2 h. All samples were fixed overnight in ice-cold 3 % (v/v) glutaraldehyde in 0.1 M sodium phosphate buffer pH 7.4. Cell pellets were washed twice in the same buffer before post-fixation with 2 % osmium tetroxide for 1 h. Following a further buffer-wash step, cells were dehydrated using a graded ethanol series. For SEM samples, cells were then air dried from hexamethyldisilazane using a 1 : 1 mix of ethanol and hexamethyldisilazane, followed by 100 % hexamethyldisilazane. Once dried, samples were mounted on 12.5 mm stubs, attached with carbon-sticky tabs and coated in and Edwards S150B sputter coater with approximately 25 nm gold. Samples were analysed in a Philips XL-20 scanning electron microscope at an accelerating voltage of 20 Kv. For TEM samples, ethanol-dried samples were incubated in propylene oxide before infiltration of the samples was carried out at room temperature overnight using a 1 :1 mix of propylene oxide and araldite resin. Samples were then incubated in araldite resin for 8 h before embedding in fresh araldite resin for 48-72 h at 60 °C. 0.5 μηι sections were cut on a Reichert Ultracut E ultramicrotome and stained with 1 % Toluidine blue in 1 % borax. Ultrathin sections (70-90 nm) were then cut as before and stained with 3 % uranyl acetate and Reynold's lead citrate before being viewed using a FEI Tecnai transmission electron microscope at an accelerating voltage of 80 Kv. Electron micrographs were taking using a Gatan digital camera.

Preparation of S. aureus and B. subtilis sacculi

Sacculi were prepared using the method previously described (Turner et al., 2010). Briefly, exponentially growing cultures (OD₆oo ~ 0.5) were collected, boiled for 7 min and broken by FastPrep. Broken cells were then suspended in 5 % (w/v) SDS and boiled for 25 min. Insoluble material was collected by centrifugation and the pellet was resuspended in 4 % (w/v) SDS and subsequently boiled for 15 min. SDS was removed from samples by repeated washing with distilled water. The resulting pellets were then resuspended in Tris-HCI (50 mM pH 7) containing 2 mg ml^"1 pronase and incubated at 60 °C for 90 min, followed by a single dH₂0 wash step. To removed teichoic acids, pellets were resuspended in 250 μΙ hydrofluoric acid and incubated overnight at 4 °C, before being washed six times in distilled water. Samples were stored at -20 °C.

Atomic force microscopy

AFM was carried out as previously described (Turner et al., 2010). A dilution of sacculi were dried onto freshly cleaved mica and washed three times with Milli-Q water using a stream of nitrogen. Tapping mode with silicon tips in ambient conditions using a Multimode or Dimension AFM with an Extended Nanoscope Ilia controller (Veeco Instruments) was performed. Images were analysed using Gwyddion and ImageJ.

Cell wall binding assays The ability of DivlB to bind to peptidoglycan was investigated using the method based on Kern et al. (2008). Briefly, samples of a total volume of 200 μΙ containing 0.1 mg ml^"1 protein and different concentrations of peptidoglycan (0.5, 0.25, 0.125 and 0.0625 mg ml^" ) were incubated for 2 h at 37 °C. Peptidoglycan, and any associated protein, was separated from unbound protein before washing twice in buffer (20 mM sodium citrate pH5 10 mM MgCI₂). Equal amounts of supernatant and pellet were then separated on an 1 1 % (w/v) SDS-PAGE gel.

To investigate binding of fluorescent protein to purified peptidoglycan, recombinant proteins were firstly labelled with Cy2 bis-reactive dye (GE Healthcare) using the method described in Schlag et al. (2010). Unconjugated dye was separated from labelled protein by dialysis against excess 50 mM sodium phosphate 0.5 M NaCI (pH 7.2) before storage of the conjugated protein at -20°C. To investigate the peptidoglycan binding kinetics of Cy2-labelled protein, 0.25 mg ml^"1 peptidoglycan was incubated with a range of concentrations of Cy2-labelled protein in a final volume of 200 μΙ at room temperature for 5 min. Insoluble peptidoglycan and associated protein was removed by centrifugation and the remaining pellet was washed to remove non-specifically bound protein. Bound fluorescent protein was released using 200 μΙ of 10% (w/v) SDS in two SDS wash steps to ensure complete release of all peptidoglycan-bound protein. The extent of binding was determined by fluorescence measurement at 525 nm using a Victor™ X3 multilabel reader, and the concentration of bound Cy2-labelled protein was calculated.

Table 1. Plasmids and bacterial strains used in this study.

Ery^r, erythromycin resistant; Tet^r, tetracycline resistant; Kan^r, kanamycin resistant; Cam^1", chloramphenicol resistant; Amp^1", ampicillin resistant; Spec^1", spectinomycin resistant

ALB28 SH1000 spa::kan pGL485; (Kan^r, Cam^r) This study

SH1000 spa/.kan geh::P_Spac-divlBAdivlB pGL485; (Kan^r, This study

ALB29

Tet^r, Cam^r)

SH1000 ezrA-GFP+ geh::P_Spac-divlBAdivlB pGL485; This study

ALB30

(Ery^r, Tef , Cam')

SH1000 gpsB-GFP+ geh::P_Spac-divlBAdivlB pGL485; This study

ALB31

(Ery^r, Tef, Cam^r)

SH1000 spa/.kan ezrA-GFP+ pGL485; (Kan^r, Ery^r, This study

ALB32

Cam^r)

SH1000 spa/.kan ezrA-GFP+ geh::P_Spac-divlBAdivlB This study

ALB33

pGL485; (Kan^r, Ery^r, Tef, Cam^r)

Table 2 Primers used in this study

Restriction sites are underlined.

Primer Sequence

GLUSH341C ATAATACCATGGCTCCACTTAGTAAAATTGCGCAT S. aureus divlB 5' (SEQ ID G extracytoplasmic NO 21) domain

GLUSH341C ATAATACTCGAGATTATTCTTACTTGATTGTTTG S. aureus divlB 3'(SEQ ID extracytoplasmic NO 22) domain

ALB9 TTTTTTGAATTCATCTTATTAAAGGGTGTGAGTATT RBS and coding

(SEQ ID NO G region of S. aureus 23) divlB

ALB10 (SEQ TTTTTTCGGCCGATTTTTTAATTATTCTTACTTGATT 3' end of S. aureus ID NO 24) GT divlB

ALB11 (SEQ TTTTTTCGGCCGTATCTACGTTTAATGTGTTTGGTA N terminus of ID NO 25) S. aureus divlB

ALB12(SEQ ATAATACCATGGCTAATGAAATTATTGCTTTAGTGA S. aureus divlB β ID NO 26) AATATAAA domain

ALB14(SEQ ATAATACCATGGCTAGGGATAGTTCGGGTAAACTA S. aureus divlB γ ID NO 27) AAA domain

ALB15(SEQ ATAATACTCGAGTGATAATGATTGTGACATCTGCG S. aureus divlB β ID NO 28) G domain

ALB17(SEQ ATAATACCATGGCTAGTAAAGTATCAACAATCTCT B. subtil is divlB ID NO 29) GTTACA extracytoplasmic domain

ALB18(SEQ ATAATACTCGAGATTTTCATCTTCCTTTTTAGCAG B. subtil is divlB ID NO 30) extracytoplasmic domain

Table 3 Sequence ID Summary

Clostridium difficile Vaccine Testing

The design of the model is based on published manuscripts (Theriot CM et al Cefoperazone-treated mice as an experimental platform to assess differential virulence of Clostridium difficile strains. Gut Microbes. 201 1 ; 2(6):326-34. Reeves AE et al. The interplay between microbiome dynamics and pathogen dynamics in a murine model of Clostridium difficile Infection. Gut Microbes. 201 ; 2(3): 145-58).

Mouse Strain

Sub-adult (6 weeks at delivery) male C57/BL6 mice used in this study are specifically pathogen free; the strain of mouse used is a well characterized strain. Mice will be -18- 20 g upon receipt at Euprotec's facility and will be allowed to acclimatize for 7 days (weight at the start of the experiment ~22-25g).

Housing of Mice

Mice are housed in sterile individual ventilated cages that expose the mice at all times to HEPA filtered sterile air (Tecniplast IVC). Mice have free access to food and water (sterile provided in disposable bags) and have sterile aspen chip bedding (changed every 2-3 days). Additionally during infection if required mice have additional access to wet food (mash) to ensure they remain fully hydrated. The room temperature is 22°C +/- 2°C, with a relative humidity of 50-60% and maximum background noise of 56dB. Mice are exposed to 12 hour light/dark cycles with dawn/dusk phases.

Model Design

Mice are pretreated for 10 days with cefoperazone (0.5 mg/ml) in sterile drinking water. Antibiotic water is refreshed every other day in order to minimize antibiotic deterioration. 48 hours pre-infection the antibiotic containing water is substituted for antibiotic-free water. This is followed on day 0 by gastric inoculation with ~10⁷ colony-forming units of C. difficile vegetative bacteria (see below) strain VPI 10463 (ATCC43255). Mice are monitored at 6h intervals for signs of C. difficile infection. Signs of infection include pyrexia, loose stools, weight loss and in approximately 5-15% of cases, death (if left to deteriorate clinically). Mice found with severe wet tail, diarrhoea, hypothermia lying prone or unresponsive are euthanized.

Clostridium difficile Isolate

C. difficile strain VPI 10463 (ATCC43255) was first isolated from an abdominal wound (hup.//irTi j.i j; doe aov/cq!-b!n w rria!n eg;: DOE Joint Genome Institute website) and is ribotype 087 and grouped in toxinotype 0. The strain produces 2 toxins, toxin A (enterotoxin) and toxin B (cytotoxin), which are the major known virulence factors for C. difficile associated diarrhoea (CDAD). The strain reliably establishes a chronic infection that is maintained for at least 14 days. Preparation of Inoculum and Infection

C. difficile is inoculated onto brain heart infusion agar supplemented with 0.01 % L- cysteine (BHIS) and cultured overnight under anaerobic conditions at 37°C to obtain single colonies. A single colony is used to inoculate 20ml_ of pre-reduced BHIS broth, which is cultured overnight under anaerobic conditions and without shaking. A 1 :5 dilution of this is cultured in fresh pre-reduced media for 4h under anaerobic conditions at 37°C to ensure the growth is in the mid-phase logarithmic growth before use. The bacteria are washed three times in PBS to remove toxin etc. and used to inoculate animals.

Temperature Measurement in Mice Prior to antibiotic preconditioning, mice have telemetric temperature recording chips inserted into the skin behind the neck (Biomedical Data Systems Micro-Chip ID- Acquisition System).

Vaccine administration

In all studies ^g of cholera toxin per intranasal vaccination is used as an adjuvant (Cholera Toxin, Vibrio cholerae, Type Inaba 569B, Azide Free lyophilized powder). The vehicle used in vaccination is Phosphate Buffer Saline. The vaccination schedule is -28, -14 and -7 days preceding C. difficile challenge. End of experiment

Throughout the study animals are weighed every day post infection. The end of the experiment is at most 10 days post infection. Samples of faeces will be collected 1 , 3. 5, 7, and 10 days post infection and semi-quantitatively cultured for the presence of C. difficile. Endpoints include (including statistical analysis as appropriate):

1. Daily weight measurements of all animals.

2. Temperature measurement throughout infection model

3. Survival of animals post infection.

4. Presence/absence of mega-colon.

5. Quantitative counts of C. difficile in colon (small intestine, caecum and colon).

Prior to euthanasia 4-10 faecal pellets are collected from all mice for faecal IgA measurement (the measurement of faecal IgA is not included in this proposal). Faecal samples are snap frozen and stored at minus 80°C.

10 days following infection, animals are euthanized. Throughout the study animals are weighed every two days. Following euthanized blood is collected by cardiac puncture and serum separated. The colon is removed and frozen for immunochemical measurement of gut IgA (and IgG). Specific antibody titres per vaccination dose are evaluated for Specific antibody titres (IgA, IgG and IgM) will be carried out in colon and serum samples.

Streptococcus pyogenes Vaccine Testing S. pyogenes Vaccination

The design of the models is based on published manuscripts (Loof et al. 2007. The contribution of dendritic cell to host defenses against Streptococcus pyogenes. Journal of Infectious Diseases. 196: 1794-1803. Siegert et al. 2006. Vaccination equally enables both genetically susceptible and resistant mice to control infection with group A streptococci. Microbes and Infection. 8(2): 347-353). Three different vaccination protocols were implemented to determine vaccination protection: sublethal sepsis model (SSM), lethal sepsis model (LSM), and skin infection model (SIM).

Mouse Strain

Balb/C animals were used in the SSM and SIM protocols, while strain C3H/HeN was used in the LSM protocol. The animals used in this study are pathogen free, and are maintained in a pathogen-free facility. Mice are -18-20 g upon receipt and are allowed to acclimatise for 7 days (weight at the start of the experiment).

Model Design

The design of the models is based on the published manuscripts indicated above using S. pyogenes A20 in SSM and LSM administered intravenously and subcutaneously, respectively, at a dose of 1x10⁵ CFU per animal; and S. pyogenes KTL3 administered subcutaneously in the SIM at a dose of 5 x 10⁷ CFU per animal. The administration volumes were 100μΙ.

Vaccine administration Mice were immununized according to the following schedule: -35, -28, and -14 days preceding bacterial challenge on day 0. The vaccine formulation consisted on a PBS vehicle plus Incomplete Freunds as an adjuvant, and an antigen that was either the combination of Absynth's Ant2+Ant3 (test article, 5μg and 50μg, respectively) or heat- killed S. pyogenes strain A20 (control). Groups per experiment Three groups were present in every protection experiment:

1) Animals receiving vehicle plus adjuvant (IFA) alone

2) Animals receiving IFA plus heat-killed S. pyogenes A20

3) Animals receiving IFA plus the antigen[s]. Every group had 10 animals. End of experiment

Throughout the study animals were weighed and their temperature measured every day post infection. In the SIM, skin lesion size was also determined daily. CFU in liver, blood and spleen were determined after bacterial inoculation at day 2 and 4 in the SSM, at day 1 and 3 in the LSM, and at days 1 , 2 and 4 in the SIM. In addition, in the SIM CFU were also determined according to the same schedule in draining lymph nodes. Plasma for determination of biochemical parameters of organ damage was collected.

Example 1

The extracellular domain of DivlB is a novel peptidoglycan-binding protein

DivlB is a bitopic membrane protein composed of an N-terminal cytoplasmic domain, a membrane-spanning domain and a C-terminal extracytoplasmic region. Domain swapping experiments in E.coli and B. subtilis have shown that the extracytoplasmic domain of FtsQ and DivlB is topologically separate and sufficient for cell division (Guzman et al., 1997; Katis and Wake, 1999). To investigate putative DivlB biochemical function, the extracytoplasmic domain of DivlB from B. subtilis (BsDivlB; residues 54 - 263) and S. aureus (SaDivlB; residues 195 - 439) were expressed as his-tagged recombinant proteins (Figure 10A) and tested for the ability to bind purified peptidoglycan using a sedimentation assay (see Materials and Methods). SaDivlB efficiently bound purified native peptidoglycan in a substrate-concentration-dependent manner (Figure 1.B). Binding of BsDivlB to native peptidoglycan was also observed, although slight precipitation of the recombinant protein was observed under the conditions used (Figure 1.C). Furthermore, both BsDivlB and SaDivlB bound to non-native peptidoglycan, indicating that the binding ability of DivlB is not affected by the composition of the peptide stem (Figures 1.B and 1.C). Affinity for peptidoglycan was not due to nonspecific interactions since binding was not observed for cytochrome C, which has a comparable isoelectric point to SaDivlB (9.5 and 9.34, respectively) or BSA (Figure 10.B). To further determine the domain(s) involved in peptidoglycan affinity, truncations of SaDivlB were tested for the ability to bind peptidoglycan (Figure 1.D). Truncations were made based on alignments with the domain architecture for G. stearothermophilus DivlB to attempt to reduce protein misfolding and expressed as his-tagged recombinant proteins (Figure 10A). Sedimentation assays revealed that both the a and γ domains are dispensable for peptidoglycan binding of S. aureus DivlB. Progressive removal of the N terminus of the β domain did not abolish affinity for peptidoglycan, inferring that the binding site of SaDivlB lies within the C terminus of the β domain (residues 333 - 372). Additionally, removal of the extreme C terminus of the β domain did not affect the binding of SaDivlB, further mapping the peptidoglycan binding site to residues 334 - 344 of the β domain. However, all truncations tested in this study showed some degree of affinity for peptidoglycan, and so it cannot be ruled out that another binding site is present, but not essential, for binding under the conditions used in this study. To investigate peptidoglycan binding semi-quantitatively, SaDivlB was conjugated to the fluorescent dye Cy2 and the peptidoglycan binding kinetics were examined (see Materials and Methods). It was found that a significant amount of non-specific peptidoglycan binding of Cy2-BSA occurred without addition of 0.05% (v/v) Tween 20 to the binding buffer (Figure 10C, Li and Howard, 2010). SaDivlB bound to purified S. aureus peptidoglycan in a concentration-dependent and saturable manner. This binding was dependent on pH, with highest affinity observed at pH5 and greatly reduced binding at higher pH (Figure 2. A).

To determine if increased affinity for peptidoglycan at lower pH correlates with physiologically relevant conditions, protonation of S. aureus cell walls was investigated by measurement of the total amount of cell wall-bound fluorescence using FITC, a pH- sensitive dye (Calamita et al., 2001). Unprotonated bacterial cell walls results in available linkage sites for FITC, whilst cell walls possessing a lower pH greatly reduces the concentration of aliphatic amines. Here, similar results for FITC conjugation to cell walls were observed for S. aureus to that previously reported for B. subtilis (Calmita et al., 2001). Cell walls were more readily labelled at pH 8 after dissipation of the proton motive force (pmf), using DCCD, resulting in loss of the low pH cell wall and an equilibrium of pH of the cell wall and surrounding environment (Figure 11A and 11 B). Hence, optimal binding of Cy2-SaDivlB to peptidoglycan at pH 5 is likely to reflect the physiological conditions of the native protein. Peptidoglycan binding of DivlB was abolished by the addition of 1 M NaCI, indicating ionic interactions between DivlB and substrate. Addition of Mg²⁺ cations did not affect DivlB affinity for peptidoglycan. It was found however that a higher amount of Cy2- SaDivlB was dissociated from peptidoglycan during the wash stages in the absence of magnesium cations compared to the presence of cations (4 ± 0.2 % lost compared to 1 ± 0.1 % at the highest Cy2-SaDivlB concentration tested), suggesting that magnesium cations may act to stabilise the interaction between DivlB and peptidoglycan.

The presence of teichoic acids was found to reduce the affinity of a known peptidoglycan-binding protein (S. aureus Cy2-PBP1) for peptidoglycan (data not shown). To investigate if the same was true for Cy2-SaDivlB, binding kinetics were analysed using either SDS- and pronase-treated broken S. aureus cell walls (peptidoglycan plus teichoic acids), or purified S. aureus peptidoglycan that had been chemically stripped of teichoic acids (Figure 2.B). An apparent K_d of 550.2 ± 56.3 nM could be calculated, representing the concentration of Cy2-SaDivlB giving half-maximum binding, for binding to cell walls (peptidoglycan plus teichoic acids). A K_d of 134.5 ± 9.7 nM was observed for binding to peptidoglycan stripped of teichoic acids, indicating higher affinity for the peptidoglycan backbone. To confirm that differences in binding affinity was due to teichoic acids and not caused by chemical modification of cell walls during the purification process, purified S. aureus AtagO peptidoglycan, which is devoid of teichoic acids due to deletion of the enzyme responsible for the first step in of wall teichoic acid synthesis, was used as substrate. An apparent K_d of 220.6 ± 80.6 nM was calculated, indicating that the presence of teichoic acids decreases the affinity of DivlB for peptidoglycan, presumably due to masking of available binding sites.

Example 2

S. aureus DivlB localises at midcell

Immunoblot analysis of native B. subtilis DivlB showed the protein to be associated with the cytoplasmic membrane, and also the cell wall in vivo (Harry et al., 1993). The ability of S. aureus DivlB to bind to cell wall in vivo was therefore determined using a-DivlB antiserum. S. aureus DivlB associated with both cytoplasmic membrane and cell wall fractions (Figure 3. A). It is unlikely that detection of DivlB in the cell wall fraction was due solely to contamination with unfractionated cells and/or membranes, as immunoblot analysis using antiserum against S. aureus YneS, a known membrane-bound protein (J. Garcia-Lara, unpublished) showed only minimal detection in the cell wall fraction. Bacterial two-hybrid analysis has previously indicated that DivlB is a component of the S. aureus divisome (Steele et al., 2011). Initial attempts to determine the subcellular localisation of DivlB utilised a C-terminal GFP fusion protein (ALB2; divlB-gfp pGL485). Unexpectedly, no obvious midcell localisation of DivlB-GFP was observed. Instead, two or three discrete peripheral foci on each cell, or each hemisphere of dividing cells, were detected (Figure 3.B). A line of fluorescence was also sometimes observed that connected two of the peripheral foci. It may be that this localisation pattern is due to the degradation of GFP due to fusion to the C terminus of DivlB and thus export outside the cytoplasm. However, immunofluorescence microscopy with a-DivlB antibodies showed a similar localisation pattern at that seen for DivlB-GFP (data not shown).

To fully confirm localisation of S. aureus DivlB, and to exclude any potential polar effects on downstream genes due to expression of the fusion proteins, an N-terminal YFP fusion protein was constructed. Strain x (SH100 AdivlB geh::P_Spac eYFP-divlB pGL485) expresses a single copy of eYFP-divlB under the control of P_{S a}c ectopically inserted at lipase using the pCL84 integrase system (Lee et al., 1991). YFP-DivlB was found to localise in a range of different patterns, including a two foci or line of fluorescence at the presumptive midcell, as single foci at the cell membrane, or as uniform fluorescence throughout the membrane of the cell (Figure 3.C). These results confirm the localisation patterns observed using DivlB-GFP and immune-localisation, suggesting that DivlB localisation at midcell in S. aureus may only be transient.

Example 3

DivlB is essential for S. aureus growth

S. aureus divlB, SAOUHSC_01 148, was identified to be putatively essential by a high density transposon screen for genes important for cell viability (Chaudhuri et al., 2009). Bioinformatic analysis of the S. aureus divlB chromosomal regions indicated that the gene is part of the dew cluster and is located directly upstream of ftsA and ftsZ (Figure 4. A). Initial attempts to confirm essentiality of divlB involved construction of a S. aureus conditional mutation using pAISHI (Aish, 2003), resulting in strain ALB14 (SH1000 P_Spac- divIBb' pGL485) which carries a truncated copy of divlB under the control of the native promoter and a full-length copy of the gene under the control of the Spac promoter (Yansura and Henner, 1984). A control strain, ALB13 (SH1000 P_Spac-divlB pGL485), was also constructed which carries full-length divlB under the control of the native promoter in addition to an IPTG-inducible copy of the gene under the control of P_{S a}c- This strain allowed observation of potential polar effects on ftsAZ when grown in the absence of inducer, as divlB and downstream genes will not be expressed from P_Spac whilst a full- length copy of divlB will still be expressed from the native promoter. It was found that in the absence of IPTG inducer, ALB13 was not impaired in growth rate compared to wild- type, although a larger proportion of cells showed a cell diameter >1.5 μηι compared to wild-type cells (data not shown). Since ftsZ is known to be essential for S. aureus division, with ftsZ depletion resulting in cell enlargement and eventual lysis (Pinho and Errington, 2003), there may be leaky expression from the Spac promoter. It cannot be ruled out that S. aureus ftsZ is expressed from a separate promoter(s) to high enough levels to support growth in the absence of upstream promoters; characterisation of the region upstream of B. subtilis ftsA demonstrated that the ftsAZ operon is controlled by three promoters (Gonzy-Treboul et al, 1992), whilst in E.coli it was found that 7 promoters located in the coding regions of the immediately adjacent upstream ddlB, ftsQ and ftsA genes provide only 33 % of total ftsZ transcription (Flardh et al, 1998) and expression of ftsZ is dependent, but not exclusively, on promoters present at the 5' end of the dew cluster (Mengin-Lecreulx et al., 1998). Thus, it was found that control of divlB at its native locus has polar effects on the downstream genes ftsA and ftsZ, which are known to have essential roles in cell division (Beall and Lutkenhaus, 1991 , 1992). Furthermore, due to the complexity of transcription of the dew cluster, the role of divlB could not be established using this method.

To overcome this, and to determine the role of divlB, a conditional mutant was constructed where a full-length copy of divlB under the control of P_{S a}c was inserted ectopically at the geh locus, allowing an in frame deletion of the gene from its native chromosomal location without disruption of expression of downstream genes (Figure 4.B). To ensure minimal expression from P_Spac in the absence of inducer, lad was constitutively overexpressed from a multicopy plasmid, pGL485 (Cooper et al, 2009), resulting in strain ALB27 {geh::P_Spac-divlB AdivlB pGL485). ALB27 did not grow in the absence of inducer (IPTG), whereas in the presence of IPTG ALB27 had a growth rate comparable to wild-type strain VF17 (SH1000 pGL485) on both solid and in liquid media (Figure 4.C). ALB27 (geh::P_Spac-divlB AdivlB pGL485) was also unable to grow on agar plates in the absence of IPTG when incubated at 30 °C (data not shown). Therefore, divlB is essential for growth of S. aureus. Example 4

Depletion of DivlB results in increased cell size To investigate the effect of DivlB depletion on cellular morphology, ALB27 (geh::P_Spac- divlB AdivlB pGL485) was examined following growth in the absence or presence of the inducer IPTG. In the presence of inducer, cells showed a similar morphology to wild-type cells (Figure 5. A). However, after 2 h incubation in the absence of inducer, ALB27 cells showed an increased cell size. It is important to note that this morphology differs to that previously observed for S. aureus depleted of FtsZ (Pinho and Errington, 2003) or EzrA (Steele et al., 2011), which results in very large spherical single cells. DivlB-depleted S. aureus cells showed a range of phenotypes, including misplacement of septa resulting in 'hamburger' cells due to initiation of new rounds of septum formation in parallel planes without the completion of previous rounds of septation, bulging of the cell wall and eventual lysis (Figure 5. A). Measurement of cells found that in the presence of 1 mM IPTG, the mean cell diameter of ALB27 was similar to wild-type VF17 cells (mean diameter = 1 ± 0.2 μηι, n = 768 and 0.9 ± 0.1 μηι, n = 363, respectively). In the absence of inducer, cells showed an increased cell size (mean diameter = 1.5 ± 0.4 μηι, n = 980). A small proportion of ALB27 cells showed an increased cell size (> 1.25 μηι) even at 1 mM IPTG, indicating that expression of DivlB from the Spac promoter doesn't fully restore cellular morphology. However, this phenotypic change was most notable in the absence of inducer, with a high proportion of very large cells up to 3.5 μηι in diameter seen (Figure 5.B). Western blot analysis shows undetectable levels of DivlB after growth in the absence of inducer (Figure 5.C), indicating the observed morphology is due to depletion of DivlB.

Example 5 DivlB is required for completion, but not initiation, of septum formation

Previous work has shown that S. aureus synthesises cell wall specifically at the septum, and that nascent cell wall synthesis is dispersed or does not occur in the absence of early components of the divisome (Pinho and Errington, 2003; Steele et al., 201 1). To investigate if DivlB plays a role in the synthesis of cell wall, a fluorescent derivative of vancomycin (Van-FI) was used to label nascent peptidoglycan in DivlB-depleted cells. Almost all wild-type S.aureus cells (VF17; SH 1000 pGL485) and ALB27 (geh::P_Spac-divlB AdivlB pGL485) grown in the absence or presence of IPTG showed septal peptidoglycan synthesis (Figure 6. A). However, different staining morphologies were observed for VF17 and ALB27 grown in the presence of inducer compared to ALB27 cells grown in the absence of IPTG. 48 % of VF17 cells and 43 % of ALB27 cells grown in the presence of IPTG showed either a ring or line of fluorescence at midcell, and 23 % and 22 %, respectively, showed an 'x' or y staining pattern, characteristic of separating newly- formed daughter cells (Figure 6.B, Turner et al., 2010). A large proportion (75 %) of ALB27 cells grown in the absence of inducer also showed a midcell staining pattern. In addition, 13 % of DivlB-depleted cells showed multiple or aberrant fluorescent rings. These unusual staining patterns were observed exclusively in cells > 1.25 μηι, indicating misplacement of the cell wall biosynthesis machinery. Further analysis of midcell staining found that 72 % and 52 % of VF17 and induced ALB27 cells showed a ring of fluorescence at the division site which corresponds to a ring of new peptidoglycan, and 28 % and 33 % (VF17 and ALB27, respectively) showed a fluorescent line across the cell, corresponding to a plate of nascent peptidoglycan that is the completed septum (Figure 6.C). In the absence of IPTG, ALB27 cells showed a ring of fluorescence that appeared to be equivalent to the cell diameter. Only a small proportion of DivlB-depleted cells appeared to form complete septa (12 %). Growth of S. aureus has been proposed to occur in between cell division events via specific hydrolysis of existing cell wall material (Turner et al., 2010). A distinct ring of nascent peptidoglycan between 2 cells was also often observed, indicating that cells are undergoing hydrolytic growth of the cell wall in the absence of the formation of complete septa. Thus, in the absence of DivlB, initiation of septum formation is not affected, resulting in the synthesis of a large 'band' (piecrust) of nascent peptidoglycan at midcell. However the ensuing formation of the septal plate is blocked.

Scanning electron microscopy of ALB27 (geh::P_Spac-divlB AdivlB pGL485) grown in the absence of IPTG revealed a band of cell wall at midcell which was not detectable in wild- type cells (VF17) or ALB27 cells grown in the presence of IPTG (Fig 7. A), and may represent the piecrust. This is likely due to the continued hydrolytic growth and turnover of the existing cell wall of DivlB-depleted cells in the absence of new septum formation, revealing cell wall architecture not normally observed in wild-type cells. Transmission electron microscopy of DivlB-depleted cells also confirmed the misplacement of septa, resulting in more than one initiation site within dividing cells, bulging of the cell wall and cell lysis (Fig 7. B).

To investigate the architecture of the cell wall in the absence of DivlB in more detail, atomic force microscopy (AFM) of purified sacculi of ALB27 (geh::P_Spac-divlB AdivlB pGL485) cells grown in the absence of inducer was performed. Thick bands of peptidoglycan were observed, confirming the formation of piecrusts in cells depleted of DivlB (Fig 7C). Incomplete septa were also occasionally observed, and may represent cells that were at different stages of the cell cycle when cell division was blocked by depletion of DivlB. Thus, investigation of the macromolecular architecture of the cell wall in the absence of DivlB confirms the results observed for fluorescence microscopy, resulting in the initiation of septation and the formation of the piecrust. However, completion of septum formation is severely affected in the absence of DivlB.

Example 6

Localisation of cell division proteins in the absence of DivlB

The dramatic increase in cell size and misplacement of septa in S. aureus cells depleted of DivlB suggests that recruitment of the divisome to the midcell may be altered in the absence of this protein. The effect of DivlB depletion on the ability of divisome components to localise to midcell was therefore investigated.

In B. subtilis, EzrA localises to the midcell in an FtsZ-dependent manner where it is thought to be a negative regulator of Z ring formation (Levin et al., 1999). Time-lapse microscopy has shown that EzrA localises concomitantly with FtsZ, with a time delay of at least 20% of the cell cycle before late proteins, including DivlB, assemble at midcell (Gamba et al., 2009). Previous analysis of the role of EzrA in S. aureus has shown that the protein likely acts as a scaffold for the assembly of the divisome (Steele et al., 2011). It was therefore investigated if depletion of DivlB, a late division protein, affected the localisation of the early protein EzrA in S. aureus. Localisation of EzrA in VF104 (ezrA- GFP+ pGL485) and ALB30 (ezrA-GFP+ geh::P_Spac-divlB AdivlB pGL485) was determined using a C-terminal GFP+ fusion. Fluorescence was detected as a ring or line at the septum in almost all VF104 cells and ALB30 grown in the presence of IPTG (Figure 8.A). Midcell localisation of EzrA-GFP+ was also observed for the majority of ALB30 cells grown in the absence of IPTG with a cell diameter < 1.25 μηι (Figure 8.B). However, for ALB30 cells with a diameter > 1.25 μηι, a striking localisation pattern was observed, with fluorescence almost exclusively observed as multiple or aberrantly- formed rings. Interestingly, EzrA-GFP+ ring size appeared to be equivalent to the cell diameter for large DivlB-depleted cells. Furthermore, the localisation pattern of EzrA- GFP+ suggests that EzrA is still recruited to midcell, perhaps through interactions with FtsZ.

Recruitment of all known division proteins to the midcell occurs in an FtsZ-dependent manner (Errington et al., 2003). In order to determine FtsZ localisation in the absence of DivlB, and to investigate if EzrA is recruited to midcell in an FtsZ-dependent DivlB- independent manner, co-localisation of EzrA-GFP+ and FtsZ in ALB33 (spa::kan ezrA- GFP+ geh::P_Spac-divlB AdivlB pGL485) in the presence and absence of IPTG was performed using a-S. aureus FtsZ. It was found that FtsZ and EzrA-GFP+ co-localised in a ring at midcell in the control strain ALB32 {spa::kan ezrA-GFP+ pGL485) and in ALB33 (spa::kan ezrA-GFP+ geh::P_Spac-divlB AdivlB pGL485) grown in the presence of IPTG (Figure 8.C). Additionally, FtsZ immunofluorescence in ALB33 cells grown in the absence of inducer showed the formation of large, sometimes aberrant, midcell rings which coincided with EzrA-GFP+ localisation. Thus, whilst FtsZ can polymerise into the Z ring and recruit EzrA to midcell in the absence of DivlB, constriction of the Z ring and progression of the division cycle is blocked.

Although ezrA in not essential in B. subtilis, deletion of ezrA in combination with gpsB results in severe defects in lateral and septal peptidoglycan synthesis as a result of perturbed PBP1 localisation (Claessen et ai, 2008). Direct interactions have been observed between EzrA and GpsB in both B. subtilis and S. aureus (Claessen et ai, 2008; Steele et ai, 201 1). It was therefore investigated if GpsB showed a similar localisation pattern to EzrA in DivlB-depleted S. aureus using a C-terminal GpsB-GFP+ fusion protein. GpsB-GFP+ fluorescence was observed as a line or ring in the majority of wild- type (VF94, gpsB-GFP+ pGL485) and ALB31 (gpsB-GFP+ geh::P_Spac-divlB AdivlB pGL485) cells grown in the presence of IPTG (Figure 8.D). A bright focus of fluorescence was also often observed between two daughter cells that were undergoing separation, indicating that GpsB remains at the site of division after septum formation is complete. In ALB31 cells grown in the absence of inducer, a larger proportion of cells showed a dispersed fluorescence pattern compared to VF94 (33 % compared to 8 %, respectively; Figure 8.E). Dispersed localisation of GpsB-GFP+ in DivlB-depleted cells was independent of cell size, indicating that, unlike EzrA, DivlB is required for localisation of GpsB at midcell.

Depletion of DivlB in S. aureus cells does not affect initiation of septation, but results in a cessation of completion of septum formation. To investigate if the inability to form complete septa in the absence of DivlB is due to mislocalisation of cell wall synthetic enzymes (PBPs), a fluorescent derivative of penicillin, Bocillin 650/665, was used. S. aureus encodes four PBPs, 3 of which have previously been shown to localise to midcell in wild-type cells (Atilano et ai, 2010; Pereira et ai, 2007; Pinho and Errington, 2005). Midcell localisation of the PBPs was observed for both control VF17 (SH1000 pGL485) cells and ALB27 (geh::P_Spac-divlB AdivlB pGL485) cells grown in the presence and absence of IPTG (Figure 8.F). Staining of nascent cell wall with Van-FI revealed that the PBPs localised at the leading edge of forming septa. Furthermore, PBPs were located to aberrant rings in DivlB-depleted cells. Thus the inability of S. aureus cells to complete septum formation is not due to mislocalisation of cell wall synthetic enzymes, but due to depletion of DivlB.

Claims

1. A monovalent or multivalent vaccine or immunogenic composition comprising a polypeptide characterized by: i) a domain that binds bacterial cell wall peptidoglycan; ii) is not a polypeptide that comprises the amino acid sequences as set forth in SEQ ID NO: 1 or 2;

iii) has an amino acid sequence comprising or consisting essentially of the amino acid sequence set forth in SEQ I D NO: 3, 4 or 5; and iv) a polypeptide comprising an amino acid sequence as set forth in SEQ I D NO: 3, 4 or 5 which sequence is modified by addition deletion or substitution of at least one amino acid residue wherein said modified sequence retains or has enhanced peptidoglycan binding.

2. The composition according to claim 1 wherein said polypeptide comprises the amino acid sequence set forth in SEQ ID NO: 3, 4 or 5.

3. The composition according to claim 1 or 2 wherein said composition includes an adjuvant and/or carrier.

4. The composition according to claim 3 wherein said adjuvant is selected from the group consisting of: cytokines selected from the group consisting of GMCSF, interferon gamma, interferon alpha, interferon beta, interleukin 12, interleukin 23, interleukin 17, interleukin 2, interleukin 1 , TGF, TNFa, and TNFfi.

5. The composition according to claim 3 wherein said adjuvant is a TLR agonist such as CpG oligonucleotides, flagellin, monophosphoryl lipid A, poly l:C and derivatives thereof.

6. The composition according to claim 3 wherein said adjuvant is a bacterial cell wall derivative such as muramyl dipeptide (MDP) and/or trehalose dicorynomycolate (TDM).

7. The composition according to claim 3 wherein said adjuvant is an aluminium based adjuvant comprising one or more aluminium salts.

8. The composition according to claim 7 wherein said aluminium salt is aluminium phosphate or aluminium hydroxide.

9. The composition according to any one of claims 3 to 8 wherein said adjuvant is a gel based adjuvant.

10. The composition according to any one of claims 3 to 9 wherein said composition comprises two or more adjuvants.

11. The composition according to any one of claims 1 to 10 wherein said vaccine composition is adapted for administration as a nasal spray.

12. The composition according to claim 1 1 wherein said vaccine composition is provided in an inhaler and delivered as an aerosol.

13. The composition according to any one of claims 1 to 12 that includes at least one additional anti-bacterial agent.

14. The composition according to claim 13 wherein said agent is a second different vaccine and/or immunogenic agent.

15. A composition according to any one of claims 1 to 14 for use in the treatment of microbial infections or conditions that result from microbial infections.

16. The composition according to claim 15 wherein said microbial infection is a staphylococcal infection.

17. A method to immunize a subject comprising vaccinating said subject with an effective amount of the vaccine composition according to any one of claims 1 to 16.

18. The method according to claim 17 wherein said subject is a human.

19. The method according to claim 17 wherein said subject is a non-human animal,

20. The method according to claim 19 wherein said non-human animal is a livestock animal.

21. The method according to claim 20 wherein said livestock animal is vaccinated against bacterial mastitis caused by staphylococcal bacterial cells.

22. The method according to claim 21 wherein said livestock animal is a caprine animal.

23. The method according to claim 21 wherein said livestock animal is a bovine animal.

24. An immunogenic or vaccine composition comprising two or more different polypeptides selected from the group consisting of:

i) a polypeptide comprising or consisting essentially of the amino acid sequence set forth in SEQ ID NO: 3, 4 or 5; ii) a polypeptide comprising an amino acid sequence as set forth in SEQ ID NO: 3, 4 or 5 which sequence is modified by addition deletion or substitution of at least one amino acid residue wherein said modified sequence retains or has enhanced peptidoglycan binding;

iii) a polypeptide comprising or consisting of the amino acid sequence as set forth in SEQ ID NO: 16 or 17.

25. The composition according to claim 24 wherein said composition comprises: i) a polypeptide comprising or consisting essentially of the amino acid sequence set forth in SEQ ID NO: 3, 4 or 5; and

26. An immunogenic or vaccine composition according to claim 24 or 25 for use in the treatment of a staphylococcal infection.

27. The composition according to claim 26 wherein said staphylococcal infection is a staphylococcus aureus infection.

28. The composition according to claim 26 wherein said staphylococcal infection is a staphylococcus epidermidis infection.

29. The composition according to any one of claims 1 to 16 or 24 to 28 wherein said staphylococcal infection is caused by an antibiotic resistant staphylococcal cell.