WO2016046266A1

WO2016046266A1 - Method for predicting resistance to clopidogrel treatment

Info

Publication number: WO2016046266A1
Application number: PCT/EP2015/071876
Authority: WO
Inventors: Joan Montaner Villalonga; Israel FERNÁNDEZ CADENAS
Original assignee: Fundació Hospital Universitari Vall D'hebron - Institut De Recerca; Fundació Mútua De Terrassa Per A La Docència I Recerca Biomèdica I Social, F.P.C.
Priority date: 2014-09-23
Filing date: 2015-09-23
Publication date: 2016-03-31

Abstract

The invention provides an in vitro method of predicting resistance to clopidogrel treatment, wherein the method comprises a step in which the presence or absence of genotype AA of SNP rs13085351 of the MDS1 and EVI1 complex locus (MECOM) gene is detected in an isolated sample of a patient, wherein the presence of said genotype indicates resistance to clopidogrel treatment, and additionally or alternatively comprises a step wherein the presence or absence of an allele that correlates with allele A of SNP rs13085351 of at least a second SNP in linkage disequilibrium with SNP rs13085351 is detected.

Description

Method for predicting resistance to clopidogrel treatment

The present invention provides a method for predicting resistance to treatment with clopidogrel. The method is applicable to patients with different

cardiovascular diseases and represents a new tool in the implementation of personalised medicine.

BACKGROUND ART Cardiovascular disease is the primary cause of death in the industrialised world. This figure has led the pharmaceutical industry to invest in large amounts of resources in recent decades for the purpose of finding cardiovascular treatments, and has led to the discovery of some of the most successful drugs currently available in pharmacopoeia.

One such drug is clopidogrel, a platelet aggregation inhibitor having multiple applications in the prevention of coronary artery disease, peripheral vascular disease and cerebrovascular disease. This drug works by irreversibly inhibiting the adenosine P2Y12 receptor, located in the platelet membrane, and is orally administered in the form of a prodrug. This prodrug is metabolised mainly by cytochrome P450 CYP2C19 to produce the active drug, having a thiol group that reacts covalently with a cysteine thiol group located in the active site of the P2Y12 receptor, inactivating it and thereby inhibiting platelet aggregation. In addition to its applications in the reduction of various atherosclerotic events (myocardial infarction, ictus and artery disease), clopidogrel may also be used to prevent thrombosis in intracoronary stenting treatment.

Despite the great success of this drug, which has led it to become the second most prescribed drug in 2010 (only surpassed by atorvastatin) and sales peaks in excess of $9 billion, its use is not devoid of problems. One of these is its side effects, such as neutropenia, haemorrhage, thrombocytopenia and dermatitis. A second problem related to the use of clopidogrel is lack of effectiveness. It is estimated that approximately 30 % of patients treated with this drug do not respond to treatment. In order to minimise the side effects in treatment-resistant patients, it would be desirable to have means for determining the probability of successful clopidogrel treatment. It is widely known in this field that the functional tests used to determine the probability of appearance of resistance (in vitro kinetic platelet aggregation studies) are not robust as regards the reliable prediction of recurring episodes of cardiovascular disease.

The biomedical community is currently investing intensively in the search for markers with potential applications in the diagnosis, prognosis and prediction of response to the treatment of a number of diseases. Among the deluge of data drawn from genomic studies, there are numerous Single Nucleotide

Polymorphisms (SNPs) that may be used to this end. Many SNPs have been related not only to the risk of developing a disease or its prognosis, but also with the probability of responding to certain therapies.

With respect to clopidogrel, some of the most notorious cases of polymorphism associated with the lack of response to treatment therewith are obviously those related to cytochromes, particularly cytochrome P450 CYP2C19. This is due to the fact that CYP2C19 metabolises the conversion of the prodrug into the drug with biological activity. Polymorphisms responsible for the greater or lesser activity of this enzyme may obviously have an impact on the pharmacokinetics of clopidogrel and, thus, on its effectiveness and toxicity (Cresci, S., et al.

"Cytochrome P450 gene variants, race and mortality among clopidogrel treated patients following acute myocardial infarction" Circ. Cardiovasc. Genet. 2014, Epub - published online).

Among the multiple polymorphisms described for CYP2C19, mention should be made of loss-of-f unction polymorphism CYP2C19^*2 (rs4244285). This allele is associated with reduced generation of the active metabolite and, therefore, with the drug's lack of efficacy.

There are references to polymorphisms in the state of the art having the opposite effect. For example, gain-of-function polymorphism CYP2C19^*17 has been associated with a higher metabolism of the prodrug, with the ensuing increased risk of haemorrhage (Li, Y., et al. "The gain-of-function variant allele CYP2C19^*17: a double-edged sword between thrombosis and bleeding in clopidogrel-treated patients" J. Thromb. Haemost. 2012, vol. 10, pp. 199-206).

Despite the described efforts, it is becoming increasingly patent that cytochrome CYP2C19 polymorphisms are only partially responsible for the changes in response to clopidogrel treatment, as discussed in Cuisset "Recent advances in the pharmacogenetics of clopidogrel" (Hum. Genet. 2012, vol. 131 , pp. 653- 564.) Thus, according to this reference, CYP2C19^*2 polymorphism is only responsible for 12 % of the change in response to the drug, which indicates that there are other polymorphisms outside of the cytochrome family that play a highly relevant role. The discovery and validation of some of these could enable progress in predicting lack of response to clopidogrel.

SUMMARY OF THE INVENTION

Inventors have found that a polymorphism located in the MDS1 and EVI1 complex locus (MECOM) gene may be used to determine the predisposition to respond to clopidogrel treatment. In particular, inventors have discovered in a statistical analysis that genotype AA of SNP rs13085351 of the MDS1 and EVI1 complex locus (MECOM) gene is a risk genotype for developing resistance to clopidogrel treatment. This genotype AA (homozygote for adenine in this position) is found with much greater frequency in patients who do not respond adequately to clopidogrel treatment than in patients who do respond adequately.

Remarkably, the polymorphism in question is found in an intron of said gene, which does not bear any relation whatsoever to the cytochromes, the family in relation to which most of the polymorphisms associated with changes in response to the drug are known (vide supra).

Thus, a first aspect of the invention is an in vitro method for predicting resistance to clopidogrel treatment, wherein the method comprises a step in which the presence or absence of genotype AA in SNP rs13085351 of the MDS1 and EVI1 complex locus (MECOM) gene is detected in an isolated sample of a patient, wherein the presence of said genotype indicates resistance to clopidogrel treatment, and additionally or alternatively comprises a step wherein the presence of an allele that correlates with allele A of SNP

rs13085351 of at least a second SNP in linkage disequilibrium with SNP rs13085351 is detected.

This invention may provide a new tool with which to evaluate a priori whether a patient who has a disease susceptible of being treated with platelet

antiaggregants should or should not be treated with clopidogrel or, on the contrary, should be treated with other alternative therapies.

Thus, a second aspect of the invention is a method for selecting or

recommending the initiation of clopidogrel treatment in a patient who has a disease susceptible of being treated with platelet antiaggregants, wherein the method comprises a step in which the presence or absence of genotype AA in SNP rs13085351 of the MDS1 and EVI1 complex locus (MECOM) gene is detected in an isolated sample of a patient and wherein: i) if the presence of genotype AA is detected, platelet antiaggregant treatment excluding clopidogrel is recommended; and ii) if the presence of genotype AA is not detected, platelet antiaggregant treatment including clopidogrel is recommended.

A third aspect of the invention is the use of means for detecting the presence of genotype AA in SNP rs13085351 of the MDS1 and EVI1 complex locus

(MECOM) gene in an isolated sample of a patient in the first and second aspect of the invention.

A fourth aspect of the invention is the use of genotype AA in SNP rs13085351 of the MDS1 and EVI1 complex locus (MECOM) gene of an isolated sample of a patient as a marker for predicting resistance to clopidogrel treatment or for selecting or recommending the initiation of clopidogrel treatment.

BRIEF DESCRIPTION OF THE DRAWINGS

FIG. 1 . Manhattan Plot depicting GWAs study results. The chromosomes and chromosomal positions are plotted on the x-axis and the values of p, transformed into -log p, are plotted on the y-axis.

DETAILED DESCRIPTION OF THE INVENTION In order to further clarify this description, the following definitions have been included:

The term "clopidogrel" herein is understood to be the drug used as a platelet antiaggregant of the thienopyridine type and which has the systematic name lUPAC (+)-(S)-methyl 2-(2-chlorophenyl)-2-(6,7-dihydrothieno[3,2-c]pyridin- 5(4H)-yl)acetate, CAS number 1 13665-84-2, and which is marketed under the commercial names Plavix, Clopilet, Ceruvin or Clavix. Its bidimensional chemical structure is as follows:

"Resistance to clopidogrel treatment" herein is understood to be the

phenomenon whereby the patient does not respond to treatment with the drug, i.e. the patient has the same platelet aggregation activity during and subsequent to the treatment as prior to being administered clopidogrel. Also, "clopidogrel treatment" should be understood to be any therapy comprising this drug, and may comprise others or consist solely of clopidogrel.

"Genotype AA in SNP rs13085351 " herein is understood to mean that the patient is homozygotic and has an adenine in that position for each of his or her two chromosome sets.

The single nucleotide polymorphism rs13085351 of the MECOM gene, according to the dbSNP database (single nucleotide polymorphism database) of the NCBI (National Center for Biotechnology Information), may have an

Adenine (A) or Guanine (G) in that position. Thus, the patients may be AA (homozygous for adenine), AG (heterozygous) or GG (homozygous for guanine) for that polymorphism.

Polymorphisms are allelic variants of a same population, each of which is present in more than 1 % of the population and which confer different phenotypical characteristics on their carriers. A single nucleotide polymorphism (SNP) is a polymorphism in which the change only affects one nucleotide.

Since SNPs form part of a continuous DNA chain (i.e. a chromosome), there may be other polymorphisms near the chromosome that are co-inherited with a very similar frequency and, therefore, contain a very similar level of information to that of the polymorphism of interest (in this case rs13085351 ). This phenomenon, according to which alleles of different SNPs may be highly correlated, is known as "linkage disequilibrium." In the case of the present invention, the existence of SNPs in linkage disequilibrium with SNP rs13085351 may also be used to predict response to clopidogrel treatment. Two SNPs that may be used to define an alternative (or complementary) method to the method based on SNP rs13085351 are, for example, rs1386827 and rs998749, as both are located in the same region as rs13085351 and have a p<10E-05 according to the GWAs analysis performed by the inventors.

"An allele that correlates with allele A of SNP rs13085351 " is understood to be an allele (polymorphic form) of a second SNP in linkage disequilibrium with allele A (polymorphic form A) of rs13085351 . This indicates a very high probability that allele A in SNP rs13085351 and the allele correlated therewith are co-inherited.

The MDS1 and EVI1 complex locus (MECOM) protein is also known as

"ecotropic virus integration site 1 protein homolog (eVI-1 )" or "positive regulatory domain zinc finger protein 3 (PRDM2)." It is a protein which, in humans, is encoded by the MECOM gene, entry 2122 in the Entrez database (last modified on 08/06/2014). It is a protein that acts as a transcriptional regulator and has been related to hematopoyesis, apoptosis and cell development, differentiation and proliferation. Different transcriptional variants that encode different isoforms are known. As mentioned earlier, a first aspect of the invention is an in vitro method for predicting resistance to clopidogrel treatment, wherein the method comprises a step in which the presence or absence of genotype AA in SNP rs13085351 of the MDS1 and EVI1 complex locus (MECOM) gene is detected in an isolated sample of a patient, wherein the presence of said genotype indicates resistance to clopidogrel treatment, and additionally or alternatively comprises a step in which the presence of an allele that correlates with allele A of SNP rs13085351 of at least a second SNP in linkage disequilibrium with SNP rs13085351 is detected.

In other words, the patients for whom the rs13085351 polymorphism is determined to be AA (that is, they are homozygous for A) will be predicted as resistant to clopidogrel by the method, whereas the patients for whom said polymorphism is determined to be AG (heterozygous) or GG (homozygous for G) will be predicted as non-resistant by the method. In a similar fashion, if a certain allele X of a polymorphism other than rs13085351 was found to be linked with the allele A of polymorphism rs13085351 , this allele could also be used to predict resistance. The method could then, in order to predict resistance to clopidogrel, make use only of allele A of polymorphism rs13085351 , allele A of polymorphism rs13085351 together with allele X of the second

polymorphism, or only allele X of the second polymorphism.

In an embodiment of the first aspect of the invention, the method comprises a step wherein the presence or absence of genotype AA in SNP rs13085351 of the MDS1 and EVI1 complex locus (MECOM) gene is detected in an isolated sample of a patient, wherein the presence of said genotype indicates resistance to clopidogrel treatment.

In another embodiment of the first aspect of the invention, the second SNP is selected from the group consisting of rs1386827 and rs998749.

In an embodiment of the first aspect of the invention, the patient has previously been diagnosed with a disease susceptible of being treated with platelet antiaggregants. In another embodiment of the first aspect of the invention, the patient has previously been diagnosed with coronary artery disease, peripheral vascular disease or cerebrovascular disease. In another embodiment of the first aspect of the invention, the patient has previously been diagnosed with ischaemic stroke.

In another embodiment of the first aspect of the invention, the isolated sample of the patient is selected from the group consisting of plasma, serum, whole blood, saliva or urine.

In another embodiment of the first aspect of the invention, the isolated sample analysed in the detection step comprises DNA. In another embodiment of the first aspect of the invention, the detection of the presence of genotype AA comprises an amplification reaction of the isolated DNA sample of the patient.

In another embodiment of the first aspect of the invention, the detection step comprises a hybridisation step, a real-time polymerase chain reaction, a Sanger sequencing step, a pyrosequencing step or a combination thereof.

In another embodiment of the first aspect of the invention, the detection step comprises a hybridisation step wherein the probes used to detect polymorphism rs13085351 by means of amplification are the probes of SEQ ID NO 1 :

ACGTTGGATGATCAAGGGCCAAATTGCCTG and SEQ ID NO 2:

ACGTTGGATGTGATGTGTCAGTTCCAAGGC. That is, the in vitro method of predicting resistance to clopidogrel treatment comprises placing the isolated sample of the patient in contact with one or more compounds which are bonded to the DNA sequence where polymorphism rs13085351 may be present or that make it possible to determine the genotype in this region of the patient's genome. These compounds that are placed in contact with the isolated sample may be amplification primers analogous to those mentioned earlier. As is also described above, a second aspect of the invention is a method for selecting or recommending the initiation of clopidogrel treatment in a patient with a disease susceptible of being treated with platelet antiaggregants, wherein the method comprises a step wherein the presence or absence of genotype AA in SNP rs13085351 o the MDS1 and EVI1 complex locus (MECOM) is detected in an isolated sample of a patient, and wherein: i) if the presence of genotype AA is detected, treatment with platelet antiaggregants that excludes clopidogrel is recommended; and ii) if the presence of genotype AA is not detected, i.e. the genotype AA is absent, platelet antiaggregant treatment including clopidogrel is recommended.

In a particular embodiment of the second aspect of the invention, the method for selecting or recommending the initiation of clopidogrel treatment comprises a hybridisation step wherein the probes of SEG ID NO 1 and SEQ ID NO 2 are used to detect polymorphism rs13085351 (see above). That is, the method for predicting resistance to clopidogrel or the method for selecting or

recommending the initiation of clopidogrel treatment comprises placing the isolated sample of the patient in contact with one or more compounds that are bonded to the DNA sequence where polymorphism rs13085351 may be present, for the purpose of amplifying it in order to improve detection thereof or that make it possible to determine the genotype in this region of the patient's genome.

As also described earlier, a third aspect of the invention is the use of means to detect the presence of genotype AA in SNP rs13085351 of the MDS1 and EVI1 complex locus (MECOM) gene in an isolated sample of a patient in the first and second aspect of the invention.

In an embodiment of the third aspect of the invention, said means comprise a biosensor. This could be based on the bonding of probes that hybridise with the sequence where the polymorphism is located (both when a G or A are found in that position) or in enzyme reactions that emit light depending on the presence of the adenine or guanine in the position of the polymorphism.

In another embodiment of the third aspect of the invention, said means form part of a kit. Throughout the description and claims, the word "comprises" and its variations do not intend to exclude other technical characteristics, additives, components or steps. Also, the word "comprises" includes the case "consists of." For persons skilled in the art, other objects, advantages and characteristics of the invention shall be partially inferred from the description and partially from the practice of the invention. The following examples and drawings are provided for illustrative purposes and are not intended to limit the scope of the present invention. The numerical signs relating to the drawings and shown between parentheses in a claim are solely aimed at increasing understanding of the claim and should not be interpreted as limiting the scope of protection of the claim. Also, the present invention covers all the possible combinations of particular and preferred embodiments indicated herein. EXAMPLES

A) Material and Methods

A1 . Patients

Patients with ischaemic stroke evaluated by a neurologist in Vail d'Hebron Hospital and treated with the drug clopidogrel were recruited and a blood sample obtained for subsequent processing thereof. The basal clinical and demographic data of each of the patients were obtained. Subsequently, telephone follow-up was performed to determine the appearance of new vascular events and ensure proper adherence to the antiaggregant treatment. Clinical and radiological risk factors and the demographic data of the recruited patients were collected after 3, 6, 9 and 12 months. Of the recruited patients, 24 suffered a new vascular event (a new ischaemic stroke, myocardial infarction, peripheral vascular disease or vascular death) in the first year of the follow-up. These 24 ictus cases were combined with 49 ictus cases treated with clopidogrel but that did not suffer a new cardiovascular event in the first year of follow-up, taking into account sex, age (±5 years old) and the type of ischaemic stroke according to the TOAST classification (Adams H.P., et al. "Classification of subtype of acute ishcemic stroke. Definitions for use in a multicenter clinical trial. TOAST. Trial of Org 10172 in acute stroke treatment" Stroke 1993, vol. 24, pp. 35-41 ). A.2 Genetic analysis

DNA was extracted from the 73 cases and controls were performed using Gentra technology following the manufacturer's recommendations. The quality analysis and controls of the Genome Wide Association Studies (GWAs) were performed based on the recommendations of Anderson CA, et al. "Data quality control in genetic case-control association studies." Nat. Protoc. 2010, vol. 5, pp. 1564-73):

A) Quality controls (QC) by patient:

1 ) Identification of gender-discordant individuals; 2) identification of individuals with a large number of lost genotypes; 3) identification of duplicates; and 4) identification of divergences with ancestors.

B) QC by marker:

1 ) Identification of rare mutations or SNPs with a large number of cases without data ("missings" - i.e. SNPs that were unable to be genotyped in an individual); 2) identification of rare mutations or SNPs with a different range of missings between cases and controls; and 3) elimination of low-frequency SNPs (not for rare mutations).

Individual-based summary:

Missings (<0.05), heterozygosity (>-0.3). The existence of layering in the cohort study was also determined and adjusted by principal components. In summary: QC for rare mutations and SNPs: missingness (<0.05 - i.e. elimination of SNPs with data in less than 95 % of the individuals and minor allele frequency of (>0.01 ) (only in SNPs). The results were allocated using IMPUTE2 software, using the results of the 1000 Genomes Project as a reference. The objective was to obtain estimates of more than five million SNPs. The analysis software tools used were: Plink (Purcell, S., et al. "Plink: a toolset for whole-genome association and population-based linkage analyses" Am. J. Hum. Genet. 2007, vol. 81 , pp. 559-575), R (www.R-project.org), Galaxy (https://usegalaxy.org), dbSNP (http://www.ncbi.nlm.nih.gov/SNP/). Allocation: IMPUTE2 (https://mathgen.stats.ox.ac.uk/impute/impute_v2.html), SNPtest (https://mathqen.stats.ox.ac.uk/qenetics softwa re/sn ptest/sn ptest . htm I ) , and GTOOL (http://www.well.ox.ac.uk/~cfreeman/software/qwas/qtool.html).

The statistical analysis was performed using PLINK software and the chi-square test implemented in the -assoc software function. The replication of the most significant results was carried out in a new cohort of patients with

cardiovascular disease treated with clopidogrel recruited in seven European research centres through SEQUENOM at the Santiago de Compostela node of the National Genotyping Centre (CeGEN). B) Results

A total of 24 cases and 49 controls were analysed using HumanOnmil -Quad Beadchip (lllumina) arrays, capable of analysing 1 ,000,000 polymorphisms (SNPs) distributed throughout the genome. This cohort was called Discovery cohort. The cases were ischaemic stroke treated with clopidogrel and with a new vascular event (ischaemic stroke, myocardial infarction, peripheral vascular disease or vascular death) in the first year after the ischaemic stroke. The controls were ischaemic strokes treated with clopidogrel but which did not have new vascular events in the first year after having suffered the ischaemic stroke.

A total of 88 SNPs with a value of p<10^"05 (Table 1 , see below) were found, of which 16 were selected for the subsequent replication thereof depending on the value of p and on the function of the genes near those SNPs. Table 1 . SNPs associated with resistance to clopidogrel in the GWA studies. SNPs having the most significant p value and located in regions near genes potentially associated with the clopidogrel response were selected.

CHR SNP POSITION A1 F_A F_U A2 CHISQ P OR

8 rs13263375 1 17531687 A 0.6905 0.2396 G 25.3 4.92E-07 7.08 rs13270180 1 17532173 G 0.6905 0.25 A 23.96 9.82E-07 6.692 rs286734 105177252 C 0.1429 0.5851 A 22.95 1.66E-06 0.1 182 rs 7002421 1 17512275 G 0.6667 0.2396 A 22.87 1.73E-06 6.348 rs4129294 1 17544471 G 0.5952 0.1875 A 22.64 1.95E-06 6.373 rs1 1706512 170437468 A 0.7381 0.3021 C 22.6 1.99E-06 6.51 1 rs9507233 23532556 A 0.1667 0.5938 C 21 .43 3.67E-06 0.1368 rs222956 26841803 G 0.4524 0.1042 A 21 .34 3.84E-06 7.104 rs222962 26847959 G 0.4524 0.1042 A 21 .34 3.84E-06 7.104 rs749943 34629580 A 0.2381 0.01042 G 20.65 5.52E-06 29.69 rs2573624 98325256 G 0.1667 0.5833 A 20.44 6.14E-06 0.1429 rs2017041 33670103 C 0.1667 0.5833 A 20.44 6.14E-06 0.1429 rs 13085351 170416385 A 0.6667 0.2604 G 20.38 6.34E-06 5.68 rs 1386827 170442024 A 0.7143 0.3021 G 20.28 6.68E-06 5.776 rs 10886834 122750532 A 0.4524 0.1 146 G 19.6 9.57E-06 6.383 rs 795941 77189773 A 0.1905 0.0 G 19.41 1.05E-05 NaN rs9297556 1 17538533 A 0.5714 0.1979 G 19.0 1.31 E-05 5.404 rs 1 1870920 4832161 1 G 0.5238 0.1667 A 18.68 1.55E-05 5.5 rs4769315 23526143 C 0.09524 0.4792 G 18.64 1.58E-05 0.1 144 rs 12646808 3219626 G 0.6667 0.2812 A 18.1 1 2.09E-05 5.1 1 1 rs998749 170455496 G 0.6905 0.3021 A 18.09 2.1 1 E-05 5.154 rs2203207 5653456 G 0.6905 0.3021 A 18.09 2.1 1 E-05 5.154 rs7189161 76535568 G 0.381 0.08333 A 18.01 2.19E-05 6.769 rs 10750008 1 12065743 G 0.5 0.1562 A 17.91 2.32E-05 5.4 rs1 1742309 34625449 A 0.2381 0.02083 G 17.37 3.08E-05 14.69 rs9284975 167313056 A 0.2381 0.02083 G 17.37 3.08E-05 14.69 rs 10506670 73942777 G 0.2381 0.02083 A 17.37 3.08E-05 14.69 rs139160 42928837 A 0.5238 0.1771 G 17.32 3.15E-05 5.1 12 rs6953636 15002776 C 0.3333 0.0625 A 17.29 3.20E-05 7.5 rs491880 10408032 A 0.7381 0.3542 C 17.28 3.22E-05 5.139 rs505141 10410901 G 0.7381 0.3542 A 17.28 3.22E-05 5.139 rs528713 1041 1 142 G 0.7381 0.3542 A 17.28 3.22E-05 5.139 rs4821325 33665681 A 0.2619 0.6458 G 17.28 3.22E-05 0.1946 rs5755439 33667732 G 0.2619 0.6458 A 17.28 3.22E-05 0.1946 rs1 1 185717 136321920 G 0.4762 0.1458 A 17.17 3.41 E-05 5.325 rs7664824 1 14548564 C 0.3095 0.05208 A 17.07 3.60E-05 8.159 rs2454667 67699305 G 0.3095 0.05208 A 17.07 3.60E-05 8.159 rs2076552 1856299 A 0.3095 0.05208 G 17.07 3.60E-05 8.159 rs292813 33875124 A 0.2619 0.03125 G 17.05 3.64E-05 1 1 .0 rs 1445891 34638209 A 0.2105 0.01064 G 17.02 3.70E-05 24.8 rs 10865505 28697727 G 0.2857 0.04167 A 16.98 3.78E-05 9.2 rs17078413 176043265 A 0.1667 0.0 G 16.85 4.04E-05 NaN rs7152344 86945403 A 0.1667 0.0 G 16.85 4.04E-05 NaN rs7140940 86956830 A 0.1667 0.0 G 16.85 4.04E-05 NaN rs8004994 86966279 G 0.1667 0.0 A 16.85 4.04E-05 NaN rs9307607 129595331 A 0.4048 0.1042 G 16.78 4.21 E-05 5.848 rs 1 1657592 48318926 A 0.5 0.1667 G 16.54 4.75E-05 5.0 rs 1 1564296 24053957 G 0.5 0.1667 A 16.54 4.75E-05 5.0 rs7149612 86896979 A 0.1667 0.0 G 16.52 4.82E-05 NaN rs261753 39361099 A 0.4524 0.1354 G 16.48 4.92E-05 5.274 rs1 174952 22046123 A 0.381 0.09375 G 16.25 5.56E-05 5.949 rs4386173 48326359 C 0.381 0.09375 A 16.25 5.56E-05 5.949 rs4300697 48330644 A 0.381 0.09375 G 16.25 5.56E-05 5.949 SNP21- 26845333 26845333 G 0.381 0.09375 A 16.25 5.56E-05 5.949 rs 1636327 22048680 G 0.4048 0.1064 A 16.24 5.57E-05 5.712 rs2417767 19055531 C 0.619 0.2604 A 16.13 5.92E-05 4.615 rs 1420180 96861080 G 0.5238 0.1875 A 16.05 6.16E-05 4.767 rs2160259 96879266 A 0.5238 0.1875 G 16.05 6.16E-05 4.767 rs7794869 96882641 G 0.5238 0.1875 A 16.05 6.16E-05 4.767 rs649639 10412872 G 0.725 0.3478 A 15.96 6.48E-05 4.943 rs12915138 64309412 A 0.1667 0.5312 G 15.94 6.54E-05 0.1765 rs 12097296 239518514 A 0.4762 0.1562 G 15.8 7.04E-05 4.909 rs38096 78074052 G 0.4762 0.1562 A 15.8 7.04E-05 4.909 rs616714 74722288 A 0.4762 0.1562 C 15.8 7.04E-05 4.909 rs1 1 122614 229034068 A 0.3571 0.08333 G 15.77 7.15E-05 6.1 1 1 rs6481099 55888938 A 0.3571 0.08333 G 15.77 7.15E-05 6.1 1 1 rs 743018 25001 105 A 0.5476 0.2083 G 15.68 7.50E-05 4.6 rs4575879 190904013 G 0.2381 0.6042 A 15.66 7.56E-05 0.2047 rs481571 10413468 A 0.725 0.3542 G 15.62 7.76E-05 4.807 rs 10040425 3780332 C 0.1905 0.01042 A 15.54 8.09E-05 22.35 6 rs 750618 158902909 G 0.1905 0.5521 A 15.49 8.29E-05 0.1909

2 rs1861 108 59274551 A 0.07143 0.4062 G 15.47 8.38E-05 0.1 124

3 rs709547 108557600 A 0.07143 0.4062 G 15.47 8.38E-05 0.1 124

13 rs7999200 23538701 C 0.1 19 0.4688 A 15.46 8.41 E-05 0.1532

8 rs4317609 1 17536189 A 0.55 0.2083 G 15.44 8.51 E-05 4.644

15 rs7182401 69560049 G 0.5238 0.1915 A 15.44 8.51 E-05 4.644

1 rs3738676 39764175 A 0.5714 0.2292 C 15.4 8.69E-05 4.485

4 rs1 1 14663 20539633 A 0.5714 0.2292 G 15.4 8.69E-05 4.485

13 rs2066586 49581474 G 0.375 0.09375 A 15.37 8.85E-05 5.8

7 rs 10487790 15009432 G 0.3333 0.07292 A 15.36 8.90E-05 6.357

7 rs1292312 153721089 A 0.3333 0.07292 C 15.36 8.90E-05 6.357

4 rs6845322 158103555 G 0.5 0.1771 A 15.27 9.33E-05 4.647

14 rs 12586664 96683579 G 0.5 0.1771 A 15.27 9.33E-05 4.647

18 rs 12458475 24100442 G 0.5 0.1771 A 15.27 9.33E-05 4.647

18 rs 1 1083266 24102816 A 0.5 0.1771 G 15.27 9.33E-05 4.647

12 rs 1 1064831 1 18473336 A 0.275 0.04255 G 15.25 9.41 E-05 8.534

1 rs 12090898 239519123 A 0.4048 0.1 146 G 15.21 9.61 E-05 5.255

4 rs17013315 129592875 A 0.4048 0.1 146 G 15.21 9.61 E-05 5.255

FIG. 1 shows the Manhattan Plot representative of the results obtained from the GWAs. The role of the SNPs of the previously described CYP family associated with platelet reactivity and resistance to clopidogrel was analysed. According to the data obtained by the inventors, SNP CYP2C19^*2 (rs4244285), which is the SNP of the CYP family associated with the resistance to clopidogrel measured by platelet reactivity, was not associated with a higher risk of vascular events:

CHR SNP BP A1 F_A F_U A2 CHISQ P OR 10 rs4244285 96531606 A 0.1591 0.1224 G 0.3518 0.5531 1.356 In fact, frequency in cases with vascular events of this polymorphism was

15.91 % (F_A) and 12.24 % (F_U) in eventless controls. In the Discovery cohort (n=73) the SNP rs13085351 of the MECOM gene is found with a frequency of 66 % (allele A; F_A) in the cases group (n=24) and 26 % in controls (F_U) with a value of p:6.3 x 10^"06:

CHR SNP POSITION A1 F_A F_U A2 CHISQ P OR

3 rs13085351 170416385 A 0.6667 0.2604 G 20.38 6.335E-6 5.68

On replicating the results (Table 2, see below) in a new cohort of cases and controls (n=676), polymorphism rs13085351 of the MECOM gene was replicated in this new cohort of patients.

Table 2. The 16 selected SNPs associated with resistance to clopidogrel in the GWAs (p<10-05) and that were replicated using SEQUENOM technology in the replication cohort (n=676). SNPJD polymorphism identifier, 2nd-PCRP and 1 st- PCRP: primers used to replicate the results of the GWAs. AMP_LEN: length in base pairs of the amplicons generated. CHR: Chromosome. Position: position in the chromosome. A1 : lowest-frequency allele. F_A: allele frequency in cases. F_U: allele frequency in controls. A2: allele 2. CHISQ: chi-square statistic. P: Pvalor. OR: Odds Ratio.

SUP ID 2nd-PCRP tst-PCKP IMP Iffl

Γ3106Β6Β34 4CGT?GG¾IG4ICCAC^™™AGAG%AG¾iCCC ACGTTGGATGTCAGAGGAGGGGCGGCTAC 113 rs222S62 ACGTTGGAIGCAmrAZTIAGIIGGGAGGG ACGTTGGAGAGAGCGTGGAGCTrGITTTC 67

105

ACGI2GG.¾T9:CC 3JftIIIICaTiGGGC ACGirGGATGCACAGGAGTSGTAAGTAGAC

ACGTTGGATGGTGAGrGGCATTGTATGAGC ACGTTGGATGAGGTCTTrGrGACTAGCTG 105 rsl3085351 ACG XGGAIGIGAIGrGTXAGXICCAAGGC ACGirGGAIGATCAAGGGCCAAAITGCCTG 102

«222956 ACGTTGGATGCArCTGTACCCCAATGTGIG ACGirGGATGAGICACAITAATAGAIGGC 110 rsiS263375 ACGTTGGATGCCITCrGTTAGGTAAAGTTGC ACGT GiGATG&GiZAlCACAMGTGCATjTCAC 11B

ACG iGGAIGGCCTCCAGGCTIIIATTATr ACGTTGGATGGGTTCCAACrCAAGTTTTCAG 118

«11706512 ACGTTGGAIGIArGAG&ICATAGGTCAAG ACGirGGAIGIGGCACIGICCTGTCAIITC 112

Γ3Ή 9543 ACGTTGGATGTTCAMGGCCCAGGTICCAr ACGirGGATGTGGTATACArGTGTGAAGG 120

-32017041 ACGT.GGATGACC'TGrGAGCACCCAlT C AGTrGGATGGGGTCTIGGAG"TAGATIC 87 ra9507233 SCGTTGGATSCAGGGITTAGATA&CTTIGG ACGirGGATGGAGACTGAAGITGGAICCCI 116

Γ313270160 ACGTTGGATGGGCCCrAAATTCTGTTTrCC ACGTrGGATGGCATATATCCTGCT^ATGCC 106 rs4i292S4 ACGirGGAIGGAGTCAAACAGAAGAIGAAC ACGirGGATGGAICIAGrGrGGTACCAAGC 101

«6413436 ACG TGGATGGCAAIAATTTTCCCACIAIC ACGirGGAGCACTTTCCAIAAAAGCAAGG 101

-31336827 ACGT GGATGCirGACAGTTCTTTTTGTG ACGTTGGATGGAATGTACCriAAGCTAGGG 113 Risk genotype AA for the SNP of the MECOM gene is found in 16.7 % of cases and in 9.9 % (p=0.041 ) of the controls in the replication cohort (n=676).

In summary, the information drawn from these experimental data corroborates that polymorphism rs13085351 of the MECOM gene is highly useful for estimating the probability of responding positively to dopidogrel treatment or to a treatment that includes it among other drugs.

REFERENCES CITED IN THE APPLICATION

Cresci, S., et al. "Cytochrome P450 gene variants, race and mortality among clopidogrel-treated patients following acute myocardial infarction" Circ.

Cardiovasc. Genet. 2014, Epub - published online. Li, Y., et.al. "The gain-of-function variant allele CYP2C19^*17: a double-edged sword between thrombosis and bleeding in clopidogrel-treated patients" J.

Thromb. Haemost. 2012, vol. 10, pp. 199-206.

Cuisset "Recent advances in the pharmacogenetics of dopidogrel" Hum. Genet. 2012, vol. 131 , pp. 653-564.

Adams H.P., et al. "Classification of subtype of acute ishcemic stroke.

Definitions for use in a multicenter clinical trial. TOAST. Trial of Org 10172 in acute stroke treatment" Stroke 1993, vol. 24, pp. 35-41 ).

Anderson CA, et al. "Data quality control in genetic case-control association studies". Nat. Protoc. 2010, vol. 5, pp. 1564-73.

Purcell, S., et al. "Plink: a toolset for whole-genome association and population- based linkage analyses" Am. J. Hum. Genet. 2007, vol. 81 , pp. 559-575.

Claims

1 . An in vitro method for predicting resistance to clopidogrel treatment, wherein the method comprises a step in which the presence or absence of genotype AA in SNP rs13085351 of the MDS1 and EVI1 complex locus (MECOM) gene is detected in an isolated sample of a patient, wherein the presence of said genotype indicates resistance to clopidogrel treatment, and additionally or alternatively comprises a step wherein the presence of an allele that correlates with allele A of SNP rs13085351 of at least a second SNP in linkage

disequilibrium with SP rs13085351 is detected.

2. The method, according to claim 1 , wherein the method comprises a step wherein the presence or absence of genotype AA in SNP rs13085351 of the MDS1 and EVI1 complex locus (MECOM) gene is detected in an isolated sample of a patient, wherein the presence of said genotype indicates resistance to clopidogrel treatment.

3. The method according to claim 1 , wherein the second SNP is selected from among the group consisting of rs1386827 and rs998749.

4. The method according to claims 1 to 3, wherein the patient has previously been diagnosed with a disease susceptible of being treated with platelet antiaggregants.

5. The method according to claim 4, wherein the patient has previously been diagnosed with coronary artery disease, peripheral vascular disease or cerebrovascular disease.

6. The method according to claim 5, wherein the subject has previously been diagnosed with ischaemic stroke.

7. The method, according to claims 1 -6, wherein the isolated sample of the patient is selected from the group consisting of plasma, serum, whole blood, saliva or urine.

8. The method according to claims 1 to 7, wherein the isolated sample analysed in the detection step comprises DNA.

9. The method according to claim 8, wherein the detection of the presence of genotype AA comprises an amplification reaction of the isolated DNA sample of the patient.

10. The method according to claim 9, wherein the detection step comprises a hybridisation step, a real-time polymerase chain reaction, a Sanger sequencing step, a pyrosequencing step or a combination thereof.

1 1 . A method for selecting or recommending the initiation of clopidogrel treatment in a patient with a disease susceptible of being treated with platelet antiaggregants, wherein the method comprises a step in which the presence or absence of genotype AA in SNP rs13085351 of the MDS1 and EVI1 complex locus (MECOM) gene is detected in an isolated sample of a patient, and wherein:

i) if the presence of genotype AA is detected, platelet antiaggregant treatment excluding clopidogrel is recommended; and

ii) if the presence of genotype AA is not detected, platelet antiaggregant treatment including clopidogrel is recommended.

12. Use of means for detecting the presence of genotype AA in SNP

rs13085351 of the MDS1 and EVI1 complex locus (MECOM) gene of an isolated sample of a patient in the methods according to any of claims 1 to 9.

13. The use according to claim 12, wherein said means comprise a biosensor.

14. The use according to claims 12 to 13, wherein said means form part of a kit.

15. Use of genotype AA in SNP rs13085351 of the MDS1 and EVI1 complex locus (MECOM) gene of an isolated sample of a patient as a marker for predicting resistance to clopidogrel treatment or for selecting or recommending the initiation of clopidogrel treatment.