WO2016049280A1 - mTORC1 MODULATION - Google Patents

mTORC1 MODULATION Download PDF

Info

Publication number
WO2016049280A1
WO2016049280A1 PCT/US2015/051875 US2015051875W WO2016049280A1 WO 2016049280 A1 WO2016049280 A1 WO 2016049280A1 US 2015051875 W US2015051875 W US 2015051875W WO 2016049280 A1 WO2016049280 A1 WO 2016049280A1
Authority
WO
WIPO (PCT)
Prior art keywords
mtorcl
sestrin
polypeptide
signaling
sestrin2
Prior art date
Application number
PCT/US2015/051875
Other languages
French (fr)
Inventor
Ming Li
Min Peng
Original Assignee
Memorial Sloan Kettering Cancer Center
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Memorial Sloan Kettering Cancer Center filed Critical Memorial Sloan Kettering Cancer Center
Publication of WO2016049280A1 publication Critical patent/WO2016049280A1/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/48—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving transferase
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • G01N33/6893—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids related to diseases not provided for elsewhere
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00—Detection or diagnosis of diseases
    • G01N2800/04—Endocrine or metabolic disorders
    • G01N2800/044—Hyperlipemia or hypolipemia, e.g. dyslipidaemia, obesity

Definitions

  • mTORCl Mechanistic target of rapamycin complex 1
  • mTORCl is a master regulator of cellular growth, whose dysregulation results in a plethora of pathological conditions including cancer, diabetes, and aging (Laplante and Sabatini, 2012).
  • mTORCl regulates macromolecule biosynthesis and energy metabolism by integrating intracellular and environmental signals such as growth factors and nutrients that impinge on mTORCl signaling through the Rheb and Rag subfamilies of GTPases (Bar-Peled and Sabatini, 2014; Dibble and Manning, 2013; Jewell et al, 2013).
  • Sestrin peptide agents can act as modulators of mTORCl signaling.
  • the present disclosure specifically demonstrates that Sestrin peptide agents inhibit mTORCl signaling; in some embodiments, such inhibition occurs in the absence of AMPK and/or TSC2.
  • the present disclosure further demonstrates that Sestrin peptide agents can act as specific modulators of mTORCl signaling (e.g., and not of mTORC2 signaling).
  • Sestrin peptide agents can act as GDIs for Rags.
  • the present disclosure provides, among other things, systems for identifying and/or characterizing useful mTORCl modulatory agents including, for example, Sestrin peptide agents and/or other agents whose activity can be assessed relative thereto.
  • mTORCl modulatory agents are useful in a variety of contexts, including for example, in nutrient sensing and/or mTORCl signaling.
  • mTORCl modulatory agents are useful, for example, in the treatment of one or more diseases, disorders, or conditions associated with mTORCl signaling.
  • mTORCl modulatory agents are useful in accordance with the present invention in the treatment of cancer, diabetes, and/or aging.
  • mTORCl modulatory agents are useful in accordance with the present invention in the treatment of one or more metabolic diseases, disorders or conditions.
  • mTORCl modulatory agents are useful in accordance with the present invention in the treatment of autophagy.
  • mTORCl modulatory agents that specifically modulate mTORCl signaling and not mTORC2 signaling are not useful in the treatment of cancer and/or are not significantly active in one or more cancer models.
  • such agents are useful in the treatment of other mTORCl -associated diseases, disorders or conditions as described herein.
  • useful mTORCl modulatory agents as described herein and/or otherwise defined or provided by the present disclosure are characterized by their activity relative to a reference Sestrin peptide agent in one or more assays or models, for example as described herein.
  • Figure 1 shows Sestrin2 inhibits mTORCl signaling in the absence of TSC2 or
  • AMPK AMPK.
  • A TSC2-deficient MEFs stably expressing FLAG-tagged Sestrin2 or RFP were cultured in complete medium. Total cell lysates were analyzed by immunoblotting.
  • B Wild- type (WT) or AMPK DKO MEFs stably expressing FLAG-tagged Sestrin2 or RFP were cultured in complete medium or starved for amino acids for 60 min, and analyzed as in (A).
  • FIG. 2 shows Sestrins function upstream of Rag GTPases to inhibit amino acid- induced mTORCl lysosomal translocation and signaling
  • A HEK293T cells stably expressing indicated proteins were starved for amino acids for 60 min, and re-stimulated with amino acids for 10 min. Total cell lysates were analyzed by immunoblotting.
  • B HEK293T cells stably expressing indicated proteins were treated and analyzed as in (A).
  • C HeLa cells or HeLa cells stably expressing indicated proteins were starved for amino acids for 60 min, and were either left untreated or re-stimulated with amino acids for 15 min. The localization of mTOR and Lamp2 was determined by immunostaining.
  • FIG. 3 shows Sestrins directly interact with Rag GTPases.
  • A HEK293T cells were co-transfected with constructs encoding indicated proteins. Total cell lysate or the anti- FLAG immunoprecipitate (IP) was analyzed by immunoblotting. All lanes were from the same blot, and irrelevant lanes were removed and indicated by a dashed line.
  • B HeLa cells stably expressing indicated proteins were subject to crosslinking with DSP prior to cell lysis. Total cell lysate or the anti-FLAG immunoprecipitates was analyzed by immunoblotting.
  • FIG. 4 shows Sestrin2 stabilizes GTP binding to RagB Q99L and potentiates RagB Q99L - induced mTORCl signaling.
  • A HEK293T cells stably expressing indicated proteins were starved for amino acids for 60 min. Total cell lysates were analyzed by immunoblotting.
  • B-C HEK293T cells stably expressing indicated proteins starved for amino acids for 60 min. Total cell lysates were analyzed by immunoblotting (B). The effect of Sestrin2 on RagB Q99L - or RagB Q99H -induced S6K phosphorylation was normalized to the expression level of RagB by the Image J software (C).
  • HEK293T cells stably expressing indicated proteins were transfected with constructs encoding the HA-GST-RagB Q99L and FLAG-RagC D181N dimer.
  • the RagB Q99L -bound guanine nucleotides were analyzed by TLC.
  • FIG. 5 shows Sestrin2 is a GDI for RagA/B.
  • A HEK293T cells stably expressing indicated proteins were labeled with 32 P orthophosphate for 4 h, starved for amino acids for 50 min and restimualted with amino acids for 10 min, and RagA was
  • Figure 6 shows the GDI activity of Sestrin is important for inhibiting mTORCl activation
  • A Sequence alignment of a putative GDI motif from Sestrins to that of RabGDI is shown. The conserved amino acids are labeled in red and blue, and the two positively charged lysines present specifically in Sestrins are labeled in green. Arrows indicate the amino acid residues that are mutated to alanines.
  • B HEK293T cells stably expressing indicated proteins were cultured in medium with different concentrations of amino acids for 60 min. Total cell lysates were analyzed by immunoblotting.
  • HEK293T cells stably expressing indicated proteins were starved for amino acids for 60 min, and were either left untreated or re-stimulated with amino acids for 10 min. The localization of mTOR and Lamp2 was determined by immunostaining.
  • E Sequences of mouse Sestrin2 amino acids 410 - 431, Tat-Sestrin2-GDI motif (T-G) and Tat- Tat-Sestrin2-GDI motif-Scramble (T-S) control peptides.
  • F HEK293T or HEK293T stably expressing FLAG-RagB y were incubated with DMEM containing the indicated concentrations of peptides for 60 min. Cells were also deprived of amino acids or incubated with rapamycin (100 ng/ml) for 60 min as controls. Total cell lysates were analyzed by immunoblotting.
  • Figure 7 shows the importance of residues in human and mouse Sestrin.
  • GDI motif of Sestrin2 from mouse and human has one amino acid substitution, which is labeled in purple. The three positively charged amino acids (green) that are critical for the GDI activity of Sestrins were changed to alanines (red).
  • B The three positively charged amino acids in Sestrin2 GDI motif are critical for GDI activity.
  • HEK293E cells were treated with 20 ⁇ indicated peptides in the presence or absence of amino acids for 1 hour. Total cell lysates were analyzed by immunoblotting.
  • C GDI motif from human Sestrin2 inhibit mTORCl signaling in HEK293T cells.
  • HEK293T or HEK293T cells expressing RagBQ99L were treatment with indicated concentrations of peptides for 1 hour. Cells were also treated with ⁇ Rapamycin or starved for amino acids for 1 hour as control. Total cell lysates were analyzed by immunoblotting.
  • FIG. 8 shows Sestrins are indispensable for amino acid starvation-triggered mTORCl inactivation.
  • A Genotyping results of pups at 10 days after birth or neonates at birth.
  • B Total cell lysates prepared from the liver, heart or limbs of neonates with the indicated genotypes after 8 h of fasting were analyzed by immunoblotting.
  • C Wild-type (WT) and Sesnl- ⁇ 2-/-3-/- MEFs were starved for amino acids for 0.5, 1, 2, 4, and 6 h. Total cell lysates were analyzed by immunoblotting.
  • FIG. 9 further demonstrates TSC2 and AMPK Are nonessential for Sestrin inhibition of mTORCl signaling.
  • A Total cell lysates from Tsc2+/+ and Tsc2-/- mouse embryonic fibroblasts (MEFs) were analyzed by immunoblotting.
  • B HeLa cells stably expressing the FLAG-tagged RFP or Sestrin2 as well as the shRNA against TSC2 or the control LacZ shRNA were starved for amino acids for 60 min, and re-stimulated with amino acids for 10 min. Total cell lysates were analyzed by immunoblotting.
  • FIG. 10 shows overexpression of Sestrin2 does not affect RagC lysosomal localization.
  • HeLa cells stably expressing the FLAG-tagged Sestrin2 were starved for amino acids for 60 min, and were either left untreated or re-stimulated with amino acids for 15 min. The subcellular localization of RagC and Lamp2 was determined by coimmunostaining.
  • Figure 1 1 shows the interaction between Sestrins and Rags.
  • A The subcellular localization of Flag-Sestrin2 and the RagC was determined by co-immunostaining in HEK293T cells or HEK293T cells stably expressing Flag-Sestrin2.
  • B GST or GST-Sestrin2 were expressed and purified from BL21 (DE3). Purified proteins were further separated by an anion exchange column Resource 15Q. Aliquots of the proteins were separated on a SDS-PAGE, and visualized by coomassie blue staining. The two fractions used for the in vitro binding experiment are marked in red.
  • C The His-RagA-RagC complex was purified with Ni-NTA Agarose.
  • Figure 12 shows Sestrins do not potentiate the Raptor-Rheb 15 -triggered mTORCl activation.
  • HEK293T cells stably expressing indicated proteins were starved for amino acids for 60 min.
  • Total cell lysates were analyzed by immunoblotting.
  • FIG. 13 shows Sestrin2 does not exhibit GAP activity towards Rags.
  • A The purified recombinant Rag complexes, Rap2A, and Sestrin2 proteins were separated by SDS- PAGE, and visualized by coomassie blue staining.
  • B Rap2A or the Rag dimers were incubated with XTP and a- 32 P-GTP in the absence or presence of Sestrin2 for 60 min. The nucleotides were separated by TLC.
  • Figure 14 demonstrates that mutations in Sestrin2 GDI motif does not affect its binding to Rags.
  • HEK293T cells were co-transfected with constructs encoding the HA-GST- tagged RagA and the FLAG-tagged Sestrin2, Sestrin2 419A , Sestrin2 422A , Sestrin2 426A , or
  • Sestrin2 AAA Total cell lysate and the anti-FLAG immunoprecipitates were analyzed by immunoblotting.
  • Figure 15 demonstrates the steps for generation of mice with null alleles for
  • A Gene targeting strategy for Sesnl. Two loxp sites were inserted into intron 1 and intron 6 respectively by homologous gene recombination.
  • B Germline transmission of wild-type (WT), floxed, and deleted alleles of Sesnl was validated by PCR.
  • C Germline transmission of WT and null alleles of Sesn2 was validated by PCR.
  • D Germline transmission of WT, floxed and deleted alleles of Sesn3 was validated by PCR.
  • E Quantitative real-time PCR analysis of the mRNA level of Sestrin3 in livers from WT and Sestrin3 deficient (KO) mice.
  • F Total cell lysates were prepared from the liver, heart or limbs of neonates with the indicated genotypes after 10 h of fasting. The levels of the indicated proteins and phosphorylation states were analyzed by immunoblotting. All lanes were from the same blot, and the irrelevant lanes were removed and indicated by dashed lines.
  • G Sestrinl expression in MEFs of the indicated genotypes was analyzed by immunoblotting.
  • H Sestrin2 expression in MEFs of the indicated genotypes was analyzed by immunoblotting.
  • agent may refer to a compound or entity of any chemical class including, for example, polypeptides, nucleic acids, saccharides, lipids, small molecules, metals, or combinations thereof.
  • an agent is or comprises a natural product in that it is found in and/or is obtained from nature.
  • an agent is or comprises one or more entities that is man-made in that it is designed, engineered, and/or produced through action of the hand of man and/or is not found in nature.
  • an agent may be utilized in isolated or pure form; in some embodiments, an agent may be utilized in crude form.
  • potential agents are provided as collections or libraries, for example that may be screened to identify or characterize active agents within them.
  • agents that may be utilized in accordance with the present invention include small molecules, antibodies, antibody fragments, aptamers, nucleic acids (e.g., siR As, shR As, DNA/RNA hybrids, antisense oligonucleotides, ribozymes), peptides, peptide mimetics, etc.
  • an agent is or comprises a polymer.
  • an agent is not a polymer and/or is substantially free of any polymer.
  • an agent contains at least one polymeric moiety.
  • an agent lacks or is substantially free of any polymeric moiety.
  • amino acid in its broadest sense, refers to any compound and/or substance that can be incorporated into a polypeptide chain, e.g., through formation of one or more peptide bonds.
  • an amino acid has the general structure H2N-C(H)(R)-COOH.
  • an amino acid is a naturally- occurring amino acid.
  • an amino acid is a synthetic amino acid; in some embodiments, an amino acid is a D-amino acid; in some embodiments, an amino acid is an L- amino acid.
  • Standard amino acid refers to any of the twenty standard L-amino acids commonly found in naturally occurring peptides.
  • Nonstandard amino acid refers to any amino acid, other than the standard amino acids, regardless of whether it is prepared synthetically or obtained from a natural source.
  • an amino acid including a carboxy- and/or amino-terminal amino acid in a polypeptide, can contain a structural modification as compared with the general structure above.
  • an amino acid may be modified by methylation, amidation, acetylation, and/or substitution as compared with the general structure.
  • such modification may, for example, alter the circulating half life of a polypeptide containing the modified amino acid as compared with one containing an otherwise identical unmodified amino acid.
  • such modification does not significantly alter a relevant activity of a polypeptide containing the modified amino acid, as compared with one containing an otherwise identical unmodified amino acid.
  • amino acid is used to refer to a free amino acid; in some embodiments it is used to refer to an amino acid residue of a polypeptide.
  • animal refers to any member of the animal kingdom. In some embodiments, “animal” refers to humans, at any stage of development. In some embodiments, “animal” refers to non-human animals, at any stage of development. In some embodiments, the non-human animal is a mammal (e.g., a rodent, a mouse, a rat, a rabbit, a monkey, a dog, a cat, a sheep, cattle, a primate, and/or a pig). In some embodiments, animals include, but are not limited to, mammals, birds, reptiles, amphibians, fish, and/or worms. In some embodiments, an animal may be a transgenic animal, genetically-engineered animal, and/or a clone.
  • Two events or entities are "associated" with one another, as that term is used herein, if the presence, level and/or form of one is correlated with that of the other.
  • a particular entity e.g., polypeptide
  • two or more entities are physically "associated” with one another if they interact, directly or indirectly, so that they are and remain in physical proximity with one another.
  • characteristic portion As used herein, the term "characteristic portion" is used, in the broadest sense, to refer to a portion of a substance whose presence (or absence) correlates with presence (or absence) of a particular feature, attribute, or activity of the substance.
  • a characteristic portion of a substance is a portion that is found in the substance and in related substances that share the particular feature, attribute or activity, but not in those that do not share the particular feature, attribute or activity. In certain embodiments, a characteristic portion shares at least one functional characteristic with the intact substance.
  • a "characteristic portion" of a protein or polypeptide is one that contains a continuous stretch of amino acids, or a collection of continuous stretches of amino acids, that together are characteristic of a protein or polypeptide. In some embodiments, each such continuous stretch generally contains at least 2, 5, 10, 15, 20, 50, or more amino acids.
  • a characteristic portion of a substance is one that, in addition to the sequence and/or structural identity specified above, shares at least one functional characteristic with the relevant intact substance.
  • a characteristic portion may be biologically active.
  • Characteristic sequence element refers to a sequence element found in a polymer (e.g., in a polypeptide or nucleic acid) that represents a characteristic portion of that polymer.
  • presence of a characteristic sequence element correlates with presence or level of a particular activity or property of the polymer.
  • presence (or absence) of a characteristic sequence element defines a particular polymer as a member (or not a member) of a particular family or group of such polymers.
  • a characteristic sequence element typically comprises at least two monomers (e.g., amino acids or nucleotides).
  • a characteristic sequence element includes at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25, 30, 35, 40, 45, 50, or more monomers (e.g., contiguously linked monomers).
  • a characteristic sequence element includes at least first and second stretches of contiguous monomers spaced apart by one or more spacer regions whose length may or may not vary across polymers that share the sequence element.
  • Combination therapy refers to those situations in which a subject is simultaneously exposed to two or more therapeutic regimens (e.g., two or more therapeutic agents). In some embodiments, two or more agents may be administered simultaneously; in some embodiments, such agents may be administered sequentially; in some embodiments, such agents are administered in overlapping dosing regimens.
  • Comparable refers to two or more agents, entities, situations, sets of conditions, etc that may not be identical to one another but that are sufficiently similar to permit comparison therebetween so that conclusions may reasonably be drawn based on differences or similarities observed.
  • comparable sets of conditions, circumstances, individuals, or populations are characterized by a plurality of substantially identical features and one or a small number of varied features.
  • Those of ordinary skill in the art will understand, in context, what degree of identity is required in any given circumstance for two or more such agents, entities, situations, sets of conditions, etc to be considered comparable.
  • sets of circumstances, individuals, or populations are comparable to one another when characterized by a sufficient number and type of substantially identical features to warrant a reasonable conclusion that differences in results obtained or phenomena observed under or with different sets of circumstances, individuals, or populations are caused by or indicative of the variation in those features that are varied.
  • the term "corresponding to” is often used to designate a structural element or moiety in an agent of interest that shares a position (e.g., in three-dimensional space or relative to another element or moiety) with one present in an appropriate reference agent.
  • the term is used to refer to position/identity of a residue in a polymer, such as an amino acid residue in a polypeptide or a nucleotide residue in a nucleic acid.
  • residues in such a polymer are often designated using a canonical numbering system based on a reference related polymer, so that a residue in a first polymer "corresponding to" a residue at position 190 in the reference polymer, for example, need not actually be the 190 th residue in the first polymer but rather corresponds to the residue found at the 190 th position in the reference polymer; those of ordinary skill in the art readily appreciate how to identify "corresponding" amino acids, including through use of one or more commercially-available algorithms specifically designed for polymer sequence comparisons.
  • Detectable Moiety or Entity refers to any element, molecule, functional group, compound, fragment or moiety that is detectable.
  • a detection entity is provided or utilized alone.
  • a detection entity is provided and/or utilized in association with (e.g., joined to) another agent. Examples of detection entities include, but are not limited to: various ligands,
  • radionuclides e.g., H, C, F, F, P, S, I, I, I, Cu, Re, In, ⁇ , Tc, Lu, 89 Zr etc.
  • fluorescent dyes for specific exemplary fluorescent dyes, see below
  • chemiluminescent agents such as, for example, acridinum esters, stabilized dioxetanes, and the like
  • bioluminescent agents such as, for example, acridinum esters, stabilized dioxetanes, and the like
  • bioluminescent agents such as, for example, acridinum esters, stabilized dioxetanes, and the like
  • bioluminescent agents such as, for example, acridinum esters, stabilized dioxetanes, and the like
  • bioluminescent agents such as, for example, acridinum esters, stabilized dioxetanes, and the like
  • bioluminescent agents such as, for example, acridin
  • Domain The term "domain” is used herein to refer to a section or portion of an entity.
  • a “domain” is associated with a particular structural and/or functional feature of the entity so that, when the domain is physically separated from the rest of its parent entity, it substantially or entirely retains the particular structural and/or functional feature.
  • a domain may be or include a portion of an entity tha, when separated from that (parent) entity and linked with a different (recipient) entity, substantially retains and/or imparts on the recipient entity one or more structural and/or functional features that characterized it in the parent entity.
  • a domain is a section or portion of a molecular (e.g., a small molecule, carbohydrate, a lipid, a nucleic acid, or a polypeptide).
  • a domain is a section of a polypeptide; in some such embodiments, a domain is characterized by a particular structural element (e.g., a particular amino acid sequence or sequence motif, a-helix character, ⁇ -sheet character, coiled-coil character, random coil character, etc), and/or by a particular functional feature (e.g., binding activity, enzymatic activity, folding activity, signaling activity, etc).
  • a particular structural element e.g., a particular amino acid sequence or sequence motif, a-helix character, ⁇ -sheet character, coiled-coil character, random coil character, etc
  • a particular functional feature e.g., binding activity, enzymatic activity, folding activity, signaling activity, etc.
  • determining can utilize or be accomplished through use of any of a variety of techniques available to those skilled in the art, including for example specific techniques explicitly referred to herein.
  • determining involves manipulation of a physical sample.
  • determining involves consideration and/or manipulation of data or information, for example utilizing a computer or other processing unit adapted to perform a relevant analysis.
  • determining involves receiving relevant information and/or materials from a source.
  • determining involves comparing one or more features of a sample or entity to a comparable reference.
  • Dosage form refers to a physically discrete unit of an active agent (e.g., a therapeutic or diagnostic agent) for administration to a subject.
  • Each unit contains a predetermined quantity of active agent.
  • such quantity is a unit dosage amount (or a whole fraction thereof) appropriate for administration in accordance with a dosing regimen that has been determined to correlate with a desired or beneficial outcome when administered to a relevant population (i.e., with a therapeutic dosing regimen).
  • a dosage amount or a whole fraction thereof
  • the total amount of a therapeutic composition or agent administered to a particular subject is determined by one or more attending physicians and may involve administration of multiple dosage forms.
  • Dosing regimen refers to a set of unit doses (typically more than one) that are administered individually to a subject, typically separated by periods of time.
  • a given therapeutic agent has a
  • a dosing regimen comprises a plurality of doses each of which are separated from one another by a time period of the same length; in some embodiments, a dosing regimen comprises a plurality of doses and at least two different time periods separating individual doses. In some embodiments, all doses within a dosing regimen are of the same unit dose amount. In some embodiments, different doses within a dosing regimen are of different amounts. In some embodiments, a dosing regimen comprises a first dose in a first dose amount, followed by one or more additional doses in a second dose amount different from the first dose amount.
  • a dosing regimen comprises a first dose in a first dose amount, followed by one or more additional doses in a second dose amount same as the first dose amount
  • a dosing regimen is correlated with a desired or beneficial outcome when administered across a relevant population (i.e., is a therapeutic dosing regimen).
  • Human In some embodiments, a human is an embryo, a fetus, an infant, a child, a teenager, an adult, or a senior citizen.
  • Identity refers to the overall relatedness between polymeric molecules, e.g., between nucleic acid molecules (e.g., DNA molecules and/or RNA molecules) and/or between polypeptide molecules.
  • polymeric molecules are considered to be “substantially identical” to one another if their sequences are at least 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% identical.
  • Calculation of the percent identity of two nucleic acid or polypeptide sequences can be performed by aligning the two sequences for optimal comparison purposes (e.g., gaps can be introduced in one or both of a first and a second sequences for optimal alignment and non-identical sequences can be disregarded for comparison purposes).
  • the length of a sequence aligned for comparison purposes is at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or substantially 100% of the length of a reference sequence. The nucleotides at corresponding positions are then compared.
  • the percent identity between the two sequences is a function of the number of identical positions shared by the sequences, taking into account the number of gaps, and the length of each gap, which needs to be introduced for optimal alignment of the two sequences.
  • the comparison of sequences and determination of percent identity between two sequences can be accomplished using a mathematical algorithm. For example, the percent identity between two nucleotide sequences can be determined using the algorithm of Meyers and Miller (CABIOS, 1989, 4: 1 1-17), which has been incorporated into the ALIGN program (version 2.0).
  • nucleic acid sequence comparisons made with the ALIGN program use a PAM120 weight residue table, a gap length penalty of 12 and a gap penalty of 4.
  • the percent identity between two nucleotide sequences can,
  • Modulator is used to refer to an entity whose presence or level in a system in which an activity of interest is observed correlates with a change in level and/or nature of that activity as compared with that observed under otherwise comparable conditions when the modulator is absent.
  • a modulator is an activator, in that activity is increased in its presence as compared with that observed under otherwise comparable conditions when the modulator is absent.
  • a modulator is an antagonist or inhibitor, in that activity is reduced in its presence as compared with otherwise comparable conditions when the modulator is absent.
  • a modulator interacts directly with a target entity whose activity is of interest.
  • a modulator interacts indirectly (i.e., directly with an intermediate agent that interacts with the target entity) with a target entity whose activity is of interest.
  • a modulator affects level of a target entity of interest; alternatively or additionally, in some embodiments, a modulator affects activity of a target entity of interest without affecting level of the target entity.
  • a modulator affects both level and activity of a target entity of interest, so that an observed difference in activity is not entirely explained by or commensurate with an observed difference in level.
  • Peptide refers to a polypeptide that is typically relatively short, for example having a length of less than about 100 amino acids, less than about 50 amino acids, less than 20 amino acids, or less than 10 amino acids.
  • composition refers to an active agent, formulated together with one or more pharmaceutically acceptable carriers.
  • active agent is present in unit dose amount appropriate for administration in a therapeutic regimen, for example that shows a statistically significant probability of achieving a predetermined therapeutic effect when administered to a relevant population or system (e.g., model system).
  • compositions may be specially formulated for administration in solid or liquid form, including those adapted for the following: oral administration, for example, drenches (aqueous or nonaqueous solutions or suspensions), tablets, e.g., those targeted for buccal, sublingual, and systemic absorption, boluses, powders, granules, pastes for application to the tongue; parenteral administration, for example, by subcutaneous, intramuscular, intravenous or epidural injection as, for example, a sterile solution or suspension, or sustained-release formulation; topical application, for example, as a cream, ointment, or a controlled-release patch or spray applied to the skin, lungs, or oral cavity; intravaginally or intrarectally, for example, as a pessary, cream, or foam; sublingually; ocularly; transdermally; or nasally, pulmonary, and to other mucosal surfaces.
  • oral administration for example, drenches (aqueous or nonaqueous solutions or suspensions),
  • Polypeptide typically refers to a polymer of at least three amino acids and/or to a polymer in which monomers are linked to one another via peptide bonds.
  • the term is used to refer to a "polypeptide” that occurs in nature; in some embodiments, the term is used to refer to a "polypeptide” that was engineered (e.g., designed and/or manufactured) by the hand of man.
  • a polypeptide may comprise or consist of natural amino acids, non-natural amino acids, or both.
  • a polypeptide may comprise or consist of only natural amino acids or only non-natural amino acids.
  • a polypeptide may comprise D-amino acids, L-amino acids, or both. In some embodiments, a polypeptide may comprise only D-amino acids. In some embodiments, a polypeptide may comprise only L-amino acids. In some embodiments, a polypeptide may include one or more pendant groups or other modifications, e.g., modifying or attached to one or more amino acid side chains, at the polypeptide's N-terminus, at the polypeptide's C-terminus, or any
  • a polypeptide may be cyclic, and/or may comprise a cyclic portion. In some embodiments, a polypeptide is not cyclic and/or does not comprise any cyclic portion. In some embodiments, a polypeptide is linear. In some embodiments, a polypeptide may be or comprise a stapled polypeptide.
  • polypeptide may be appended to a name of a reference polypeptide, activity, or structure; in such instances it is used herein to refer to polypeptides that share the relevant activity or structure and thus can be considered to be members of the same class or family of polypeptides.
  • the present specification provides and/or those skilled in the art will be aware of exemplary polypeptides within the class whose amino acid sequences and/or functions are known; in some embodiments, such exemplary polypeptides are reference polypeptides for the polypeptide class.
  • a member of a polypeptide class or family shows significant sequence homology or identity with, shares a common sequence motif (e.g., a characteristic sequence element) with, and/or shares a common activity (in some embodiments at a comparable level or within a designated range) with a reference polypeptide of the class; in some embodiments with all polypeptides within the class).
  • a common sequence motif e.g., a characteristic sequence element
  • shares a common activity in some embodiments at a comparable level or within a designated range
  • a member polypeptide shows an overall degree of sequence homology or identity with a reference polypeptide that is at least about 30-40%, and is often greater than about 50%, 60%, 70%, 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more and/or includes at least one region (i.e., a conserved region that may in some embodiments may be or comprise a characteristic sequence element) that shows very high sequence identity, often greater than 90% or even 95%, 96%, 97%, 98%, or 99%.
  • a conserved region that may in some embodiments may be or comprise a characteristic sequence element
  • Such a conserved region usually encompasses at least 3-4 and often up to 20 or more amino acids; in some embodiments, a conserved region encompasses at least one stretch of at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1, 12, 13, 14, 15 or more contiguous amino acids.
  • a useful polypeptide may comprise or consist of a fragment of a parent polypeptide.
  • a useful polypeptide as may comprise or consist of a plurality of fragments, each of which is found in the same parent polypeptide in a different spatial arrangement relative to one another than is found in the polypeptide of interest (e.g., fragments that are directly linked in the parent may be spatially separated in the polypeptide of interest or vice versa, and/or fragments may be present in a different order in the polypeptide of interest than in the parent), so that the polypeptide of interest is a derivative of its parent polypeptide.
  • Reference is often used herein to describe a standard or control agent or value against which an agent or value of interest is compared.
  • a reference agent is tested and/or a reference value is determined substantially simultaneously with the testing or determination of the agent or value of interest.
  • a reference agent or value is a historical reference, optionally embodied in a tangible medium.
  • a reference agent or value is determined or characterized under conditions comparable to those utilized to determine or characterize the agent or value of interest.
  • sample typically refers to a biological sample obtained or derived from a source of interest, as described herein.
  • a source of interest comprises an organism, such as an animal or human.
  • a biological sample is or comprises biological tissue or fluid.
  • a biological sample may be or comprise bone marrow; blood; blood cells; ascites; tissue or fine needle biopsy samples; cell-containing body fluids; free floating nucleic acids; sputum; saliva; urine;
  • a biological sample is or comprises cells obtained from an individual.
  • obtained cells are or include cells from an individual from whom the sample is obtained.
  • a sample is a "primary sample" obtained directly from a source of interest by any appropriate means.
  • a primary biological sample is obtained by methods selected from the group consisting of biopsy (e.g., fine needle aspiration or tissue biopsy), surgery, collection of body fluid (e.g., blood, lymph, feces etc.), etc.
  • sample refers to a preparation that is obtained by processing (e.g., by removing one or more components of and/or by adding one or more agents to) a primary sample. For example, filtering using a semi-permeable membrane.
  • processing e.g., by removing one or more components of and/or by adding one or more agents to
  • filtering using a semi-permeable membrane.
  • Such a "processed sample” may comprise, for example nucleic acids or proteins extracted from a sample or obtained by subjecting a primary sample to techniques such as amplification or reverse transcription of mRNA, isolation and/or purification of certain components, etc.
  • Small molecule means a low molecular weight organic and/or inorganic compound.
  • a "small molecule” is a molecule that is less than about 5 kilodaltons (kD) in size.
  • a small molecule is less than about 4 kD, 3 kD, about 2 kD, or about 1 kD.
  • the small molecule is less than about 800 daltons (D), about 600 D, about 500 D, about 400 D, about 300 D, about 200 D, or about 100 D.
  • a small molecule is less than about 2000 g/mol, less than about 1500 g/mol, less than about 1000 g/mol, less than about 800 g/mol, or less than about 500 g/mol. In some embodiments, a small molecule is not a polymer. In some embodiments, a small molecule does not include a polymeric moiety. In some embodiments, a small molecule is not a protein or polypeptide (e.g., is not an oligopeptide or peptide). In some embodiments, a small molecule is not a polynucleotide (e.g., is not an oligonucleotide). In some embodiments, a small molecule is not a polysaccharide.
  • a small molecule does not comprise a polysaccharide (e.g., is not a glycoprotein, proteoglycan, glycolipid, etc.). In some embodiments, a small molecule is not a lipid. In some embodiments, a small molecule is a modulating agent. In some embodiments, a small molecule is biologically active. In some embodiments, a small molecule is detectable (e.g., comprises at least one detectable moiety). In some embodiments, a small molecule is a therapeutic.
  • the term "specific”, when used herein with reference to an agent having an activity, is understood by those skilled in the art to mean that the agent discriminates between potential target entities or states.
  • an agent is said to bind "specifically" to its target if it binds preferentially with that target in the presence of one or more competing alternative targets.
  • specific interaction is dependent upon the presence of a particular structural feature of the target entity (e.g., an epitope, a cleft, a binding site). It is to be understood that specificity need not be absolute. In some embodiments, specificity may be evaluated relative to that of the binding agent for one or more other potential target entities (e.g., competitors).
  • specificity is evaluated relative to that of a reference specific binding agent. In some embodiments specificity is evaluated relative to that of a reference non-specific binding agent. In some embodiments, the agent or entity does not detectably bind to the competing alternative target under conditions of binding to its target entity. In some embodiments, binding agent binds with higher on-rate, lower off-rate, increased affinity, decreased dissociation, and/or increased stability to its target entity as compared with the competing alternative target(s).
  • Subject By “subject” is meant a mammal (e.g., a human, in some embodiments including prenatal human forms). In some embodiments, a subject is suffering from a relevant disease, disorder or condition. In some embodiments, a subject is susceptible to a disease, disorder, or condition. In some embodiments, a subject displays one or more symptoms or characteristics of a disease, disorder or condition. In some embodiments, a subject does not display any symptom or characteristic of a disease, disorder, or condition. In some
  • a subject is someone with one or more features characteristic of susceptibility to or risk of a disease, disorder, or condition.
  • a subject can be a patient, which refers to a human presenting to a medical provider for diagnosis or treatment of a disease.
  • a subject is an individual to whom therapy is administered.
  • a disease, disorder, or condition e.g., influenza
  • an individual who is susceptible to a disease, disorder, or condition does not display any symptoms of the disease, disorder, or condition.
  • an individual who is susceptible to a disease, disorder, or condition has not been diagnosed with the disease, disorder, and/or condition.
  • an individual who is susceptible to a disease, disorder, or condition is an individual who has been exposed to conditions associated with development of the disease, disorder, or condition.
  • a risk of developing a disease, disorder, and/or condition is a population-based risk (e.g., family members of individuals suffering from the disease, disorder, or condition).
  • therapeutically effective amount refers to an amount of a therapeutic protein which confers a therapeutic effect on the treated subject, at a reasonable benefit/risk ratio applicable to any medical treatment.
  • the therapeutic effect may be objective (i.e., measurable by some test or marker) or subjective (i.e., subject gives an indication of or feels an effect).
  • therapeutically effective amount refers to an amount of a therapeutic protein or composition effective to treat, ameliorate, or prevent a desired disease or condition, or to exhibit a detectable therapeutic or preventative effect, such as by ameliorating symptoms associated with the disease, preventing or delaying the onset of the disease, and/or also lessening the severity or frequency of symptoms of the disease.
  • a therapeutically effective amount is commonly administered in a dosing regimen that may comprise multiple unit doses.
  • a therapeutically effective amount (and/or an appropriate unit dose within an effective dosing regimen) may vary, for example, depending on route of administration, on combination with other pharmaceutical agents.
  • the specific therapeutically effective amount (and/or unit dose) for any particular patient may depend upon a variety of factors including the disorder being treated and the severity of the disorder; the activity of the specific pharmaceutical agent employed; the specific composition employed; the age, body weight, general health, sex and diet of the patient; the time of administration, route of administration, and/or rate of excretion or metabolism of the specific fusion protein employed; the duration of the treatment; and like factors as is well known in the medical arts.
  • treatment refers to any administration of a substance (e.g., provided compositions) that partially or completely alleviates, ameliorates, relives, inhibits, delays onset of, reduces severity of, and/or reduces incidence of one or more symptoms, features, and/or causes of a particular disease, disorder, and/or condition .
  • a substance e.g., provided compositions
  • such treatment may be administered to a subject who does not exhibit signs of the relevant disease, disorder and/or condition and/or of a subject who exhibits only early signs of the disease, disorder, and/or condition.
  • treatment may be administered to a subject who exhibits one or more established signs of the relevant disease, disorder and/or condition.
  • treatment may be of a subject who has been diagnosed as suffering from the relevant disease, disorder, and/or condition.
  • treatment may be of a subject known to have one or more susceptibility factors that are statistically correlated with increased risk of development of the relevant disease, disorder, and/or condition.
  • Unit dose refers to an amount administered as a single dose and/or in a physically discrete unit of a pharmaceutical composition.
  • a unit dose contains a predetermined quantity of an active agent.
  • a unit dose contains an entire single dose of the agent.
  • more than one unit dose is administered to achieve a total single dose.
  • administration of multiple unit doses is required, or expected to be required, in order to achieve an intended effect.
  • a unit dose may be, for example, a volume of liquid (e.g., an acceptable carrier) containing a predetermined quantity of one or more therapeutic agents, a predetermined amount of one or more therapeutic agents in solid form, a sustained release formulation or drug delivery device containing a predetermined amount of one or more therapeutic agents, etc. It will be appreciated that a unit dose may be present in a formulation that includes any of a variety of components in addition to the therapeutic agent(s). For example, acceptable carriers (e.g., pharmaceutically acceptable carriers), diluents, stabilizers, buffers, preservatives, etc., may be included as described infra.
  • acceptable carriers e.g., pharmaceutically acceptable carriers
  • diluents e.g., diluents, stabilizers, buffers, preservatives, etc.
  • a total appropriate daily dosage of a particular therapeutic agent may comprise a portion, or a plurality, of unit doses, and may be decided, for example, by the attending physician within the scope of sound medical judgment.
  • the specific effective dose level for any particular subject or organism may depend upon a variety of factors including the disorder being treated and the severity of the disorder; activity of specific active compound employed; specific composition employed; age, body weight, general health, sex and diet of the subject; time of administration, and rate of excretion of the specific active compound employed; duration of the treatment; drugs and/or additional therapies used in combination or coincidental with specific compound(s) employed, and like factors well known in the medical arts.
  • the mechanistic target of rapamycin complex 1 contains the serine/threonine kinase mTOR as well as Raptor and mLST8.
  • the complex is a master regulator of fundamental biological processes including but not limited to transcription, translation, autophagy, actin organization and ribosome biogenesis.
  • mTORCl regulates this processes through its integration of intracellular and extracellular signals - sensing growth factors, changes in nutrient and energy availability and cellular stress . Most, but not all, of the mTORCl signaling occurs through Rheb and Rag.
  • Rheb and Rags function on endomembranes to regulate mTORCl signaling (Betz and Hall, 2013). While Rheb is targeted to the endomembranes via a lipid-binding motif (Saito et al, 2005), Rags are anchored to the lysosomal surface by the
  • Ragulator complex (Sancak et al, 2010).
  • Rags function as obligate heterodimers in which RagA or the highly related RagB bind to RagC or RagD, which are homologous to each other (Kim et al, 2008; Sancak et al, 2008; Sekiguchi et al, 2001).
  • the active Rag complex consisting of RagA/B in the GTP-bound state and RagC/D in the GDP-bound state (RagA/BGTP-RagC/DGDP), promotes mTORC 1 translocation to the lysosome, where GTP-bound Rheb stimulates the mTOR kinase.
  • GTPase-activating proteins GTPase-activating proteins
  • GEFs guanine nucleotide exchange factors
  • GDIs guanine nucleotide dissociation inhibitors
  • TSC2 component of the trimeric tuberous sclerosis complex is a GAP for Rheb, which inhibits Rheb by converting it from the GTP-bound state to the GDP-bound state (Inoki et al, 2003; Tee et al, 2003). While TSC phosphorylation by the energy sensor AMP-responsive protein kinase (AMPK) promotes its activation, growth factor-induced
  • PI3K/Akt pathway phosphorylates and inactivates TSC (Laplante and Sabatini, 2012).
  • Multiple GAPs have been identified for Rags, including the GATORl complex for RagA/B (Bar-Peled et al, 2013), the FLCN-FNIP complex for RagC/D (Tsun et al, 2013), and possibly the leucyl- tRNA synthase for RagD (Han et al, 2012).
  • the Ragulator complex functions as a GEF for RagA/B, whose activity is induced via the lysosomal v-ATPase upon amino acid stimulation (Bar-Peled et al, 2012).
  • Sestrins are evolutionarily conserved proteins whose expression is upregulated by various environmental insults including genotoxic, oxidative, and nutritional stress (Lee et al, 2013). Whereas mammalian Sestrinl and Sestrin2 are regulated by p53 (Budanov et al., 2004), Sestrinl and Sestrin3 as well as the Drosophila Sestrin (dSestrin) are target genes of the Foxo family of transcription factors (Chen et al, 2010; Lee et al, 2010; Ouyang et al, 2012).
  • Sestrin overexpression potently suppresses mTORCl signaling (Budanov and Karin, 2008), and conveys stress signals for the reprogramming of cellular metabolism and the restoration of organismal homeostasis (Lee et al, 2013). Indeed, while dSestrin gain-of-function inhibits mTORCl signaling and cell growth in Drosophila, dSestrin deficiency results in an age-dependent metabolic syndrome caused by mTORCl hyper-activation (Lee et al, 2010).
  • Sestrin2- deficient mice fail to inactivate mTORCl in the liver during fasting (Bae et al., 2013), and spontaneously elevated mTORCl signaling is observed in mice devoid of both Sestrin2 and Sestrin3 (Lee et al, 2012).
  • the present disclosure defines a mechanism for Sestrin inhibition of mTORCl, and furthermore defines certain modulators of mTORCl activity based on this mechanism and/or on the structure of Sestrins.
  • the present disclosure specifically demonstrates, for example, that Sestrins can inhibit mTORCl signaling independent of TSC and/or of AMPK.
  • the present disclosure demonstrates that Sestrins inhibit Rag- dependent mTORCl lysosomal Translocation.
  • the present disclosure specifically demonstrates that Sestrins interact with RAGs, and in particular enhance RagBQ99L-induced mTORCl activation under amino acid starvation conditions.
  • Sestrins can act as GDIs for RagA and/or RagB. Moreover, the present disclosure defines a Sestrin peptide GDI motif that itself can achieve (e.g., is sufficient for) mTORCl modulation as described herein.
  • mTORCl Modulatory Agents e.g., is sufficient for
  • the present disclosure provides mTORCl modulatory agents, and in particular mTORCl inhibitory agents.
  • mTORCl modulatory agents are mTORCl -specific modulatory agents; in some such embodiments, provided mTORCl modulatory agents specifically modulate mTORCl signaling as compared with mTORC2 signaling.
  • provided mTORCl modulatory agents show one or more structural and/or functional characteristics of Sestrins as described herein.
  • provided mTORCl modulatory agents inhibit mTORCl signaling independent of TSC and/or of AMPK.
  • provided mTORCl modulatory agents modulate mTORCl signaling in a Rag-GTPas dependent manner.
  • provided mTORCl modulatory agents inhibit Rag-dependent mTORCl lysosomal
  • provided mTORCl modulatory agents interact with (e.g., bind directly to) RAGs.
  • provided mTORCl modulatory agents enhance RagBQ99L-induced mTORCl activation under amino acid starvation conditions.
  • provided mTORCl modulatory agents can act as GDIs for RagA and/or RagB.
  • modulation of mTORCl signaling activity occurs in an mTORCl signaling system.
  • an mTORCl signaling system is or comprises one or more intact cells, tissues, organs, or organisms, e.g., from bacteria, yeast, animals (e.g., mammals), and/or humans.
  • an mTORCl signaling system is an in vitro system.
  • an appropriate mTORCl signaling system is any system in which mTORC 1 signaling can be propagated and detected.
  • particular mTORCl signaling activity can be determined by the measurement of the phosphorylation state of one or more downstream targets.
  • downstream targets may include but are not limited to 4E-BP 1, p70s6K (S6K), LC3, or AKT.
  • mTORCl signaling activity is measured during amino acid starvation.
  • an mTORCl modulatory agent provided in accordance with the present invention shows an mTORCl modulatory activity at least comparable to that of a Sestrin and/or of a Sestrin peptide agent as described herein.
  • Polypeptide Agents e.g., Sestrin polypeptide agents
  • the present disclosure provides mTORCl modulatory agents that are peptides whose amino acid sequence includes a Sestrin GDI motif.
  • the present specification defines, characterizes, and/or describes various Sestrin peptide agents that modulate mTORCl signaling as described herein.
  • a provided Sestrin peptide agent has an amino acid sequence that includes a Sestrin peptide GDI motif as described herein.
  • the Sestrin peptide GDI motif corresponds to a sequence element found in a mammalian Sestrin.
  • a Sestrin peptide agent as described herein includes a human Sestrin peptide GDI motif; in some embodiments a Sestrin peptide agent as described herein includes a mouse Sestrin peptide GDI motif; in some embodiments a Sestrin peptide agent as described herein includes a Sestrin peptide GDI motif that corresponds to a consensus human/mouse and/or mammalian GDI motif.
  • the present specification provides mTORCl modulatory agents that are polypeptides whose amino acid sequence is or comprises a Sestrin GDI domain.
  • provided mTORCl modulatory agents are polypeptides whose amino acid sequence further includes one or more other elements, motifs, or domains such as, for example, one or more linkers, targeting moieties, cell permeability domains, etc.
  • a provided polypeptide mTORCl modulatory agent is or comprises a cyclic peptide.
  • a provided polypeptide mTORC 1 modulatory agent, or one or more motifs or domains therein is or comprises a stapled peptide.
  • a Sestrin GDI motif as described herein shows at least
  • a reference Sestrin GDI motif such as, for example amino acids 410-431 of a mouse Sestrin2 protein (e.g., SEQ ID NO.: 1), amino acids 410-431 of human Sestrin2 (e.g., SEQ ID NO.:2), amino acids 422-443 of mouse Sestrin l(e.g., SEQ ID NO.:3), amino acids 422-443 of human Sestrin 1 (e.g., SEQ ID NO.:4), amino acids 422-443 of mouse Sestrin3 (e.g., SEQ ID NO.: 5), and/or amino acids 422-443 of human Sestrin3 (e.g., SEQ ID NO.:6).
  • a mouse Sestrin2 protein e.g., SEQ ID NO.: 1
  • amino acids 410-431 of human Sestrin2 e.g., SEQ ID NO.:2
  • amino acids 422-443 of mouse Sestrin l e.g.,
  • a Sestrin GDI motif comprises or consists of at least the three positively charged residues found in the human Sestrin2 GDI motif set forth in SEQ ID NO: l .
  • a Sestrin GDI motif comprises or consists of a positively charged residue at positions corresponding to 419, 422, and/or 426 of SEQ ID NO: 1).
  • a Sestrin GDI motif has a glutamic acid at a position corresponding to position 418 of such a reference GDI motif (which may represent a sequence difference relative to such reference GDI motif).
  • a Sestrin GDI motif or domain has an amino acid sequence that comprises or consists of YGEVNQLLE(418)RNLKVYIKTVACY.
  • presence of a Sestrin GDI motif in a polypeptide mTORC 1 modulator as described herein correlates with mTORCl modulatory activity and/or with one or more features thereof.
  • a polypeptide mTORCl modulatory agent as described herein has an amino acid sequence that includes a cell permeability motif or domain.
  • a cell permeability motif or domain is one that shows at least 80%, 85%, 90%, 95%, Or 100% sequence identity with a reference cell permeability motif or domain, such as are known in the art.
  • a variety of amino acid sequence elements, particularly those characterized by cationic surface residues see, for example, Ryser Science 150:501, 1965; Green, Cell 55: 1179, 1988; Frankel, Cell 55: 1189, 1988; Joliot Proc. Natl. Acad. Sci. U.S.A.
  • Arginine-rich sequences and particularly arginine-rich peptides with significant alpha-helical character are known to act as cell permability motifs or domains (see, for example, Wender Proc. Natl. Acad. Sci. U.S.A. 97: 13003, 2000, ; Deshayes Cell. Mol. Life Sci. 62: 1839, 2005).
  • a reference cell permeability motif or domain is or comprises a Tat polypeptide , for example having an amino acid sequence as set forth in SEQ ID NO.:7).
  • a polypeptide mTORCl modulatory agent as described herein has an amino acid sequence that includes a linker motif or domain.
  • a linker motif or domain is characterized by absence of rigid structural motifs.
  • a linker motif or domain has a length between a lower limit and an upper limit, the upper limit being larger than the lower limit.
  • such a lower limit is at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more amino acids, inclusive.
  • such an upper limit is less than 50, 45, 40, 35, 30, 25, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, or fewer amino acids.
  • a linker motif or domain is or comprises a plurality of glycine residues.
  • a linker motif or domain is or comprises two adjacent glycines.
  • mTORCl modulatory agents e.g., Sestrin polypeptide agents such as, for example, Sestrins
  • systems and technologies for identifying and/or characterizing useful mTORCl modulatory agents of any chemical class e.g., Sestrin polypeptide agents such as, for example, Sestrins
  • agents that show mTORCl modulatory (e.g., inhibitory) activity at least comparable to that of at least one Sestrin polypeptide agent (e.g., at least one Sestrin) as described herein, for example in one or more assays as described herein.
  • mTORCl modulatory e.g., inhibitory
  • a candidate mTORCl modulatory agent is or comprises a polypeptide, a nucleic acid, a carbohydrate, a lipid, and/or a small molecule. Small molecule mTORCl modulatory agents are of particular interest.
  • the mTORCl modulatory agent comprises a targeting moiety or is encapsulated to be released at a specific disease site.
  • mTORCl is a sensor for many environmental cues and regulates a large number of downstream effectors and implicated in numerous conditions and diseases. Below, particular conditions are discussed and/or highlighted. Those skilled in the art, reading the present disclosure, however, will readily appreciate that its teachings are not limited only to these particularly exemplified diseases, disorders, and conditions.
  • one or more provided mTORCl modulatory agents may be useful in the treatment of a disease, disorder or condition associated with mTORCl signaling.
  • one or more such mTORCl modulatory agents may be administered to a subject suffering from or susceptible to such a disease, disorder or condition, according to a dosing regimen that is and/or has been shown to be (e.g., in a relevant model and/or population) correlated with a desirable outcome (e.g., reduction in magnitude and/or frequency of, and/or delay of onset of, one or more symptoms or characteristics of the disease, disorder or condition) with respect to an mTORCl -associated disease, disorder or condition.
  • a dosing regimen e.g., in magnitude and/or frequency of, and/or delay of onset of, one or more symptoms or characteristics of the disease, disorder or condition
  • the disease, disorder, or condition may be or comprise diabetes mellitus, obesity, aging or a disease, disorder, or condition that may be related to aging (e.g., a cardiovascular diseases, disorder or condition, a neurodegenerative disease, disorder or condition, a metabolic disease, disorder or condition), an inflammatory disease, disorder or condition (e.g., arthritis), and/or cancer.
  • a cardiovascular diseases, disorder or condition e.g., a cardiovascular diseases, disorder or condition, a neurodegenerative disease, disorder or condition, a metabolic disease, disorder or condition
  • an inflammatory disease, disorder or condition e.g., arthritis
  • cancer e.g., arthritis
  • one or more provided mTORCl modulatory agents may not be useful in the treatment of cancer, particularly if such agents have activity specific to mTORCl signaling relative to mTORC2 signaling.
  • provided methods of treatment may include administering an mTORCl modulatory agent in combination with one or more other therapies for treatment of the mTORCl -associated disease, disorder or condition or of one or more other diseases, disorders or conditions from which the relevant subject is suffering or to which the relevant subject is susceptible.
  • such other therapies are or comprise therapies that have received marketing approval from a relevant regulatory agent and/or have otherwise been correlated with a desirable outcome or attribute relevant to the subject and/or the particular disease, disorder or condition involved.
  • mTORCl modulatory agents as described herein are administered in the context of pharmaceutically acceptable compositions, as is known in the art, and according to a dosing regimen that includes one or more doses, optionally spaced out over time (e.g., at determined and/or regular intervals).
  • mTOR has been implicated in organism aging, at least in part due to a finding that removal of its ortholog from yeast increased the organisms life span. Indeed, the well characterized mTOR inhibitor rapamycin shows an anti-aging effect from yeast to mammals (Fontana et al, 2010). However, significant side effects have been observed after prolonged treatment with rapamycin, which prevents its use in humans as an anti-aging drug (Lamming et al, 2013). It is believed that some of the side effects of long-term rapamycin treatment are caused by its inhibition of mTORC2 (Lamming et al, 2012). Recent findings suggest that mTORCl signaling plays a major role in the rate of tissue and cellular aging.
  • the present disclosure provides mTORCl modulators that show specific activity on mTORCl signaling relative to mTORC2 signaling; such modulatory agents are particularly useful in the treatment of various diseases, disorders, and conditions, including for example various aging-associated diseases, disorders and conditions.
  • mTORCl is central to sensing nutrient intake. Consumption of high fat diets has been demonstrated to activate mTORCl and reduce food consumption. Moreover, overactivation of mTORCl induces adipogenesis. Therefore, alterations in mTORC activity can effect obesity. Additionally, though increases in activity of mTORCl can result in increased ⁇ -cell insulin secretion, obesity or high fat diets can lead to mTORCl mediated phosphorylation of p70s6K in other cell types such as skeletal muscle. p70s6K (S6K) can phosphorylate insulin receptor substrate which inhibits insulin sensitivity resulting in diabetes mellitus. Various mTORCl modulators as provided herein are useful in the treatment of obesity and/or diabetes.
  • mTORCl Due to its role in regulating protein synthesis, cellular proliferation and metabolism mTORCl can be implicated in tumorigenisis and cancer progression through numerous signaling pathways. mTORCl regulates the activity of 4E-BP1 which is a regulator of protein synthesis . mTORCl modulation of 4E-BP1 can relive the 4E-BP1 inhibibition of eukaryotic translation initiation factor 4E (eiF4E) leading to the potential translation of oncogenes. mTORCl can also lead to tumorigenisis by suppressing autophagy or promoting angiogenesis through regulating hypoxia- inducible factor la.
  • eiF4E eukaryotic translation initiation factor
  • Sestrin3tmla(EUCOMM)Wtsi/WtsiBiat, EMMA ID: 05719) Sestrin2-/- mice were generated from ES cells obtained from EUCOMM (Sestrin2tmla(KOMP)Wtsi, clone number: EPD0524_3_B 11). Sestrinl conditional knockout mice were generated by homologous recombination. A BAC clone (RP24-127A24) spanning the whole genomic sequence of
  • Sestrinlb was obtained from CHORI.
  • the loxp site on the backbone of the BAC was removed by a Zeo cassette flanked by the BAC vector sequence.
  • a loxp-Neo-loxp cassette was introduced to create the orphan loxp site in intron 1 after Cre expression in SW106.
  • a Neo cassette with a loxp site was inserted between exon 6 and exon 7, which was followed by insertion of a DTA/AMP cassette.
  • the BAC targeting vector was used to generate recombinant mouse ES cells that were injected to create chimeric mice at the Mouse Genetics Core Facility of MSKCC.
  • the Neo cassette was removed by breeding the germ line-transmitted mice with the Flipase transgenic mice (Jackson Laboratory).
  • the CMV-Cre deleter mice (Jackson Laboratory) were used to generate null alleles for Sestrinl and Sestrin3. All mice were maintained in a specific pathogen-free facility and animal experimentation was conducted in accordance with
  • Sestrinl+/-, Sestrin2+/-, and Sestrin3+/- mice were crossed to each other to create
  • Sestrin triple knockout MEFs MEFs from El 3.5 embryos of indicated genotype were prepared by chemical digestion followed by mechanical disaggregation. Wild type, Sestrinl+/-2-/-3+/-, Sestrinl+/-2-/-3-/-, and Sestrinl-/-2-/-3-/- MEFs were immortalized by the expression of SV40 large T antigen.
  • the cDNAs of mouse Sestrinl, Sestrin2, and Sestrin3 were cloned from the total mRNA of mouse T lymphocytes. Sestrins were cloned into the plnducer21 vector using gateway cloning with a FLAG tag added to the N-terminus.
  • plnducer21 is an all-in-one lentiviral doxycycline-inducible vector with an EGFP selection marker driven by an independent promoter.
  • lentiviruses produced in HEK293T cells were used to infect target cells. GFP-positive cells were sorted by FACS (>99.5% purity), and used for experiments.
  • the FLAG-tagged Sestrins were also cloned into the pcDNA3.1 vector for transient transfection experiments.
  • HEK293T cells were plated in a 6-cm culture dish. On the next day, 100 ng pRK5-based Rag GTPase and pcDNA3.1 -based Sestrin expression plasmids were co-transfected. Thirty-six hours later, cells were lysed, and the protein extracts were prepared.
  • CST Buffer (CST) supplemented with one tablet of EDTA-free protease inhibitor (Roche) per 50 ml and one tablet of PhosSTOP (Roche) per 10 ml.
  • EDTA-free protease inhibitor Roche
  • PhosSTOP PhosSTOP
  • cells were lysed with CHAPS lysis buffer (40 mM HEPES [pH 7.4], 0.3% CHAPS, 10 mM -glycerol phosphate, 10 mM pyrophosphate and 2.5 mM MgC12) supplemented with the EDTA-free protease inhibitor and PhosSTOP.
  • CHAPS lysis buffer 40 mM HEPES [pH 7.4], 0.3% CHAPS, 10 mM -glycerol phosphate, 10 mM pyrophosphate and 2.5 mM MgC12
  • the soluble fractions of cell lysates were isolated by centrifugation at 14,000 rpm for 6 min.
  • the FLAG-M2 affinity gel was pre-blocked with 5% BSA/PBS for 30 min and washed 3 times with the lysis buffer. 20 ⁇ of 50% slurry of the affinity gel was added, and incubated with the lysates for 1 - 3 h at 4 °C.
  • the beads were washed five times with the lysis buffer containing 150 mM NaCl. Immunoprecipitated proteins were denatured by the additionof 30 - 60 ⁇ of sample buffer and boiling for 5 min, resolved by 10% SDS-PAGE, and analyzed by immunoblotting.
  • HEK293T, HeLa, and MEFs were treated with doxycycline to induce Sestrin expression.
  • cells were rinsed once with amino acid- and/or glucose-free DMEM, incubated with amino acid- and/or glucose-free DMEM supplemented with 10% dialyzed FBS (dFBS) for 60 min, and stimulated with the amino acid and glucose-replete DMEM for 10 - 20 min.
  • dFBS dialyzed FBS
  • amino acid dose responses cells were cultured with the DMEM containing 100%, 50%, 20%, 5%, or 0% amino acids for 60 min.
  • serum starvation cells were incubated with DMEM without FBS for 2 h. After treatment, cells were lysed, and protein extracts were prepared for immunoblotting.
  • the Tat-Sestrin2-GDI motif (T-G) peptide (YGRKKRRQRRR-GG- YGEV QLLERNLKIYIKTVACY) was made of 1 1 amino acids from the Tat protein transduction domain attached via a G2 linker to a Sestrin2 GDI motif spanning the amino acids 410 - 431.
  • the Tat-Sestrin2-GDI motif-Scramble (T-S) peptide (YGRKKRRQRRR-GG- RYKNVYLAEQTEILVGCNILKY) was used as a control.
  • Peptides were synthesized in the Microchemistry and Proteomics Core at MSKCC, and purified by HPLC.
  • HEK293T cells or HEK293T-FLAG- RagBQ99L cells were plated in 6-well plates at the density of 1 million per well in 2 ml complete DMEM. On the next day, cells were grown to about 60 ⁇ 80% confluence before treatment. Peptides were dilute to the indicated concentrations in DMEM (without serum) and incubated with cells for 60 min. Cells were also deprived of amino acids or incubated with rapamycin (100 ng/ml) for 60 min. After treatment, total cell lysate were prepared for analysis.
  • HEK293T, HeLa, and MEFs were plated on Poly-D-Lysine Cellware 12-mm Coverslips (BD Biosciences). Twenty-four hours later, cells were either amino acid-starved, or starved and followed by amino acid re-stimulation. At the end of treatment, cells were rinsed once with PBS, and fixed for 15 min with 4% paraformaldehyde in PBS at room temperature. The slides were rinsed twice with PBS, and the cells were permeabilized with 0.1% Triton X-100 in PBS for 5 min.
  • cells were rinsed once with serum, amino acid, and phosphate-free DMEM, incubated with 0.8 ml serum, amino acid, and phosphate-free media containing 0.1 ⁇ 32P orthophosphate for 50 min, and stimulated with cell culture medium for 15 min.
  • Cells were lysed in 0.5 ml lysis buffer (1% Triton X-100, 50 mM HEPES KOH [pH 7.4], 100 mM NaCl, 20 mM MgC12, 1 mM KH2P04, 1 mM ATP), and the lysates were centrifuged for 5 min at 14,000 rpm at 4 °C.
  • the supernatant was incubated with 10 ⁇ RagA antibody (CST) for 60 min at 4 °C.
  • 20 ⁇ protein G beads were added to the lysates, and incubated for another 60 min.
  • the beads were washed three times with the wash buffer 1 (0.5% Triton X-100, 500 mM NaCl, 50 mM HEPES/KOH [pH 7.4], 20 mM MgC12 and 1 mM DTT), followed by two washes with the wash buffer 2 (0.1% Triton X-100, 100 mM NaCl, 50 mM HEPES/KOH [pH 7.4], 20 mM MgC12 and 1 mM DTT).
  • RagBQ99L, HEK293T cells stably expressing FLAG-RFP or FLAG-Sestrin2 were cotransfected with 100 ng of pLJM 1 -FLAG-RagBQ99L and 100 ng of pRK5-FLAG-RagCD 18 IN. Twenty- four hours later, cells were treated, and lysed as afore-described. Anti-FALG M2 affinity gel was used for immunoprecipitation, and the RagBQ99L-bound guanine nucleotides were determined with the same method described above for RagA.
  • Recombinant proteins used in in vitro GAP assay and the nucleotide exchange assay were expressed and purified from HEK293T cells.
  • Six million HEK293T cells were plated in 15 cm dishes.
  • 30 ⁇ g pcDNA3.1-FLAG-Sestrin2 or pRK5-HA-GST-Rap2A plasmids were used for transfection, while 20 ⁇ g pRK5-HA-GST-RagA and 10 ⁇ g pRK5 -FLAG-RagCD 18 IN, 20 ⁇ g pRK5-HA-GST-RagB and 10 ⁇ g pRK5 -FLAG-RagCD 181 N, 20 ⁇ g pRK5-HA-GST- RagC and 10 ⁇ g pRK5-FLAG-RagBD163N, 20 ⁇ g pRK5-HA-GST-RagD and 10 ⁇ g p
  • cell lysates were prepared with the 1% Triton XI 00 buffer described above. Either 200 ⁇ 50% slurry of glutathione affinity beads or 200 ⁇ 50% slurry of FLAG-M2 affinity gel were used to pull down HA-GST-tagged Rag dimers or immunoprecipitate FLAG-tagged Sestrin2 respectively. Recombinant proteins were immunoprecipitated for 3 h at 4 °C. Each sample was washed once with 1% Triton X100 buffer, followed by 3 washes with 1% Triton X100 buffer supplemented with 500 mM NaCl.
  • FLAG-Sestrins were eluted twice with 10 ⁇ g/ml FLAG peptide, and HA-GST-tagged proteins were eluted twice with the reduced glutathione.
  • the two elusions were pooled, and concentered by Amico Ultra centrifugal filter with a 10 kD cut-off.
  • Recombinant proteins used in in vitro binding assays were expressed, and purified from bacteria.
  • cDNAs of RagA and RagC were subcloned into pETDuet-1 vector (Novagen) for bicistronic protein expression in the Escherichia coli strain BL21 (DE3).
  • the His-RagA-RagC complex was purified using HisPurTM Ni-NTA Superflow Agarose (Thermo Scientific).
  • Sestrins To express Sestrins in bacteria, cDNAs of Sestrinl, Sestrin2, and Sestrin3 were subcloned into pGEX-6p-l, and expressed in BL21 (DE3).
  • GST, GST-Sestrinl, GST-Sestrin2, GST-Sestrin3 were purified using Glutatione Sepharose 4B columns (GE Health).
  • GST-Sestrinl and GST-Sestrin3 were not stable in bacteria, and the recombinant proteins were degraded quickly after purification.
  • the purified GST-Sestrin2 fusion protein was relatively stable, and further purified by anion exchange with Resouce 15Q (GE Health).
  • the GTPase-GDP-XTP complexes were stabilized by the addition of 0.4 ⁇ 2 M MgC12 (final concentration at 20 mM), which were further incubated at 4 °C overnight or at 25 °C for 5 min (no difference was observed between the two methods).
  • the 40 ⁇ GTPase-GDP-XTP complexes were split into two equal parts, and were either left untreated or incubated with Sestrin2.
  • 1 ⁇ (800 nM) 35S-GTP-yS in a total volume of 10 ⁇ were added to the 20 ⁇ GTPase-GDP-XTP complexes.
  • 6 ⁇ samples were taken at 2, 4, 6, 8, 10 min, and spotted on nitrocellulose filters. The filters were washed with 5 ml wash buffer, and the retained radioactivity was measured using a TriCarb scintillation counter (PerkinElmer).
  • Lamp2 mouse monoclonal antibody H4B4, for human cells
  • Lamp2 rat-monoclonal antibody GL2A7, for mouse cells
  • Anti-FLAG F1804
  • Anti-HA 3F10
  • Anti-Sestrinl sc-376170
  • anti-Sestrin2 10795-1-AP antibodies were from Santa Cruz Biotechnology and Proteintech.
  • Sestrin2419A, Sestrin2422A, Sestrin2426A, and Sestrin2AAA were generated by site-directed mutagenesis and cloned into plnducer21 using gateway cloning.
  • Sestrinl primer #1 : GGATTGATTGCCCTCAAAAG
  • Sestrin2 primer #1 : GGTCAGAGGAAGTGCATAGGA
  • Sestrin3 primer #1 : GGTTTCCAGACAGGGTTTCTC
  • primer #2 GACCTGGGATGGGAAGCTAT primer #3 : GCCATGTGCCATGTAACAAC
  • RNA from liver or MEFs was extracted with R easy (Qiagen), revers- transcribed with Superscript III (Invitrogen) and used at 1 : 100 dilution in quantitative real-time PCR.
  • mRNA levels of Sestrin3 were normalized to ⁇ -Actin.
  • the primers used were: Sestrin3-F, TTACTTGAACGGAGCCTGAAG; Sestrin3-R, TCCATCAGAAGCAGATTCACG; Actin-F, GGCACCACACCTTCTACAATG; Actin-R, GTGGTGGTGAAGCTGTAGCC.
  • the present Example provides the surprising demonstration that mTORCl signaling is independent of TSC2 and AMPK, contrary to expectation in the field. Based on the observation that Sestrins could not repress mTORCl signaling in TSC2 deficient mouse embryonic fibroblasts (MEFs), studies had concluded that Sestrin inhibition of mTORCl signaling was dependent on TSC (Budanov and Karin, 2008; Chen et al, 2010). However, the present Example demonstrates that basal mTORCl activity in TSC2 deficient MEFs is substantially higher than that in WT MEFs (Figure 9A).
  • the present disclosure identifies the source of a problem in certain prior work, and thus provides strategies for identifying, characterizing, and/or using mTORCl modulators.
  • the present Example demonstrates that Sestrins mediate modulation of mTORCl function, and particularly that such modulation is achieved through modulation of Rag GTPases.
  • these findings establish, as described herein, that the present disclosure provides strategies for identifying, characterizing, and/or using mTORCl modulators.
  • the present disclosure provides the insight, in light of the finding described herein in Example 2 that TSC2 was dispensable for Sestrin inhibition of mTORCl signaling, that Sestrins do not interfere with Rheb-dependent mTORCl activation induced by growth factors.
  • the present disclosure appreciates that amino acid-triggered mTORCl lysosomal translocation is an obligate step for mTORCl activation that is independent of the TSC-Rheb axis (as confirmed, for example, by Bar-Peled and Sabatini, 2014 and references cited therein). Without wishing to be bound by any particular theory, we explored the possibility that Sestrins might target the nutrient-sensing pathway for mTORCl regulation.
  • mTORCl modulators that utilize or involve disruption of Rag complex interactions (e.g., with Sestrins).
  • Example 5 Sestrins Enhance RagB Q99L - induced mTORCl Activation under the Amino Acid Starvation Condition
  • the present Example describes the enhancement of mTORCl activity by Sestrins in the context of GTP "locked" RagB and amino acid starvation.
  • the RagB Q99L mutant was generated based on the finding that the corresponding glutamine 61 in Ras GTPase is required for the nucleophilic attack of the ⁇ -phosphate of GTP to trigger its hydrolysis to GDP (Boguski and McCormick, 1993).
  • Ras-bound GTP cannot be hydrolyzed and the GTPases are "locked" into the GTP-bound state.
  • detailed analysis of the biochemical properties of RasQ 61L showed that this mutant has a six- fold faster GTP dissociation rate compared to that of wild-type Ras due to the inability of the hydrophobic leucine to stabilize GTP (Krengel et al, 1990).
  • This Example demonstrates, among other things, that Sestrins can inhibit nucleotide exchange by Rag proteins. Without wishing to be bound by any particular theory, we propose that such inhibition may contribute to and/or provide a mechanism fo Sestrin inhibition of mTORCl signaling.
  • the present invention provides the insight that ability of Sestrin2 to stabilize
  • Sestrin2 did not stimulate the hydrolysis of Rag-bound GTP (Figure 13B), and therefore was not a GAP for Rags.
  • the present Example defines a Sestrin GDI motif and establishes its ability to modulate mTORCl signaling.
  • Sestrins To gain molecular insights into the GDI activity of Sestrins, we aligned the sequences of Sestrins to those of RhoGDI and Rab GDI. Although Sestrins did not share overall sequence similarities with RhoGDI or Rab GDI (data not shown), a peptide motif near the C-termini of all Sestrins from fly, mouse, and human was highly homologous to the Rab GTPase-binding motif of Rab GDI (Schalk et al, 1996) ( Figure 6A).
  • Sestrin2 AAA a Sestrin2 mutant with the replacement of both lysines and arginine to alanines (Sestrin2 AAA ) rendered the cells almost completely insensitive to amino acid starvation- triggered mTORCl inactivation ( Figure 6B, lane 9 - 12).
  • Sestrin2 AAA was mostly devoid of its GDI activity towards RagB ( Figure 6C).
  • cells expressing Sestrin2 AAA were refractory to amino acid starvation- triggered mTORCl lysosome dissociation (Figure 6D).
  • Sestrin2 (amino acids 410 - 431) ( Figure 6E).
  • the GDI motif was randomly shuffled to generate a control Tat-Sestrin2-GDI motif-Scramble peptide (T-S) ( Figure 6E).
  • T-S Tat-Sestrin2-GDI motif-Scramble peptide
  • FIG. 6F Treatment of HEK293T cells with T-G, but not T-S, resulted in a dose dependent repression of mTORCl signaling (Figure 6F).
  • T-G failed to inhibit mTORCl activation in HEK293T cells stably expressing RagB Q99L that "locks" RagB in the GTP-bound state, and renders cells insensitive to amino acid deprivation-triggered mTORCl inactivation ( Figure 6F).
  • Example 8 Mouse and Human Sestrin Peptides Regulate mTORCl Signaling
  • the present Example describes the amino acid differences between human and mouse Sestrin GDI motif and their shared ability to modulate mTORC 1 signaling. Alignment of the amino acid sequences of mouse and human Sestrin2 demonstrates that the human peptide has one amino acid substitution relative to the mouse sequence( Figure 7A). The three positively charged amino acids in the Sestrin2 GDI motif are demonstrated to be important for modulation of mTORCl signaling ( Figure 7B). Moreover, a peptide with the human Sestrin GDI motif inhibits mTORCl signaling ( Figure 7B). In accordance with the present invention, either mouse or human Sestrin GDI motif can be used for modulation of mTORCl signaling.
  • Example 9 Loss of Sestrins Renders mTORCl Signaling Insensitive to Nutrient Status In Vivo
  • the present Example describes characteristics of Sestrin-knockout mice and demonstrates that, among other things, Sestrin 1, Sestrin2, and Sestrin3 function redundantly to suppress nutrient- but not growth factor- induced mTORCl signaling .
  • Sestrin 1-/-2-/-3-/- MEFs maintained mTORCl activation after prolonged amino acid deprivation (Figure 8C).
  • glucose also regulates mTORCl activity partially through Rag GTPases (Efeyan et al, 2013).
  • Sestrin 1-/-2-/-3 -/- MEFs were also resistant to mTORCl inactivation triggered by glucose, or glucose and amino acid deprivation (Figure 8D).
  • the present Example describes a particuarl Sestrin peptide agent provided in accordance with the present invention that inhibits mTORCl signaling.
  • Tat protein transduction domain and a Sestrin GDI motif e.g., of mouse of human Sestrins.
  • This peptide inhibitor specifically and reversibly inhibits mTORCl signaling in a Rag GTPases dependent manner. Unlike Rapamycin or kinase inhibitors of mTOR that inhibit both mTORCl and mTORC2, this inhibitor does not inhibit mTORC2; this inhibitor represents the first mTORCl -specific inhibitor. More precisely, this peptide is a Rag GTPases inhibitor, which is also the first in the field.
  • the present disclosure establishes the effectiveness of Sestrin peptide agents as modulators, and specifically as inhibitors, of mTORCl signaling. Moreover, the present disclosure establishes the effectiveness of inhibiting RAG GTPases in achieving inhibition of mTORCl signaling, including specific inhibition of mTORCl signaling as compared with mTORC2 signaling. The present disclosure therefore demonstrates the feasibility of identifying and/or characterization of such agents that show such acitivites, and moreover provides reagents useful in such identification and/or characterization.
  • the present disclosure provides assays for the identification and/or characterization of agents that specifically modulate (e.g., inhibit) mTORCl signaling, for example by establishing their effectiveness relative to a Sestrin peptide agent as described herein.
  • one or more mTORCl modulatory agents can be identified and/or characterized by direct function screening.
  • RagA will be loaded with fluorescence labeled GDP first, then excessive unlabeled GTP will be added to replace the GDP, the reduction of the signal of fluorescence (labeled GDP) can be monitored. Then one or more potential mTORCl modulatory agents will be used in this assay; any agent that can inhibit GDP release can be considered to be an inhibitor of RagA
  • effects of mTORCl modulating agents can be assessed in an obesity model, for example using mice that are fed a high-fat diet (60% fat) to induce obesity, insulin resistance and diabetes.
  • mTORCl modulating agents e.g., Sestrin peptide agents as described herein
  • an obesity model for example using mice that are fed a high-fat diet (60% fat) to induce obesity, insulin resistance and diabetes.
  • groups of mice are intraperitoneally (IP) injected with PBS or with an mTORCl modulatory (e.g., inhibitory) agent (e.g., a Sestrin peptide agent) as described herein dissolved in PBS (20mg/kg/day).
  • IP intraperitoneally
  • an mTORCl modulatory agent e.g., a Sestrin peptide agent
  • the mTORCl modulatory agent is a Sestrin peptide agent.
  • a particular Sestrin peptide agent is utilized as a reference against which activity of one or more other agents (in some embodiments one or more other Sestrin peptide agents; in some embodiments one or more non-Sestrin-peptide and/or non- peptide agents) is compared.
  • mTORCl modulating agents e.g., Sestrin peptide agents as described herein
  • a cancer model for example using rapamycin- sensitive cancer cell lines (such as PC3 and SW780, whose growth can be inhibited by rapamycin) implanted in immune-deficient mice.
  • Groups of mice are intraperitoneally (IP) injected with PBS or with an mTORCl modulatory (e.g., inhibitory) agent (e.g., a Sestrin peptide agent) dissolved in PBS (20mg/kg/day). Tumor size and the survival of mice is monitored.
  • IP intraperitoneally
  • an mTORCl modulatory agent e.g., a Sestrin peptide agent
  • the mTORCl modulatory agent is a Sestrin peptide agent.
  • a particular Sestrin peptide agent is utilized as a reference against which activity of one or more other agents (in some embodiments one or more other Sestrin peptide agents; in some embodiments one or more non-Sestrin-peptide and/or non-peptide agents) is compared.
  • agents in some embodiments one or more other Sestrin peptide agents; in some embodiments one or more non-Sestrin-peptide and/or non-peptide agents.
  • mTORCl modulating agents e.g.Sestrin peptide agents
  • neurodegenerative diseases e.g., showing activity in models thereof.
  • mTORCl is a critical negative regulator of autophagy, a process involved in many diseases.
  • Polyglutamine repeat expansion is a neurodegenerative disease model related to Huntington's disease, spinocerebellar ataxias, synucleinopathies and tauopathies.
  • Pharmacological activation of autophagy reduces levels of soluble and aggregated proteins.
  • HeLa cells expressing doxycyline-repressible CFP fused to, for example, httl03Q are treated with one or more mTORCl modulating agents of interest, or with a control (e.g., with no agent and/or with a reference agent e.g., a reference Sestin peptide agent of known activity); activation of autophagy and clearance of protein aggregates are examined, for example by immunoblotting.
  • RNA viruses e.g., Sindbis virus (SINV), chikungunya virus (CHIKV), West Nile virus (WNV)
  • INV infectious virus
  • intracellular bacteria e.g., Listeria monocytogenes
  • an mTORCl modulatory agent e.g., a Sestrin peptide agent
  • the mTORCl modulatory agent is a Sestrin peptide agent.
  • a particular Sestrin peptide agent is utilized as a reference against which activity of one or more other agents (in some embodiments one or more other Sestrin peptide agents; in some embodiments one or more non-Sestrin-peptide and/or non-peptide agents) is compared.
  • the mTOR inhibitor rapamycin is a well-known immunosuppressant.
  • the experimental autoimmune encephalomyelitis (EAE) model is an animal model of the human central nervous system (CNS) inflammatory demyelinating diseases, including multiple sclerosis and acute disseminated encephalomyelitis (ADEM).
  • CNS central nervous system
  • ADAM acute disseminated encephalomyelitis
  • the effect of mTORCl inhibition can be assessed in autoimmune models, for example using mice in which EAE has been induced.
  • groups of such mice are intraperitoneally (IP) injected with PBS or an mTORCl inhibitory agent as described herein dissolved in PBS (20mg/kg/day). Disease state is monitored and the inflammation of CNS is examined by flow cytometry.
  • IP intraperitoneally
  • the mTORC 1 modulatory agent is a Sestrin peptide agent.
  • a particular Sestrin peptide agent is utilized as a reference against which activity of one or more other agents (in some embodiments one or more other Sestrin peptide agents; in some embodiments one or more non-Sestrin-peptide and/or non-peptide agents) is compared.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Molecular Biology (AREA)
  • Organic Chemistry (AREA)
  • Hematology (AREA)
  • Microbiology (AREA)
  • Zoology (AREA)
  • Urology & Nephrology (AREA)
  • Biomedical Technology (AREA)
  • Wood Science & Technology (AREA)
  • Biotechnology (AREA)
  • Physics & Mathematics (AREA)
  • Analytical Chemistry (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Pathology (AREA)
  • Biophysics (AREA)
  • General Physics & Mathematics (AREA)
  • Food Science & Technology (AREA)
  • Cell Biology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

The present disclosure defines roles of Sestrins in mTORC 1 signaling and provides agents and methods related to such signaling and modification thereof. Among other things, the present disclosure demonstrates that Sestrin peptide agents can act as modulators of mTORC 1 signaling. The present disclosure specifically demonstrates that Sestrin peptide agents inhibit mTORCI signaling; in some embodiments, such inhibition occurs in the absence of AMPK and/or TSC2. The present disclosure further demonstrates that Sestrin peptide agents can act as specific modulators of mTORC 1 signaling (e.g., and not of mTORC2 signaling). The present disclosure demonstrates that Sestrin peptide agents can act as GDIs for Rags.

Description

mTORCl Modulation
Government Rights
[0001] This invention was made with government support under a grant awarded by the National Institutes of Health. The government has certain rights in the invention.
Background
[0002] Mechanistic target of rapamycin complex 1 (mTORCl) is a master regulator of cellular growth, whose dysregulation results in a plethora of pathological conditions including cancer, diabetes, and aging (Laplante and Sabatini, 2012). mTORCl regulates macromolecule biosynthesis and energy metabolism by integrating intracellular and environmental signals such as growth factors and nutrients that impinge on mTORCl signaling through the Rheb and Rag subfamilies of GTPases (Bar-Peled and Sabatini, 2014; Dibble and Manning, 2013; Jewell et al, 2013).
Summary
[0003] Among other things, the present disclosure demonstrates that Sestrin peptide agents can act as modulators of mTORCl signaling. The present disclosure specifically demonstrates that Sestrin peptide agents inhibit mTORCl signaling; in some embodiments, such inhibition occurs in the absence of AMPK and/or TSC2. The present disclosure further demonstrates that Sestrin peptide agents can act as specific modulators of mTORCl signaling (e.g., and not of mTORC2 signaling). The present disclosure demonstrates that Sestrin peptide agents can act as GDIs for Rags.
[0004] The present disclosure provides, among other things, systems for identifying and/or characterizing useful mTORCl modulatory agents including, for example, Sestrin peptide agents and/or other agents whose activity can be assessed relative thereto.
[0005] mTORCl modulatory agents (e.g., as identified, characterized, and/or otherwise described herein) are useful in a variety of contexts, including for example, in nutrient sensing and/or mTORCl signaling. In some embodiment, mTORCl modulatory agents are useful, for example, in the treatment of one or more diseases, disorders, or conditions associated with mTORCl signaling. For example, in some embodiments, mTORCl modulatory agents are useful in accordance with the present invention in the treatment of cancer, diabetes, and/or aging. In some embodiments, mTORCl modulatory agents are useful in accordance with the present invention in the treatment of one or more metabolic diseases, disorders or conditions. In some embodiments, mTORCl modulatory agents are useful in accordance with the present invention in the treatment of autophagy. In some embodiments, and particularly in embodiments relating to mTORCl modulatory agents that specifically modulate mTORCl signaling and not mTORC2 signaling are not useful in the treatment of cancer and/or are not significantly active in one or more cancer models. In some embodiments, such agents are useful in the treatment of other mTORCl -associated diseases, disorders or conditions as described herein.
[0006] In some embodiments, useful mTORCl modulatory agents as described herein and/or otherwise defined or provided by the present disclosure are characterized by their activity relative to a reference Sestrin peptide agent in one or more assays or models, for example as described herein.
Description of the Drawing
[0007] Figure 1 shows Sestrin2 inhibits mTORCl signaling in the absence of TSC2 or
AMPK. (A) TSC2-deficient MEFs stably expressing FLAG-tagged Sestrin2 or RFP were cultured in complete medium. Total cell lysates were analyzed by immunoblotting. (B) Wild- type (WT) or AMPKDKO MEFs stably expressing FLAG-tagged Sestrin2 or RFP were cultured in complete medium or starved for amino acids for 60 min, and analyzed as in (A).
[0008] Figure 2 shows Sestrins function upstream of Rag GTPases to inhibit amino acid- induced mTORCl lysosomal translocation and signaling (A) HEK293T cells stably expressing indicated proteins were starved for amino acids for 60 min, and re-stimulated with amino acids for 10 min. Total cell lysates were analyzed by immunoblotting. (B) HEK293T cells stably expressing indicated proteins were treated and analyzed as in (A). (C) HeLa cells or HeLa cells stably expressing indicated proteins were starved for amino acids for 60 min, and were either left untreated or re-stimulated with amino acids for 15 min. The localization of mTOR and Lamp2 was determined by immunostaining.
[0009] Figure 3 shows Sestrins directly interact with Rag GTPases. (A) HEK293T cells were co-transfected with constructs encoding indicated proteins. Total cell lysate or the anti- FLAG immunoprecipitate (IP) was analyzed by immunoblotting. All lanes were from the same blot, and irrelevant lanes were removed and indicated by a dashed line. (B) HeLa cells stably expressing indicated proteins were subject to crosslinking with DSP prior to cell lysis. Total cell lysate or the anti-FLAG immunoprecipitates was analyzed by immunoblotting. (C) GST, GST- Sestrin2, and His-RagA-RagC dimer were purified from bacteria and used in the GST pull-down assay. The amounts of RagA, RagC, GST, and GST-Sestrin2 proteins were determined by immunoblotting.
[0010] Figure 4 shows Sestrin2 stabilizes GTP binding to RagBQ99L and potentiates RagBQ99L- induced mTORCl signaling. (A) HEK293T cells stably expressing indicated proteins were starved for amino acids for 60 min. Total cell lysates were analyzed by immunoblotting. (B-C) HEK293T cells stably expressing indicated proteins starved for amino acids for 60 min. Total cell lysates were analyzed by immunoblotting (B). The effect of Sestrin2 on RagBQ99L- or RagBQ99H-induced S6K phosphorylation was normalized to the expression level of RagB by the Image J software (C). The arbitrary units represent the normalized mean ± SEM for n = 3. The relative fold change between RFP-expressing and Sestrin2- expressing cells, and the p values between the measurements are shown. (D) HEK293T cells stably expressing indicated proteins were transfected with constructs encoding the HA-GST-RagBQ99L and FLAG-RagCD181N dimer. The RagBQ99L-bound guanine nucleotides were analyzed by TLC.
[0011] Figure 5 shows Sestrin2 is a GDI for RagA/B. (A) HEK293T cells stably expressing indicated proteins were labeled with 32P orthophosphate for 4 h, starved for amino acids for 50 min and restimualted with amino acids for 10 min, and RagA was
immunoprecipitated with anti-RagA. The RagA-bound guanine nucleotides were eluted and separated by TLC. The percentage of GTP -bound RagA was quantified, and is shown as the normalized mean ± SEM for n = 3. (B) The different combinations of Rag dimers were preloaded with GDP and XTP, and were incubated with 35S-GTPyS in the absence or presence of Sestrin2. Aliquots of the samples were taken at 2, 4, 6, 8, and 10 min, and the amounts of exchanged 35S-GTPyS were determined in a filter-binding assay. The relative fractions of the exchanged guanine nucleotides were normalized, and are presented as mean ± SEM for n = 3.
[0012] Figure 6 shows the GDI activity of Sestrin is important for inhibiting mTORCl activation (A) Sequence alignment of a putative GDI motif from Sestrins to that of RabGDI is shown. The conserved amino acids are labeled in red and blue, and the two positively charged lysines present specifically in Sestrins are labeled in green. Arrows indicate the amino acid residues that are mutated to alanines. (B) HEK293T cells stably expressing indicated proteins were cultured in medium with different concentrations of amino acids for 60 min. Total cell lysates were analyzed by immunoblotting. (C) The RagB-RagCX dimer was pre-loaded with GDP and XTP, and was incubated with 35S-GTPyS in the absence or presence of Sestrin2 or Sestrin2AAA. Aliquots of the samples were taken at 2, 4, 6, 8, and 10 min, and the amounts of exchanged 35S-GTPyS were determined in a filter-binding assay. The relative fractions of the exchanged guanine nucleotides were normalized, and are presented as mean ± SEM for n = 3.
(D) HEK293T cells stably expressing indicated proteins were starved for amino acids for 60 min, and were either left untreated or re-stimulated with amino acids for 10 min. The localization of mTOR and Lamp2 was determined by immunostaining. (E) Sequences of mouse Sestrin2 amino acids 410 - 431, Tat-Sestrin2-GDI motif (T-G) and Tat- Tat-Sestrin2-GDI motif-Scramble (T-S) control peptides. (F) HEK293T or HEK293T stably expressing FLAG-RagBy were incubated with DMEM containing the indicated concentrations of peptides for 60 min. Cells were also deprived of amino acids or incubated with rapamycin (100 ng/ml) for 60 min as controls. Total cell lysates were analyzed by immunoblotting.
[0013] Figure 7 shows the importance of residues in human and mouse Sestrin. (A)
Sequences of peptides. GDI motif of Sestrin2 from mouse and human has one amino acid substitution, which is labeled in purple. The three positively charged amino acids (green) that are critical for the GDI activity of Sestrins were changed to alanines (red). (B) The three positively charged amino acids in Sestrin2 GDI motif are critical for GDI activity. HEK293E cells were treated with 20μΜ indicated peptides in the presence or absence of amino acids for 1 hour. Total cell lysates were analyzed by immunoblotting. (C) GDI motif from human Sestrin2 inhibit mTORCl signaling in HEK293T cells. HEK293T or HEK293T cells expressing RagBQ99L were treatment with indicated concentrations of peptides for 1 hour. Cells were also treated with ΙΟΟηΜ Rapamycin or starved for amino acids for 1 hour as control. Total cell lysates were analyzed by immunoblotting.
[0014] Figure 8 shows Sestrins are indispensable for amino acid starvation-triggered mTORCl inactivation. (A) Genotyping results of pups at 10 days after birth or neonates at birth. (B) Total cell lysates prepared from the liver, heart or limbs of neonates with the indicated genotypes after 8 h of fasting were analyzed by immunoblotting. (C) Wild-type (WT) and Sesnl- Λ2-/-3-/- MEFs were starved for amino acids for 0.5, 1, 2, 4, and 6 h. Total cell lysates were analyzed by immunoblotting. (D) WT and Sesnl-/-2-/-3-/- MEFs were starved for amino acids and/or glucose for 1 h, or FBS for 2 h. Total cell lysates were analyzed by immunoblotting. (E) WT and Sesnl-/-2-/-3-/- MEFs were starved for amino acids for 60 min, and either left untreated or re-stimulated with amino acids for 10 min. The localization of mTOR and Lamp2 was determined by immunostaining.
[0015] Figure 9 further demonstrates TSC2 and AMPK Are nonessential for Sestrin inhibition of mTORCl signaling. (A) Total cell lysates from Tsc2+/+ and Tsc2-/- mouse embryonic fibroblasts (MEFs) were analyzed by immunoblotting. (B) HeLa cells stably expressing the FLAG-tagged RFP or Sestrin2 as well as the shRNA against TSC2 or the control LacZ shRNA were starved for amino acids for 60 min, and re-stimulated with amino acids for 10 min. Total cell lysates were analyzed by immunoblotting. (C) MEFs deficient in both AMPK 1 and AMPKa2 (AMPKDKO) were engineered to stably express the FLAG-tagged Sestrin2 or RFP. The size of these cells was determined byflow cytometry. [0016] Figure 10 shows overexpression of Sestrin2 does not affect RagC lysosomal localization. HeLa cells stably expressing the FLAG-tagged Sestrin2 were starved for amino acids for 60 min, and were either left untreated or re-stimulated with amino acids for 15 min. The subcellular localization of RagC and Lamp2 was determined by coimmunostaining.
[0017] Figure 1 1 shows the interaction between Sestrins and Rags. (A) The subcellular localization of Flag-Sestrin2 and the RagC was determined by co-immunostaining in HEK293T cells or HEK293T cells stably expressing Flag-Sestrin2. (B) GST or GST-Sestrin2 were expressed and purified from BL21 (DE3). Purified proteins were further separated by an anion exchange column Resource 15Q. Aliquots of the proteins were separated on a SDS-PAGE, and visualized by coomassie blue staining. The two fractions used for the in vitro binding experiment are marked in red. (C) The His-RagA-RagC complex was purified with Ni-NTA Agarose.
Aliquots of the proteins were separated on a SDS-PAGE, and visualized by coomassie blue staining.
[0018] Figure 12 shows Sestrins do not potentiate the Raptor-Rheb 15 -triggered mTORCl activation. HEK293T cells stably expressing indicated proteins were starved for amino acids for 60 min. Total cell lysates were analyzed by immunoblotting.
[0019] Figure 13 shows Sestrin2 does not exhibit GAP activity towards Rags. (A) The purified recombinant Rag complexes, Rap2A, and Sestrin2 proteins were separated by SDS- PAGE, and visualized by coomassie blue staining. (B) Rap2A or the Rag dimers were incubated with XTP and a-32P-GTP in the absence or presence of Sestrin2 for 60 min. The nucleotides were separated by TLC.
[0020] Figure 14 demonstrates that mutations in Sestrin2 GDI motif does not affect its binding to Rags. HEK293T cells were co-transfected with constructs encoding the HA-GST- tagged RagA and the FLAG-tagged Sestrin2, Sestrin2419A, Sestrin2422A, Sestrin2426A, or
Sestrin2AAA. Total cell lysate and the anti-FLAG immunoprecipitates were analyzed by immunoblotting.
[0021] Figure 15 demonstrates the steps for generation of mice with null alleles for
Sesnl, Sesn2, and Sesn3. (A) Gene targeting strategy for Sesnl. Two loxp sites were inserted into intron 1 and intron 6 respectively by homologous gene recombination. (B) Germline transmission of wild-type (WT), floxed, and deleted alleles of Sesnl was validated by PCR. (C) Germline transmission of WT and null alleles of Sesn2 was validated by PCR. (D) Germline transmission of WT, floxed and deleted alleles of Sesn3 was validated by PCR. (E) Quantitative real-time PCR analysis of the mRNA level of Sestrin3 in livers from WT and Sestrin3 deficient (KO) mice. (F) Total cell lysates were prepared from the liver, heart or limbs of neonates with the indicated genotypes after 10 h of fasting. The levels of the indicated proteins and phosphorylation states were analyzed by immunoblotting. All lanes were from the same blot, and the irrelevant lanes were removed and indicated by dashed lines. (G) Sestrinl expression in MEFs of the indicated genotypes was analyzed by immunoblotting. (H) Sestrin2 expression in MEFs of the indicated genotypes was analyzed by immunoblotting. (I) Sestrin3 expression in WT and Sestrin3 KO MEFs was analyzed by quantitative real-time PCR analysis. (J) WT, Sesnl-/-2-/-3-/-, Sesnl+/-2-/-3-/-, and Sesnl+/-2-/-3+/- MEFs were cultured in medium with different concentrations of amino acids for 60 min. Total cell lysates were analyzed by immunoblotting. (K) MEFs with the indicated genotypes were cultured in complete medium. Total cell lysates were analyzed by immunoblotting. (L) A model of Sestrin regulation of mTORCl signaling
Definitions
[0022] Agent : The term "agent" as used herein may refer to a compound or entity of any chemical class including, for example, polypeptides, nucleic acids, saccharides, lipids, small molecules, metals, or combinations thereof. In some embodiments, an agent is or comprises a natural product in that it is found in and/or is obtained from nature. In some embodiments, an agent is or comprises one or more entities that is man-made in that it is designed, engineered, and/or produced through action of the hand of man and/or is not found in nature. In some embodiments, an agent may be utilized in isolated or pure form; in some embodiments, an agent may be utilized in crude form. In some embodiments, potential agents are provided as collections or libraries, for example that may be screened to identify or characterize active agents within them. Some particular embodiments of agents that may be utilized in accordance with the present invention include small molecules, antibodies, antibody fragments, aptamers, nucleic acids (e.g., siR As, shR As, DNA/RNA hybrids, antisense oligonucleotides, ribozymes), peptides, peptide mimetics, etc. In some embodiments, an agent is or comprises a polymer. In some embodiments, an agent is not a polymer and/or is substantially free of any polymer. In some embodiments, an agent contains at least one polymeric moiety. In some embodiments, an agent lacks or is substantially free of any polymeric moiety.
[0023] Amino acid: As used herein, the term "amino acid," in its broadest sense, refers to any compound and/or substance that can be incorporated into a polypeptide chain, e.g., through formation of one or more peptide bonds. In some embodiments, an amino acid has the general structure H2N-C(H)(R)-COOH. In some embodiments, an amino acid is a naturally- occurring amino acid. In some embodiments, an amino acid is a synthetic amino acid; in some embodiments, an amino acid is a D-amino acid; in some embodiments, an amino acid is an L- amino acid. "Standard amino acid" refers to any of the twenty standard L-amino acids commonly found in naturally occurring peptides. "Nonstandard amino acid" refers to any amino acid, other than the standard amino acids, regardless of whether it is prepared synthetically or obtained from a natural source. In some embodiments, an amino acid, including a carboxy- and/or amino-terminal amino acid in a polypeptide, can contain a structural modification as compared with the general structure above. For example, in some embodiments, an amino acid may be modified by methylation, amidation, acetylation, and/or substitution as compared with the general structure. In some embodiments, such modification may, for example, alter the circulating half life of a polypeptide containing the modified amino acid as compared with one containing an otherwise identical unmodified amino acid. In some embodiments, such modification does not significantly alter a relevant activity of a polypeptide containing the modified amino acid, as compared with one containing an otherwise identical unmodified amino acid. As will be clear from context, in some embodiments, the term "amino acid" is used to refer to a free amino acid; in some embodiments it is used to refer to an amino acid residue of a polypeptide.
[0024] Animal: As used herein, the term "animal" refers to any member of the animal kingdom. In some embodiments, "animal" refers to humans, at any stage of development. In some embodiments, "animal" refers to non-human animals, at any stage of development. In some embodiments, the non-human animal is a mammal (e.g., a rodent, a mouse, a rat, a rabbit, a monkey, a dog, a cat, a sheep, cattle, a primate, and/or a pig). In some embodiments, animals include, but are not limited to, mammals, birds, reptiles, amphibians, fish, and/or worms. In some embodiments, an animal may be a transgenic animal, genetically-engineered animal, and/or a clone.
[0025] Associated with: Two events or entities are "associated" with one another, as that term is used herein, if the presence, level and/or form of one is correlated with that of the other. For example, a particular entity (e.g., polypeptide) is considered to be associated with a particular disease, disorder, or condition, if its presence, level and/or form correlates with incidence of and/or susceptibility to the disease, disorder, or condition (e.g., across a relevant population). In some embodiments, two or more entities are physically "associated" with one another if they interact, directly or indirectly, so that they are and remain in physical proximity with one another. In some embodiments, two or more entities that are physically associated with one another are covalently linked to one another; in some embodiments, two or more entities that are physically associated with one another are not covalently linked to one another but are non- covalently associated, for example by means of hydrogen bonds, van der Waals interaction, hydrophobic interactions, magnetism, and combinations thereof. [0026] Characteristic portion : As used herein, the term "characteristic portion" is used, in the broadest sense, to refer to a portion of a substance whose presence (or absence) correlates with presence (or absence) of a particular feature, attribute, or activity of the substance. In some embodiments, a characteristic portion of a substance is a portion that is found in the substance and in related substances that share the particular feature, attribute or activity, but not in those that do not share the particular feature, attribute or activity. In certain embodiments, a characteristic portion shares at least one functional characteristic with the intact substance. For example, in some embodiments, a "characteristic portion" of a protein or polypeptide is one that contains a continuous stretch of amino acids, or a collection of continuous stretches of amino acids, that together are characteristic of a protein or polypeptide. In some embodiments, each such continuous stretch generally contains at least 2, 5, 10, 15, 20, 50, or more amino acids. In general, a characteristic portion of a substance (e.g., of a protein, antibody, etc.) is one that, in addition to the sequence and/or structural identity specified above, shares at least one functional characteristic with the relevant intact substance. In some embodiments, a characteristic portion may be biologically active.
[0027] Characteristic sequence element: As used herein, the phrase "characteristic sequence element" refers to a sequence element found in a polymer (e.g., in a polypeptide or nucleic acid) that represents a characteristic portion of that polymer. In some embodiments, presence of a characteristic sequence element correlates with presence or level of a particular activity or property of the polymer. In some embodiments, presence (or absence) of a characteristic sequence element defines a particular polymer as a member (or not a member) of a particular family or group of such polymers. A characteristic sequence element typically comprises at least two monomers (e.g., amino acids or nucleotides). In some embodiments, a characteristic sequence element includes at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25, 30, 35, 40, 45, 50, or more monomers (e.g., contiguously linked monomers). In some embodiments, a characteristic sequence element includes at least first and second stretches of contiguous monomers spaced apart by one or more spacer regions whose length may or may not vary across polymers that share the sequence element.
[0028] Combination therapy: As used herein, the term "combination therapy" refers to those situations in which a subject is simultaneously exposed to two or more therapeutic regimens (e.g., two or more therapeutic agents). In some embodiments, two or more agents may be administered simultaneously; in some embodiments, such agents may be administered sequentially; in some embodiments, such agents are administered in overlapping dosing regimens. [0029] Comparable: The term "comparable", as used herein, refers to two or more agents, entities, situations, sets of conditions, etc that may not be identical to one another but that are sufficiently similar to permit comparison therebetween so that conclusions may reasonably be drawn based on differences or similarities observed. In some embodiments, comparable sets of conditions, circumstances, individuals, or populations are characterized by a plurality of substantially identical features and one or a small number of varied features. Those of ordinary skill in the art will understand, in context, what degree of identity is required in any given circumstance for two or more such agents, entities, situations, sets of conditions, etc to be considered comparable. For example, those of ordinary skill in the art will appreciate that sets of circumstances, individuals, or populations are comparable to one another when characterized by a sufficient number and type of substantially identical features to warrant a reasonable conclusion that differences in results obtained or phenomena observed under or with different sets of circumstances, individuals, or populations are caused by or indicative of the variation in those features that are varied.
[0030] Corresponding to: As used herein, the term "corresponding to" is often used to designate a structural element or moiety in an agent of interest that shares a position (e.g., in three-dimensional space or relative to another element or moiety) with one present in an appropriate reference agent. For example, in some embodiments, the term is used to refer to position/identity of a residue in a polymer, such as an amino acid residue in a polypeptide or a nucleotide residue in a nucleic acid. Those of ordinary skill will appreciate that, for purposes of simplicity, residues in such a polymer are often designated using a canonical numbering system based on a reference related polymer, so that a residue in a first polymer "corresponding to" a residue at position 190 in the reference polymer, for example, need not actually be the 190th residue in the first polymer but rather corresponds to the residue found at the 190th position in the reference polymer; those of ordinary skill in the art readily appreciate how to identify "corresponding" amino acids, including through use of one or more commercially-available algorithms specifically designed for polymer sequence comparisons.
[0031] Detectable Moiety or Entity: The term "detectable entity" or "detectable moiety" as used herein refers to any element, molecule, functional group, compound, fragment or moiety that is detectable. In some embodiments, a detection entity is provided or utilized alone. In some embodiments, a detection entity is provided and/or utilized in association with (e.g., joined to) another agent. Examples of detection entities include, but are not limited to: various ligands,
■ · , 3xj I , 18 19 32n 35 c 135T 125T 123T 64,-, 187π 111T 9C 7 99ηιτ 177T radionuclides (e.g., H, C, F, F, P, S, I, I, I, Cu, Re, In, Ύ , Tc, Lu, 89Zr etc.), fluorescent dyes (for specific exemplary fluorescent dyes, see below), chemiluminescent agents (such as, for example, acridinum esters, stabilized dioxetanes, and the like), bioluminescent agents, spectrally resolvable inorganic fluorescent semiconductors nanocrystals (i.e., quantum dots), metal nanoparticles (e.g., gold, silver, copper, platinum, etc.) nanoclusters, paramagnetic metal ions, enzymes (for specific examples of enzymes, see below), colorimetric labels (such as, for example, dyes, colloidal gold, and the like), biotin, dioxigenin, haptens, and proteins for which antisera or monoclonal antibodies are available.
[0032] Domain: The term "domain" is used herein to refer to a section or portion of an entity. In some embodiments, a "domain" is associated with a particular structural and/or functional feature of the entity so that, when the domain is physically separated from the rest of its parent entity, it substantially or entirely retains the particular structural and/or functional feature. Alternatively or additionally, a domain may be or include a portion of an entity tha, when separated from that (parent) entity and linked with a different (recipient) entity, substantially retains and/or imparts on the recipient entity one or more structural and/or functional features that characterized it in the parent entity. In some embodiments, a domain is a section or portion of a molecular (e.g., a small molecule, carbohydrate, a lipid, a nucleic acid, or a polypeptide). In some embodiments, a domain is a section of a polypeptide; in some such embodiments, a domain is characterized by a particular structural element (e.g., a particular amino acid sequence or sequence motif, a-helix character, β-sheet character, coiled-coil character, random coil character, etc), and/or by a particular functional feature (e.g., binding activity, enzymatic activity, folding activity, signaling activity, etc). Determine: Many methodologies described herein include a step of "determining". Those of ordinary skill in the art, reading the present specification, will appreciate that such "determining" can utilize or be accomplished through use of any of a variety of techniques available to those skilled in the art, including for example specific techniques explicitly referred to herein. In some embodiments, determining involves manipulation of a physical sample. In some embodiments, determining involves consideration and/or manipulation of data or information, for example utilizing a computer or other processing unit adapted to perform a relevant analysis. In some embodiments, determining involves receiving relevant information and/or materials from a source. In some embodiments, determining involves comparing one or more features of a sample or entity to a comparable reference.
[0033] Dosage form: As used herein, the term "dosage form" refers to a physically discrete unit of an active agent (e.g., a therapeutic or diagnostic agent) for administration to a subject. Each unit contains a predetermined quantity of active agent. In some embodiments, such quantity is a unit dosage amount (or a whole fraction thereof) appropriate for administration in accordance with a dosing regimen that has been determined to correlate with a desired or beneficial outcome when administered to a relevant population (i.e., with a therapeutic dosing regimen). Those of ordinary skill in the art appreciate that the total amount of a therapeutic composition or agent administered to a particular subject is determined by one or more attending physicians and may involve administration of multiple dosage forms.
[0034] Dosing regimen: As used herein, the term "dosing regimen" refers to a set of unit doses (typically more than one) that are administered individually to a subject, typically separated by periods of time. In some embodiments, a given therapeutic agent has a
recommended dosing regimen, which may involve one or more doses. In some embodiments, a dosing regimen comprises a plurality of doses each of which are separated from one another by a time period of the same length; in some embodiments, a dosing regimen comprises a plurality of doses and at least two different time periods separating individual doses. In some embodiments, all doses within a dosing regimen are of the same unit dose amount. In some embodiments, different doses within a dosing regimen are of different amounts. In some embodiments, a dosing regimen comprises a first dose in a first dose amount, followed by one or more additional doses in a second dose amount different from the first dose amount. In some embodiments, a dosing regimen comprises a first dose in a first dose amount, followed by one or more additional doses in a second dose amount same as the first dose amount In some embodiments, a dosing regimen is correlated with a desired or beneficial outcome when administered across a relevant population (i.e., is a therapeutic dosing regimen).
[0035] Human : In some embodiments, a human is an embryo, a fetus, an infant, a child, a teenager, an adult, or a senior citizen.
[0036] Identity: As used herein, the term "identity" refers to the overall relatedness between polymeric molecules, e.g., between nucleic acid molecules (e.g., DNA molecules and/or RNA molecules) and/or between polypeptide molecules. In some embodiments, polymeric molecules are considered to be "substantially identical" to one another if their sequences are at least 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% identical. Calculation of the percent identity of two nucleic acid or polypeptide sequences, for example, can be performed by aligning the two sequences for optimal comparison purposes (e.g., gaps can be introduced in one or both of a first and a second sequences for optimal alignment and non-identical sequences can be disregarded for comparison purposes). In certain embodiments, the length of a sequence aligned for comparison purposes is at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or substantially 100% of the length of a reference sequence. The nucleotides at corresponding positions are then compared. When a position in the first sequence is occupied by the same residue (e.g., nucleotide or amino acid) as the corresponding position in the second sequence, then the molecules are identical at that position. The percent identity between the two sequences is a function of the number of identical positions shared by the sequences, taking into account the number of gaps, and the length of each gap, which needs to be introduced for optimal alignment of the two sequences. The comparison of sequences and determination of percent identity between two sequences can be accomplished using a mathematical algorithm. For example, the percent identity between two nucleotide sequences can be determined using the algorithm of Meyers and Miller (CABIOS, 1989, 4: 1 1-17), which has been incorporated into the ALIGN program (version 2.0). In some exemplary embodiments, nucleic acid sequence comparisons made with the ALIGN program use a PAM120 weight residue table, a gap length penalty of 12 and a gap penalty of 4. The percent identity between two nucleotide sequences can,
alternatively, be determined using the GAP program in the GCG software package using an NWSgapdna.CMP matrix.
[0037] Modulator: The term "modulator" is used to refer to an entity whose presence or level in a system in which an activity of interest is observed correlates with a change in level and/or nature of that activity as compared with that observed under otherwise comparable conditions when the modulator is absent. In some embodiments, a modulator is an activator, in that activity is increased in its presence as compared with that observed under otherwise comparable conditions when the modulator is absent. In some embodiments, a modulator is an antagonist or inhibitor, in that activity is reduced in its presence as compared with otherwise comparable conditions when the modulator is absent. In some embodiments, a modulator interacts directly with a target entity whose activity is of interest. In some embodiments, a modulator interacts indirectly (i.e., directly with an intermediate agent that interacts with the target entity) with a target entity whose activity is of interest. In some embodiments, a modulator affects level of a target entity of interest; alternatively or additionally, in some embodiments, a modulator affects activity of a target entity of interest without affecting level of the target entity. In some embodiments, a modulator affects both level and activity of a target entity of interest, so that an observed difference in activity is not entirely explained by or commensurate with an observed difference in level.
[0038] Peptide: The term "peptide" as used herein refers to a polypeptide that is typically relatively short, for example having a length of less than about 100 amino acids, less than about 50 amino acids, less than 20 amino acids, or less than 10 amino acids.
[0039] Pharmaceutical composition: As used herein, the term "pharmaceutical composition" refers to an active agent, formulated together with one or more pharmaceutically acceptable carriers. In some embodiments, active agent is present in unit dose amount appropriate for administration in a therapeutic regimen, for example that shows a statistically significant probability of achieving a predetermined therapeutic effect when administered to a relevant population or system (e.g., model system). In some embodiments, pharmaceutical compositions may be specially formulated for administration in solid or liquid form, including those adapted for the following: oral administration, for example, drenches (aqueous or nonaqueous solutions or suspensions), tablets, e.g., those targeted for buccal, sublingual, and systemic absorption, boluses, powders, granules, pastes for application to the tongue; parenteral administration, for example, by subcutaneous, intramuscular, intravenous or epidural injection as, for example, a sterile solution or suspension, or sustained-release formulation; topical application, for example, as a cream, ointment, or a controlled-release patch or spray applied to the skin, lungs, or oral cavity; intravaginally or intrarectally, for example, as a pessary, cream, or foam; sublingually; ocularly; transdermally; or nasally, pulmonary, and to other mucosal surfaces.
[0040] Polypeptide: The term "polypeptide", as used herein, in accordance with its art- understood meaning, typically refers to a polymer of at least three amino acids and/or to a polymer in which monomers are linked to one another via peptide bonds. In some embodiments, the term is used to refer to a "polypeptide" that occurs in nature; in some embodiments, the term is used to refer to a "polypeptide" that was engineered (e.g., designed and/or manufactured) by the hand of man. In some embodiments, a polypeptide may comprise or consist of natural amino acids, non-natural amino acids, or both. In some embodiments, a polypeptide may comprise or consist of only natural amino acids or only non-natural amino acids. In some embodiments, a polypeptide may comprise D-amino acids, L-amino acids, or both. In some embodiments, a polypeptide may comprise only D-amino acids. In some embodiments, a polypeptide may comprise only L-amino acids. In some embodiments, a polypeptide may include one or more pendant groups or other modifications, e.g., modifying or attached to one or more amino acid side chains, at the polypeptide's N-terminus, at the polypeptide's C-terminus, or any
combination thereof. In some embodiments, such pendant groups or modifications may be selected from the group consisting of acetylation, amidation, lipidation, methylation, pegylation, etc., including combinations thereof. In some embodiments In some embodiments, a polypeptide may be cyclic, and/or may comprise a cyclic portion. In some embodiments, a polypeptide is not cyclic and/or does not comprise any cyclic portion. In some embodiments, a polypeptide is linear. In some embodiments, a polypeptide may be or comprise a stapled polypeptide. In some embodiments, the term "polypeptide" may be appended to a name of a reference polypeptide, activity, or structure; in such instances it is used herein to refer to polypeptides that share the relevant activity or structure and thus can be considered to be members of the same class or family of polypeptides. For each such class, the present specification provides and/or those skilled in the art will be aware of exemplary polypeptides within the class whose amino acid sequences and/or functions are known; in some embodiments, such exemplary polypeptides are reference polypeptides for the polypeptide class. In some embodiments, a member of a polypeptide class or family shows significant sequence homology or identity with, shares a common sequence motif (e.g., a characteristic sequence element) with, and/or shares a common activity (in some embodiments at a comparable level or within a designated range) with a reference polypeptide of the class; in some embodiments with all polypeptides within the class). For example, in some embodiments, a member polypeptide shows an overall degree of sequence homology or identity with a reference polypeptide that is at least about 30-40%, and is often greater than about 50%, 60%, 70%, 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more and/or includes at least one region (i.e., a conserved region that may in some embodiments may be or comprise a characteristic sequence element) that shows very high sequence identity, often greater than 90% or even 95%, 96%, 97%, 98%, or 99%. Such a conserved region usually encompasses at least 3-4 and often up to 20 or more amino acids; in some embodiments, a conserved region encompasses at least one stretch of at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1, 12, 13, 14, 15 or more contiguous amino acids. In some embodiments, a useful polypeptide may comprise or consist of a fragment of a parent polypeptide. In some embodiments, a useful polypeptide as may comprise or consist of a plurality of fragments, each of which is found in the same parent polypeptide in a different spatial arrangement relative to one another than is found in the polypeptide of interest (e.g., fragments that are directly linked in the parent may be spatially separated in the polypeptide of interest or vice versa, and/or fragments may be present in a different order in the polypeptide of interest than in the parent), so that the polypeptide of interest is a derivative of its parent polypeptide.
[0041] Reference: The term "reference" is often used herein to describe a standard or control agent or value against which an agent or value of interest is compared. In some embodiments, a reference agent is tested and/or a reference value is determined substantially simultaneously with the testing or determination of the agent or value of interest. In some embodiments, a reference agent or value is a historical reference, optionally embodied in a tangible medium. Typically, as would be understood by those skilled in the art, a reference agent or value is determined or characterized under conditions comparable to those utilized to determine or characterize the agent or value of interest.
[0042] Sample: As used herein, the term "sample" typically refers to a biological sample obtained or derived from a source of interest, as described herein. In some embodiments, a source of interest comprises an organism, such as an animal or human. In some embodiments, a biological sample is or comprises biological tissue or fluid. In some embodiments, a biological sample may be or comprise bone marrow; blood; blood cells; ascites; tissue or fine needle biopsy samples; cell-containing body fluids; free floating nucleic acids; sputum; saliva; urine;
cerebrospinal fluid, peritoneal fluid; pleural fluid; feces; lymph; gynecological fluids; skin swabs; vaginal swabs; oral swabs; nasal swabs; washings or lavages such as a ductal lavages or broncheoalveolar lavages; aspirates; scrapings; bone marrow specimens; tissue biopsy specimens; surgical specimens; feces, other body fluids, secretions, and/or excretions; and/or cells therefrom, etc. In some embodiments, a biological sample is or comprises cells obtained from an individual. In some embodiments, obtained cells are or include cells from an individual from whom the sample is obtained. In some embodiments, a sample is a "primary sample" obtained directly from a source of interest by any appropriate means. For example, in some embodiments, a primary biological sample is obtained by methods selected from the group consisting of biopsy (e.g., fine needle aspiration or tissue biopsy), surgery, collection of body fluid (e.g., blood, lymph, feces etc.), etc. In some embodiments, as will be clear from context, the term "sample" refers to a preparation that is obtained by processing (e.g., by removing one or more components of and/or by adding one or more agents to) a primary sample. For example, filtering using a semi-permeable membrane. Such a "processed sample" may comprise, for example nucleic acids or proteins extracted from a sample or obtained by subjecting a primary sample to techniques such as amplification or reverse transcription of mRNA, isolation and/or purification of certain components, etc.
[0043] Small molecule: As used herein, the term "small molecule" means a low molecular weight organic and/or inorganic compound. In general, a "small molecule" is a molecule that is less than about 5 kilodaltons (kD) in size. In some embodiments, a small molecule is less than about 4 kD, 3 kD, about 2 kD, or about 1 kD. In some embodiments, the small molecule is less than about 800 daltons (D), about 600 D, about 500 D, about 400 D, about 300 D, about 200 D, or about 100 D. In some embodiments, a small molecule is less than about 2000 g/mol, less than about 1500 g/mol, less than about 1000 g/mol, less than about 800 g/mol, or less than about 500 g/mol. In some embodiments, a small molecule is not a polymer. In some embodiments, a small molecule does not include a polymeric moiety. In some embodiments, a small molecule is not a protein or polypeptide (e.g., is not an oligopeptide or peptide). In some embodiments, a small molecule is not a polynucleotide (e.g., is not an oligonucleotide). In some embodiments, a small molecule is not a polysaccharide. In some embodiments, a small molecule does not comprise a polysaccharide (e.g., is not a glycoprotein, proteoglycan, glycolipid, etc.). In some embodiments, a small molecule is not a lipid. In some embodiments, a small molecule is a modulating agent. In some embodiments, a small molecule is biologically active. In some embodiments, a small molecule is detectable (e.g., comprises at least one detectable moiety). In some embodiments, a small molecule is a therapeutic.
[0044] Specific: The term "specific", when used herein with reference to an agent having an activity, is understood by those skilled in the art to mean that the agent discriminates between potential target entities or states. For example, an in some embodiments, an agent is said to bind "specifically" to its target if it binds preferentially with that target in the presence of one or more competing alternative targets. In many embodiments, specific interaction is dependent upon the presence of a particular structural feature of the target entity (e.g., an epitope, a cleft, a binding site). It is to be understood that specificity need not be absolute. In some embodiments, specificity may be evaluated relative to that of the binding agent for one or more other potential target entities (e.g., competitors). In some embodiments, specificity is evaluated relative to that of a reference specific binding agent. In some embodiments specificity is evaluated relative to that of a reference non-specific binding agent. In some embodiments, the agent or entity does not detectably bind to the competing alternative target under conditions of binding to its target entity. In some embodiments, binding agent binds with higher on-rate, lower off-rate, increased affinity, decreased dissociation, and/or increased stability to its target entity as compared with the competing alternative target(s).
[0045] Subject: By "subject" is meant a mammal (e.g., a human, in some embodiments including prenatal human forms). In some embodiments, a subject is suffering from a relevant disease, disorder or condition. In some embodiments, a subject is susceptible to a disease, disorder, or condition. In some embodiments, a subject displays one or more symptoms or characteristics of a disease, disorder or condition. In some embodiments, a subject does not display any symptom or characteristic of a disease, disorder, or condition. In some
embodiments, a subject is someone with one or more features characteristic of susceptibility to or risk of a disease, disorder, or condition. A subject can be a patient, which refers to a human presenting to a medical provider for diagnosis or treatment of a disease. In some embodiments, a subject is an individual to whom therapy is administered.
[0046] Susceptible to: An individual who is "susceptible to" a disease, disorder, or condition (e.g., influenza) is at risk for developing the disease, disorder, or condition. In some embodiments, an individual who is susceptible to a disease, disorder, or condition does not display any symptoms of the disease, disorder, or condition. In some embodiments, an individual who is susceptible to a disease, disorder, or condition has not been diagnosed with the disease, disorder, and/or condition. In some embodiments, an individual who is susceptible to a disease, disorder, or condition is an individual who has been exposed to conditions associated with development of the disease, disorder, or condition. In some embodiments, a risk of developing a disease, disorder, and/or condition is a population-based risk (e.g., family members of individuals suffering from the disease, disorder, or condition).
[0047] Therapeutically effective amount: As used herein, the term "therapeutically effective amount" refers to an amount of a therapeutic protein which confers a therapeutic effect on the treated subject, at a reasonable benefit/risk ratio applicable to any medical treatment. The therapeutic effect may be objective (i.e., measurable by some test or marker) or subjective (i.e., subject gives an indication of or feels an effect). In particular, the "therapeutically effective amount" refers to an amount of a therapeutic protein or composition effective to treat, ameliorate, or prevent a desired disease or condition, or to exhibit a detectable therapeutic or preventative effect, such as by ameliorating symptoms associated with the disease, preventing or delaying the onset of the disease, and/or also lessening the severity or frequency of symptoms of the disease. A therapeutically effective amount is commonly administered in a dosing regimen that may comprise multiple unit doses. For any particular therapeutic protein, a therapeutically effective amount (and/or an appropriate unit dose within an effective dosing regimen) may vary, for example, depending on route of administration, on combination with other pharmaceutical agents. Also, the specific therapeutically effective amount (and/or unit dose) for any particular patient may depend upon a variety of factors including the disorder being treated and the severity of the disorder; the activity of the specific pharmaceutical agent employed; the specific composition employed; the age, body weight, general health, sex and diet of the patient; the time of administration, route of administration, and/or rate of excretion or metabolism of the specific fusion protein employed; the duration of the treatment; and like factors as is well known in the medical arts.
[0048] Treatment: As used herein, the term "treatment" (also "treat" or "treating"), in its broadest sense, refers to any administration of a substance (e.g., provided compositions) that partially or completely alleviates, ameliorates, relives, inhibits, delays onset of, reduces severity of, and/or reduces incidence of one or more symptoms, features, and/or causes of a particular disease, disorder, and/or condition . In some embodiments, such treatment may be administered to a subject who does not exhibit signs of the relevant disease, disorder and/or condition and/or of a subject who exhibits only early signs of the disease, disorder, and/or condition.
Alternatively or additionally, in some embodiments, treatment may be administered to a subject who exhibits one or more established signs of the relevant disease, disorder and/or condition. In some embodiments, treatment may be of a subject who has been diagnosed as suffering from the relevant disease, disorder, and/or condition. In some embodiments, treatment may be of a subject known to have one or more susceptibility factors that are statistically correlated with increased risk of development of the relevant disease, disorder, and/or condition.
[0049] Unit dose: The expression "unit dose" as used herein refers to an amount administered as a single dose and/or in a physically discrete unit of a pharmaceutical composition. In many embodiments, a unit dose contains a predetermined quantity of an active agent. In some embodiments, a unit dose contains an entire single dose of the agent. In some embodiments, more than one unit dose is administered to achieve a total single dose. In some embodiments, administration of multiple unit doses is required, or expected to be required, in order to achieve an intended effect. A unit dose may be, for example, a volume of liquid (e.g., an acceptable carrier) containing a predetermined quantity of one or more therapeutic agents, a predetermined amount of one or more therapeutic agents in solid form, a sustained release formulation or drug delivery device containing a predetermined amount of one or more therapeutic agents, etc. It will be appreciated that a unit dose may be present in a formulation that includes any of a variety of components in addition to the therapeutic agent(s). For example, acceptable carriers (e.g., pharmaceutically acceptable carriers), diluents, stabilizers, buffers, preservatives, etc., may be included as described infra. It will be appreciated by those skilled in the art, in many embodiments, a total appropriate daily dosage of a particular therapeutic agent may comprise a portion, or a plurality, of unit doses, and may be decided, for example, by the attending physician within the scope of sound medical judgment. In some embodiments, the specific effective dose level for any particular subject or organism may depend upon a variety of factors including the disorder being treated and the severity of the disorder; activity of specific active compound employed; specific composition employed; age, body weight, general health, sex and diet of the subject; time of administration, and rate of excretion of the specific active compound employed; duration of the treatment; drugs and/or additional therapies used in combination or coincidental with specific compound(s) employed, and like factors well known in the medical arts.
Detailed Description of Certain Embodiments
mTORCl Signaling
[0050] The mechanistic target of rapamycin complex 1 (mTORCl) contains the serine/threonine kinase mTOR as well as Raptor and mLST8. The complex is a master regulator of fundamental biological processes including but not limited to transcription, translation, autophagy, actin organization and ribosome biogenesis. mTORCl regulates this processes through its integration of intracellular and extracellular signals - sensing growth factors, changes in nutrient and energy availability and cellular stress . Most, but not all, of the mTORCl signaling occurs through Rheb and Rag.
[0051] As small GTPases, Rheb and Rags function on endomembranes to regulate mTORCl signaling (Betz and Hall, 2013). While Rheb is targeted to the endomembranes via a lipid-binding motif (Saito et al, 2005), Rags are anchored to the lysosomal surface by the
Ragulator complex (Sancak et al, 2010). In addition, Rags function as obligate heterodimers in which RagA or the highly related RagB bind to RagC or RagD, which are homologous to each other (Kim et al, 2008; Sancak et al, 2008; Sekiguchi et al, 2001). Upon growth factor and amino acid stimulation, the active Rag complex, consisting of RagA/B in the GTP-bound state and RagC/D in the GDP-bound state (RagA/BGTP-RagC/DGDP), promotes mTORC 1 translocation to the lysosome, where GTP-bound Rheb stimulates the mTOR kinase. As a crucial determinant of small GTPase activity, the guanine nucleotide-loading status of GTPases is regulated by multiple factors including GTPase-activating proteins (GAPs) that stimulate GTP hydrolysis, guanine nucleotide exchange factors (GEFs) that facilitate GDP dissociation, and the guanine nucleotide dissociation inhibitors (GDIs) that prevent GDP dissociation (Cherfils and Zeghouf, 2013).
[0052] The TSC2 component of the trimeric tuberous sclerosis complex (TSC) is a GAP for Rheb, which inhibits Rheb by converting it from the GTP-bound state to the GDP-bound state (Inoki et al, 2003; Tee et al, 2003). While TSC phosphorylation by the energy sensor AMP-responsive protein kinase (AMPK) promotes its activation, growth factor-induced
PI3K/Akt pathway phosphorylates and inactivates TSC (Laplante and Sabatini, 2012). Multiple GAPs have been identified for Rags, including the GATORl complex for RagA/B (Bar-Peled et al, 2013), the FLCN-FNIP complex for RagC/D (Tsun et al, 2013), and possibly the leucyl- tRNA synthase for RagD (Han et al, 2012). In addition, the Ragulator complex functions as a GEF for RagA/B, whose activity is induced via the lysosomal v-ATPase upon amino acid stimulation (Bar-Peled et al, 2012). Finally, although GDI proteins are known to control the functions of Rho and Rab subfamilies of small GTPases (Garcia- Mata et al, 201 1; Pfeffer and Aivazian, 2004), no GDIs have been described for either Rheb or Rags. Sestrins
[0053] Sestrins are evolutionarily conserved proteins whose expression is upregulated by various environmental insults including genotoxic, oxidative, and nutritional stress (Lee et al, 2013). Whereas mammalian Sestrinl and Sestrin2 are regulated by p53 (Budanov et al., 2004), Sestrinl and Sestrin3 as well as the Drosophila Sestrin (dSestrin) are target genes of the Foxo family of transcription factors (Chen et al, 2010; Lee et al, 2010; Ouyang et al, 2012). Sestrin overexpression potently suppresses mTORCl signaling (Budanov and Karin, 2008), and conveys stress signals for the reprogramming of cellular metabolism and the restoration of organismal homeostasis (Lee et al, 2013). Indeed, while dSestrin gain-of-function inhibits mTORCl signaling and cell growth in Drosophila, dSestrin deficiency results in an age-dependent metabolic syndrome caused by mTORCl hyper-activation (Lee et al, 2010). Likewise, Sestrin2- deficient mice fail to inactivate mTORCl in the liver during fasting (Bae et al., 2013), and spontaneously elevated mTORCl signaling is observed in mice devoid of both Sestrin2 and Sestrin3 (Lee et al, 2012).
[0054] Among other things, the present disclosure defines a mechanism for Sestrin inhibition of mTORCl, and furthermore defines certain modulators of mTORCl activity based on this mechanism and/or on the structure of Sestrins. The present disclosure specifically demonstrates, for example, that Sestrins can inhibit mTORCl signaling independent of TSC and/or of AMPK. Furthermore, the present disclosure demonstrates that Sestrins inhibit Rag- dependent mTORCl lysosomal Translocation. The present disclosure specifically demonstrates that Sestrins interact with RAGs, and in particular enhance RagBQ99L-induced mTORCl activation under amino acid starvation conditions. The present disclosure establishes that Sestrins can act as GDIs for RagA and/or RagB. Moreover, the present disclosure defines a Sestrin peptide GDI motif that itself can achieve (e.g., is sufficient for) mTORCl modulation as described herein. mTORCl Modulatory Agents
[0055] In some embodiments, the present disclosure provides mTORCl modulatory agents, and in particular mTORCl inhibitory agents. In some embodiments, such mTORCl modulatory agents are mTORCl -specific modulatory agents; in some such embodiments, provided mTORCl modulatory agents specifically modulate mTORCl signaling as compared with mTORC2 signaling.
[0056] In some embodiments, provided mTORCl modulatory agents show one or more structural and/or functional characteristics of Sestrins as described herein. For example, in some embodiments, provided mTORCl modulatory agents inhibit mTORCl signaling independent of TSC and/or of AMPK. In some embodiments in which provided mTORCl modulatory agents modulate mTORCl signaling in a Rag-GTPas dependent manner. In some embodiments, provided mTORCl modulatory agents inhibit Rag-dependent mTORCl lysosomal
Translocation. In some embodiments, provided mTORCl modulatory agents interact with (e.g., bind directly to) RAGs. In some embodiments, provided mTORCl modulatory agents enhance RagBQ99L-induced mTORCl activation under amino acid starvation conditions. In some embodiments, provided mTORCl modulatory agents can act as GDIs for RagA and/or RagB.
[0057] In some embodiments, modulation of mTORCl signaling activity occurs in an mTORCl signaling system. In some embodiments an mTORCl signaling system is or comprises one or more intact cells, tissues, organs, or organisms, e.g., from bacteria, yeast, animals (e.g., mammals), and/or humans. In some embodiments, an mTORCl signaling system is an in vitro system. In general, as described herein, an appropriate mTORCl signaling system is any system in which mTORC 1 signaling can be propagated and detected.
[0058] In some embodiments particular mTORCl signaling activity can be determined by the measurement of the phosphorylation state of one or more downstream targets. Such downstream targets may include but are not limited to 4E-BP 1, p70s6K (S6K), LC3, or AKT.
[0059] In some embodiments, mTORCl signaling activity is measured during amino acid starvation.
[0060] In some embodiments, an mTORCl modulatory agent provided in accordance with the present invention shows an mTORCl modulatory activity at least comparable to that of a Sestrin and/or of a Sestrin peptide agent as described herein.
Polypeptide Agents (e.g., Sestrin polypeptide agents)
[0061] Given the characterization of Sestrins, their GDI domain and the ability of that domain to modulate mTORCl activity described herein (e.g., see Examples below), in some embodiments the present disclosure provides mTORCl modulatory agents that are peptides whose amino acid sequence includes a Sestrin GDI motif.
[0062] That is, in some embodiments, the present specification defines, characterizes, and/or describes various Sestrin peptide agents that modulate mTORCl signaling as described herein. In some embodiments, a provided Sestrin peptide agent has an amino acid sequence that includes a Sestrin peptide GDI motif as described herein. In some embodiments, the Sestrin peptide GDI motif corresponds to a sequence element found in a mammalian Sestrin. In some embodiments, a Sestrin peptide agent as described herein includes a human Sestrin peptide GDI motif; in some embodiments a Sestrin peptide agent as described herein includes a mouse Sestrin peptide GDI motif; in some embodiments a Sestrin peptide agent as described herein includes a Sestrin peptide GDI motif that corresponds to a consensus human/mouse and/or mammalian GDI motif.
[0063] In some particular embodiments, the present specification provides mTORCl modulatory agents that are polypeptides whose amino acid sequence is or comprises a Sestrin GDI domain. In some embodiments, provided mTORCl modulatory agents are polypeptides whose amino acid sequence further includes one or more other elements, motifs, or domains such as, for example, one or more linkers, targeting moieties, cell permeability domains, etc.
[0064] In some embodiments, a provided polypeptide mTORCl modulatory agent , or one or more motifs or domains therein, is or comprises a cyclic peptide. In some embodiments, a provided polypeptide mTORC 1 modulatory agent, or one or more motifs or domains therein, is or comprises a stapled peptide.
[0065] In some embodiments a Sestrin GDI motif as described herein shows at least
80%, 85%, 90%, 95%, or 100% identity with a reference Sestrin GDI motif such as, for example amino acids 410-431 of a mouse Sestrin2 protein (e.g., SEQ ID NO.: 1), amino acids 410-431 of human Sestrin2 (e.g., SEQ ID NO.:2), amino acids 422-443 of mouse Sestrin l(e.g., SEQ ID NO.:3), amino acids 422-443 of human Sestrin 1 (e.g., SEQ ID NO.:4), amino acids 422-443 of mouse Sestrin3 (e.g., SEQ ID NO.: 5), and/or amino acids 422-443 of human Sestrin3 (e.g., SEQ ID NO.:6). In some embodiments, a Sestrin GDI motif comprises or consists of at least the three positively charged residues found in the human Sestrin2 GDI motif set forth in SEQ ID NO: l . In some embodiments, a Sestrin GDI motif comprises or consists of a positively charged residue at positions corresponding to 419, 422, and/or 426 of SEQ ID NO: 1). In some embodiments, a Sestrin GDI motif has a glutamic acid at a position corresponding to position 418 of such a reference GDI motif (which may represent a sequence difference relative to such reference GDI motif). In some particular embodiments, a Sestrin GDI motif or domain has an amino acid sequence that comprises or consists of YGEVNQLLE(418)RNLKVYIKTVACY.
[0066] In some embodiments, presence of a Sestrin GDI motif in a polypeptide mTORC 1 modulator as described herein correlates with mTORCl modulatory activity and/or with one or more features thereof.
[0067] In some embodiments, a polypeptide mTORCl modulatory agent as described herein has an amino acid sequence that includes a cell permeability motif or domain. In some embodiments, such a cell permeability motif or domain is one that shows at least 80%, 85%, 90%, 95%, Or 100% sequence identity with a reference cell permeability motif or domain, such as are known in the art. For example, a variety of amino acid sequence elements, particularly those characterized by cationic surface residues (see, for example, Ryser Science 150:501, 1965; Green, Cell 55: 1179, 1988; Frankel, Cell 55: 1189, 1988; Joliot Proc. Natl. Acad. Sci. U.S.A. 88: 1864, 1991; Wu J. Biol. Chem. 268: 10686, 1993; Will Nucleic Acids Res. 30, e59, 2002,; Apple J. Immunol. 140:3290, 1988; Fuchs ACS Chem. Biol. 2: 167, 2007). Arginine-rich sequences, and particularly arginine-rich peptides with significant alpha-helical character are known to act as cell permability motifs or domains (see, for example, Wender Proc. Natl. Acad. Sci. U.S.A. 97: 13003, 2000, ; Deshayes Cell. Mol. Life Sci. 62: 1839, 2005). As is known in the art, certain polypeptide motifs have been specifically desgined or engineered to have cell permeability character (see, for example, Daniels et al J Am Chem Soc 129: 14578, Nov 6, 2007), and references cited therein).
[0068] In some particular embodiments, a reference cell permeability motif or domain is or comprises a Tat polypeptide , for example having an amino acid sequence as set forth in SEQ ID NO.:7).
[0069] In some embodiments a polypeptide mTORCl modulatory agent as described herein has an amino acid sequence that includes a linker motif or domain. In some
embodiments, a linker motif or domain is characterized by absence of rigid structural motifs. In some embodiments, a linker motif or domain has a length between a lower limit and an upper limit, the upper limit being larger than the lower limit. In some embodiments, such a lower limit is at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more amino acids, inclusive. In some embodiments, such an upper limit is less than 50, 45, 40, 35, 30, 25, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, or fewer amino acids. In some embodiments, a linker motif or domain is or comprises a plurality of glycine residues. In some particular embodiments, a linker motif or domain is or comprises two adjacent glycines.
Other Agents
[0070] In addition to providing polypeptide mTORCl modulatory agents (e.g., Sestrin polypeptide agents) as described herein, the present disclosure provides systems and
technologies for assessing relevant mTORCl modulatory activities, including relative to that of provided polypeptide mTORCl modulatory agents (e.g., Sestrin polypeptide agents such as, for example, Sestrins), and therefore provides systems and technologies for identifying and/or characterizing useful mTORCl modulatory agents of any chemical class.
[0071] Of particular interest, as described herein, are agents that show mTORCl modulatory (e.g., inhibitory) activity at least comparable to that of at least one Sestrin polypeptide agent (e.g., at least one Sestrin) as described herein, for example in one or more assays as described herein.
[0072] Those of ordinary skill in the art, reading the present disclosure, will immediately appreciate that any of a variety of agents can be assayed and/or characterized as mTORCl modulatory agents as described herein. For example, in some embodiments, a candidate mTORCl modulatory agent is or comprises a polypeptide, a nucleic acid, a carbohydrate, a lipid, and/or a small molecule. Small molecule mTORCl modulatory agents are of particular interest. In some embodiments the mTORCl modulatory agent comprises a targeting moiety or is encapsulated to be released at a specific disease site. [0073] Those of ordinary skill in the art will be aware of a variety of sources (e.g., libraries, collections) of agents whose mTORCl modulatory activity can be identified and/or characterized in accordance with the present invention, and will appreciate and understand the utility and significance of such agents in light of the present disclosure. mTORCl-Associated Diseases, Disorders, or Conditions
[0074] mTORCl is a sensor for many environmental cues and regulates a large number of downstream effectors and implicated in numerous conditions and diseases. Below, particular conditions are discussed and/or highlighted. Those skilled in the art, reading the present disclosure, however, will readily appreciate that its teachings are not limited only to these particularly exemplified diseases, disorders, and conditions.
[0075] In general , in accordance with many embodiments of the present invention, one or more provided mTORCl modulatory agents may be useful in the treatment of a disease, disorder or condition associated with mTORCl signaling. For example, in accordance with the present disclosure, one or more such mTORCl modulatory agents may be administered to a subject suffering from or susceptible to such a disease, disorder or condition, according to a dosing regimen that is and/or has been shown to be (e.g., in a relevant model and/or population) correlated with a desirable outcome (e.g., reduction in magnitude and/or frequency of, and/or delay of onset of, one or more symptoms or characteristics of the disease, disorder or condition) with respect to an mTORCl -associated disease, disorder or condition.
[0076] In some embodiments, the disease, disorder, or condition may be or comprise diabetes mellitus, obesity, aging or a disease, disorder, or condition that may be related to aging (e.g., a cardiovascular diseases, disorder or condition, a neurodegenerative disease, disorder or condition, a metabolic disease, disorder or condition), an inflammatory disease, disorder or condition (e.g., arthritis), and/or cancer. In some embodiments, however, one or more provided mTORCl modulatory agents may not be useful in the treatment of cancer, particularly if such agents have activity specific to mTORCl signaling relative to mTORC2 signaling.
[0077] In some embodiments, provided methods of treatment may include administering an mTORCl modulatory agent in combination with one or more other therapies for treatment of the mTORCl -associated disease, disorder or condition or of one or more other diseases, disorders or conditions from which the relevant subject is suffering or to which the relevant subject is susceptible. In some embodiments, such other therapies are or comprise therapies that have received marketing approval from a relevant regulatory agent and/or have otherwise been correlated with a desirable outcome or attribute relevant to the subject and/or the particular disease, disorder or condition involved. [0078] In some embodiments, mTORCl modulatory agents as described herein are administered in the context of pharmaceutically acceptable compositions, as is known in the art, and according to a dosing regimen that includes one or more doses, optionally spaced out over time (e.g., at determined and/or regular intervals).
Aging
[0079] mTOR has been implicated in organism aging, at least in part due to a finding that removal of its ortholog from yeast increased the organisms life span. Indeed, the well characterized mTOR inhibitor rapamycin shows an anti-aging effect from yeast to mammals (Fontana et al, 2010). However, significant side effects have been observed after prolonged treatment with rapamycin, which prevents its use in humans as an anti-aging drug (Lamming et al, 2013). It is believed that some of the side effects of long-term rapamycin treatment are caused by its inhibition of mTORC2 (Lamming et al, 2012). Recent findings suggest that mTORCl signaling plays a major role in the rate of tissue and cellular aging. Therefore, mTORCl specific inhibitors are actively sought in the field of aging and neurodegenerative disorders. In some embodiments, the present disclosure provides mTORCl modulators that show specific activity on mTORCl signaling relative to mTORC2 signaling; such modulatory agents are particularly useful in the treatment of various diseases, disorders, and conditions, including for example various aging-associated diseases, disorders and conditions.
Obesity and Diabetes
[0080] mTORCl is central to sensing nutrient intake. Consumption of high fat diets has been demonstrated to activate mTORCl and reduce food consumption. Moreover, overactivation of mTORCl induces adipogenesis. Therefore, alterations in mTORC activity can effect obesity. Additionally, though increases in activity of mTORCl can result in increased β-cell insulin secretion, obesity or high fat diets can lead to mTORCl mediated phosphorylation of p70s6K in other cell types such as skeletal muscle. p70s6K (S6K) can phosphorylate insulin receptor substrate which inhibits insulin sensitivity resulting in diabetes mellitus. Various mTORCl modulators as provided herein are useful in the treatment of obesity and/or diabetes.
Cancer
[0081] Due to its role in regulating protein synthesis, cellular proliferation and metabolism mTORCl can be implicated in tumorigenisis and cancer progression through numerous signaling pathways. mTORCl regulates the activity of 4E-BP1 which is a regulator of protein synthesis . mTORCl modulation of 4E-BP1 can relive the 4E-BP1 inhibibition of eukaryotic translation initiation factor 4E (eiF4E) leading to the potential translation of oncogenes. mTORCl can also lead to tumorigenisis by suppressing autophagy or promoting angiogenesis through regulating hypoxia- inducible factor la.
[0082] Those of ordinary skill in the art will appreciate that, in at least some cases, effective cancer therapy may involve or require modulation (e.g., inhibition) of both mTORCl and mTORC2 signaling; in such embodiments, at least some mTORCl modulatory agents as described and/or provided herein may not be useful in the treatment of cancer.
Examples
Example 1: Materials & Methods
[0083] The present Example presents Materials & Methods descriptions of protocols utilized in Examples 2-15.
Generation of Mice and MEFs
[0084] Sestrin3 conditional knockout mice were obtained from EUCOMM
(C57BL/6NTac Sestrin3tmla(EUCOMM)Wtsi/WtsiBiat, EMMA ID: 05719). Sestrin2-/- mice were generated from ES cells obtained from EUCOMM (Sestrin2tmla(KOMP)Wtsi, clone number: EPD0524_3_B 11). Sestrinl conditional knockout mice were generated by homologous recombination. A BAC clone (RP24-127A24) spanning the whole genomic sequence of
Sestrinlb was obtained from CHORI. The loxp site on the backbone of the BAC was removed by a Zeo cassette flanked by the BAC vector sequence. Subsequently, a loxp-Neo-loxp cassette was introduced to create the orphan loxp site in intron 1 after Cre expression in SW106. A Neo cassette with a loxp site was inserted between exon 6 and exon 7, which was followed by insertion of a DTA/AMP cassette. The BAC targeting vector was used to generate recombinant mouse ES cells that were injected to create chimeric mice at the Mouse Genetics Core Facility of MSKCC. The Neo cassette was removed by breeding the germ line-transmitted mice with the Flipase transgenic mice (Jackson Laboratory). The CMV-Cre deleter mice (Jackson Laboratory) were used to generate null alleles for Sestrinl and Sestrin3. All mice were maintained in a specific pathogen-free facility and animal experimentation was conducted in accordance with institutional guidelines.
[0085] Sestrinl+/-, Sestrin2+/-, and Sestrin3+/- mice were crossed to each other to create
Sestrin triple knockout MEFs. MEFs from El 3.5 embryos of indicated genotype were prepared by chemical digestion followed by mechanical disaggregation. Wild type, Sestrinl+/-2-/-3+/-, Sestrinl+/-2-/-3-/-, and Sestrinl-/-2-/-3-/- MEFs were immortalized by the expression of SV40 large T antigen.
Neonatal Fasting
[0086] El 8.5 pregnant females from timed breeding were monitored hourly and every born neonate was numbered and immediately placed in a humidified chamber at 30 °C. All neonates were fasted for the same time (8 h for litter #1 and 10 h for litter #2) starting from their individual time of birth. After fasting, liver, heart and limbs were harvested and immediately put into lysis buffer (1% Triton X-100 buffer described above) and snap frozen by dry ice and store at - 80 °C. After genotyping, total cell lysates were prepared. Sestrin expression and mTORCl signaling in different organs were determined by immunoblotting.
Cloning and Establishment of Stable Cell Lines
[0087] The cDNAs of mouse Sestrinl, Sestrin2, and Sestrin3 were cloned from the total mRNA of mouse T lymphocytes. Sestrins were cloned into the plnducer21 vector using gateway cloning with a FLAG tag added to the N-terminus. plnducer21 is an all-in-one lentiviral doxycycline-inducible vector with an EGFP selection marker driven by an independent promoter. To establish cell lines with inducible expression of Sestrins, lentiviruses produced in HEK293T cells were used to infect target cells. GFP-positive cells were sorted by FACS (>99.5% purity), and used for experiments. The FLAG-tagged Sestrins were also cloned into the pcDNA3.1 vector for transient transfection experiments.
Transfection, Cell Lysis, and Immunoprecipitation
[0088] For cotransfection experiments, one million HEK293T cells were plated in a 6-cm culture dish. On the next day, 100 ng pRK5-based Rag GTPase and pcDNA3.1 -based Sestrin expression plasmids were co-transfected. Thirty-six hours later, cells were lysed, and the protein extracts were prepared.
[0089] For protein extracts used in Western blotting, cells were lysed in IX Cell Lysis
Buffer (CST) supplemented with one tablet of EDTA-free protease inhibitor (Roche) per 50 ml and one tablet of PhosSTOP (Roche) per 10 ml. For protein extracts used in
immunoprecipitation, cells were lysed with CHAPS lysis buffer (40 mM HEPES [pH 7.4], 0.3% CHAPS, 10 mM -glycerol phosphate, 10 mM pyrophosphate and 2.5 mM MgC12) supplemented with the EDTA-free protease inhibitor and PhosSTOP. The soluble fractions of cell lysates were isolated by centrifugation at 14,000 rpm for 6 min. The FLAG-M2 affinity gel was pre-blocked with 5% BSA/PBS for 30 min and washed 3 times with the lysis buffer. 20 μΐ of 50% slurry of the affinity gel was added, and incubated with the lysates for 1 - 3 h at 4 °C. The beads were washed five times with the lysis buffer containing 150 mM NaCl. Immunoprecipitated proteins were denatured by the additionof 30 - 60 μΐ of sample buffer and boiling for 5 min, resolved by 10% SDS-PAGE, and analyzed by immunoblotting.
[0090] To detect the interactions between Sestrins and endogenous Rags, in-cell crosslinking with DSP was preformed prior to cell lysis. Sestrin expression in HeLa cells was induced by the addition of 1 μg/ml of doxycycline in the culture medium for 24 h. Cells were rinsed once with PBS before subject to crosslinking with DSP. 20 mg DSP was dissolved in 1 ml DMSO to a final concentration of 50 mM (100X stock solution), and then diluted into 100 ml of PBS with 1 mM MgC12 and 0.1 mM CaC12. Cells were incubated with the IX crossing linking DSP solution for 20 min at room temperature. After incubation, cells were rinsed once with PBS, and incubated with 20 mM Tris/PBS for 5 min to quench the excessive DSP. Subsequently, cells were rinsed twice with PBS and lysed with 1% Triton X-100 lysis buffer (the same recipe as 0.3% CHAPS lysis buffer except the detergent CHAPS was replaced by 1% Triton X-100). Anti- FLAG M2 immunoprecipitation was performed as described above.
Amino Acid, Glucose, and Serum Starvation and Re-stimulation
[0091] HEK293T, HeLa, and MEFs were treated with doxycycline to induce Sestrin expression. On the next day, cells were rinsed once with amino acid- and/or glucose-free DMEM, incubated with amino acid- and/or glucose-free DMEM supplemented with 10% dialyzed FBS (dFBS) for 60 min, and stimulated with the amino acid and glucose-replete DMEM for 10 - 20 min. For amino acid dose responses, cells were cultured with the DMEM containing 100%, 50%, 20%, 5%, or 0% amino acids for 60 min. For serum starvation, cells were incubated with DMEM without FBS for 2 h. After treatment, cells were lysed, and protein extracts were prepared for immunoblotting.
Peptide Synthesis and Treatment of Cells
[0092] The Tat-Sestrin2-GDI motif (T-G) peptide (YGRKKRRQRRR-GG- YGEV QLLERNLKIYIKTVACY) was made of 1 1 amino acids from the Tat protein transduction domain attached via a G2 linker to a Sestrin2 GDI motif spanning the amino acids 410 - 431. The Tat-Sestrin2-GDI motif-Scramble (T-S) peptide (YGRKKRRQRRR-GG- RYKNVYLAEQTEILVGCNILKY) was used as a control. Peptides were synthesized in the Microchemistry and Proteomics Core at MSKCC, and purified by HPLC. The purified peptides were dissolved in water and stored as aliquots at - 80 °C. HEK293T cells or HEK293T-FLAG- RagBQ99L cells were plated in 6-well plates at the density of 1 million per well in 2 ml complete DMEM. On the next day, cells were grown to about 60 ~ 80% confluence before treatment. Peptides were dilute to the indicated concentrations in DMEM (without serum) and incubated with cells for 60 min. Cells were also deprived of amino acids or incubated with rapamycin (100 ng/ml) for 60 min. After treatment, total cell lysate were prepared for analysis.
Immunofluorescence Staining
[0093] HEK293T, HeLa, and MEFs were plated on Poly-D-Lysine Cellware 12-mm Coverslips (BD Biosciences). Twenty-four hours later, cells were either amino acid-starved, or starved and followed by amino acid re-stimulation. At the end of treatment, cells were rinsed once with PBS, and fixed for 15 min with 4% paraformaldehyde in PBS at room temperature. The slides were rinsed twice with PBS, and the cells were permeabilized with 0.1% Triton X-100 in PBS for 5 min. After rinsing twice with PBS, the slides were incubated with primary antibodies in 5% normal donkey serum for 1 - 3 h at room temperature, rinsed four times with PBS, and incubated with secondary antibodies produced in donkey (diluted 1 : 1000 in 5% normal donkey serum) for 60 min at room temperature in the dark. Slides were washed four times with PBS, mounted on glass coverslips using ProLong Gold (Invitrogen), and imaged on a Leica- Upright Point-scanning confocal microscope with a 63x oil lens.
Thin-Layer Chromatography
[0094] RagA-bound guanine nucleotides were determined by thin-layer chromatography as previously described (Li et al, 2006; Long et al, 2005). Near confluent HEK-293T cells stably expressing FLAG-RFP or FLAG-Sestrin2 were rinsed once with phosphate and serum- free DMEM, and incubated in 0.8 ml phosphate and serum- free DMEM supplemented with 0.1 μθί 32P orthophosphate (Perkin Elmer) for 4 h. Subsequently, cells were rinsed once with serum, amino acid, and phosphate-free DMEM, incubated with 0.8 ml serum, amino acid, and phosphate-free media containing 0.1 μθί 32P orthophosphate for 50 min, and stimulated with cell culture medium for 15 min. Cells were lysed in 0.5 ml lysis buffer (1% Triton X-100, 50 mM HEPES KOH [pH 7.4], 100 mM NaCl, 20 mM MgC12, 1 mM KH2P04, 1 mM ATP), and the lysates were centrifuged for 5 min at 14,000 rpm at 4 °C. The supernatant was incubated with 10 μΐ RagA antibody (CST) for 60 min at 4 °C. 20 μΐ protein G beads were added to the lysates, and incubated for another 60 min. The beads were washed three times with the wash buffer 1 (0.5% Triton X-100, 500 mM NaCl, 50 mM HEPES/KOH [pH 7.4], 20 mM MgC12 and 1 mM DTT), followed by two washes with the wash buffer 2 (0.1% Triton X-100, 100 mM NaCl, 50 mM HEPES/KOH [pH 7.4], 20 mM MgC12 and 1 mM DTT). The RagA-bound nucleotides were eluted in 15 μΐ elution buffer (20 mM Tris [pH = 7.4], 20 mM EDTA, 2% SDS, 1 mM GTP, 1 mM GDP, and 5 mM ATP) at 68 °C for 15 minutes. From a total of 10 μΐ elution, 2.5 μΐ was spotted on a PEI cellulose TLC plate, and the plate was developed in 0.75 M KH2P04 [pH = 3.4]. 1 μΐ partially hydrolyzed 32P-a-GTP and 32P-a-ATP was spotted on the same TLC plate to mark the position of GTP and GDP. With this protocol, three major bands were detected: the band closest to the origin was GTP that was followed by ATP and GDP. The radioactivity was detected with a phosphoimager, and the intensities of the GTP and GDP spots were measured by Image J software. The percent of GTP nucleotides was calculated as: [GTP/(GTP + GDP X 1.5)] X 100%. To determine Sestrin2 regulation of the guanine nucleotide-loading status of
RagBQ99L, HEK293T cells stably expressing FLAG-RFP or FLAG-Sestrin2 were cotransfected with 100 ng of pLJM 1 -FLAG-RagBQ99L and 100 ng of pRK5-FLAG-RagCD 18 IN. Twenty- four hours later, cells were treated, and lysed as afore-described. Anti-FALG M2 affinity gel was used for immunoprecipitation, and the RagBQ99L-bound guanine nucleotides were determined with the same method described above for RagA.
Expression and Purification of Recombinant Proteins
[0095] Recombinant proteins used in in vitro GAP assay and the nucleotide exchange assay were expressed and purified from HEK293T cells. Six million HEK293T cells were plated in 15 cm dishes. 30 μg pcDNA3.1-FLAG-Sestrin2 or pRK5-HA-GST-Rap2A plasmids were used for transfection, while 20 μg pRK5-HA-GST-RagA and 10 μg pRK5 -FLAG-RagCD 18 IN, 20 μg pRK5-HA-GST-RagB and 10 μg pRK5 -FLAG-RagCD 181 N, 20 μg pRK5-HA-GST- RagC and 10 μg pRK5-FLAG-RagBD163N, 20 μg pRK5-HA-GST-RagD and 10 μg pRK5- FLAG-RagBD163N plasmids were used to express the dimeric Rag complexes. Thirty-six hours after transfection, cell lysates were prepared with the 1% Triton XI 00 buffer described above. Either 200 μΐ 50% slurry of glutathione affinity beads or 200 μΐ 50% slurry of FLAG-M2 affinity gel were used to pull down HA-GST-tagged Rag dimers or immunoprecipitate FLAG-tagged Sestrin2 respectively. Recombinant proteins were immunoprecipitated for 3 h at 4 °C. Each sample was washed once with 1% Triton X100 buffer, followed by 3 washes with 1% Triton X100 buffer supplemented with 500 mM NaCl. FLAG-Sestrins were eluted twice with 10 μg/ml FLAG peptide, and HA-GST-tagged proteins were eluted twice with the reduced glutathione. The two elusions were pooled, and concentered by Amico Ultra centrifugal filter with a 10 kD cut-off. The buffer of the concentrated proteins was exchanged into the wash buffer used in the nucleotide exchange assay (40 mM Hepes [pH=7.4], 150 mM NaCl and 5 mM MgC12) by 3 times centrifugation with the same Ultra centrifugal filter. Purified proteins were snap-frozen by dry ice and stored as small aliquots at - 80 °C.
[0096] Recombinant proteins used in in vitro binding assays were expressed, and purified from bacteria. To express His-RagA-RagC dimer in bacteria, cDNAs of RagA and RagC were subcloned into pETDuet-1 vector (Novagen) for bicistronic protein expression in the Escherichia coli strain BL21 (DE3). The His-RagA-RagC complex was purified using HisPurTM Ni-NTA Superflow Agarose (Thermo Scientific). To express Sestrins in bacteria, cDNAs of Sestrinl, Sestrin2, and Sestrin3 were subcloned into pGEX-6p-l, and expressed in BL21 (DE3). GST, GST-Sestrinl, GST-Sestrin2, GST-Sestrin3 were purified using Glutatione Sepharose 4B columns (GE Health). GST-Sestrinl and GST-Sestrin3 were not stable in bacteria, and the recombinant proteins were degraded quickly after purification. The purified GST-Sestrin2 fusion protein was relatively stable, and further purified by anion exchange with Resouce 15Q (GE Health).
In vitro Protein-binding Assay
[0097] 2 μg recombinant GST or GST-Sestrin2 fusion protein was incubated with 20 μΐ 50% slurry of Glutatione Sepharose 4B beads in 100 μΐ binding buffer (1% Triton X-100, 2.5 mM MgC12, 40 mM HEPES [pH 7.4], 2 mM DTT and 1 mg/ml BSA) for 60 min at 4 °C. The beads were washed three times with binding buffer to remove unbound proteins. Subsequently, the recombinant His-RagA-RagC protein complex was incubated with the beads for 60 min at 4 °C. The beads were then washed three times with ice-cold binding buffer supplemented with 150 mM NaCl, and reconstituted with 50 μΐ sample buffer for immunoblotting.
Nucleotide Exchange Assay
[0098] 16 pmols HA-GST-RagA-RagCD 18 IN, HA-GST-RagB-RagCD 18 IN, HA-GST-
RagC-RagBD 163N, or HA-GST-RagD-RagBD 163N were co-loaded with 100 nM GDP and 100 nM XTP in a total volume of 40 μΐ loading buffer (5 mM EDTA, 0.3% CHAPS, 40 mM Hepes [pH = 7.4], 2 mM DTT, 1 mg/ml BSA) for 10 min at 25 °C. The GTPase-GDP-XTP complexes were stabilized by the addition of 0.4 μΐ 2 M MgC12 (final concentration at 20 mM), which were further incubated at 4 °C overnight or at 25 °C for 5 min (no difference was observed between the two methods). The 40 μΐ GTPase-GDP-XTP complexes were split into two equal parts, and were either left untreated or incubated with Sestrin2. To initiate nucleotide exchange, 16 pmols FLAG-Sestrin2 or FLAG-Sestrin2AAA in wash buffer (40 mM Hepes [pH=7.4], 150 mM NaCl, and 5 mM MgC12) supplemented with 1 μθί (800 nM) 35S-GTP-yS in a total volume of 10 μΐ were added to the 20 μΐ GTPase-GDP-XTP complexes. 6 μΐ samples were taken at 2, 4, 6, 8, 10 min, and spotted on nitrocellulose filters. The filters were washed with 5 ml wash buffer, and the retained radioactivity was measured using a TriCarb scintillation counter (PerkinElmer).
In Vitro GAP Assay
[0099] In a total volume of 15 μΐ GAP buffer (50 mM Hepes [pH=7.4], 2 mM EDTA, 1 mM DTT, 10 mM MgC12 and 0.5 mg/ml BSA), 10 pmols Rap2a or the indicated Rag heterodimers were incubated with XTP and 32P-a-GTP in the presence or absence of 20 pmols FLAG-Sestrin2 for 60 min at 30°C. At the end of incubation, 1 μΐ sample was spotted on PEI cellulose TLC plates, and analyzed as afore-described.
Antibodies
[0100] Antibodies against phospho-S6K (T389) (#9205), S6K (#9202), phospho-S6 (Ser235/236) (#4858), phospho-S6 (Ser235/236) (#2215), S6 (#2217), phospho-Akt (Thr308) (#13038), phospho-Akt (Ser473) (#4060), AKT (4691), phospho-4E-BPl (Thr37/46) (#2855), 4E-BP1 (#9644), TSC2 (#4308), mTOR (#2983), RagA (#4357), RagB (#8150), RagC (#9480) and RagD (#4470) were purchased from Cell Signaling Technology. Lamp2 mouse monoclonal antibody (H4B4, for human cells) and Lamp2 rat-monoclonal antibody (GL2A7, for mouse cells) were purchased from Abeam. Anti-FLAG (F1804) and anti-HA (3F10) were purchased from Sigma. Anti-Sestrinl (sc-376170) and anti-Sestrin2 (10795-1-AP) antibodies were from Santa Cruz Biotechnology and Proteintech.
Plasmid Constructs
[0101] Sestrin2419A, Sestrin2422A, Sestrin2426A, and Sestrin2AAA were generated by site-directed mutagenesis and cloned into plnducer21 using gateway cloning. The following plasmids were obtained from Addgene: pRK5-HA-GST-Rap2a (14952), pRK5 -HA-GST-RagA- wt (19298), pRK5-HA-GST-RagA-21L (19299), pRK5-HA-GST-RagA-66L (19300), pRK5- HA-GST-RagB-wt (19301), pRK5-HA-GST-RagB-54L (19302), pRK5-HA-GST-RagB-99L (19303), pRK5-HA-GST-RagC-wt (19304), pRK5-HA-GST-RagB-75L (19305), pRK5-HA- GST-RagC-120L (19306), pRK5-HA-GST-RagD-wt (19307), pRK5-HA-GST-RagD-77L (19308), pRK5-HA-GST-RagD- 121 L (19309), pRK5-FLAG-RagB-D163N (42324), pRK5- FLAG-RagC-D 18 IN (42325), pLJMl-Flag-RagB-99L (19315), and pLK0.1-TSC2 (15478). RagB-99H was generated by site-directed mutagenesis with pLJMl-Flag-RagB-99L as a template. The integrity of all constructs and the presence of targeted mutations were verified by sequencing.
Genotyping
[0102] The following primers were used for genotyping Sestrin-deficient mice:
Sestrinl : primer #1 : GGATTGATTGCCCTCAAAAG
primer #2: CGTGGGCTGTCAGTGATACA
primer #3 : AAATCCATGCTGGTGAGGTG
Sestrin2: primer #1 : GGTCAGAGGAAGTGCATAGGA
primer #2: CCAACCCCTTCCTCCTACAT
primer #3: CTCACCAGCCCCTGTTTTTA
Sestrin3 : primer #1 : GGTTTCCAGACAGGGTTTCTC
primer #2: GACCTGGGATGGGAAGCTAT primer #3 : GCCATGTGCCATGTAACAAC
Quantitative RT-PCR
[0103] Total RNA from liver or MEFs was extracted with R easy (Qiagen), revers- transcribed with Superscript III (Invitrogen) and used at 1 : 100 dilution in quantitative real-time PCR. mRNA levels of Sestrin3 were normalized to β-Actin. The primers used were: Sestrin3-F, TTACTTGAACGGAGCCTGAAG; Sestrin3-R, TCCATCAGAAGCAGATTCACG; Actin-F, GGCACCACACCTTCTACAATG; Actin-R, GTGGTGGTGAAGCTGTAGCC.
Example 2: Sestrin Inhibition of mTORCl Signaling is Independent of TSC2 and AMPK
[0104] The present Example provides the surprising demonstration that mTORCl signaling is independent of TSC2 and AMPK, contrary to expectation in the field. Based on the observation that Sestrins could not repress mTORCl signaling in TSC2 deficient mouse embryonic fibroblasts (MEFs), studies had concluded that Sestrin inhibition of mTORCl signaling was dependent on TSC (Budanov and Karin, 2008; Chen et al, 2010). However, the present Example demonstrates that basal mTORCl activity in TSC2 deficient MEFs is substantially higher than that in WT MEFs (Figure 9A). Without wishing to be bound by any particular theory, we propose that the source of a problem with prior studies attempting to analyze and/or control/modulate mTORCl signaling is that, in the systems they utilized, Sestrins might not have been expressed at sufficiently high levels to inhibit elevated mTORCl signaling. Among other things, therefore, the present disclosure identifies the source of a problem in certain prior work, and thus provides strategies for identifying, characterizing, and/or using mTORCl modulators.
[0105] Specifically, as described herein, we overexpressed a FLAG tagged Sestrin2 at different levels in TCS2 deficient MEFs, and found that Sestrin2, in a dose-dependent manner, inhibited threonine 389 phosphorylation of S6K, a canonical mTORCl substrate (Figure 1A). In addition, Sestrin2 overexpression corrected the low AKT signaling (Figure 1A) caused by mTORCl -induced feedback inhibition of the PI3K pathway in TCS2 deficient MEFs (Um et al, 2004). To corroborate these findings and assess whether Sestrins can inhibit mTORCl signaling via TSC-independent mechanisms in human cells, we overexpressed Sestrin2 in HeLa cells in which TSC2 was knocked down by shRNA. TSC2 knockdown led to enhanced mTORCl signaling (Figure 9B). Importantly, Sestrin2 overexpression substantially inhibited mTORCl activation in TSC2 knockdown cells (Figure 9B). Previous studies have also implicated AMPK in Sestrin inhibition of mTORCl signaling (Budanov and Karin, 2008; Chen et al, 2010).
Although AMPK phosphorylates and activates TSC, it can suppress mTORCl signaling through TSC-independent pathways such as direct phosphorylation of the mTORCl component Raptor (Gwinn et al, 2008). To investigate the definitive role of AMPK in Sestrin regulation of mTORCl signaling, we overexpressed Sestrin2 in MEFs deficient in both AMPKal and AMPKa2 (AMPKDKO). Unexpectedly, Sestrin2 overexpression repressed mTORCl signaling in a dose-dependent manner in AMPKDKO MEFs (Figure IB), in line with reduced cell size
(Figure 9C) as a consequence of diminished mTORCl activity. Taken together, these observations demonstrate that Sestrin regulation of mTORCl signaling can occur with or without either TSC2 or AMPK.
Example 3: Sestrins Inhibit Rag-dependent mTORCl Lysosomal Translocation
[0106] The present Example demonstrates that Sestrins mediate modulation of mTORCl function, and particularly that such modulation is achieved through modulation of Rag GTPases. Among other things, these findings establish, as described herein, that the present disclosure provides strategies for identifying, characterizing, and/or using mTORCl modulators.
[0107] The present disclosure provides the insight, in light of the finding described herein in Example 2 that TSC2 was dispensable for Sestrin inhibition of mTORCl signaling, that Sestrins do not interfere with Rheb-dependent mTORCl activation induced by growth factors. The present disclosure appreciates that amino acid-triggered mTORCl lysosomal translocation is an obligate step for mTORCl activation that is independent of the TSC-Rheb axis (as confirmed, for example, by Bar-Peled and Sabatini, 2014 and references cited therein). Without wishing to be bound by any particular theory, we explored the possibility that Sestrins might target the nutrient-sensing pathway for mTORCl regulation. A previous study showed that amino acid signaling to mTORCl can be bypassed by expressing a mutant form of the mTORCl scaffolding subunit Raptor with its C-terminus fused to a 15-amino acid lysosome-targeting signal from Rhebl (Raptor-Rhebl5) (Sancak et al, 2010). Indeed, compared to cells expressing the control GTPase Rap2A, cells expressing Raptor-Rhebl5 that tethers mTORCl to the lysosome were insensitive to Sestrin2-induced mTORCl suppression (Figure 2A). In light of these observations and the data described herein, we propose that Sestrins inhibit mTORCl signaling upstream of mTORCl lysosomal translocation. Amino acid- induced mTORCl translocation is mediated by the Rag subfamily of small GTPases. The active Rag complex, RagA/BGTP-RagC/DGDP, physically interacts with Raptor, and recruits mTORCl to the lysosome (Sancak et al, 2010). To investigate whether Sestrins regulate mTORCl via Rag proteins, we used a RagBQ99L mutant that is "locked" in the active GTP-bound state, and renders the Rag complex constitutively active (Sancak et al, 2008). Indeed, when co-expressed with Sestrin2, RagBQ99L but not the control Rap2A fully rescued mTORC 1 signaling (Figure 2B).
[0108] To directly examine the role of Sestrins in the control of mTORCl translocation, we established stable cell lines expressing Sestrin 1, Sestrin2, or Sestrin3. Cells were starved for 60 minutes in a medium that was depleted of amino acids but contained 10% fetal bovine serum to maintain growth factor signaling, and were re-stimulated with amino acid-replete medium for 15 minutes. As expected, mTORCl was dispersed in the cytosol in the absence of amino acids, and amino acid re-stimulation triggered mTORC 1 translocation to the lysosome marked by Lamp2 staining in control HeLa cells (Figure 2C). In contrast, amino acid-induced mTORCl translocation was markedly inhibited in cells expressing either of the Sestrins (Figure 2C), while the lysosomal localization of Rag molecules was not affected (Figure 10). The present disclosure therefore demonstrates that Sestrins modulate (e.g., repress) mTORCl signaling, and furthermore indicates that such modulation can be achieved through the inhibition of amino acid- induced Rag activation and mTORCl lysosomal translocation.
Example 4: Sestrins Interact with Rags
[0109] The present Example demonstrates that direct interaction between Sestrins and
Rag proteins.
[0110] To investigate whether Sestrins regulate Rag activation through protein-protein interactions, we co-transfected HA-GST-tagged Rag heterodimers or control Rap2A with FLAG- tagged Sestrin2, and evaluated their interactions by co-immunoprecipitation. We found that Rag complexes with different combinations of GTP- and GDP-loading states but not the control Rap2A co-immunoprecipitated with Sestrin2 (Figure 3A). Similar observations were made with FLAG-tagged Sestrinl and Sestrin3 (data not shown).
[0111] To interrogate these interactions more stringently, we established HeLa cell lines expressing FLAG-tagged Sestrins or RFP, and evaluated their association with endogenous Rag proteins. We found that Rags could co-immunoprecipitate with all Sestrins, but not RFP (Figure 3B), although the expression level of RFP was much higher than those of Sestrins (Figure 3B). The association between Sestrins and Rags was further corroborated by the observation that a Flag-tagged Sestrin was partially colocalized with RagC in cells (Figure 1 1A). To test whether Sestrins directly interact with the Rag complex, we expressed and purified GST-tagged Sestrin2 (Figure 1 IB) and His-tagged RagA and RagC heterodimer (Figure 11C) from bacteria. In an in vitro GST pull-down assay, we found that the His-RagA-RagC dimer physically interacts with GSTSestrin2, but not GST alone (Figure 3C). Taken together, these observations demonstrate that Sestrins can interact with the Rag complex in vivo and in vitro. In some embodiments, the present disclosure provides systems (e.g., methods and/or compositions) that permit
identification, characterization, and/or use of mTORCl modulators that utilize or involve disruption of Rag complex interactions (e.g., with Sestrins).
Example 5: Sestrins Enhance RagBQ99L- induced mTORCl Activation under the Amino Acid Starvation Condition [0112] The present Example describes the enhancement of mTORCl activity by Sestrins in the context of GTP "locked" RagB and amino acid starvation.
[0113] The present disclosure encompasses the recognition, informed by the
demonstration provided herein that Sestrins physically interact with the Rag complex, that Sestrins may directly modulate Rag GTPase activation. The present Example demonstrates, among other things, that under conditions of amino acid starvation followed by amino acid re- stimulation, RagBQ99L could fully rescue the mTORCl suppression induced by Sestrins (Figure 2B). We also observed that the GTP-"locked" RagBQ99L mutant induced mTORCl signaling in the absence of amino acids (Figure 4A), as expected. Surprisingly, co-expression of Sestrinl, Sestrin2, or Sestrin3 with RagBQ99L substantially enhanced mTORCl signaling (Figure 4A and data not shown), which was not observed when Sestrins were co-expressed with Raptor- Rhebl5 (Figure 12). These observations reveal that Sestrins can either inhibit or potentiate mTORCl signaling. Furthermore, these findings demonstrate that these opposing activities function upstream of mTORCl lysosomal translocation, and are dependent on the guanine nucleotide loading status of the Rag GTPases. The RagBQ99L mutant was generated based on the finding that the corresponding glutamine 61 in Ras GTPase is required for the nucleophilic attack of the γ-phosphate of GTP to trigger its hydrolysis to GDP (Boguski and McCormick, 1993). When this glutamine is mutated to other amino acid residues, Ras-bound GTP cannot be hydrolyzed and the GTPases are "locked" into the GTP-bound state. However, detailed analysis of the biochemical properties of RasQ61L showed that this mutant has a six- fold faster GTP dissociation rate compared to that of wild-type Ras due to the inability of the hydrophobic leucine to stabilize GTP (Krengel et al, 1990). In light of these findings, we hypothesized that Sestrins might enhance RagBQ99L- induced mTORCl activation by preventing GTP dissociation from RagBQ99L. To test this hypothesis, we generated another RagB mutant (RagBQ99H) by replacing glutamine 99 to histidine, which is analogous to the glutamine 61 to histidine mutant of Ras (RasQ61H). A previous study showed that similar to RasQ61L, RasQ61H cannot hydrolyze GTP, but unlike RasQ61L, RasQ61H has a normal GTP dissociation rate that is comparable to that of wild-type Ras (Krengel et al, 1990). To investigate the mTORCl- stimulating functions of RagBQ99H and RagBQ99L, we established RagBQ99H-, RagBQ99L- or control Rap2A-expressing cell lines that co- expressed Sestrin2 or RFP. RagBQ99H- expressing cells had stronger mTORCl signaling than that of RagBQ99L-expressing cells (Figure 4B and 4C), which was in line with the predicted increase in stability of GTP binding to RagBQ99H. Interestingly, Sestrin2 had a lesser impact on RagBQ99H-induced mTORCl activation than that triggered by RagBQ99L (Figure 4B and 4C).
[0114] To directly test whether Sestrin2 could stabilize RagBQ99L GTP binding, we examined the guanine nucleotide loading status of RagBQ99L in RFP- or Sestrin2-expressing cells that had been pulse labeled with P orthophosphate. A HA-GST-tagged RagBy was pulled- down with glutathione beads, and the bound nucleotides were eluted and separated by thinlayer chromatography (TLC). We found that Sestrin2 increased GTP binding to RagBQ99L by more than 2 fold (Figure 4D). Taken together, these observations demonstrate that Sestrins have the unexpected function of enhancing mTORCl signaling induced by a GTPase-deficient RagB mutant, which is associated with the stabilization of GTP binding to RagBQ99L.
Example 6: Sestrins Can Act as GDIs for RagA and RagB
[0115] This Example demonstrates, among other things, that Sestrins can inhibit nucleotide exchange by Rag proteins.. Without wishing to be bound by any particular theory, we propose that such inhibition may contribute to and/or provide a mechanism fo Sestrin inhibition of mTORCl signaling.
[0116] To investigate whether Sestrins regulated guanine nucleotide loading of endogenous Rags, we immunoprecipitated RagA and analyzed RagA-bound nucleotides by TLC. In line with a previous study (Sancak et al, 2008), amino acid stimulation triggered a GDP to GTP exchange resulting in a higher proportion of GTP-loaded RagA than observed in amino acid-starved cells (Figure 5A). This amino acid-induced nucleotide exchange was completely inhibited in Sestrin2-expressing cells (Figure 5A). These observations suggest that Sestrin- mediated suppression of mTORCl signaling results from its inhibition of RagA GDP
dissociation upon amino acid stimulation.
[0117] The present invention provides the insight that ability of Sestrin2 to stabilize
RagA GDP binding is most consistent with its role as a GDI. To test this hypothesis, we adopted a previously described GEF/GDI assay (Bar-Peled et al., 2012) in which the conserved aspartic acid in the "NKxD" motif of RagB and RagC was mutated to asparagine (RagBD163N and RagCD181N, designated as RagBX and RagCX respectively). This mutation changes the base specificity of GTPases from guanine to xanthosine (Hoffenberg et al., 1995; Schmidt et al, 1996). We could thus pre-load the recombinant RagA/B-RagCX or RagBX -RagC/D (Figure 13 A) with GDP and XTP, resulting in GDP binding to WT Rags and XTP binding to RagBX or RagCX. 35S-labeled GTP was subsequently added to initiate nucleotide exchange. We found that Sestrin2 inhibited GDP to GTP exchange in RagA/B, but not in RagC/D (Figure 5B).
Furthermore, Sestrin2 did not stimulate the hydrolysis of Rag-bound GTP (Figure 13B), and therefore was not a GAP for Rags.
[0118] These findings demonstrate that Sestrins are GDIs for RagA and RagB.
Moreover, given that Sestrins display classical GDI activity towards Rag GTPases, but do not affect their lysosomal localization, these findings demonstrate that Sestrins represent a unique subfamily of GDIs. Example 7: A Sestrin GDI Motif Modulates Signaling of mTORCl
[0119] The present Example defines a Sestrin GDI motif and establishes its ability to modulate mTORCl signaling.
[0120]
To gain molecular insights into the GDI activity of Sestrins, we aligned the sequences of Sestrins to those of RhoGDI and Rab GDI. Although Sestrins did not share overall sequence similarities with RhoGDI or Rab GDI (data not shown), a peptide motif near the C-termini of all Sestrins from fly, mouse, and human was highly homologous to the Rab GTPase-binding motif of Rab GDI (Schalk et al, 1996) (Figure 6A). Structural analysis of Rab GDI has revealed that the arginine residue within the motif forms a hydrogen bond with the aspartic acid residue from the switch 2 region of Rab, which stabilizes the coordination of Mg2+ that is essential for guanine nucleotide binding (Rak et al, 2003). To investigate whether the analogous arginine residue in Sestrins can effect Sestrin regulation of mTORCl signaling, we mutated arginine 419 in Sestrin2 to alanine, and established a stable cell line expressing this mutant (Sestrin2419A). We found that, compared to WT Sestrin2, Sestrin2419A was unable to inhibit mTORCl signaling in cells cultured with amino acid-replete medium (Figure 6B, lanes 1, 5, and 13).
[0121] To determine whether Sestrin2419A regulation of mTORCl activation might be dependent on the strength of nutrient signaling, we cultured cells in medium with different concentrations of amino acids. Lowering the concentration of amino acids in control cells led to a gradual decline of mTORCl signaling (Figure 6B, lanes 1 - 4), which was exacerbated in cells expressing Sestrin2 (Figure 6B, lanes 5 - 8). Surprisingly, the effect of amino acid dosage on mTORCl signaling was much attenuated in cells expressing Sestrin2419A, with 5% amino acids maintaining a high level of mTORCl activity (Figure 6B, lanes 13 - 15). Residual mTORCl activity could still be detected in medium depleted of amino acids (Figure 6B, lane 16), suggesting that Sestrin2419A might function as a dominant negative mutant. Indeed, further characterization of the Sestrin2419A mutant showed that Sestrin2 binding to Rags was not compromised with the arginine 419 to alanine substitution (Figure 14 and data not shown).
[0122] Because the dominant negative effect of Sestrin2419A was partial, we reasoned that positively charged residues other than the arginine might compensate for the GDI activity of Sestrins. A closer examination of the sequence alignment revealed two highly conserved lysines in all Sestrins (K422 and K426 in Sestrin2), which are not present in Rab GDI (Figure 6A). Replacement of these two lysines either alone or in combination with alanines did not have a major effect on Sestrin2 inhibition of mTORCl activation (Figure 6B, lanes 17 - 24, and data not shown). However, a Sestrin2 mutant with the replacement of both lysines and arginine to alanines (Sestrin2AAA) rendered the cells almost completely insensitive to amino acid starvation- triggered mTORCl inactivation (Figure 6B, lane 9 - 12). In line with its inability to inhibit mTORCl signaling, Sestrin2AAA was mostly devoid of its GDI activity towards RagB (Figure 6C). Furthermore, cells expressing Sestrin2AAA were refractory to amino acid starvation- triggered mTORCl lysosome dissociation (Figure 6D). These findings have thus identified a functional GDI motif in Sestrins, and supported the conclusion that Sestrins target the Rag- dependent nutrient-sensing pathway to control mTORCl signaling.
[0123] To investigate whether the GDI motif of Sestrins might be sufficient to inhibit mTORCl signaling, we generated a cell-permeable peptide, Tat-Sestrin2-GDI motif (TG), composed of the HIV-1 Tat protein transduction domain (Van den Berg and Dowdy, 201 1) attached via a di-glycine linker to a 22-amino acid peptide encompassing the GDI motif of
Sestrin2 (amino acids 410 - 431) (Figure 6E). In addition, the GDI motif was randomly shuffled to generate a control Tat-Sestrin2-GDI motif-Scramble peptide (T-S) (Figure 6E). Treatment of HEK293T cells with T-G, but not T-S, resulted in a dose dependent repression of mTORCl signaling (Figure 6F). Importantly, T-G failed to inhibit mTORCl activation in HEK293T cells stably expressing RagBQ99L that "locks" RagB in the GTP-bound state, and renders cells insensitive to amino acid deprivation-triggered mTORCl inactivation (Figure 6F). These findings demonstrate that the GDI motif of Sestrins by itself is able to target the Rag GTPases to suppress mTORCl signaling.
Example 8: Mouse and Human Sestrin Peptides Regulate mTORCl Signaling
[0124] The present Example describes the amino acid differences between human and mouse Sestrin GDI motif and their shared ability to modulate mTORC 1 signaling. Alignment of the amino acid sequences of mouse and human Sestrin2 demonstrates that the human peptide has one amino acid substitution relative to the mouse sequence( Figure 7A). The three positively charged amino acids in the Sestrin2 GDI motif are demonstrated to be important for modulation of mTORCl signaling (Figure 7B). Moreover, a peptide with the human Sestrin GDI motif inhibits mTORCl signaling (Figure 7B). In accordance with the present invention, either mouse or human Sestrin GDI motif can be used for modulation of mTORCl signaling.
Example 9: Loss of Sestrins Renders mTORCl Signaling Insensitive to Nutrient Status In Vivo
[0125] The present Example describes characteristics of Sestrin-knockout mice and demonstrates that, among other things, Sestrin 1, Sestrin2, and Sestrin3 function redundantly to suppress nutrient- but not growth factor- induced mTORCl signaling .
[0126] To investigate whether endogenous Sestrins were regulators of Rag dependent mTORCl signaling, we wished to generate Sestrin deficient mice. Overexpression of Sestrin 1, Sestrin2, or Sestrin3 inhibited mTORCl activation (Figure 2C), raising the possibility that they might be functionally redundant. To investigate the total contribution of Sestrins, we generated null alleles for Sestrinl, Sestrin2, and Sestrin3 (Figure 15A - 15D). Mice harboring these alleles were crossed with each other to generate the triple-knockout (TKO) mice. We found that mice with the deletion of 5 of the 6 Sestrin alleles were born with the expected Mendelian ratios (data not shown). However, Sestrin TKO pups were dramatically underrepresented when genotyped at 10 days after birth (Figure 8 A).
[0127] When neonatal mice were genotyped right after birth, Sestrin TKO mice were born at an expected Mendelian ratio, and appeared indistinguishable from their wild-type littermates (Figure 8A and data not shown). These findings suggest that Sestrins are not required for embryonic development, but are important for postnatal survival. Intriguingly, a similar neonatal lethal phenotype was observed in RagAGTP/GTP knockin mice that could not terminate mTORC 1 signaling during the fasting period that occurs in mammals between birth and suckling (Efeyan etal., 2013). Indeed, we found that mTORCl signaling was constitutively active in the liver, heart and skeletal muscle (limbs) of TKO mice during neonatal fasting
(Figure 8B). In particular, mTORCl activity in the liver and limbs was inversely associated with the Sestrin gene dosage, which was in line with the finding that all Sestrins were expressed in these tissues (Figures 8B and 15E, and data not shown). In contrast, Sestrinl, but not Sestrin2 or Sestrin3, was expressed at high levels in the heart (Figure 8B and data not shown), and the loss of Sestrinl alone was sufficient to render mTORC l signaling resistant to neonatal fasting in this organ (Figures 8B and 15F). Taken together, these findings demonstrate that Sestrins have family member-specific as well as redundant functions in repressing mTORC l signaling in different tissues during neonatal fasting, and the loss of all three Sestrins triggers a neonatal lethal phenotype.
[0128] To further investigate Sestrin control of mTORCl signaling, we used MEFs that expressed all three Sestrins (Figure 15G - 151). We derived MEFs from wild-type, Sestrinl+/- 2-/-3+Λ, Sestrin 1+/-2-/-3-/-, and Sestrin 1-/-2-/-3-/- embryos, and found that the sensitivity of mTORCl signaling to amino acids was dependent on Sestrin gene dosage: the fewer alleles of Sestrins, the less dependence of MEFs on amino acids (Figure 15 J). Importantly, whereas mTORCl signaling in wild-type MEFs was completely inhibited within 30 minutes of amino acid starvation, Sestrin 1-/-2-/-3-/- MEFs maintained mTORCl activation after prolonged amino acid deprivation (Figure 8C). As another major nutrient, glucose also regulates mTORCl activity partially through Rag GTPases (Efeyan et al, 2013). We found that Sestrin 1-/-2-/-3 -/- MEFs were also resistant to mTORCl inactivation triggered by glucose, or glucose and amino acid deprivation (Figure 8D). In line with these observations, substantial amounts of mTORCl were localized on the lysosome in Sestrinl -I-2-/-3-/- MEFs under the condition of amino acid starvation (Figure 8E). In contrast, mTORC l signaling in Sestrinl -/-2-/-3-/- MEFs was still dependent on growth factors (Figure 8D). In addition, unlike Tsc2-/- MEFs that had increased mTORCl signaling when cultured in complete medium, Sestrinl-/-2-/-3-/- MEFs did not show enhanced mTORCl activation under the same conditions (Figure 15K), suggesting that the maximum capacity of mTORCl signaling was not increased in the absence of Sestrins. In summary, these data demonstrate that Sestrins are regulators of Rag GTPases, with Sestrinl, Sestrin2, and Sestrin3 functioning redundantly to suppress nutrient- but not growth factor- induced mTORCl signaling (Figure 15L).
Example 10: A Sestrin Peptide Inhibitory Agent
[0129] The present Example describes a particuarl Sestrin peptide agent provided in accordance with the present invention that inhibits mTORCl signaling.
[0130] We generated a peptide inhibitor of mTORCl, which is composed of an HIV-1
Tat protein transduction domain and a Sestrin GDI motif (e.g., of mouse of human Sestrins).
This peptide inhibitor specifically and reversibly inhibits mTORCl signaling in a Rag GTPases dependent manner. Unlike Rapamycin or kinase inhibitors of mTOR that inhibit both mTORCl and mTORC2, this inhibitor does not inhibit mTORC2; this inhibitor represents the first mTORCl -specific inhibitor. More precisely, this peptide is a Rag GTPases inhibitor, which is also the first in the field.
[0131] As shown in Figure 6a, we found that three positively charged residues found in the mouse Sestrin2 motif were required for inhibition of mTORCl, at least in certain constructs as specifically exemplified herein. We found that both mouse and human GDI motifs can inhibit mTORCl signaling.
Example 11: Identifying and/or Characterizing mTORCl Modulating Agents
[0132] As described herein, the present disclosure establishes the effectiveness of Sestrin peptide agents as modulators, and specifically as inhibitors, of mTORCl signaling. Moreover, the present disclosure establishes the effectiveness of inhibiting RAG GTPases in achieving inhibition of mTORCl signaling, including specific inhibition of mTORCl signaling as compared with mTORC2 signaling. The present disclosure therefore demonstrates the feasibility of identifying and/or characterization of such agents that show such acitivites, and moreover provides reagents useful in such identification and/or characterization. For example, in some embodiments, the present disclosure provides assays for the identification and/or characterization of agents that specifically modulate (e.g., inhibit) mTORCl signaling, for example by establishing their effectiveness relative to a Sestrin peptide agent as described herein.
[0133] To give but a few specific examples, we have expressed the G domain of RagA.
We will label the G domain and a Sestrin peptide agent as described herein with different detectable labels (e.g., different fluorescent labels), so that binding between the RagA G domain and the Sestrin peptide agent can be directed detected. Agents that disrupt such binding will be identified and/or characterized as potential RagA inhibitors and therefore, in accordance with the present disclosure, potential mTORCl modulatory (e.g., inhibitory) agents.
[0134] Alternatively or additionally, one or more mTORCl modulatory agents can be identified and/or characterized by direct function screening. In some particular embodiments, RagA will be loaded with fluorescence labeled GDP first, then excessive unlabeled GTP will be added to replace the GDP, the reduction of the signal of fluorescence (labeled GDP) can be monitored. Then one or more potential mTORCl modulatory agents will be used in this assay; any agent that can inhibit GDP release can be considered to be an inhibitor of RagA
Example 12: Analyzing Effectis of mTORCl Inhibition in Obesity Models
In accordance with the present invention, effects of mTORCl modulating agents (e.g., Sestrin peptide agents as described herein) can be assessed in an obesity model, for example using mice that are fed a high-fat diet (60% fat) to induce obesity, insulin resistance and diabetes. For example, in some embodiments, at the onset of obesity, groups of mice are intraperitoneally (IP) injected with PBS or with an mTORCl modulatory (e.g., inhibitory) agent (e.g., a Sestrin peptide agent) as described herein dissolved in PBS (20mg/kg/day). Metabolic parameters are monitored, including body weight, glucose tolerance test (GTT), insulin tolerance test (ITT), and pyruvate tolerance test (PTT). In some embodiments, the mTORCl modulatory agent is a Sestrin peptide agent. In some embodiments, a particular Sestrin peptide agent is utilized as a reference against which activity of one or more other agents (in some embodiments one or more other Sestrin peptide agents; in some embodiments one or more non-Sestrin-peptide and/or non- peptide agents) is compared.
Example 13: Analyzing Effects of mTORCl Inhibition in Cancer Models
[0135] In accordance with the present invention, the effect of mTORCl modulating agents (e.g., Sestrin peptide agents as described herein) can be assessed in a cancer model, for example using rapamycin- sensitive cancer cell lines (such as PC3 and SW780, whose growth can be inhibited by rapamycin) implanted in immune-deficient mice. Groups of mice are intraperitoneally (IP) injected with PBS or with an mTORCl modulatory (e.g., inhibitory) agent (e.g., a Sestrin peptide agent) dissolved in PBS (20mg/kg/day). Tumor size and the survival of mice is monitored. In some embodiments, the mTORCl modulatory agent is a Sestrin peptide agent. In some embodiments, a particular Sestrin peptide agent is utilized as a reference against which activity of one or more other agents (in some embodiments one or more other Sestrin peptide agents; in some embodiments one or more non-Sestrin-peptide and/or non-peptide agents) is compared. [0136] Those of ordinary skill in the art will appreciate that effective treatment of cancer may well require inhibition of both mTORCl and mTORC2. In some embodiments, as described herein, provided mTORCl modulating agents specifically inhibit mTORCl signaling and not mTORC2 signaling. In some emodiments, therefore, provided mTORCl modulating agents (e.g.Sestrin peptide agents) are not effective in the treatment of cancer (and/or do not show significant activity in cancer treatment models such as described in this Example), but are effective,for example in treatment of aging-related, metabolic syndrome, and/or
neurodegenerative diseases (e.g., showing activity in models thereof).
Example 14: Analyzing Effectis of mTORCl Inhibition in Autophagy Related Disease Models
[0137] mTORCl is a critical negative regulator of autophagy, a process involved in many diseases. Polyglutamine repeat expansion is a neurodegenerative disease model related to Huntington's disease, spinocerebellar ataxias, synucleinopathies and tauopathies.
Pharmacological activation of autophagy (such as inhibition of mTORCl) reduces levels of soluble and aggregated proteins. HeLa cells expressing doxycyline-repressible CFP fused to, for example, httl03Q are treated with one or more mTORCl modulating agents of interest, or with a control (e.g., with no agent and/or with a reference agent e.g., a reference Sestin peptide agent of known activity); activation of autophagy and clearance of protein aggregates are examined, for example by immunoblotting.
[0138] Induction of autophagy has beneficial effects in animal models of certain viral and intracellular bacterial infections, and autophagy-inducing compounds (such as rapamycin) inhibit HIV replication in primary human monocyte-derived macrophages (MDMs). In accordance with the present invention, replication of any or all of RNA viruses (e.g., Sindbis virus (SINV), chikungunya virus (CHIKV), West Nile virus (WNV)), HIV-1, and/or intracellular bacteria (e.g., Listeria monocytogenes) in cells can be monitored in the presence or absence of an mTORCl modulatory (e.g., inhibitory) agent (e.g., a Sestrin peptide agent). In some
embodiments, the mTORCl modulatory agent is a Sestrin peptide agent. In some embodiments, a particular Sestrin peptide agent is utilized as a reference against which activity of one or more other agents (in some embodiments one or more other Sestrin peptide agents; in some embodiments one or more non-Sestrin-peptide and/or non-peptide agents) is compared.
.
Example 15: Analyzing Effects of mTORCl Inhibition in Autoimmune Disease Models
[0139]
The mTOR inhibitor rapamycin is a well-known immunosuppressant. The experimental autoimmune encephalomyelitis (EAE) model is an animal model of the human central nervous system (CNS) inflammatory demyelinating diseases, including multiple sclerosis and acute disseminated encephalomyelitis (ADEM). In accordance with the present invention, the effect of mTORCl inhibition can be assessed in autoimmune models, for example using mice in which EAE has been induced. In some embodiments, groups of such mice are intraperitoneally (IP) injected with PBS or an mTORCl inhibitory agent as described herein dissolved in PBS (20mg/kg/day). Disease state is monitored and the inflammation of CNS is examined by flow cytometry. In some embodiments, the mTORC 1 modulatory agent is a Sestrin peptide agent. In some embodiments, a particular Sestrin peptide agent is utilized as a reference against which activity of one or more other agents (in some embodiments one or more other Sestrin peptide agents; in some embodiments one or more non-Sestrin-peptide and/or non-peptide agents) is compared.
Equivalents and Scope
[0140] It is to be understood that while the invention has been described in conjunction with the detailed description thereof, the foregoing description is intended to illustrate and not limit the scope of the invention, which is defined by the scope of the appended claims. Other aspects, advantages, and modifications are within the scope of the following claims.

Claims

Claims We Claim:
1. A composition comprising a polypeptide modulator of mTORCl wherein the polypeptide comprises;
a. a Sestrin guanine nucleotide dissociation inhibition (GDI) domain whose amino acid sequence comprises or consists of a Sestrin GDI motif; and
b. a cell permeability domain.
2. The composition of claim 1, wherein the Sestrin GDI domain has an amino acid sequence that is or comprises a sequence showing at least 80%, 85%, 90%, 95% or 100% identity to a reference GDI motif selected from SEQ ID NO: 1 (mouse Sestrin2 aa 410-431), SEQ ID NO: 2 (human Sestrin2 aa 410-431), SEQ ID NO: 3 (mouse Sestrinl aa 422-443), SEQ ID NO: 4 (human Sestrinl aa 422-443), SEQ ID NO: 5 (mouse Sestrin3 aa 422-443), and SEQ ID NO: 6 (human Sestrin3 aa 422-443).
3. The composition of claim 1 or claim 2, wherein the Sestrin GDI motif includes arginine at a position corresponding to residue 419 of SEQ ID NO: l or 2, 431 of SEQ ID NO: 3, 4, 5, or 6.
4. The composition of claim 1, wherein the cell permeability domain is or comprises a Tat cell permeability domain.
5. The composition of claim 1, wherein the Sestrin GDI domain and the cell permeability domain are separated by a linker.
6. The composition of claim 5, wherein the linker is an unstructured domain having a length of at least 2 amino acids.
7. The composition of any of the above claims, wherein the polypeptide modulator is characterized in that, when contacted with an mTORC 1 signaling system, it modulates mTORCl signaling in a Rag GTPase dependent manner.
8. The composition of any of the above claims, wherein the polypeptide is or comprises a cyclic polypeptide.
9. The composition of any of the above claims, wherein the polypeptide is or comprises a stapled polypeptide.
10. The composition of any of the above claims, wherein the polypeptide is encapsulated to be released at specific disease site.
1 1. A method of treating a disease, disorder or condition associated with mTORCl signaling, the method comprising steps of:
administering to the subject a therapeutically effective amount of a composition as set forth in any of the above claims.
12. The method of claim 11, wherein the disease, disorder or condition is or comprises diabetes mellitus, obesity, aging, or an aging-related disease, disorder or condition.
13. The method of claim 1 1 or claim 12, further comprising administering the composition in combination with one or more other therapeutic modalities for treatment of the disease, disorder or condition.
14. A method of identifying or characterizing an mTORCl modulator, the method comprising steps of :
a. providing a plurality of test agents
b. assessing ability of each provided agent to modulate an association between RagA/B's G domain and the polypeptide of claim 1.
15. The method of claim 14, wherein the step of assessing comprises
bl. contacting the RagA/B G domain with the polypeptide of claim 1 in the presence and absence of each of the test agents, and
b2. identifying a test agent as an mTORCl modulator if levels of RagA/B G domain/peptide complex differ when the test agent is present as compared to when it is absent
16. The method of claim 15, wherein;
i. the polypeptide of claim 1 is labeled with a first detectable moiety or entity;
ii. the G domain of RagA/B is modified with a second detectable moiety or entity, distinguishable from the first detectable moiety or entity; and
iii. determining that a test agent is an mTORC 1 modulator if it modulates level of a detectable complex between the polypeptide and the RagA/B.
17. A method of identifying or characterizing an mTORCl modulator, the method comprising steps of
iv. Providing a plurality of test agents
v. assesing the ability of each provided agent to modulate the amount of GDP bound to RagA/B in the presence of each provided test agent and unlabeled GTP.
PCT/US2015/051875 2014-09-24 2015-09-24 mTORC1 MODULATION WO2016049280A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201462054863P 2014-09-24 2014-09-24
US62/054,863 2014-09-24

Publications (1)

Publication Number Publication Date
WO2016049280A1 true WO2016049280A1 (en) 2016-03-31

Family

ID=55581990

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2015/051875 WO2016049280A1 (en) 2014-09-24 2015-09-24 mTORC1 MODULATION

Country Status (1)

Country Link
WO (1) WO2016049280A1 (en)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN114702552A (en) * 2022-03-11 2022-07-05 苏州思萃免疫技术研究所有限公司 mTORC2 inhibitors
US11639508B2 (en) 2017-07-14 2023-05-02 The Johns Hopkins University Engineered TSC2
WO2023119337A1 (en) * 2021-12-24 2023-06-29 Sentcell Ltd Sestrin-mapk complex inhibitors

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20090176713A1 (en) * 2007-12-05 2009-07-09 Nono, Inc. Co-Administration of an Agent Linked to an Internalization Peptide with an Anti-Inflammatory
US20100132055A1 (en) * 2006-09-15 2010-05-27 Frankgen Biotechnologie Ag Animal model for the selection and validation of agents active against pulmonary emphysema and colorectal cancer
US20130252950A1 (en) * 2010-09-23 2013-09-26 President And Fellows Of Harvard College Targeting mtor substrates in treating proliferative diseases

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20100132055A1 (en) * 2006-09-15 2010-05-27 Frankgen Biotechnologie Ag Animal model for the selection and validation of agents active against pulmonary emphysema and colorectal cancer
US20090176713A1 (en) * 2007-12-05 2009-07-09 Nono, Inc. Co-Administration of an Agent Linked to an Internalization Peptide with an Anti-Inflammatory
US20130252950A1 (en) * 2010-09-23 2013-09-26 President And Fellows Of Harvard College Targeting mtor substrates in treating proliferative diseases

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
LEE ET AL.: "Sestrins at the crossroad between stress and aging", AGING, vol. 2, no. 6, 13 June 2010 (2010-06-13), pages 369 - 374 *
MARTINA ET AL.: "Rag GTPases mediate amino acid-dependent recruitment of TFEB and MITF to lysosomes", J CELL. BIOL., vol. 200, no. 4, 11 February 2013 (2013-02-11), pages 475 - 491 *
PENG ET AL.: "Sestrins Function as Guanine Nucleotide Dissociation Inhibitors for Rag GTPases to Control mTORC1 Signaling", CELL, vol. 159, 1, 25 September 2014 (2014-09-25), pages 122 - 133, XP029069894, DOI: doi:10.1016/j.cell.2014.08.038 *

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11639508B2 (en) 2017-07-14 2023-05-02 The Johns Hopkins University Engineered TSC2
WO2023119337A1 (en) * 2021-12-24 2023-06-29 Sentcell Ltd Sestrin-mapk complex inhibitors
CN114702552A (en) * 2022-03-11 2022-07-05 苏州思萃免疫技术研究所有限公司 mTORC2 inhibitors
CN114702552B (en) * 2022-03-11 2024-05-31 苏州思萃免疫技术研究所有限公司 MTORC2 inhibitors

Similar Documents

Publication Publication Date Title
Peng et al. Sestrins function as guanine nucleotide dissociation inhibitors for Rag GTPases to control mTORC1 signaling
Jewell et al. GPCR signaling inhibits mTORC1 via PKA phosphorylation of Raptor
Tang et al. Selective inhibition of STRN3-containing PP2A phosphatase restores hippo tumor-suppressor activity in gastric cancer
El Masri et al. RHO GTPases: from new partners to complex immune syndromes
Chen et al. Akt isoforms differentially regulate neutrophil functions
Li et al. Atrogin-1/muscle atrophy F-box inhibits calcineurin-dependent cardiac hypertrophy by participating in an SCF ubiquitin ligase complex
Linossi et al. Kinase inhibition, competitive binding and proteasomal degradation: resolving the molecular function of the suppressor of cytokine signaling (SOCS) proteins
Bjarnadottir et al. Neuregulin1 (NRG1) signaling through Fyn modulates NMDA receptor phosphorylation: differential synaptic function in NRG1+/− knock-outs compared with wild-type mice
Suh et al. Multiple roles of phosphoinositide-specific phospholipase C isozymes
Dyson et al. Phosphoinositide phosphatases: just as important as the kinases
Lian et al. Filamin a regulates neural progenitor proliferation and cortical size through Wee1-dependent Cdk1 phosphorylation
Zhang et al. Disruption of chaperone-mediated autophagy-dependent degradation of MEF2A by oxidative stress-induced lysosome destabilization
Liu et al. TRAF6 protein couples Toll-like receptor 4 signaling to Src family kinase activation and opening of paracellular pathway in human lung microvascular endothelia
Susaki et al. Cyclin D2 translocates p27 out of the nucleus and promotes its degradation at the G0-G1 transition
JP2008517931A (en) Methods and compositions for modulating PGC-1β for treating lipid-related diseases and disorders
Özgen et al. Reactive oxygen species decrease cAMP response element binding protein expression in cardiomyocytes via a protein kinase D1-dependent mechanism that does not require Ser133 phosphorylation
Ugbode et al. JNK signalling regulates antioxidant responses in neurons
WO2016049280A1 (en) mTORC1 MODULATION
Kebache et al. Grb10 and active Raf-1 kinase promote Bad-dependent cell survival
CN103965342A (en) MG53 mutant, and mutation method and application thereof
WO2020168850A1 (en) Use of ube3a ubiquitination pp2a activating factor ptpa in treating angelman syndrome and autism
Lühn et al. Identification and molecular cloning of a functional GDP-fucose transporter in Drosophila melanogaster
CA2405311A1 (en) Multiprotein-complexes comprising a nmda receptor and uses thereof
Dorrestijn et al. Changes in the signalling status of the small GTP-binding proteins Rac and Rho do not influence insulin-stimulated hexose transport
Paquette Functional Characterization of the Role of FLCN and AMPK in Autophagy

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 15844734

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 15844734

Country of ref document: EP

Kind code of ref document: A1