WO2016050819A1 - Method for preparing an acrylamide solution having a low acrylic acid concentration - Google Patents

Abstract

The present invention relates to methods for preparing an aqueous acrylamide solution having a low acrylic acid concentration. In addition, the present invention relates to methods for reducing the acrylic acid concentration of an aqueous acrylamide solution. The methods involve a bioconversion of acrylonitrile to acrylamide in the presence of a biocatalyst. In these methods a biocatalyst is employed which is contacted with urea. Also provided is an aqueous acrylamide solution which is obtained by the methods of the present invention. Furthermore, the present invention is related to an acrylamide homopolymer or copolymer obtained by polymerizing the acrylamide of the aqueous solution. The present invention also relates to the use of urea in the preparation of an aqueous acrylamide solution by a bio-based process where acrylonitrile is converted to acrylamide using a biocatalyst.

Description

Method for preparing an acrylamide solution having a low acrylic acid concentration

The present invention relates to methods for preparing aqueous acrylamide solutions having a low acrylic acid concentration, aqueous acrylamide solutions obtainable by such methods, and acrylamide homopolymers or copolymers obtainable by polymerizing such acrylamide. In addition, the present invention is also directed to methods for reducing the acrylic acid concentration of aqueous acrylamide solutions. The present invention is further directed to the use of urea for preparing aqueous acrylamide solutions and the use of urea for reducing the acrylic acid concentration of aqueous acrylamide solutions.

Polyacrylamide is widely used as flocculants, as thickener in the paper industry, as additive in tertiary oil recovery, and many other fields. The raw material for polyacrylamide is typically its monomer acrylamide. In principal, there exist two different methods to produce acrylamide in industrial scales: Chemical synthesis and biological synthesis, wherein the biological synthesis methods are more and more on the rise due to milder reaction conditions and inherent process safety. Due to the milder reaction conditions, the absence of copper catalyst and the quantitative conversion of the nitrile, expensive downstream processing steps such as distillation or ion exchange can be avoided in the biological synthesis, thus resulting in cheaper plants with drastically reduced plant footprint.

Both synthesis methods use acrylonitrile as starting substance. While the chemical synthesis method uses copper catalysts (e.g., US4048226, US3597481 ), the biological synthesis method (also known as bio-based method) employs biocatalysts to hydrate (i.e. to convert) acrylonitrile in order to obtain acrylamide. Generally, such biocatalysts are microorganisms which are able to produce (i.e. which encode) the enzyme nitrile hydratase (IUBMB nomenclature as of September 30, 2014: EC 4.2.1.84; CAS-No. 2391-37-5; also referred to as, e.g., NHase). Nitrile hydratase producing microorganisms are largely distributed in the environment and comprise, inter alia, representatives of the species Rhodococcus rhodochrous, Rhodococcus pyridinovorans, Rhodococcus erythropolis, Rhodococcus equi, Rhodococcus ruber, Rhodococcus opacus, Aspergillus niger, Acidovorax avenae, Acidovorax facilis, Agrobacterium tumefaciens, Agrobacterium radiobacter, Bacillus subtilis, Bacillus pallidus, Bacillus smithii, Bacillus sp BR449, Bradyrhizobium oligotrophicum, Bradyrhizobium diazoefficiens, Bradyrhizobium japonicum, Burkholderia cenocepacia, Burkholderia gladioli, Klebsiella oxytoca, Klebsiella pneumonia, Klebsiella variicola, Mesorhizobium ciceri, Mesorhizobium opportunistum, Mesorhizobium sp F28, Moraxella, Pantoea endophytica, Pantoea agglomerans, Pseudomonas chlororaphis, Pseudomonas putida, Rhizobium, Rhodopseudomonas palustris, Serratia liquefaciens, Serratia marcescens, Amycolatopsis, Arthrobacter, Brevibacterium sp CH1, Brevibacterium sp CH2, Brevibacterium sp R312, Brevibacterium imperiale, Corynebacterium nitrilophilus, Corynebacterium pseudodiph teriticum, Corynebacterium glutamicum, Corynebacterium hoffmanii, Microbacterium imperiale, Microbacterium smegmatis, Micrococcus luteus, Nocardia globerula, Nocardia rhodochrous, Pseudonocardia thermophila, Trichoderma, Myrothecium verrucaria, Aureobasidium pullulans, Candida famata, Candida guilliermondii, Candida tropicalis, Cryptococcus flavus, Cryptococcus sp UFMG- Y28, Debaryomyces hanseii, Geotrichum candidum, Geotrichum sp JR1 , Hanseniaspora, Kluyveromyces thermotolerans, Pichia kluyveri, Rhodotorula glutinis, Comomonas testosteroni, Pyrococcus abyssi, Pyrococcus furiosus, and Pyrococcus horikoshii. (see, e.g., Prasad, Biotechnology Advances (2010), 28(6): 725-741 ; FR2835531 ). The enzyme nitrile hydratase is either iron- or cobalt-dependent (i.e. it possesses either an iron or a cobalt atom coordinated in its activity center) which is particularly characterized by its ability to catalyze conversion of acrylonitrile to obtain acrylamide by hydrating acrylonitrile (Kobayashi, Nature Biotechnology (1998), 16: 733 - 736). The product of a biological synthesis method of converting acrylonitrile to acrylamide is a solution of acrylamide in water. However, in general the obtained aqueous acrylamide solution further contains acrylic acid, which is formed as a byproduct during the bioconversion.

Acrylamide is used as a monomer to form polymers of acrylamide. For the polymerization reactions, aqueous acrylamide solutions, which have been prepared by a biological synthesis method, can be used.

However, it has been found that acrylic acid, which is present in the aqueous acrylamide solutions used for the polymerization reactions, leads to reduced performance of the resulting acrylamide polymers. More specifically, the presence of acrylic acid can significantly impair the physical properties of the acrylamide polymer material, which e.g. leads to a reduced solubility and performance in various applications such as water treatment, paper making, oil recovery or mining. Thus, there is a need for biocatalytic methods of preparing aqueous acrylamide solutions having a low concentration of acrylic acid.

This objective technical problem has been overcome by the present invention as defined in the claims and as described and exemplified herein below.

The present invention relates to a method for preparing an aqueous acrylamide solution, wherein the method comprises the following steps:

(a) contacting a biocatalyst capable of converting acrylonitrile to acrylamide with urea;

(b) combining the following components (i) to (iii) in a reactor to obtain a composition for bioconversion:

(i) the biocatalyst obtained in step (a);

(ii) acrylonitrile;

(iii) water; and

(c) performing a bioconversion on the composition obtained in step (b).

As has surprisingly been found in context with the present invention and as described and exemplified in any one of the methods provided above and below, urea is capable of significantly decreasing the amount of acrylic acid which is formed as a byproduct during the bioconversion of acrylonitrile to acrylamide. Acrylic acid is an undesired byproduct in the bioconversion of acrylonitrile to acrylamide as it may have a negative impact on downstream processing of acrylamide, e.g. on the production of acrylamide polymers. Since the present invention allows for preparation of aqueous acrylamide solutions having a reduced concentration of acrylic acid, in case that such aqueous acrylamide solutions are used for homopolymerization or copolymerization reactions, also the obtained acrylamide homopolymers or copolymers have a reduced content of acrylic acid. Such acrylamide homopolymers or copolymers exhibit improved physical properties, such as solubility, and performance.

Without wishing to be bound by any theory, it can be assumed that urea may inhibit the activity of amidase. Amidase is an enzyme which is capable of catalyzing the conversion of acrylamide to acrylic acid and therefore effects an increase of the acrylic acid concentration. Hence, by inhibiting amidase the conversion of acrylamide to acrylic acid is suppressed. As a consequence, the acrylic acid concentration of an aqueous acrylamide solution obtained in any one of the methods described herein, wherein the biocatalyst is contacted with urea, is reduced. As has further been found in context with the present invention, urea has no negative impact on the reaction time. It may be therefore assumed that urea does not negatively influence nitrile hydratase (NHase), which is the enzyme that promotes the conversion of acrylonitrile to acrylamide in the biocatalytic process of acrylamide production.

Accordingly, the present invention further relates to methods for reducing the acrylic acid concentration of an aqueous acrylamide solution, wherein said aqueous acrylamide solution is prepared by a biocatalytic process where acrylonitrile is converted to acrylamide using a biocatalyst, said method comprising the following steps:

(a) contacting a biocatalyst capable of converting acrylonitrile to acrylamide with urea;

(b) combining the following components (i) to (iii) in a reactor to obtain a composition for bioconversion:

(i) the biocatalyst obtained in step (a);

(ii) acrylonitrile;

(iii) water; and

(c) performing a bioconversion on the composition obtained in step (b).

The method of contacting the biocatalyst with urea of step (a) of any one of the methods described herein above and below is not particularly limited. Thus, in case that the contacting of the biocatalyst with urea is not further specified, any method known in the art may be used, which is suitable for contacting the biocatalyst with urea. In context of the present invention the term "contacting" the biocatalyst with urea must not be construed as limiting the methods and uses described and provided herein to cases where urea is actively contacted as such with the biocatalyst. That is, the term "contacting" in this context also comprises cases where urea is brought into contact with the biocatalyst together with other components, e.g. together with water.

In any one of the methods described herein, in step (a) the biocatalyst is contacted with urea. In order to obtain a desirably low acrylic acid concentration it is preferred that in any one of the methods described herein above and below the contacting of the biocatalyst with urea is carried out before the biocatalyst is employed in the bioconversion of acrylonitrile to acrylamide, i.e. before the biocatalyst is contacted with the acrylonitrile. With this respect, contacting of the biocatalyst with urea in step (a) may e.g. be performed outside of the reactor. The biocatalyst obtained by the contacting with urea in step (a) is then added to the reactor and combined with acrylonitrile and water in step (b). Alternatively, the contacting of the biocatalyst with urea of step (a) may be performed inside of the reactor. After the contacting of the biocatalyst with urea has been carried out inside of the reactor, the biocatalyst obtained in step (a) is then combined with acrylonitrile and water by adding these components in step (b).

In any one of the methods described herein above and below the contacting of the biocatalyst with urea of step (a) may comprise contacting the biocatalyst with urea after cultivation. For example, after cultivation a biocatalyst, which optionally may have been dried, may be used and brought intentionally into contact with urea. Thus, in case that the biocatalyst is contacted with urea after cultivation, the contacting may be carried out as an active step. "Active step" in particular means that the biocatalyst and urea are brought into contact intentionally. As a non- limiting example, in any one of the methods described herein above and below, the biocatalyst may be contacted with urea by suspending the biocatalyst with a solution of urea. For this purpose, in general any solvent which is suitable to dissolve urea can be used. Preferably, water is used as the solvent such that the biocatalyst is suspended with an aqueous solution of urea. According to another non-limiting example for contacting the biocatalyst with urea, in any one of the methods described herein solid urea may be added to a suspension or solution of the biocatalyst, e.g. a suspension of the biocatalyst in water. As used with respect to any one of the methods described herein above and below, the term "cultivation" denotes a process, wherein the biocatalyst, which may be, for example, a microorganism, is grown, preferably in a(n) (aqueous) medium. For example, the cultivation as used herein comprises addition of oxygen (e.g., by aerating the cultivation medium with air) and may preferably further comprise the presence of C- and N-sources in the medium. Such cultivation is generally carried out under conditions wherein the biocatalyst is present in a fermentation broth comprising a culture medium. The specific culture medium and conditions of cultivation are not particularly limited, and any suitable method, culture medium and/or condition known for the cultivation of a biocatalyst may be used. As used with respect to any one of the methods described herein above and below, the term "after cultivation" in particular refers to the situation that the biocatalyst has been separated from the fermentation broth by any method suitable therefore, such as e.g. filtration and/or centrifugation. The term "separated" does not necessarily denote a complete separation of the biocatalyst from the culture medium. Thus, the biocatalyst may comprise residual parts of the fermentation broth and/or the culture medium even after separation. Alternatively or in addition to contacting the biocatalyst with urea after cultivation, in any one of the methods described herein above and below, the contacting of the biocatalyst with urea of step (a) may comprise contacting the biocatalyst with urea during cultivation. "During cultivation" in particular means that a contact between the biocatalyst and the urea is provided within the fermentation broth used in the cultivation. With this respect, certain amounts of urea may be present in the fermentation broth during cultivation. It is thus possible, that certain amounts of urea are contained in a fermentation broth containing the biocatalyst which is then transferred into the reactor. Preferably, in case that the biocatalyst is taken from a fermentation broth containing urea, the biocatalyst is not washed, such that residual amounts of urea may be transferred to the reactor. Also, residues of urea may still be connected to dried biocatalyst which may be added to the reactor. As a non-limiting option, in case that the biocatalyst is contacted with urea during cultivation, the biocatalyst may be further contacted with urea after cultivation. In particular, after cultivation the biocatalyst may be contacted with urea actively, which may be e.g. carried out by suspending the biocatalyst with a solution of urea or by adding solid urea to a suspension or solution of the biocatalyst as non-limiting examples.

The present invention also relates to a method for preparing an aqueous acrylamide solution, wherein the method comprises the following steps:

(a) contacting a biocatalyst capable of converting acrylonitrile to acrylamide with urea after cultivation, wherein said biocatalyst is essentially free of urea;

(b) combining the following components (i) to (iii) in a reactor to obtain a composition for bioconversion:

(i) the biocatalyst obtained in step (a);

(ii) acrylonitrile;

(iii) water; and

(c) performing a bioconversion on the composition obtained in step (b).

Preferably, a "biocatalyst being essentially free of urea" means in the context with any one of the methods described herein that the content of residual urea, which may e.g. derive from the cultivation, is 10 w/w % or less, preferably 5 w/w % or less, more preferably 2 w/w % or less and most preferably 1 w/w % or less, wherein the indications of w/w % each refer to 100 w/w % of the dry weight, in particular of the dry cell weight, of the biocatalyst. The biocatalyst may be taken directly from the fermentation broth and then be contacted with urea in a wet state. Alternatively, the biocatalyst may be dried before it is contacted with urea. According to a non- limiting example, a biocatalyst being essentially free of urea, in particular a biocatalyst having a residual content of urea of 10 w/w % or less, preferably of 5 w/w % or less, more preferably of 2 w/w % or less and most preferably of 1 w/w % or less, may be obtained by washing the biocatalyst. For example, the washing may be carried out using an aqueous medium, such as water or a buffer. Alternatively, a biocatalyst being essentially free of urea may be taken directly from the fermentation broth in case that urea has been degraded during cultivation.

The present invention is further related to a method for preparing an aqueous acrylamide solution, said method comprising the following steps:

(a) suspending a biocatalyst capable of converting acrylonitrile to acrylamide with a solution containing urea after cultivation of said biocatalyst;

(b) combining the following components (i) to (iii) in a reactor to obtain a composition for bioconversion:

(i) the suspension of the biocatalyst obtained in step (a);

(ii) acrylonitrile;

(iii) water; and

(c) performing a bioconversion on the composition obtained in step (b).

The term "bioconversion" as used in the context with any one of the methods of the present invention described herein above and below in in general denotes a reaction, wherein acrylonitrile is converted to acrylamide in the presence of water and a biocatalyst. The acrylamide is dissolved in the water, such that by any one of the methods described and provided herein an aqueous acrylamide solution is formed. As used herein, the term "composition" includes all components present in the reactor, such as, for example, the biocatalyst, acrylonitrile, acrylamide and water.

As used with regard to any one of the methods described herein above and below, the term "biocatalyst" comprises in particular microorganisms (e.g., bacteria or protozoic eukaryotes) and enzymes which are capable of converting acrylonitrile to acrylamide. Methods for determining the ability of a given biocatalyst (e.g., microorganism or enzyme) to convert acrylonitrile to acrylamide are well known in the art. As an example, in context with any one of the methods of the present invention, activity of a given biocatalyst to be capable of converting acrylonitrile to acrylamide in the sense of the present invention may be determined as follows: First reacting 100 μΙ of a cell suspension, cell lysate, dissolved enzyme powder or any other preparation containing the supposed biocatalyst with 875 μΙ of an 50 mM potassium phosphate buffer and 25 μΙ of acrylonitrile at 25 °C on an eppendorf tube shaker at 1 ,000 rpm for 10 minutes. After 10 minutes of reaction time, samples may be drawn and immediately quenched by adding the same volume of 1.4% hydrochloric acid. After mixing of the sample, cells may be removed by centrifugation for 1 minute at 10,000 rpm and the amount of acrylamide formed is determined by analyzing the clear supernatant by HPLC. For affirmation of a biocatalyst to be capable of converting acrylonitrile to acrylamide in context with the present invention, the concentration of acrylamide shall be between 0.25 and 1.25 mmol/l - if necessary, the sample has to be diluted accordingly and the conversion has to be repeated. The activity may then be deduced from the concentration of acrylamide by dividing the acrylamide concentration derived from HPLC analysis by the reaction time, which has been 10 minutes and by multiplying this value with the dilution factor between HPLC sample and original sample. Activities >5 U/mg dry cell weight, preferably >25 U/mg dry cell weight, more preferably >50 U/mg dry cell weight, most preferably >100 U/mg dry cell weight indicate the presence of a functional biocatalyst and are considered as biocatalyst capable of converting acrylonitrile to acrylamide in context with the present invention.

More specifically, by employing any one of the methods of the present invention, the acrylic acid concentration of the solution at the end of the bioconversion may be 1500 ppm or less, preferably 1200 ppm or less, more preferably 1000 ppm or less, further preferably 750 ppm or less, even more preferably 500 ppm or less, still more preferably 300 ppm or less, still more preferably 200 ppm or less and most preferably 100 ppm or less, wherein indications of ppm each relate to weight parts and are each referred to the total weight of the solution at the end of the bioconversion. With this respect, the term "end of the bioconversion" denotes in any one of the methods described herein that a substantially full conversion of acrylonitrile to acrylamide has been reached. "Substantially full conversion of acrylonitrile to acrylamide" means, in particular, that the content of acrylonitrile of the solution is 1000 ppm or less, preferably 500 ppm or less, more preferably 200 ppm or less and most preferably 100 ppm or less, wherein indications of ppm each relate to weight parts and are each referred to the total weight of the solution. The acrylic acid concentration of the solution at the end of the bioconversion and/or the content of acrylonitrile may be determined using HPLC. Preferably, an HPLC method is used as set forth below under the Examples. Accordingly, the present invention is also related to a method for preparing an aqueous acrylamide solution, wherein the method comprises the following steps:

(a) contacting a biocatalyst capable of converting acrylonitrile to acrylamide with urea;

(b) combining the following components (i) to (iii) in a reactor to obtain a composition for bioconversion:

(i) the biocatalyst obtained in step (a);

(ii) acrylonitrile;

(iii) water;

(c) performing a bioconversion on the composition obtained in step (b); and

(d) obtaining an aqueous acrylamide solution, wherein the acrylic acid concentration of the solution at the end of the bioconversion is 1500 ppm or less, preferably 1200 ppm or less, more preferably 1000 ppm or less, further preferably 750 ppm or less, even more preferably 500 ppm or less, still more preferably 300 ppm or less, still more preferably 200 ppm or less and most preferably 100 ppm or less, wherein indications of ppm each relate to weight parts and are each referred to the total weight of the solution at the end of the bioconversion.

In particular, the inventors have found that by carrying out any one of the methods of the present invention as described herein, the acrylic acid concentration may be reduced by at least 10 %, preferably by at least 15 %, more preferably by at least 20 %, even more preferably by at least 25 %, and most preferably by at least 35 % compared to a reference method. In this context, the reduction of the acrylic acid concentration as defined in the methods of the present invention is related to the final concentration of acrylic acid contained in an aqueous acrylamide solution prepared by any one of the methods of the present invention (i.e. with urea as described herein) compared to the final concentration of acrylic acid contained in an aqueous acrylamide solution not prepared by the methods of the present invention (i.e. without urea as described herein).

According to any one of the methods described herein, acrylonitrile is added to the reactor. With this respect, the acrylonitrile may be added continuously or intermittently. Addition of acrylonitrile may be at constant or variable feed rate or batch-wise. The acrylonitrile may be added in pure form or in solution. For example, an aqueous solution of acrylonitrile may be used.

In addition, in any one of the methods described and provided herein, water (component (iii)) is added to the reactor. The water may be added as such, be part of the biocatalyst as described herein, be part of an acrylonitrile solution as described herein, or otherwise be added. In case that the water is added as such, in general tap water or deionized water may be used. The water may also be part of an aqueous composition, such as an aqueous solution of a salt. In particular, a buffer may be employed. For step (b) of any one of the methods described and provided herein, it is not relevant in which order components (i) to (iii) are combined in the reactor. For example, in case that, as set out above, contacting of the biocatalyst with urea in step (a) is performed inside of the reactor, the biocatalyst obtained in step (a) is present in the reactor when acrylonitrile and water are added in step (b). Alternatively, e.g. in case that the contacting of the biocatalyst with urea of step (a) is performed outside of the reactor, in step (b) acrylonitrile and water may be placed in the reactor, and afterwards the biocatalyst obtained in step (a) may be added to the acrylonitrile and water.

The term "combining" as used herein with regard to step (b) does further not necessarily require that in step (b) an addition of water is carried out as an active step. Accordingly, water may be already present in step (a), and the water combined in step (b) may originate from step (a). In this case it is not required to further add water actively during step (b). For example, the biocatalyst may be mixed with urea and water in step (a), and no additional water is added in step (b). However, on the other hand, it is also possible that, although water originating from step (a) is already present, further water is added actively in step (b).

Regarding the amounts of the components which are combined, the biocatalyst, in particular the biocatalyst which has been contacted with urea in step (a), acrylonitrile and water may be combined in the reactor during any one of the methods described herein in a weight ratio of 0.001 to 0.5 w/w % of the biocatalyst, 22 to 45 w/w % of acrylonitrile and a balance to 100 w/w % of water; preferably of 0.005 to 0.2 w/w % of the biocatalyst, 26 to 42 w/w % of acrylonitrile and a balance to 100 w/w % of water; more preferably of 0.01 to 0.1 w/w % of the biocatalyst, 30 to 40 w/w % of acrylonitrile and a balance to 100 w/w % of water; most preferably of 0.015 to 0.065 w/w % of the biocatalyst, 35 to 39 w/w % of acrylonitrile and a balance to 100 w/w % of water, wherein in each case indications of w/w % are referred to the total weight (100 w/w %) of the combined weights of the biocatalyst, acrylonitrile and water combined in the reactor during any one of the methods described herein. Indications of w/w % of the ratio of the biocatalyst may denote in each case the ratio of the biocatalyst in terms of the dry weight of the biocatalyst, in particular in terms of the dry cell weight of the biocatalyst. The water, which forms the balance to 100 w/w %, is not particularly limited. For example, the water may be an aqueous composition, such as an aqueous solution of a salt. In particular, a buffer may be used. However, it is preferred that the water is tap water or deionized water.

Step (c) of any one of the methods described and provided herein represents the bioconversion step during which acrylonitrile is converted to acrylamide by the biocatalyst as described and exemplified herein. More specifically, in any one of the methods described herein, the bioconversion may be performed at 5 °C to 40 °C for 10 minutes to 48 hours, preferably at 5 °C to 35 °C for 10 minutes to 48 hours, more preferably at 15 °C to 30 °C for 10 minutes to 48 hours and most preferably at 20 °C to 28 °C for 10 minutes to 48 hours. In particular, such reaction temperatures are preferred from the viewpoint of high activity of the biocatalyst and reasonable reaction times. The actual time period to be applied for the bioconversion also depends on the desired acrylamide content of the aqueous acrylamide solution to be produced.

In accordance with any one of the methods of the present invention, the biocatalyst capable of converting acrylonitrile to acrylamide may be a microorganism which encodes the enzyme nitrile hydratase. With this regard, it is not relevant for the present invention whether the microorganism is naturally encoding nitrile hydratase, or whether it has been genetically modified to encode said enzyme, or whether a microorganism naturally encoding nitrile hydratase has been modified such as to be able to produce more and/or enhanced nitrile hydratase. As used herein, the expression "biocatalyst (e.g., microorganism) encoding (the enzyme) nitrile hydratase" or the like generally means that such a microorganism is generally also able to produce and stably maintain nitrile hydratase. That is, as used herein and as readily understood by the skilled person, a biocatalyst (e.g., a microorganism) to be employed in accordance with the present invention which (naturally or non-naturally) encodes nitrile hydratase is generally also capable of producing and stably maintaining nitrile hydratase. However, in accordance with the present invention, it is also possible that such microorganisms only produced nitrile hydratase during cultivation (or fermentation) of the microorganism - thus then containing nitrile hydratase - before being added to a reactor according to step (a) of any one of the methods described and provided herein. In such a case, it is possible that the microorganisms do not produce nitrile hydratase during the methods described and provided herein any more, but they act only via the nitrile hydratase units which they have produced before and which they still contain. As readily understood by the person skilled in the art, it is also possible that some nitrile hydratase molecules may leave the microorganism (e.g., due to lysis of the microorganism) and act freely in the solution as biocatalyst. As such, it also possible that the term "biocatalyst" as used herein encompasses the enzyme nitrile hydratase per se, as long as it is able to convert acrylonitrile to acrylamide as described and exemplified herein. In context with the present invention, it is also possible to directly employ nitrile hydratase as biocatalyst.

In context with the present invention, microorganisms naturally encoding nitrile hydratase, which can be used as biocatalyst in any one of the methods described herein, comprise species belonging to a genus selected from the group consisting of Rhodococcus, Aspergillus, Acidovorax, Agrobacterium, Bacillus, Bradyrhizobium, Burkholderia, Escherichia, Geobacillus, Klebsiella, Mesorhizobium, Moraxella, Pantoea, Pseudomonas, Rhizobium, Rhodopseudomonas, Serratia, Amycolatopsis, Arthrobacter, Brevibacterium, Corynebacterium, Microbacterium, Micrococcus, Nocardia, Pseudonocardia, Trichoderma, Myrothecium, Aureobasidium, Candida, Cryptococcus, Debaryomyces, Geotrichum, Hanseniaspora, Kluyveromyces, Pichia, Rhodotorula, Comomonas, and Pyrococcus. In preferred embodiments of the invention the biocatalyst is selected from bacteria of the genus Rhodococcus, Pseudomonas, Escherichia and Geobacillus.

Preferred biocatalysts to be employed in context with any one of the methods of the present invention comprise representatives of the genus Rhodococcus. Species suitable as biocatalyst to be employed in context with any one of the methods of the present invention may comprise, e.g., Rhodococcus rhodochrous (e.g., NCIMB 41 164, J1/FERM-BP 1478, M33 or M8), Rhodococcus pyridinovorans, Rhodococcus erythropolis, Rhodococcus equi, Rhodococcus ruber, Rhodococcus opacus, Aspergillus niger, Acidovorax avenae, Acidovorax facilis, Agrobacterium tumefaciens, Agrobacterium radiobacter, Bacillus subtilis, Bacillus pallidus, Bacillus smithii, Bacillus sp BR449, Bradyrhizobium oligotrophicum, Bradyrhizobium diazoefficiens, Bradyrhizobium japonicum, Burkholderia cenocepacia, Burkholderia gladioli, Escherichia coli, Geobacillus sp. RAPc8, Klebsiella oxytoca, Klebsiella pneumonia, Klebsiella variicola, Mesorhizobium ciceri, Mesorhizobium opportunistum, Mesorhizobium sp F28, Moraxella, Pantoea endophytica, Pantoea agglomerans, Pseudomonas chlororaphis, Pseudomonas putida, Rhizobium, Rhodopseudomonas palustris, Serratia liquefaciens, Serratia marcescens, Amycolatopsis, Arthrobacter, Brevibacterium sp CH1, Brevibacterium sp CH2, Brevibacterium sp R312, Brevibacterium imperiale, Brevibacterium casei, Corynebacterium nitrilophilus, Corynebacterium pseudodiph teriticum, Corynebacterium glutamicum, Corynebacterium hoffmanii, Microbacterium imperiale, Microbacterium smegmatis, Micrococcus luteus, Nocardia globerula, Nocardia rhodochrous, Nocardia sp 163, Pseudonocardia thermophila, Trichoderma, Myrothecium verrucaria, Aureobasidium pullulans, Candida famata, Candida guilliermondii, Candida tropicalis, Cryptococcus flavus, Cryptococcus sp UFMG- Y28, Debaryomyces hanseii, Geotrichum candidum, Geotrichum sp JR1 , Hanseniaspora, Kluyveromyces thermotolerans, Pichia kluyveri, Rhodotorula glutinis, Comomonas testosteroni, Pyrococcus abyssi, Pyrococcus furiosus, or Pyrococcus horikoshii.

According to an embodiment of any one of the methods of the present invention, the biocatalyst to be employed belongs to the species Rhodococcus rhodochrous. Particular examples for strains belonging to Rhodococcus rhodochrous which may be employed in context with any one of the methods described herein comprise NCIMB 41 164, J1 (FERM-BP 1478), M33 and M8.

Alternatively or in addition to Rhodococcus rhodochrous, the biocatalyst employed in any one of the methods described herein may be Rhodococcus pyridinovorans.

In context with the present invention, nitrile hydratase encoding microorganisms which are not naturally encoding nitrile hydratase may be genetically engineered microorganisms which naturally do not contain a gene encoding a nitrile hydratase but which have been manipulated such as to contain a polynucleotide encoding a nitrile hydratase (e.g., via transformation, transduction, transfection, conjugation, or other methods suitable to transfer or insert a polynucleotide into a cell as known in the art; cf. Sambrook and Russell 2001 , Molecular Cloning: A Laboratory Manual, CSH Press, Cold Spring Harbor, NY, USA), thus enabling the microorganisms to produce and stably maintain the nitrile hydratase enzyme. For this purpose, it may further be required to insert additional polynucleotides which may be necessary to allow transcription and translation of the nitrile hydratase gene or mRNA, respectively. Such additional polynucleotides may comprise, inter alia, promoter sequences, polyT- or polyU-tails, or replication origins or other plasmid-control sequences. In this context, such genetically engineered microorganisms which naturally do not contain a gene encoding a nitrile hydratase but which have been manipulated such as to contain a polynucleotides encoding a nitrile hydratase may be prokaryotic or eukaryotic microorganisms. Examples for such prokaryotic microorganisms include, e.g., representatives of the species Escherichia coli. Examples for such eukaryotic microorganisms include, e.g., yeast (e.g., Saccharomyces cerevisiae). In context of the present invention, the term "nitrile hydratase" (also referred to herein as NHase) generally means an enzyme which is capable of catalyzing the conversion (i.e. hydration) of acrylonitrile to acrylamide. Such an enzyme may be, e.g., the enzyme registered under IUBMB nomenclature as of September 30, 2014: EC 4.2.1.84; CAS-No. 2391 -37-5. However, the term "nitrile hydratase" as used herein also encompasses modified or enhanced enzymes which are, e.g., capable of converting acrylonitrile to acrylamide more quickly, or which can be produced at a higher yield/time-ratio, or which are more stable, as long as they are capable to catalyze conversion (i.e. hydration) of acrylonitrile to acrylamide. Methods for determining the ability of a given biocatalyst (e.g., microorganism or enzyme) for catalyzing the conversion of acrylonitrile to acrylamide are known in the art. As an example, in context with the present invention, activity of a given biocatalyst to act as a nitrile hydratase in the sense of the present invention may be determined as follows: First reacting 100 μΙ of a cell suspension, cell lysate, dissolved enzyme powder or any other preparation containing the supposed nitrile hydratase with 875 μΙ of an 50 mM potassium phosphate buffer and 25 μΙ of acrylonitrile at 25 °C on an eppendorf tube shaker at 1 ,000 rpm for 10 minutes. After 10 minutes of reaction time, samples may be drawn and immediately quenched by adding the same volume of 1.4% hydrochloric acid. After mixing of the sample, cells may be removed by centrifugation for 1 minute at 10,000 rpm and the amount of acrylamide formed is determined by analyzing the clear supernatant by HPLC. For affirmation of an enzyme to be a nitrile hydratase in context with the present invention, the concentration of acrylamide shall be between 0.25 and 1.25 mmol/l - if necessary, the sample has to be diluted accordingly and the conversion has to be repeated. The enzyme activity may then be deduced from the concentration of acrylamide by dividing the acrylamide concentration derived from HPLC analysis by the reaction time, which has been 10 minutes and by multiplying this value with the dilution factor between HPLC sample and original sample. Activities >5 U/mg dry cell weight, preferably >25 U/mg dry cell weight, more preferably >50 U/mg dry cell weight, most preferably >100 U/mg dry cell weight indicate the presence of a functionally expressed nitrile hydratase and are considered as nitrile hydratase in context with the present invention

In context with the present invention, the nitrile hydratase may be a polypeptide encoded by a polynucleotide which comprises or consists of a nucleotide sequence which is at least 70%, preferably at least 75%, more preferably at least 80%, more preferably at least 85%, more preferably at least 90%, more preferably at least 95%, more preferably at least 96%, more preferably at least 97%, more preferably at least 98%, more preferably at least 99%, more preferably at least 99,5%, and most preferably 100% identical to the nucleotide sequence of SEQ ID NO: 1 (alpha-subunit of nitrile hydratase of R. rhodochrous: GTGAGCGAGCACGTCAATAAGTACACGGAGTACGAGGCACGTACCAAGGCGATCGAAACC TTGCTGTACGAGCGAGGGCTCATCACGCCCGCCGCGGTCGACCGAGTCGTTTCGTACTAC GAGAACGAGATCGGCCCGATGGGCGGTGCCAAGGTCGTGGCCAAGTCCTGGGTGGACCC TGAGTACCGCAAGTGGCTCGAAGAGGACGCGACGGCCGCGATGGCGTCATTGGGCTATG CCGGTGAGCAGGCACACCAAATTTCGGCGGTCTTCAACGACTCCCAAACGCATCACGTGG TGGTGTGCACTCTGTGTTCGTGCTATCCGTGGCCGGTGCTTGGTCTCCCGCCCGCCTGGT ACAAGAGCATGGAGTACCGGTCCCGAGTGGTAGCGGACCCTCGTGGAGTGCTCAAGCGC GATTTCGGTTTCGACATCCCCGATGAGGTGGAGGTCAGGGTTTGGGACAGCAGCTCCGAA ATCCGCTACATCGTCATCCCGGAACGGCCGGCCGGCACCGACGGTTGGTCCGAGGAGGA GCTGACGAAGCTGGTGAGCCGGGACTCGATGATCGGTGTCAGTAATGCGCTCACACCGCA GGAAGTGATCGTATGA) and/or to the nucleotide sequence of SEQ ID NO: 3 (beta-subunit of nitrile hydratase of R. rhodochrous:

ATGGATGGTATCCACGACACAGGCGGCATGACCGGATACGGACCGGTCCCCTATCAGAAG GACGAGCCCTTCTTCCACTACGAGTGGGAGGGTCGGACCCTGTCAATTCTGACTTGGATG CATCTCAAGGGCATATCGTGGTGGGACAAGTCGCGGTTCTTCCGGGAGTCGATGGGGAAC GAAAACTACGTCAACGAGATTCGCAACTCGTACTACACCCACTGGCTGAGTGCGGCAGAAC GTATCCTCGTCGCCGACAAGATCATCACCGAAGAAGAGCGAAAGCACCGTGTGCAAGAGA TCCTTGAGGGTCGGTACACGGACAGGAAGCCGTCGCGGAAGTTCGATCCGGCCCAGATCG AGAAGGCGATCGAACGGCTTCACGAGCCCCACTCCCTAGCGCTTCCAGGAGCGGAGCCG AGTTTCTCTCTCGGTGACAAGATCAAAGTGAAGAGTATGAACCCGCTGGGACACACACGGT GCCCGAAATATGTGCGGAACAAGATCGGGGAAATCGTCGCCTACCACGGCTGCCAGATCT ATCCCGAGAGCAGCTCCGCCGGCCTCGGCGACGATCCTCGCCCGCTCTACACGGTCGCG TTTTCCGCCCAGGAACTGTGGGGCGACGACGGAAACGGGAAAGACGTAGTGTGCGTCGAT CTCTGGGAACCGTACCTGATCTCTGCGTGA), provided that the polypeptide encoded by said polynucleotide is capable of catalyzing hydration of acrylonitrile to acrylamide (i.e. has nitrile hydratase activity) as described and exemplified herein. Also in the context with the present invention, the nitrile hydratase may be a polypeptide which comprises or consists of an amino acid sequence which is at least 70%, preferably at least 75%, more preferably at least 80%, more preferably at least 85%, more preferably at least 90%, more preferably at least 95%, more preferably at least 96%, more preferably at least 97%, more preferably at least 98%, more preferably at least 99%, more preferably at least 99,5%, and most preferably 100% identical to the amino acid sequence of SEQ ID NO: 2 (alpha-subunit of nitrile hydratase of R. rhodochrous: VSEHVNKYTE YEARTKAI ET LLYERGLITP AAVDRVVSYY ENEIGPMGGA KVVAKSWVDP EYRKWLEEDA TAAMASLGYA GEQAHQISAV FNDSQTHHVV VCTLCSCYPW PVLGLPPAWY KSMEYRSRVV ADPRGVLKRD FGFDIPDEVE VRVWDSSSEI RYIVI PERPA GTDGWSEEEL TKLVSRDSMI GVSNALTPQE VIV) and/or to the amino acid sequence of SEQ ID NO: 4 (beta-subunit of nitrile hydratase of R. r odoc rous: MDGIHDTGGM TGYGPVPYQK DEPFFHYEWE GRTLSILTWM HLKGISWWDK SRFFRESMGN ENYVNEIRNSY YTHWLSAAE RILVADKIIT EEERKHRVQE ILEGRYTDRK PSRKFDPAQI EKAIERLHEP HSLALPGAEP SFSLGDKIKV KSMNPLGHTR CPKYVRNKIG EIVAYHGCQI YPESSSAGLG DDPRPLYTVA FSAQELWGDD GNGKDVVCVD LWEPYLISA), provided that said polypeptide is capable of catalyzing hydration of acrylonitrile to acrylamide as described and exemplified herein.

The level of identity between two or more sequences (e.g., nucleic acid sequences or amino acid sequences) can be easily determined by methods known in the art, e.g., by BLAST analysis. Generally, in context with the present invention, if two sequences (e.g., polynucleotide sequences or amino acid sequences) to be compared by, e.g., sequence comparisons differ in identity, then the term "identity" may refer to the shorter sequence and that part of the longer sequence that matches said shorter sequence. Therefore, when the sequences which are compared do not have the same length, the degree of identity may preferably either refer to the percentage of nucleotide residues in the shorter sequence which are identical to nucleotide residues in the longer sequence or to the percentage of nucleotides in the longer sequence which are identical to nucleotide sequence in the shorter sequence. In this context, the skilled person is readily in the position to determine that part of a longer sequence that matches the shorter sequence. Furthermore, as used herein, identity levels of nucleic acid sequences or amino acid sequences may refer to the entire length of the respective sequence and is preferably assessed pair-wise, wherein each gap is to be counted as one mismatch. These definitions for sequence comparisons (e.g., establishment of "identity" values) are to be applied for all sequences described and disclosed herein.

Moreover, the term "identity" as used herein means that there is a functional and/or structural equivalence between the corresponding sequences. Nucleic acid/amino acid sequences having the given identity levels to the herein-described particular nucleic acid/amino acid sequences may represent derivatives/variants of these sequences which, preferably, have the same biological function. They may be either naturally occurring variations, for instance sequences from other varieties, species, etc., or mutations, and said mutations may have formed naturally or may have been produced by deliberate mutagenesis. Furthermore, the variations may be synthetically produced sequences. The variants may be naturally occurring variants or synthetically produced variants or variants produced by recombinant DNA techniques. Deviations from the above-described nucleic acid sequences may have been produced, e.g., by deletion, substitution, addition, insertion and/or recombination. The term "addition^" refers to adding at least one nucleic acid residue/amino acid to the end of the given sequence, whereas "insertion" refers to inserting at least one nucleic acid residue/amino acid within a given sequence. The term "deletion" refers to deleting or removal of at least one nucleic acid residue or amino acid residue in a given sequence. The term "substitution" refers to the replacement of at least one nucleic acid residue/amino acid residue in a given sequence. Again, these definitions as used here apply, mutatis mutandis, for all sequences provided and described herein.

Generally, as used herein, the terms ..polynucleotide" and „nucleic acid" or „nucleic acid molecule" are to be construed synonymously. Generally, nucleic acid molecules may comprise inter alia DNA molecules, RNA molecules, oligonucleotide thiophosphates, substituted ribo- oligonucleotides or PNA molecules. Furthermore, the term "nucleic acid molecule" may refer to DNA or RNA or hybrids thereof or any modification thereof that is known in the art (see, e.g., US 552571 1 , US 471 1955, US 5792608 or EP 302175 for examples of modifications). The polynucleotide sequence may be single- or double- stranded, linear or circular, natural or synthetic, and without any size limitation. For instance, the polynucleotide sequence may be genomic DNA, cDNA, mitochondrial DNA, mRNA, antisense RNA, ribozymal RNA or a DNA encoding such RNAs or chimeroplasts (Gamper, Nucleic Acids Research, 2000, 28, 4332 - 4339). Said polynucleotide sequence may be in the form of a vector, plasmid or of viral DNA or RNA. Also described herein are nucleic acid molecules which are complementary to the nucleic acid molecules described above and nucleic acid molecules which are able to hybridize to nucleic acid molecules described herein. A nucleic acid molecule described herein may also be a fragment of the nucleic acid molecules in context of the present invention. Particularly, such a fragment is a functional fragment. Examples for such functional fragments are nucleic acid molecules which can serve as primers.

In accordance with any one of the methods described herein, which comprise the contacting of the biocatalyst with urea, the biocatalyst may have been dried before being combined in the reactor with acrylonitrile and water. In this context the term "before" does not necessarily mean that the biocatalyst has been dried and is then directly combined with acrylonitrile and water in the reactor. It is rather sufficient that the biocatalyst has undergone a drying step at any time before it is combined with acrylonitrile and water in the reactor, independently of whether further steps between the drying and the combining are performed or not. As non-limiting examples, such further steps between the drying step and the combining with acrylonitrile and water in the reactor may be storage or, in particular, the contacting of the biocatalyst with urea. The inventors have surprisingly found that by using a biocatalyst, which has undergone a drying step, the concentration of acrylic acid in an aqueous acrylamide solution obtained by any one of the methods described herein is further reduced in comparison to the case that a biocatalyst is used which has not undergone drying before being employed in the bioconversion.

In context with any one of the methods described and provided herein, a biocatalyst may be combined in the reactor with acrylonitrile and water which has undergone drying and contacting with urea. By using such a biocatalyst in the bioconversion, the acrylic acid concentration of an aqueous acrylamide solution is further reduced compared to employing a biocatalyst which has undergone only contacting with urea.

The order of the drying and of the contacting with urea is not particularly limited. For example, in accordance with any one of the methods of the present invention the biocatalyst may have been dried before being contacted with urea. With this respect, the biocatalyst may be dried and later contacted with the urea. As a non-limiting example, the dried biocatalyst may be contacted with urea by suspending with a solution containing urea.

Alternatively or in addition to drying the biocatalyst before being contacted with urea, in any one of the methods described herein the biocatalyst may have been dried after being contacted with urea and before being added to the reactor. As a non-limiting example, the biocatalyst may be contacted with urea during cultivation, taken from the fermentation broth, and dried.

Independently of the case that the biocatalyst is contacted with urea during cultivation or not, a biocatalyst taken from the fermentation broth may be contacted with urea after cultivation, for example by suspending the biocatalyst with a solution containing urea, and after such contacting the biocatalyst may be subjected to a drying step before being combined in in the reactor with acrylonitrile and water. Regarding the drying method, in any one of the methods described and provided herein, independently of whether the biocatalyst is dried before being contacted with urea, or whether the biocatalyst is dried after being contacted with urea and before being added to the reactor, the biocatalyst may be dried using freeze-drying, spray drying, heat drying, vacuum drying, fluidized bed drying and/or spray granulation. With this respect, spray drying and freeze drying are preferred, since in general by using a biocatalyst, which has been subjected to spray- or freeze drying, a higher reduction of the acrylic acid concentration in the obtained aqueous acrylamide solutions is achieved compared to employing a biocatalyst which has been dried using other methods.

According to any one of the methods of the present invention, wherein the biocatalyst is contacted with urea, a dried biocatalyst may be added to the reactor. This means that the biocatalyst is added to the reactor in a dried form. In particular, the dried biocatalyst may have the form of a powder or a granule. As an alternative to adding a dried biocatalyst to the reactor, the dried biocatalyst may be reconstituted before being combined with acrylonitrile and water. Such reconstitution of the biocatalyst may be performed outside of the reactor or inside of the reactor. For example, the biocatalyst may be reconstituted by suspending in an aqueous composition. With this respect, the aqueous composition may be water or a buffer. Preferably the aqueous composition is an aqueous composition comprising urea. As a further alternative, a biocatalyst in form of a matrix bound microorganism may be added to the reactor.

The term "dried biocatalyst" as used herein refers to a biocatalyst that has been subjected to a drying step. A dried biocatalyst typically has a moisture content of less than about 20 w/w %, more preferably less than about 15 w/w %, even more preferably less than about 14 w/w %, most preferably from about 5 to about 10 w/w % based on the total weight of the biocatalyst sample. Methods of determining the moisture content are familiar to the skilled person. For example, in the context of the present invention the moisture content of a sample of the dried biocatalyst may be determined via thermogravimetric analysis. At the beginning of the thermogravimetric analysis the initial weight of the sample is determined. The sample is then heated and the moisture vaporizes. Heating is continued until the sample weight remains constant. The difference between the constant weight at the end of the analysis and the initial weight represents the amount of water vaporized during the analysis, which allows for calculation of the moisture content of the sample. For determination of the moisture content via thermogravimetric analysis, the biocatalyst sample may be, for example, analyzed on a 'Mettler Toledo HB43-S Halogen moisture analyzer', operated at 130 °C until the sample weight remains constant for at least 30 seconds.

By performing any one of the methods described herein the aqueous acrylamide solution may be obtained along with the biocatalyst. Accordingly, the biocatalyst may be separated from the obtained aqueous acrylamide solution. Such a separation of the biocatalyst may be performed with regard to the desired applications, which may, for example, include the homopolymerization or copolymerization of the acrylamide. Suitable methods for separation of the biocatalyst are known in the art and include, for example, centrifugation, sedimentation (e.g., with flocculation), membrane separation and filtration.

The present invention further relates to aqueous acrylamide solutions obtainable or being obtained by any one of the methods described and provided herein. An aqueous acrylamide solution, in particular an aqueous acrylamide solution obtainable or being obtained by any one of the methods described herein, may contain 35 to 65 w/w % of acrylamide and may have an acrylic acid concentration of not more than 1500 ppm, preferably of not more than 1000 ppm, more preferably of not more than 750 ppm, further preferably of not more than 500 ppm, even more preferably of not more than 300 ppm, still more preferably of not more than 200 ppm and most preferably of not more than 100 ppm, wherein indications of w/w % and ppm are each referred to the total weight of the solution, and ppm each relates to weight parts.

Preferably, the aqueous acrylamide solution contains 40 to 60 w/w % of acrylamide and has an acrylic acid concentration of not more than 1500 ppm, preferably of not more than 1000 ppm, more preferably of not more than 750 ppm, further preferably of not more than 500 ppm, even more preferably of not more than 300 ppm, still more preferably of not more than 200 ppm and most preferably of not more than 100 ppm, wherein indications of w/w % and ppm are each referred to the total weight of the solution, and ppm each relates to weight parts.

More preferably, the aqueous acrylamide contains 45 to 55 w/w % of acrylamide and has an acrylic acid concentration of not more than 1500 ppm, preferably of not more than 1000 ppm, more preferably of not more than 750 ppm, further preferably of not more than 500 ppm, even more preferably of not more than 300 ppm, still more preferably of not more than 200 ppm and most preferably of not more than 100 ppm, wherein indications of w/w % and ppm are each referred to the total weight of the solution and ppm each relates to weight parts.

Most preferably, the aqueous acrylamide solution contains 50 to 54 w/w % of acrylamide and has an acrylic acid concentration of not more than 1500 ppm, preferably of not more than 1000 ppm, more preferably of not more than 750 ppm, further preferably of not more than 500 ppm, even more preferably of not more than 300 ppm, still more preferably of not more than 200 ppm and most preferably of not more than 100 ppm, wherein indications of w/w % and ppm are each referred to the total weight of the solution and ppm each relates to weight parts.

In any one of the aqueous acrylamide solutions, the acrylamide content and/or the acrylic acid concentration may be determined using HPLC. Preferably, an HPLC method is used as set forth below under the Examples. Furthermore, the present invention relates to an acrylamide homopolymer or copolymer obtainable or being obtained by polymerizing the acrylamide of the aqueous solution as described herein. With this respect, in case of a homopolymer the term "polymerizing" refers to a homopolymerization reaction, while in case of a copolymer the term "polymerizing" refers to a copolymerization reaction. The homopolymerization or copolymerization may be performed using an aqueous acrylamide solution obtainable or being obtained by any one of the methods described herein. In particular, an aqueous acrylamide solution may be used, from which the biocatalyst has been separated prior to the polymerization. Alternatively, the acrylamide may have been isolated from the aqueous acrylamide solution before being subjected to homopolymerization or copolymerization.

An acrylamide homopolymer or copolymer, in particular an acrylamide homopolymer or copolymer obtainable or being obtained by polymerizing the acrylamide of the aqueous solution as described herein, may have an acrylic acid content of 60,000 ppm or less, preferably of 20,000 ppm or less, more preferably of 10,000 ppm or less, and most preferably of 2,000 ppm or less, wherein the indications of ppm each relate to weight parts and are each referred to the total weight of the solid acrylamide homopolymer or copolymer.

High acrylic acid contents within acrylamide solutions can lead to reduced performance of the resulting polyacrylamide homopolymers and copolymers, especially for cationic polyacrylamide products, i.e. copolymers of acrylamide with cationic co-monomers. This is highly evident for cationic copolymers with low cationic co-monomer contents. Without wishing to be bound by any theory, molar equivalent amounts of anionic acrylic acid and the cationic co-monomers within the copolymer chain results in the generation of charge complexes. This can significantly impair the physical properties of the polyacrylamide material, reducing solubility and performance in applications such as water treatment, paper making, oil recovery or mining.

Regarding this impact of acrylic acid, the acrylamide homopolymer or copolymer described and provided herein is preferably a cationic polyacrylamide. As generally known to a person skilled in the art, the term "cationic polyacrylamide" denotes a copolymer which in addition to acrylamide monomers contains cationic co-monomers, such as, e.g., co-monomers which comprise quaternary ammonium groups. Particularly preferred is a cationic polyacrylamide having an acrylic acid content of 60,000 ppm or less, preferably of 20,000 ppm or less, more preferably of 10,000 ppm or less, and most preferably of 2,000 ppm or less, wherein the indications of ppm each relate to weight parts and are each referred to the total weight of the solid acrylamide homopolymer or copolymer.

In general, the acrylic acid content of any polymer or copolymer described herein may be determined using methods known in the art, e.g., NMR spectroscopy as described in European Polymer Journal (2007), 43(3): 824-834.

Acrylamide homopolymers and/or copolymers are, for example, used in oilfield applications. In particular, use of acrylamide homopolymers and/or copolymers is made in tertiary oil recovery, which is also denoted as enhanced oil recovery. With this respect, in methods of tertiary oil recovery an aqueous solution of the polymer may be injected into the rock in order to promote oil displacement and thus increase the yield of crude oil. The present invention is therefore also related to an aqueous solution of any acrylamide homopolymer and/or copolymer described herein. As the water for the aqueous solution seawater may be used. The present invention further relates to the use of urea in the preparation of an aqueous acrylamide solution by a bio-based process where acrylonitrile is converted to acrylamide using a biocatalyst. In particular, a biocatalyst may be used as described herein above and below. Again, as used herein, the tern "bio-based process" refers to the biological synthesis method which employs biocatalysts (e.g., microorganisms encoding nitrile hydratase) to hydrate (i.e. to convert) acrylonitrile in order to obtain acrylamide. Generally, for such a bio-based process, at least a biocatalyst, acrylonitrile and water is necessary for the reaction. In accordance with the present invention, as further detailed herein, additionally urea is used. According to any use described herein above and below the biocatalyst may be washed and then treated with urea before being employed in the conversion of acrylonitrile to acrylamide.

In line with any use described herein, the biocatalyst may be suspended with a solution containing urea before being employed in the conversion of acrylonitrile to acrylamide.

The present invention further relates to the use of urea for reducing the acrylic acid concentration of an aqueous acrylamide solution which is prepared by a bio-based process where acrylonitrile is converted to acrylamide using a biocatalyst. In particular, a biocatalyst as described herein may be used. In this context, the acrylic acid concentration may be reduced by at least 10 %, preferably by at least 15 %, more preferably by at least 20 %, even more preferably by at least 25 %, and most preferably by at least 35 %. The reduction of the acrylic acid concentration as referred to above is related to the final concentration of acrylic acid contained in the aqueous acrylamide solution to be prepared in accordance with present invention (i.e. with the use of urea) compared to the final concentration of acrylic acid contained in the aqueous acrylamide solution not prepared in accordance with present invention (i.e. without the use of urea).

In line with any use described herein, the biocatalyst may encode the enzyme nitrile hydratase. For example, the use may comprise that the biocatalyst is selected from the group consisting of Rhodococcus, Aspergillus, Acidovorax, Agrobacterium, Bacillus, Bradyrhizobium, Burkholderia, Escherichia, Geobacillus, Klebsiella, Mesorhizobium, Moraxella, Pantoea, Pseudomonas, Rhizobium, Rhodopseudomonas, Serratia, Amycolatopsis, Arthrobacter, Brevibacterium, Corynebacterium, Microbacterium, Micrococcus, Nocardia, Pseudonocardia, Trichoderma, Myrothecium, Aureobasidium, Candida, Cryptococcus, Debaryomyces, Geotrichum, Hanseniaspora, Kluyveromyces, Pichia, Rhodotorula, Comomonas, and Pyrococcus. In preferred embodiments of the invention the biocatalyst is selected from bacteria of the genus Rhodococcus, Pseudomonas, Escherichia and Geobacillus. More specifically, the use may comprise that the biocatalyst is selected from the group consisting of Rhodococcus rhodochrous, Rhodococcus pyridinovorans, Rhodococcus erythropolis, Rhodococcus equi, Rhodococcus ruber, Rhodococcus opacus, Aspergillus niger, Acidovorax avenae, Acidovorax facilis, Agrobacterium tumefaciens, Agrobacterium radiobacter, Bacillus subtilis, Bacillus pallidus, Bacillus smithii, Bacillus sp BR449, Bradyrhizobium oligotrophicum, Bradyrhizobium diazoefficiens, Bradyrhizobium japonicum, Burkholderia cenocepacia, Burkholderia gladioli, Escherichia coli, Geobacillus sp. RAPc8, Klebsiella oxytoca, Klebsiella pneumonia, Klebsiella variicola, Mesorhizobium ciceri, Mesorhizobium opportunistum, Mesorhizobium sp F28, Moraxella, Pantoea endophytica, Pantoea agglomerans, Pseudomonas chlororaphis, Pseudomonas putida, Rhizobium, Rhodopseudomonas palustris, Serratia liquefaciens, Serratia marcescens, Amycolatopsis, Arthrobacter, Brevibacterium sp CH1, Brevibacterium sp CH2, Brevibacterium sp R312, Brevibacterium imperiale, Brevibacterium casei, Corynebacterium nitrilophilus, Corynebacterium pseudodiph teriticum, Corynebacterium glutamicum, Corynebacterium hoffmanii, Microbacterium imperiale, Microbacterium smegmatis, Micrococcus luteus, Nocardia globerula, Nocardia rhodochrous, Nocardia sp 163, Pseudonocardia thermophila, Trichoderma, Myrothecium verrucaria, Aureobasidium pullulans, Candida famata, Candida guilliermondii, Candida tropicalis, Cryptococcus flavus, Cryptococcus sp UFMG- Y28, Debaryomyces hanseii, Geotrichum candidum, Geotrichum sp JR1 , Hanseniaspora, Kluyveromyces thermotolerans, Pichia kluyveri, Rhodotorula glutinis, Comomonas testosteroni, Pyrococcus abyssi, Pyrococcus furiosus, and Pyrococcus horikoshii.

According to an embodiment of the use, the biocatalyst belongs to the species Rhodococcus rhodochrous. Particular examples for strains belonging to Rhodococcus rhodochrous which may be used comprise NCIMB 41 164, J1 (FERM-BP 1478), M33 and M8.

As an alternative or in addition to Rhodococcus rhodochrous, the biocatalyst may be Rhodococcus pyridinovorans.

The embodiments and definitions described herein in the context of the methods of the present invention are equally applicable to the uses of the present invention, mutatis mutandis.

This description includes information that may be useful in understanding the present invention. It is not an admission that any of the information provided herein is prior art or relevant to the presently claimed inventions, or that any publication specifically or implicitly referenced is prior art.

It is to be noted that as used herein, the singular forms "a", "an", and "the", include plural references unless the context clearly indicates otherwise. Thus, for example, reference to "a reagent" includes one or more of such different reagents and reference to "the method" includes reference to equivalent steps and methods known to those of ordinary skill in the art that could be modified or substituted for the methods described herein. Those skilled in the art will recognize, or be able to ascertain, using not more than routine experimentation, many equivalents to the specific embodiments of the invention described herein. Such equivalents are intended to be encompassed by the present invention.

Unless otherwise indicated, the term "at least" preceding a series of elements is to be understood to refer to every element in the series. Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the methods and uses described herein. Such equivalents are intended to be encompassed by the present invention. Several documents are cited throughout the text of this disclosure. Each of the documents cited herein (including all patents, patent applications, scientific publications, manufacturer's specifications, instructions, etc.), whether supra or infra, are hereby incorporated by reference in their entirety. To the extent the material incorporated by reference contradicts or is inconsistent with this specification, the specification will supersede any such material. Nothing herein is to be construed as an admission that the invention is not entitled to antedate such disclosure by virtue of prior invention.

Throughout this specification and the claims which follow, unless the context requires otherwise, the word "comprise", and variations such as "comprises" and "comprising", will be understood to imply the inclusion of a stated integer or step or group of integers or steps but not the exclusion of any other integer or step or group of integer or step. When used herein the term "comprising" can be substituted with the term "containing" or sometimes when used herein with the term "having". When used herein "consisting of" excludes any element, step, or ingredient not specified in the claim element. When used herein, "consisting essentially of does not exclude materials or steps that do not materially affect the basic and novel characteristics of the claim. In each instance herein any of the terms "comprising", "consisting essentially of and "consisting of may be replaced with either of the other two terms.

As used herein, the conjunctive term "and/or" between multiple recited elements is understood as encompassing both individual and combined options. For instance, where two elements are conjoined by "and/or", a first option refers to the applicability of the first element without the second. A second option refers to the applicability of the second element without the first. A third option refers to the applicability of the first and second elements together. Any one of these options is understood to fall within the meaning, and therefore satisfy the requirement of the term "and/or" as used herein. Concurrent applicability of more than one of the options is also understood to fall within the meaning, and therefore satisfy the requirement of the term "and/or" as used herein.

The word "about" as used herein refers to a value being within an acceptable error range for the particular value as determined by one of ordinary skill in the art, which will depend in part on how the value is measured or determined, i.e., the limitations of the measurement system. For example, "about" can mean within 1 or more than 1 standard deviation, per the practice in the art. The term "about" is also used to indicate that the amount or value in question may be the value designated or some other value that is approximately the same. The phrase is intended to convey that similar values promote equivalent results or effects according to the invention. In this context "about" may refer to a range above and/or below of up to 10%. The word "about" refers in some embodiments to a range above and below a certain value that is up to 5%, such as up to up to 2%, up to 1 %, or up to 0.5 % above or below that value. In one embodiment "about" refers to a range up to 0.1 % above and below a given value.

Generally, the present invention relates to all the embodiments described herein as well as to all permutations and combinations thereof. Any particular aspects or embodiments described herein must not be construed as limiting the scope of the present invention on such aspects or embodiments. The following examples further describe and exemplify the invention provided herein without limiting the invention to any specifications or embodiments defined therein.

Examples Method 1 : 1.64 g of dried biocatalyst Rodococcus r odoc rous, strain NCIMB 41 164 (specific nitrilehydratase activity: 1 10 kU/g) was suspended with a solution of a certain amount of urea in 20 ml of deionized water. The amount of urea, which was contained in the solution in each case, is provided in below Table 1. In a separate step, 2425 g of deionized water and 20 g of acrylonitrile were placed in a glass reactor. The suspension of the biocatalyst with the aqueous urea solution was then added to the glass reactor to initiate the bioconversion of acrylonitrile to acrylamide. During the bioconversion further 1533 g of acrylonitrile was added to the reactor. At the end of the bioconversion 4 kg of an aqueous acrylamide solution having a content of 52 % w/w acrylamide based on the total weight of the composition in the reactor was obtained. The following Table 1 shows different runs of Method 1 as described above, wherein different amounts of urea were used.

* These values denote the amount of urea present in the aqueous solution used for suspending the biocatalyst.

** These values represent the concentration of urea based on the total weight of the composition in the reactor at the end of the bioconversion.

*** Determined using HPLC according to the method provided below.

The results outlined in Table 1 show that by using a biocatalyst, which has been contacted with urea, aqueous acrylamide solutions are produced having lower concentrations of acrylic acid compared to an aqueous acrylamide solution, which is prepared employing a biocatalyst not being contacted with urea. In addition, these results indicate that by increasing the amount of urea, which is used for the contacting of the biocatalyst with urea, the concentration of acrylic acid in the obtained aqueous acrylamide solutions is further reduced.

Method 2:

In a reactor having a total volume of 100 ml, 60.5 g of deionized water, 67.5 mg of spray dried biocatalyst R odococcus r odoc rous, strain NCIMB 41 164 (specific nitrile hydratase activity: 1 10 kU/g, the biocatalyst was free of urea) and certain amounts of urea were placed. The concentration of urea for each run is provided in below Table 2. The composition was stirred at 20 °C and a total amount of 39.56 g acrylonitrile was added at a constant rate of 9.9 g/h. The reaction temperature was kept constant at 20 °C. After 5 h the reaction was stopped, and the concentrations of acrylamide, acrylic acid and acrylonitrile were determined using HPLC. In each run complete conversion of acrylonitrile was achieved (residual acrylonitrile < 100 ppm) and the concentration of acrylamide was 52-53% (w/w) based on the total weight of the composition in the reactor.

The following Table 2 shows different runs of Method 2, wherein different concentrations of urea were used.

* These values denote weight parts and are based on the total weight of the biocatalyst, water and urea before addition of acrylonitrile.

** Determined using HPLC according to the method provided below. The values denote weight parts and are based on the total weight of the composition in the reactor. Also the results of Table 2 show that by using a biocatalyst, which has been contacted with urea, aqueous acrylamide solutions are obtained having reduced acrylic acid concentrations. The concentration of acrylic acid was dependent of the concentration of urea. With this regard, increasing the concentration of urea resulted in a lower concentration of acrylic acid.

Method 3:

A biocatalyst, which had not been dried, was used in the bioconversion. With this regard, an aqueous fermentation broth being free of urea and containing R odococcus r odoc rous, strain NCIMB 41 164 was concentrated by centrifugation after end of cultivation. The obtained concentrate had a volumetric nitrile hydratase activity of 28688 kU/kg. In a reactor having a total volume of 100 ml, 60.5 g of deionized water, 207 mg of the concentrate and either 0 or 50 ppm of urea were placed. The composition was stirred at 20 °C and a total amount of 39.56 g acrylonitrile was added at a constant rate of 9.9 g/h. The reaction temperature was kept constant at 20 °C, and after 23 h the concentrations of acrylamide and acrylic acid were determined using HPLC. In each run the concentration of acrylamide was > 52% (w/w) based on the total weight of the composition in the reactor.

Table 3 shows two runs of Method 3, wherein either 0 ppm or 50 ppm of urea was used.

* These values denote weight parts and are based on the total weight of the concentrate, water and urea before addition of acrylonitrile.

** Determined using HPLC according to the method provided below. The values denote weight parts and are based on the total weight of the composition in the reactor.

The results of Table 3 show that also in case a biocatalyst is used which has not been dried the acrylic acid concentration is reduced by contacting the biocatalyst with urea. HPLC Method

In the aforementioned examples the concentration of acrylic acid in the obtained aqueous acrylamide solutions was determined using HPLC. The following conditions were applied in order to determine the contents of acrylamide, acrylic acid and acrylonitrile:

Column: Aqua C18, 250*4.6 mm (Phenomenex)

Guard column: C18 Aqua

Temperature: 40 °C

Flow rate: 1 .00 ml/min

Injection volume 1 .0 μΙ

Detection: UV detector, wavelength 210 nm

Stop time: 8.0 minutes

Post time: 0.0 minutes

Maximum pressure 250 bar

Eluent A: 10 mM KH2PO4, pH 2.5

Eluent B: Acetonitrile

Gradient:

Fermentation broths, bioconversion mixtures

Sample is filtered through 0.22 μηι

Analytes:

Claims

Claims

Method for preparing an aqueous acrylamide solution, said method comprising the following steps:

(a) contacting a biocatalyst capable of converting acrylonitrile to acrylamide with urea;

(b) combining the following components (i) to (iii) in a reactor to obtain a composition for bioconversion:

(i) the biocatalyst obtained in step (a);

(ii) acrylonitrile;

(iii) water; and

(c) performing a bioconversion on the composition obtained in step (b).

Method for reducing the acrylic acid concentration of an aqueous acrylamide solution, wherein said aqueous acrylamide solution is prepared by a biocatalytic process where acrylonitrile is converted to acrylamide using a biocatalyst, said method comprising the following steps:

(a) contacting a biocatalyst capable of converting acrylonitrile to acrylamide with urea;

(b) combining the following components (i) to (iii) in a reactor to obtain a composition for bioconversion:

(i) the biocatalyst obtained in step (a);

(ii) acrylonitrile;

(iii) water; and

(c) performing a bioconversion on the composition obtained in step (b).

The method of claim 1 or 2, wherein the contacting of the biocatalyst with urea of step (a) comprises contacting the biocatalyst with urea after cultivation.

The method of any one of claims 1 to 3, wherein the contacting of the biocatalyst with urea of step (a) comprises contacting the biocatalyst with urea during cultivation.

Method for preparing an aqueous acrylamide solution, said method comprising the following steps:

(a) contacting a biocatalyst capable of converting acrylonitrile to acrylamide with urea after cultivation, wherein said biocatalyst is essentially free of urea; (b) combining the following components (i) to (iii) in a reactor to obtain a composition for bioconversion:

(i) the biocatalyst obtained in step (a);

(ii) acrylonitrile;

(iii) water; and

(c) performing a bioconversion on the composition obtained in step (b).

Method for preparing an aqueous acrylamide solution, said method comprising the following steps:

(a) suspending a biocatalyst capable of converting acrylonitrile to acrylamide with a solution containing urea after cultivation of said biocatalyst;

(b) combining the following components (i) to (iii) in a reactor to obtain a composition for bioconversion:

(i) the suspension of the biocatalyst obtained in step (a);

(ii) acrylonitrile;

(iii) water; and

(c) performing a bioconversion on the composition obtained in step (b).

The method of any one of claims 1 to 6, wherein the acrylic acid concentration of the solution at the end of the bioconversion is 1500 ppm or less, preferably 1200 ppm or less, more preferably 1000 ppm or less, further preferably 750 ppm or less, even more preferably 500 ppm or less, still more preferably 300 ppm or less, still more preferably 200 ppm or less and most preferably 100 ppm or less, wherein indications of ppm each relate to weight parts and are each referred to the total weight of the solution at the end of the bioconversion.

Method for preparing an aqueous acrylamide solution, said method comprising the following steps:

(a) contacting a biocatalyst capable of converting acrylonitrile to acrylamide with urea;

(b) combining the following components (i) to (iii) in a reactor to obtain a composition for bioconversion:

(i) the biocatalyst obtained in step (a);

(ii) acrylonitrile;

(iii) water; (c) performing a bioconversion on the composition obtained in step (b); and

(d) obtaining an aqueous acrylamide solution, wherein the acrylic acid concentration of the solution at the end of the bioconversion is 1500 ppm or less, preferably 1200 ppm or less, more preferably 1000 ppm or less, further preferably 750 ppm or less, even more preferably 500 ppm or less, still more preferably 300 ppm or less, still more preferably 200 ppm or less and most preferably 100 ppm or less, wherein indications of ppm each relate to weight parts and are each referred to the total weight of the solution at the end of the bioconversion.

The method of any one of claims 1 to 8, wherein the biocatalyst, acrylonitrile and water are combined in the reactor during said method in a weight ratio of 0.001 to 0.5 w/w % of the biocatalyst, 22 to 45 w/w % of acrylonitrile and a balance to 100 w/w % of water; preferably of 0.005 to 0.2 w/w % of the biocatalyst, 26 to 42 w/w % of acrylonitrile and a balance to 100 w/w % of water; more preferably of 0.01 to 0.1 w/w % of the biocatalyst, 30 to 40 w/w % of acrylonitrile and a balance to 100 w/w % of water; most preferably of 0.015 to 0.065 w/w of the biocatalyst, 35 to 39 w/w % of acrylonitrile and a balance to 100 w/w % of water, wherein in each case indications of w/w % are referred to the total weight (100 w/w %) of the combined weights of the biocatalyst, acrylonitrile and water combined in the reactor during said method.

The method of any one of claims 1 to 9, wherein the bioconversion of step (c) is performed at 5 °C to 40 °C for 10 minutes to 48 hours, preferably at 5 °C to 35 °C for 10 minutes to 48 hours, more preferably at 15 °C to 30 °C for 10 minutes to 48 hours, most preferably at 20 °C to 28 °C for 10 minutes to 48 hours.

The method of any one of claims 1 to 10, wherein said biocatalyst encodes the enzyme nitrile hydratase.

The method of any one of claims 1 to 1 1 , wherein the biocatalyst is selected from the group consisting of Rhodococcus, Aspergillus, Acidovorax, Agrobacterium, Bacillus, Bradyrhizobium, Burkholderia, Escherichia, Geobacillus, Klebsiella, Mesorhizobium, Moraxella, Pantoea, Pseudomonas, Rhizobium, Rhodopseudomonas, Serratia, Amycolatopsis, Arthrobacter, Brevibacterium, Corynebacterium, Microbacterium, Micrococcus, Nocardia, Pseudonocardia, Trichoderma, Myrothecium, Aureobasidium, Candida, Cryptococcus, Debaryomyces, Geotrichum, Hanseniaspora, Kluyveromyces, Pichia, Rhodotorula, Comomonas, and Pyrococcus.

3. The method of claim 12, wherein the biocatalyst is selected from the group consisting of Rhodococcus, Pseudomonas, Escherichia and Geobacillus.

4. The method of any one of claims 1 to 13, wherein the biocatalyst is selected from the group consisting of Rhodococcus rhodochrous, Rhodococcus pyridinovorans, Rhodococcus erythropolis, Rhodococcus equi, Rhodococcus ruber, Rhodococcus opacus, Aspergillus niger, Acidovorax avenae, Acidovorax facilis, Agrobacterium tumefaciens, Agrobacterium radiobacter, Bacillus subtilis, Bacillus pallidus, Bacillus smithii, Bacillus sp BR449, Bradyrhizobium oligotrophicum, Bradyrhizobium diazoefficiens, Bradyrhizobium japonicum, Burkholderia cenocepacia, Burkholderia gladioli, Escherichia coli, Geobacillus sp. RAPc8, Klebsiella oxytoca, Klebsiella pneumonia, Klebsiella variicola, Mesorhizobium ciceri, Mesorhizobium opportunistum, Mesorhizobium sp F28, Moraxella, Pantoea endophytica, Pantoea aggiomerans, Pseudomonas chlororaphis, Pseudomonas putida, Rhizobium, Rhodopseudomonas palustris, Serratia liquefaciens, Serratia marcescens, Amycolatopsis, Arthrobacter, Brevibacterium sp CH1, Brevibacterium sp CH2, Brevibacterium sp R312, Brevibacterium imperiale, Brevibacterium casei, Corynebacterium nitrilophilus, Corynebacterium pseudodiphteriticum, Corynebacterium glutamicum, Corynebacterium hoffmanii, Microbacterium imperiale, Microbacterium smegmatis, Micrococcus luteus, Nocardia globerula, Nocardia rhodochrous, Nocardia sp 163, Pseudonocardia thermophila, Trichoderma, Myrothecium verrucaria, Aureobasidium pullulans, Candida famata, Candida guilliermondii, Candida tropicalis, Cryptococcus flavus, Cryptococcus sp UF G- Y28, Debaryomyces hanseii, Geotrichum candidum, Geotrichum sp JR1 , Hanseniaspora, Kluyveromyces thermotolerans, Pichia kluyveri, Rhodotorula glutinis, Comomonas testosteroni, Pyrococcus abyssi, Pyrococcus furiosus, and Pyrococcus horikoshii.

5. The method of claim 14, wherein the biocatalyst is Rhodococcus rhodochrous.

6. The method of claim 14, wherein the biocatalyst is Rhodococcus pyridinovorans.

17. The method of any one of claims 1 to 16, wherein the biocatalyst has been dried before being contacted with urea.

18. The method of any one of claims 1 to 17, wherein the biocatalyst has been dried after being contacted with urea and before being added to the reactor.

19. The method of claim 17 or 18, wherein the biocatalyst has been dried using freeze- drying, spray drying, heat drying, vacuum drying, fluidized bed drying and/or spray granulation, wherein spray drying and freeze drying are preferred.

20. The method of any one of claims 17 to 19, wherein a dried biocatalyst is added to the reactor.

21 . The method of any one of claims 17 to 19, wherein the dried biocatalyst is reconstituted before being combined with acrylonitrile and water.

22. The method of claim 21 , wherein the biocatalyst is reconstituted by suspending in an aqueous composition. 23. Aqueous acrylamide solution obtainable by the method of any one of claims 1 to 22.

24. Aqueous acrylamide solution, in particular according to claim 23, containing 35 to 65 w/w % of acrylamide having an acrylic acid concentration of not more than 1500 ppm, preferably of not more than 1000 ppm, more preferably of not more than 500 ppm, further preferably of not more than 300 ppm, even more preferably of not more than 200 ppm and most preferably of not more than 100 ppm, wherein indications of w/w % and ppm are each referred to the total weight of the solution.

25. The aqueous acrylamide solution of claim 24 containing 40 to 60 w/w % of acrylamide and having an acrylic acid concentration of not more than 1500 ppm, preferably of not more than 1000 ppm, more preferably of not more than 500 ppm, further preferably of not more than 300 ppm, even more preferably of not more than 200 ppm and most preferably of not more than 100 ppm .

26. The aqueous acrylamide solution of claim 25 containing 45 to 55 w/w % of acrylamide and having an acrylic acid concentration of not more than 1500 ppm, preferably of not more than 1000 ppm, more preferably of not more than 500 ppm, further preferably of not more than 300 ppm, even more preferably of not more than 200 ppm and most preferably of not more than 100 ppm.

27. The aqueous acrylamide solution of claim 26 containing 50 to 54 w/w % of acrylamide and having an acrylic acid concentration of not more than 1500 ppm, preferably of not more than 1000 ppm, more preferably of not more than 500 ppm, further preferably of not more than 300 ppm, even more preferably of not more than 200 ppm and most preferably of not more than 100 ppm .

28. The aqueous acrylamide solution of claims 23 to 27, wherein the acrylamide content and/or the acrylic acid concentration are determined using HPLC.

29. Acrylamide homopolymer or copolymer obtainable by polymerizing the acrylamide of the aqueous solution of any one of claims 23 to 28.

30. Acrylamide homopolymer or copolymer, in particular according to claim 29, having an acrylic acid content of 60,000 ppm or less, preferably of 20,000 ppm or less, more preferably of 10,000 ppm or less and most preferably of 2,000 ppm or less, wherein the indication of ppm is referred to the total weight of the solid acrylamide homopolymer or copolymer. 31 . The acrylamide homopolymer or copolymer of claim 29 or 30, wherein the acrylamide copolymer is cationic polyacrylamide.

32. The acrylamide homopolymer or copolymer of any one of claims 29 to 31 , wherein the acrylic acid content is determined using NMR spectroscopy.

33. Solution of an acrylamide homopolymer or copolymer of any one of claims 29 to 32 in seawater.