WO2016042164A1 - A method of predicting risk of recurrence of cancer - Google Patents
A method of predicting risk of recurrence of cancer Download PDFInfo
- Publication number
- WO2016042164A1 WO2016042164A1 PCT/EP2015/071524 EP2015071524W WO2016042164A1 WO 2016042164 A1 WO2016042164 A1 WO 2016042164A1 EP 2015071524 W EP2015071524 W EP 2015071524W WO 2016042164 A1 WO2016042164 A1 WO 2016042164A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- genes
- cancer
- expression
- proteins encoded
- hmgb2
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/33—Heterocyclic compounds
- A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
- A61K31/495—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
- A61K31/505—Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim
- A61K31/519—Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim ortho- or peri-condensed with heterocyclic rings
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
- A61P35/02—Antineoplastic agents specific for leukemia
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
- A61P35/04—Antineoplastic agents specific for metastasis
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/575—Immunoassay; Biospecific binding assay; Materials therefor for cancer
- G01N33/57515—Immunoassay; Biospecific binding assay; Materials therefor for cancer of the breast
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/575—Immunoassay; Biospecific binding assay; Materials therefor for cancer
- G01N33/5758—Immunoassay; Biospecific binding assay; Materials therefor for cancer involving compounds serving as markers for tumours, cancers or neoplasias, e.g. cellular determinants, receptors, heat shock/stress proteins, A-protein, oligosaccharides or metabolites
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/106—Pharmacogenomics, i.e. genetic variability in individual responses to drugs and drug metabolism
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/118—Prognosis of disease development
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
Definitions
- the invention relates to a method of predicting the risk of tumour recurrence in a subject. Specifically, the invention relates to a method of predicting the risk of early-stage node -negative breast cancer, prostate cancer and other tumour recurrence.
- Breast cancer is a heterogeneous disease which presents challenges for clinicians in predicting the likelihood of disease progression, particularly in patients where the disease is detected in the early stages.
- the conventional clinico-pathological parameters include Estrogen Receptor (ER), Progesterone Receptor (PR), Human Epidermal growth factor Receptor 2 (Her2), Ki67
- ER Estrogen Receptor
- PR Progesterone Receptor
- Her2 Human Epidermal growth factor Receptor 2
- Ki67 are not sufficient to characterise disease complexity and accurately predict the likelihood of tumour recurrence following adjuvant treatment or tumour removal by surgery. Therefore, due to inaccurate risk stratification, many of these patients who are inherently at a low risk of recurrence are assigned to receive chemotherapy, when in fact the majority of these women would remain cancer-free even without this toxic treatment.
- the challenge is to develop a method of accurately and reproducibly distinguishing the low-risk from the high-risk patients so that therapy can be assigned accordingly.
- Current guidelines often lead to differing opinions from breast oncologists as to whether to assign neoadjuvant and/or adjuvant therapy, as many are reluctant to forego neoadjuvant and/or adjuvant therapy without a reliable assessment of recurrence risk.
- the addition of more accurate and reliable prognostic and predictive biomarkers to the standard clinical assessment would greatly improve the ability of both doctors and patients to make more well-informed treatment decisions.
- WO 2005/039382 describes a number of gene sets used in predicting the likelihood of breast cancer recurrence, otherwise known as Oncotype Dx® referred to above.
- the invention is related to a gene set comprising One or more' genes from a panel of 50 genes.
- WO 2104/130825 describes a gene set comprising least 4 genes from a panel of cell cycle genes for detecting risk of lung cancer.
- US 7914988 describes a gene expression signature to predict relapse in prostate cancer, known as the GEX score.
- the invention is related to a gene set comprising 'all or a sub-combination of genes from a panel of 21 genes.
- a 'core proliferation signature' has been identified herein which is consistently high in proliferating primary cultures, and is downregulated during cellular senescence. This gene signature is also highly expressed in aggressive breast cancers.
- MTRs Master Transcriptional Regulators
- a hierarchy of several Master Transcriptional Regulators (MTRs - transcription factors responsible for the regulation of this core set of genes) upstream of these core proliferation genes has been identified. Further analysis of the expression of these factors in breast cancer datasets at the mRNA and protein levels reveals a remarkable ability to predict recurrence risk for early-stage breast cancer.
- a method for predicting risk of recurrence of cancer in an individual with cancer comprising a step of assaying a cancer sample from the individual for positive expression of at least two genes (or proteins encoded by those genes) selected from the group consisting of FOXM1, UHRF1, PTTG1, E2F1, MYBL2, HMGB2, ATAD2, E2F8, ZNF367 and TCF19, wherein positive expression of at least two genes, or proteins encoded by said genes, correlates with increased risk of recurrence of cancer compared with an individual with cancer who does not exhibit positive expression of the same genes.
- a method of predicting risk of recurrence of cancer in an individual with cancer following treatment with CDK4/6 inhibitors comprising a step of assaying a cancer sample from the individual for positive expression of at least two genes, or proteins encoded by said genes, selected from the group consisting of FOXM1, UHRF1, PTTG1, E2F1, MYBL2,HMGB2, ATAD2, E2F8, ZNF367 and TCF19, wherein positive expression of the at least two genes, or proteins encoded by said genes, correlates with increased risk of recurrence of cancer in an individual with cancer following treatment with CDK4/6 inhibitors compared with an individual with cancer who does not exhibit positive expression of the at least two genes or proteins encoded by those genes.
- a method of determining a 5 -year survival rate or a 10-year survival rate of an individual diagnosed with breast cancer comprising a step of assaying a cancer tumour sample from the individual for positive expression of at least two genes, or proteins encoded by those genes, selected from FOXM1, UHRF1, PTTG1, E2F1, MYBL2, HMGB2, ATAD2, E2F8, ZNF367 and TCF19, wherein positive expression of the at least two genes, or proteins encoded by those genes, correlates with decreased chance of 5-year survival rate or a 10-year survival rate compared with an individual with cancer who does not exhibit positive expression of the at least two genes or proteins encoded by those genes.
- the method further comprises the step of assaying for the expression of the p i giNK4A gene or protein in addition to the at least two genes (or proteins) selected from the group consisting of FOXM1, UHRF1, PTTG1, E2F1, MYBL2, HMGB2, ATAD2, E2F8, ZNF367 and TCF19, wherein dysregulated expression of pl6 WK4A in combination with positive expression of the at least two genes (or proteins encoded by those genes) selected from the group consisting of FOXM1, UHRF1, PTTG1, E2F1, MYBL2, HMGB2, ATAD2, E2F8, ZNF367 and TCF19, correlates with increased risk of recurrence of cancer, or a decreased chance of a 5-year survival rate or a 10-year survival rate, compared with an individual with cancer who does not exhibit dysregulated expression of pl6 WK4A and positive expression of the at least two genes (or proteins encoded by those genes).
- the at least two genes selected are FOXM1 and UHRF1. In one embodiment, the at least two genes selected are FOXM1 and PTTG1. In one embodiment, the at least two genes selected are FOXM1 and E2F1. In one embodiment, the at least two genes selected are FOXM1 and MYBL2. In one embodiment, the at least two genes selected are FOXM1 and HMGB2. In one embodiment, the at least two genes selected are UHRF1 and PTTG1. In one embodiment, the at least two genes selected are UHRF1 and E2F1. In one embodiment, the at least two genes selected are UHRF1 and MYBL2. In one embodiment, the at least two genes selected are UHRF1 and HMGB2.
- the at least two genes selected are PTTG1 and E2F1. In one embodiment, the at least two genes selected are PTTG1 and MYBL2. In one embodiment, the at least two genes selected are PTTG1 and HMGB2. In one embodiment, the at least two genes selected are E2F1 and MYBL2. In one embodiment, the at least two genes selected are E2F1 and HMGB2. In one embodiment, the at least two genes selected are MYBL2 and HMGB2. In one embodiment, the at least two genes selected are FOXMl and ATAD2. In one embodiment, the at least two genes selected are FOXMl and E2F8. In one embodiment, the at least two genes selected are FOXMl and ZNF367.
- the at least two genes selected are FOXMl and TCF19. In one embodiment, the at least two genes selected are UHRF1 and ATAD2. In one embodiment, the at least two genes selected are UHRF1 and E2F8. In one embodiment, the at least two genes selected are UHRF1 and ZNF367. In one embodiment, the at least two genes selected are UHRF1 and TCF19. In one embodiment, the at least two genes selected are PTTG1 and ATAD2. In one embodiment, the at least two genes selected are PTTG1 and E2F8. In one embodiment, the at least two genes selected are PTTG1 and ZNF367. In one embodiment, the at least two genes selected are PTTG1 and TCF19.
- the at least two genes selected are E2F1 and ATAD2. In one embodiment, the at least two genes selected are E2F1 and E2F8. In one embodiment, the at least two genes selected are E2F1 and ZNF367. In one embodiment, the at least two genes selected are E2F1 and TCF19. In one embodiment, the at least two genes selected are MYBL2 and ATAD2. In one embodiment, the at least two genes selected are MYBL2 and E2F8. In one embodiment, the at least two genes selected are MYBL2 and ZNF367. In one embodiment, the at least two genes selected are MYBL2 and TCF19. In one embodiment, the at least two genes selected are HMGB2 and ATAD2.
- the at least two genes selected are HMGB2 and E2F8. In one embodiment, the at least two genes selected are HMGB2 and ZNF367. In one embodiment, the at least two genes selected are HMGB2 and TCF19. In one embodiment, the at least two genes selected are E2F8 and ATAD2. In one embodiment, the at least two genes selected are E2F8 and TCF19. In one embodiment, the at least two genes selected are E2F8 and ZNF367. In one embodiment, the at least two genes selected are ZNF367 and ATAD2. In one embodiment, the at least two genes selected are ZNF367 and TCF19. In one embodiment, the at least two genes selected are TCF19 and ATAD2. Preferably, the at least two genes selected above are combined with ⁇ 1 ⁇ 4 ⁇
- At least three genes are selected and the genes selected are FOXMl, UHRF1 and PTTG1.
- the genes selected are FOXMl, UHRF1 and E2F1.
- the genes selected are FOXMl, UHRF1 and MYBL2.
- the genes selected are FOXMl, UHRF1 and HMGB2.
- the genes selected are FOXMl, PTTGl and E2F1.
- the genes selected are FOXMl, PTTGl and MYBL2.
- the genes selected are FOXMl, PTTGl and HMGB2.
- the genes selected are FOXMl, E2F1 and MYBL2.
- the genes selected are FOXMl, E2F1 and HMGB2. In one embodiment, the genes selected are FOXMl, MYBL2 and HMGB2. In one embodiment, the genes selected are UHRF1, PTTGl and E2F1. In one embodiment, the genes selected are UHRF1, PTTGl and MYBL2. In one embodiment, the genes selected are UHRF1, PTTGl and HMGB2. In one embodiment, the genes selected are PTTGl, E2F1 and MYBL2. In one embodiment, the genes selected are PTTGl, E2F1 and HMGB2. In one embodiment, the genes selected are E2F1, MYBL2 and HMGB2. In one embodiment, the genes selected are E2F1, MYBL2 and HMGB2.
- the genes selected are FOXMl, UHRF1 and ATAD2. In one embodiment, the genes selected are FOXMl, UHRF1 and E2F8. In one embodiment, the genes selected are FOXMl, UHRF1 and ZNF67. In one embodiment, the genes selected are FOXMl, UHRF1 and TCF19. In one embodiment, the genes selected are FOXMl, PTTGl and ATAD2. In one embodiment, the genes selected are FOXMl, PTTGl and E2F8. In one embodiment, the genes selected are FOXMl, PTTGl and ZNF367. In one embodiment, the genes selected are FOXMl, PTTGl and TCF19.
- the genes selected are FOXMl, E2F1 and ATAD2. In one embodiment, the genes selected are FOXMl, E2F1 and E2F8. In one embodiment, the genes selected are FOXMl, E2F1 and ZNF367. In one embodiment, the genes selected are FOXMl, E2F1 and TCF19. In one embodiment, the genes selected are FOXMl, MYBL2 and ATAD2. In one embodiment, the genes selected are FOXMl, MYBL2 and E2F8. In one embodiment, the genes selected are FOXMl, MYBL2 and ZNF367. In one embodiment, the genes selected are FOXMl, MYBL2 and TCF19.
- the genes selected are UHRF1, PTTGl and ATAD2. In one embodiment, the genes selected are UHRF1, PTTGl and E2F8. In one embodiment, the genes selected are UHRF1, PTTGl and ZNF367. In one embodiment, the genes selected are UHRF1, PTTGl and TCF19. In one embodiment, the genes selected are PTTGl, E2F1 and ATAD2. In one embodiment, the genes selected are PTTGl, E2F1 and E2F8. In one embodiment, the genes selected are PTTGl, E2F1 and ZNF367. In one embodiment, the genes selected are PTTGl, E2F1 and TCF19.
- the genes selected are E2F1, MYBL2 and ATAD2. In one embodiment, the genes selected are E2F1, MYBL2 and E2F8. In one embodiment, the genes selected are E2F1, MYBL2 and ZNF367. In one embodiment, the genes selected are E2F1, MYBL2 and TCF19. In one embodiment, the genes selected are FOXMl, HMGB2 and ATAD2. In one embodiment, the genes selected are FOXMl, HMGB2 and E2F8. In one embodiment, the genes selected are FOXMl, HMGB2 and ZNF67. In one embodiment, the genes selected are FOXMl, HMGB2 and TCF19.
- the genes selected are HMGB2, PTTGl and ATAD2. In one embodiment, the genes selected are HMGB2, PTTGl and E2F8. In one embodiment, the genes selected are HMGB2, PTTGl and ZNF367. In one embodiment, the genes selected are HMGB2, PTTGl and TCF19. In one embodiment, the genes selected are HMGB2, E2F1 and ATAD2. In one embodiment, the genes selected are HMGB2, E2F1 and E2F8. In one embodiment, the genes selected are HMGB2, E2F1 and ZNF367. In one embodiment, the genes selected are HMGB2, E2F1 and TCF19. In one embodiment, the genes selected are HMGB2, MYBL2 and ATAD2.
- the genes selected are HMGB2, MYBL2 and E2F8. In one embodiment, the genes selected are HMGB2, MYBL2 and ZNF367. In one embodiment, the genes selected are HMGB2, MYBL2 and TCF19. In one embodiment, the genes selected are UHRFl, HMGB2 and ATAD2. In one embodiment, the genes selected are UHRFl, HMGB2 and E2F8. In one embodiment, the genes selected are UHRFl, HMGB2 and ZNF367. In one embodiment, the genes selected are UHRFl, HMGB2 and TCF19. In one embodiment, the genes selected are E2F8, ZNF367 and ATAD2.
- the genes selected are E2F8, ZNF367 and TCF19. In one embodiment, the genes selected are ATAD2, E2F8 and TCF19. Preferably, the at least three genes selected above are combined with p l 6 INK4A
- At least four genes are selected and the genes selected are FOXMl, UHRFl, PTTGl and E2F1.
- the genes selected are FOXMl, UHRFl, PTTGl and MYBL2.
- the genes selected are FOXMl, UHRFl, PTTGl and HMGB2.
- the genes selected are FOXMl, UHRFl, E2F1 and MYBL2.
- the genes selected are FOXMl, UHRFl, E2F1 and HMGB2.
- the genes selected are FOXMl, UHRFl, MYBL2 and HMGB2.
- the genes selected are FOXMl, PTTGl, E2F1 and MYBL2. In one embodiment, the genes selected are FOXMl, PTTGl, E2F1 and HMGB2. In one embodiment, the genes selected are FOXMl, E2F1, MYBL2 and HMGB2. In one embodiment, the genes selected are UHRFl, PTTGl, E2F1 and MYBL2. In one embodiment, the genes selected are UHRFl, PTTGl, E2F1 and HMGB2. In one embodiment, the genes selected are PTTGl, E2F1, MYBL2 and HMGB2. In one embodiment, the genes selected are FOXMl, UHRFl, PTTGl and ATAD2.
- the genes selected are FOXMl, UHRFl, PTTGl and E2F8. In one embodiment, the genes selected are FOXMl, UHRFl, PTTGl and ZNF367. In one embodiment, the genes selected are FOXMl, UHRFl, PTTGl and TCF19. In one embodiment, the genes selected are FOXMl, UHRFl, E2F1 and ATAD2. In one embodiment, the genes selected are FOXMl, UHRFl, E2F1 and E2F8. In one embodiment, the genes selected are FOXMl, UHRFl, E2F1 and ZNF367. In one embodiment, the genes selected are FOXMl, UHRFl, E2F1 and TCF19.
- the genes selected are FOXMl, UHRFl, MYBL2 and ATAD2. In one embodiment, the genes selected are FOXMl, UHRFl, MYBL2 and E2F8. In one embodiment, the genes selected are FOXMl, UHRFl, MYBL2 and ZNF367. In one embodiment, the genes selected are FOXMl, UHRFl, MYBL2 and TCD1. In one embodiment, the genes selected are FOXMl, UHRFl, HMGB2 and ATAD2. In one embodiment, the genes selected are FOXMl, UHRFl, HMGB2 and E2F8. In one embodiment, the genes selected are FOXMl, UHRFl, HMGB2 and ZNF37.
- the genes selected are FOXMl, UHRFl, HMGB2 and TCF19. In one embodiment, the genes selected are FOXMl, PTTGl, E2F1 and ATAD2. In one embodiment, the genes selected are FOXMl, PTTGl, E2F1 and E2F8. In one embodiment, the genes selected are FOXMl, PTTGl, E2F1 and ZNF367. In one embodiment, the genes selected are FOXMl, PTTGl, E2F1 and TCF19. In one embodiment, the genes selected are FOXMl, PTTGl, MYBL2 and ATAD2. In one embodiment, the genes selected are FOXMl, PTTGl, MYBL2 and E2F8.
- the genes selected are FOXMl, PTTGl, MYBL2 and ZNF367. In one embodiment, the genes selected are FOXMl, PTTGl, MYBL2 and TCF19. In one embodiment, the genes selected are FOXMl, PTTGl, HMGB2 and ATAD2. In one embodiment, the genes selected are FOXMl, PTTGl, HMGB2 and E2F8. In one embodiment, the genes selected are FOXMl, PTTGl, HMGB2 and ZNF367. In one embodiment, the genes selected are FOXMl, PTTGl, HMGB2 and TCF19. In one embodiment, the genes selected are FOXMl, E2F1, MYBL2 and ATAD2.
- the genes selected are FOXMl, E2F1, MYBL2 and E2F8. In one embodiment, the genes selected are FOXMl, E2F1, MYBL2 and ZNF367. In one embodiment, the genes selected are FOXMl, E2F1, MYBL2 and TCF19. In one embodiment, the genes selected are FOXMl, E2F1, HMGB2 and ATAD2. In one embodiment, the genes selected are FOXMl, E2F1, HMGB2 and E2F8. In one embodiment, the genes selected are FOXMl, E2F1, HMGB2 and ZNF367. In one embodiment, the genes selected are FOXMl, E2F1, HMGB2 and TCF19.
- the genes selected are FOXMl, MYBL2, HMGB2 and ATAD2. In one embodiment, the genes selected are FOXMl, MYBL2, HMGB2 and E2F8. In one embodiment, the genes selected are FOXMl, MYBL2, HMGB2 and ZNF367. In one embodiment, the genes selected are FOXMl, MYBL2, HMGB2 and TCF19. In one embodiment, the genes selected are UHRFl, PTTGl, E2F1 and ATAD2. In one embodiment, the genes selected are UHRFl, PTTGl, E2F1 and E2F8. In one embodiment, the genes selected are UHRFl, PTTGl, E2F1 and ZNF367.
- the genes selected are UHRFl, PTTGl, E2F1 and TCF19. In one embodiment, the genes selected are UHRFl, PTTGl, MYBL2 and ATAD2. In one embodiment, the genes selected are UHRFl, PTTGl, MYBL2 and E2F8. In one embodiment, the genes selected are UHRFl, PTTGl, MYBL2 and ZNF36. In one embodiment, the genes selected are UHRFl, PTTGl, MYBL2 and TCF19. In one embodiment, the genes selected are UHRFl, PTTGl, HMGB2 and ATAD2. In one embodiment, the genes selected are UHRFl, PTTGl, HMGB2 and E2F8.
- the genes selected are UHRFl, PTTGl, HMGB2 and ZNF367. In one embodiment, the genes selected are UHRFl, PTTGl, HMGB2 and TCF19. In one embodiment, the genes selected are PTTGl, E2F1, MYBL2 and ATAD2. In one embodiment, the genes selected are PTTGl, E2F1, MYBL2 and E2F8. In one embodiment, the genes selected are PTTGl, E2F1, MYBL2 and ZNF367. In one embodiment, the genes selected are PTTGl, E2F1, MYBL2 and TCF19. In one embodiment, the genes selected are PTTGl, E2F1, HMGB2 and ATAD2.
- the genes selected are PTTGl, E2F1, HMGB2 and E2F8. In one embodiment, the genes selected are PTTGl, E2F1, HMGB2 and ZNF367. In one embodiment, the genes selected are PTTGl, E2F1, HMGB2 and TCF19. In one embodiment, the genes selected are E2F1, MYBL2, HMGB2 and ATAD2. In one embodiment, the genes selected are E2F1, MYBL2, HMGB2 and E2F8. In one embodiment, the genes selected are E2F1, MYBL2, HMGB2 and ZNF367. In one embodiment, the genes selected are E2F1, MYBL2, HMGB2 and TCF19. In one embodiment, the genes selected are ATAD2, EDF8, ZNF367 and TCF19. Preferably, the at least four genes selected above are combined with ⁇ 1 ⁇ 4 ⁇
- At least five genes are selected and the genes selected are FOXM1, UHRFl PTTGl, E2F1 and MYBL2. In one embodiment, the genes selected are FOXM1, UHRFl PTTGl, E2F1 and HMGB2. In one embodiment, the genes selected are FOXM1, PTTGl E2F1, MYBL2 and HMGB2. In one embodiment, the genes selected are UHRFl, PTTGl E2F1, MYBL2 and HMGB2. In one embodiment, the genes selected are FOXM1, UHRFl PTTGl, E2F1 and ATAD2. In one embodiment, the genes selected are FOXM1, UHRFl PTTGl, E2F1 and E2F8.
- the genes selected are FOXM1, UHRFl, PTTGl E2F1 and ZNF367. In one embodiment, the genes selected are FOXM1, UHRFl, PTTGl E2F1 and TCF19. In one embodiment, the genes selected are FOXM1, UHRFl, PTTGl MYBL2 and ATAD2. In one embodiment, the genes selected are FOXM1, UHRFl, PTTGl MYBL2 and EFF8. In one embodiment, the genes selected are FOXM1, UHRFl, PTTGl MYBL2 and ZNF367. In one embodiment, the genes selected are FOXM1, UHRFl, PTTGl MYBL2 and TCF19.
- the genes selected are FOXM1, UHRFl, PTTGl HMGB2 and ATAD2. In one embodiment, the genes selected are FOXM1, UHRFl, PTTGl HMGB2 and E2F8. In one embodiment, the genes selected are FOXM1, UHRFl, PTTGl HMGB2 and ZNF367. In one embodiment, the genes selected are FOXM1, UHRFl, PTTGl HMGB2 and TCF19. In one embodiment, the genes selected are UHRFl, PTTGl, E2F1 MYBL2 and ATAD2. In one embodiment, the genes selected are UHRFl, PTTGl, E2F1 MYBL2 and E2F8.
- the genes selected are UHRFl, PTTGl, E2F1 MYBL2 and ZNF367. In one embodiment, the genes selected are UHRFl, PTTGl, E2F1 MYBL2 and TCF19. In one embodiment, the genes selected are UHRF1, PTTG1, E2F1, HMBG2 and ATAD2. In one embodiment, the genes selected are UHRF1, PTTG1, E2F1, HMBG2 and E2F8. In one embodiment, the genes selected are UHRF1, PTTG1, E2F1, HMBG2 and ZNF367. In one embodiment, the genes selected are UHRF1, PTTG1, E2F1, HMBG2 and TCF19.
- the genes selected are PTTG1, E2F1, MYBL2, HMGB2 and ATAD2. In one embodiment, the genes selected are PTTG1, E2F1, MYBL2, HMGB2 and E2F8. In one embodiment, the genes selected are PTTG1, E2F1, MYBL2, HMGB2 and ZNF367. In one embodiment, the genes selected are PTTG1, E2F1, MYBL2, HMGB2 and TCF19. In one embodiment, the genes selected are ATAD2, E2F8, ZNF367, TCF19 and FOXMl. In one embodiment, the genes selected are ATAD2, E2F8, ZNF367, TCF19 and UHRF1.
- the genes selected are ATAD2, E2F8, ZNF367, TCF19 and PTTG1. In one embodiment, the genes selected are ATAD2, E2F8, ZNF367, TCF19 and E2F1. In one embodiment, the genes selected are ATAD2, E2F8, ZNF367, TCF19 and MYBL2. In one embodiment, the genes selected are ATAD2, E2F8, ZNF367, TCF19 and HMGB2. Preferably, the at least five genes selected above are combined with ⁇ 1 ⁇ 4 ⁇
- the at least two genes comprise FOXMl, and at least one further gene selected from UHRF1, PTTG1, E2F1, MYBL2, HMGB2, ATAD2, E2F8, ZNF367 and TCF19.
- the at least two genes is further combined with pl6 WK4A .
- the at least two genes comprise UHRF1, and at least one further gene selected from FOXMl, PTTG1, E2F1, MYBL2, HMGB2, ATAD2, E2F8, ZNF367 and TCF19.
- the at least two genes is further combined with pl6 WK4A .
- the at least two genes comprise PTTG1, and at least one further gene selected from FOXMl, UHRF1, E2F1, MYBL2, HMGB2, ATAD2, E2F8, ZNF367 and TCF19.
- the at least two genes is further combined with ⁇ 1 ⁇ 4 ⁇
- the at least two genes comprise E2F1, and at least one further gene selected from FOXMl, PTTG1, UHRF1, MYBL2, HMGB2, ATAD2, E2F8, ZNF367 and TCF19.
- the at least two genes is further combined with ⁇ 1 ⁇ 4 ⁇
- the at least two genes comprise MYBL2, and at least one further gene selected from FOXMl, PTTG1, E2F1, UHRF1, HMGB2, ATAD2, E2F8, ZNF367 and TCF19.
- the at least two genes is further combined with pl6 WK4A .
- the at least two genes comprise HMGB2, and at least one further gene selected from FOXMl, PTTGl, E2F1, MYBL2, UHRFl, ATAD2, E2F8, ZNF367 and TCF19.
- the at least two genes is further combined with pl6 WK4A .
- the genes selected are FOXMl, UHRFl, PTTGl, E2F1, MYBL2 and HMGB2.
- the genes selected are further combined with pl6 WK4A .
- the genes selected are FOXMl, UHRFl, PTTGl, E2F1, MYBL2, HMGB2, and one or more or all of ATAD2, E2F8, ZNF367 and TCF19.
- the genes selected are further combined with pi 6 ⁇ .
- the genes selected consist essentially of FOXMl, UHRFl, PTTGl, E2F1, MYBL2, and HMGB2.
- the genes are further combined with ⁇ 1 ⁇ 4 ⁇
- the term "consist essentially of should be understood to mean all six genes, or five genes, or four genes, or three genes, or two genes selected from FOXMl, UHRFl, PTTGl, E2F1, MYBL2, and HMGB2.
- the cancer is selected from the group comprising node-negative, ER- positive breast cancer; early stage, node positive breast cancer; multiple myeloma, prostate cancer, glioblastoma, lymphoma, fibrosarcoma; myxosarcoma; liposarcoma; chondrosarcoma; osteogenic sarcoma; chordoma; angiosarcoma; endotheliosarcoma; lymphangiosarcoma; lymphangioendotheliosarcoma; synovioma; mesothelioma; Ewing's tumour; leiomyosarcoma; rhabdomyosarcoma; colon carcinoma; pancreatic cancer; breast cancer; ovarian cancer; squamous cell carcinoma; basal cell carcinoma; adenocarcinoma; sweat gland carcinoma; sebaceous gland carcinoma; papillary carcinoma; papillary adenocarcinomas; cystadenocarcinoma; me
- the cancer is preferably breast cancer or prostate cancer.
- the breast cancer is early stage, typically node-negative breast cancer or early stage, node positive breast cancer.
- the breast cancer is early stage, node-negative or early stage, node positive, ER- positive breast cancer.
- the recurrence is development of a secondary tumour.
- the recurrence is developing a further, independent primary cancer unrelated to the sampled cancer.
- a method of predicting the risk of recurrence of breast cancer in an early stage, node-negative breast cancer patient, or an early stage, node positive breast cancer patient comprising a step of assaying a cancer tumour sample from the breast cancer patient for positive expression of at least two genes (or proteins encoded by those genes) selected from the group consisting of FOXM1, UHRF1, PTTG1, E2F1, MYBL2, HMGB2, ATAD2, E2F8, ZNF367, and TCF19, wherein positive expression of the at least two genes (or proteins encoded by those genes) correlates with increased risk of recurrence of cancer compared with an individual with cancer who does not exhibit positive expression of the at least two genes (or proteins encoded by those genes).
- the method further comprises the step of assaying for the expression of the pl6 WK4A gene (or a protein encoded by said gene) in addition to the at least two genes (or proteins encoded by those genes) selected from the group consisting of FOXM1, UHRF1, PTTG1, E2F1, MYBL2, HMGB2, ATAD2, E2F8, ZNF367 and TCF19, wherein dysregulated expression of pl6 WK4A in combination with positive expression of a combination of the at least two of genes (or proteins encoded by those genes), correlates with increased risk of recurrence of cancer compared with an individual with cancer who does not exhibit dysregulated expression of pi and positive expression of the at least two genes (or proteins encoded by those genes).
- a method of identifying a cancer patient that is suitable for treatment with a therapy for preventing recurrence or progression of the cancer comprising a step of assaying a cancer sample from the cancer patient for positive expression of at least two genes (or proteins encoded by those genes) selected from the group consisting of FOXM1, UHRF1, PTTG1, E2F1, MYBL2, HMGB2, ATAD2, E2F8, ZNF367 and TCF19, wherein positive expression of the at least two genes (or proteins encoded by those genes) compared with an individual with cancer who does not exhibit positive expression of the at least two genes (or proteins encoded by those genes), is indicative that the cancer patient is suitable for treatment with a therapy for preventing recurrence or progression of the cancer.
- the therapy is a neoadjuvant therapy.
- neoadjuvant therapy should be understood to mean treatment given before primary treatment to increase the chances of long-term survival.
- Primary treatment is generally surgery.
- Neoadjuvant therapy are generally selected from chemotherapy, hormonal therapy, targeted therapy, radiation therapy, immunotherapy or a combination thereof.
- the therapy is an adjuvant therapy.
- adjuvant therapy should be understood to mean any treatment given after primary treatment to increase the chances of long-term survival.
- Primary treatment is generally surgery.
- adjuvant therapy are generally selected from chemotherapy, hormonal therapy, targeted therapy, radiation therapy, immunotherapy or a combination thereof.
- the therapy can be a combination of neoadjuvant and adjuvant therapy. It should be understood that in the specification, the "neoadjuvant” and “adjuvant” therapies can be used interchangeably.
- the method further comprises the step of assaying for the expression of the p i giNK4A gene (or a protein encoded by said gene) in addition to the at least two genes (or proteins encoded by those genes) selected from the group consisting of FOXM1, UHRF1, PTTGl, E2F1, MYBL2, HMGB2, ATAD2, E2F8, ZNF367 and TCF19, wherein dysregulated expression of pi in combination with positive expression of a combination of at least two of the genes (or proteins encoded by those genes), when compared with an individual with cancer who does not exhibit dysregulated expression of pi and positive expression of the at least two genes, is indicative that the cancer patient is suitable for treatment with an adjuvant therapy for preventing recurrence or progression of the cancer.
- Breast cancer patients with dysregulated pi expression and positive expression of the at least two genes may be suitable for treatment with an adjuvant therapy for preventing recurrence or progression of the cancer.
- the cancer patient may be suitable for treatment with a neoadjuvant therapy for preventing recurrence or progression of the cancer.
- the cancer is early stage, node-negative breast cancer or early stage, node positive breast cancer.
- breast cancer is early stage, node-negative, ER-positive breast cancer or early stage, node positive, ER-positive breast cancer.
- the adjuvant therapy and neoadjuvant therapy is chemotherapeutic therapy.
- the adjuvant therapy and neoadjuvant therapy is a CDK4/6 inhibitor therapy such as palbociclib therapy (PD 0332991, Pfizer), Abemaciclib (LY2835219; Lilly, USA), or LEE011 (Novartis, Switzerland).
- a system for obtaining data from at least one test sample obtained from at least one individual comprising:
- a determination module configured to receive at least one test sample and perform at least one test analysis on the test sample to assay for expression of at least two genes (or proteins encoded by those genes) selected from the group consisting of FOXM1, UHRF1, PTTG1, E2F1, MYBL2, HMGB2, ATAD2, E2F8, ZNF367 and TCF19;
- a storage system for storing expression data generated by the determination module
- the determination module is further configured to perform at least one test analysis on the test sample for dysregulation of pi in combination with the test analysis on the at least two genes (or proteins encoded by those genes).
- the system comprises a correlation module for correlating the expression data of the at least two genes (or proteins encoded by those genes) from the determination module with recurrence potential of cancer, wherein the expression data of each gene (or a protein encoded by the gene) is compared with a reference value for the gene (or a protein encoded by the gene) to determine positive expression of the gene (or a protein encoded by the gene), and wherein positive expression of the at least two genes (or proteins encoded by those genes) correlates with increased potential for recurrence compared with an individual with cancer who does not exhibit positive expression of the at least two genes (or proteins encoded by those genes), and wherein the display module displays a content based in part on the data from the correlation system, the content optionally comprising a signal indicative of the recurrence potential of the cancer.
- the correlation module further correlates the expression data of the at least two genes (or proteins encoded by those genes) from the determination module with recurrence potential of cancer, together with the expression data of pl6 WK4A , wherein the expression data of each gene (or a protein encoded by the gene) and pl 6 WK4A is compared with a reference value for each gene (or a protein encoded by the gene) and ⁇ 1 ⁇ 4 ⁇ respectively, to determine positive expression of the gene (or a protein encoded by the gene) and dysregulation of ⁇ 1 ⁇ 4 ⁇ and wherein positive expression of the at least two genes (or proteins encoded by those genes) and dysregulation of pi correlates with increased potential for recurrence compared with an individual with cancer who does not exhibit positive expression of the at least two genes (or proteins encoded by those genes) and dysregulation of ⁇ 1 ⁇ 4 ⁇ and wherein the display module displays a content based in part on the data from the correlation system, the content optionally comprising a signal indicative of the
- the determination system may be selected from an immunohistochemical detection apparatus, a Western Blot, a Northern Blot, a Southern Blot, quantitative polymerase chain reaction (PCR), reverse transcriptase PCR (RT-PCR), quantitative real time RT-PCR (qRT- PCR), an enzyme -linked immunosorbent assay (ELISA), protein determination on polyacrylamide gels, and such methods known to those skilled in the art.
- the determination system comprises an immunohistochemical detection apparatus.
- the content based on the comparison result or the determination system is displayed on a computer monitor. In one embodiment of the invention, the content based on the comparison result or determination system is displayed through printable media.
- the display module can be any suitable device configured to receive from a computer and display computer readable information to a user. Non-limiting examples include, for example, general-purpose computers such as those based on Intel PENTIUM-type processor, Motorola PowerPC, Sun UltraSPARC, Hewlett-Packard PA-RISC processors, any of a variety of processors available from Advanced Micro Devices (AMD) of Sunnyvale, California, or any other type of processor, visual display devices such as flat panel displays, cathode ray tubes and the like, as well as computer printers of various types.
- AMD Advanced Micro Devices
- a World Wide Web browser is used for providing a user interface for display of the content based on the comparison result.
- modules of the invention can be adapted to have a web browser interface.
- a user may construct requests for retrieving data from the comparison module.
- the user will typically point and click to user interface elements such as buttons, pull down menus, scroll bars and the like conventionally employed in graphical user interfaces.
- a method for monitoring the effectiveness of treatment of cancer in an individual with cancer comprising a step of assaying a cancer sample from the individual with cancer for expression of at least two genes selected from the group consisting of FOXM1, UHRF1, PTTG1, E2F1, MYBL2, HMGB2, ATAD2, E2F8, ZNF367 and TCF19, wherein higher expression of at least two genes selected from the group consisting of FOXM1, UHRF1, PTTG1, E2F1, MYBL2, HMGB2, ATAD2, E2F8, ZNF367 and TCF19 correlates with ineffective treatment and poor outcome compared with an individual with cancer who has lower expression of the at least two genes.
- the method further comprises the step of assaying the cancer sample for expression of the pi gene (or a protein encoded by said gene) in combination with assaying the at least two genes (or proteins encoded by said genes), whereby dysregulated expression of pl6 WK4A correlates with ineffective treatment and poor outcome compared with an individual with cancer who has moderate expression of pl6 WK4A .
- a method for treating cancer comprising the steps of:
- identifying an individual with increased potential for recurrence of cancer by assaying a cancer sample from the individual for expression of at least two genes selected from the group consisting of FOXM1, UHRF1, PTTG1, E2F1, MYBL2, HMGB2, ATAD2, E2F8, ZNF367 and TCF19, wherein higher expression of at least two genes selected from the group consisting of FOXM1, UHRF1, PTTG1, E2F1, MYBL2, HMGB2, ATAD2, E2F8, ZNF367 and TCF19 correlates with increased potential for recurrence of cancer compared with an individual with cancer who has lower expression of the at least two genes; and
- the individual is treated with a therapeutically effective amount of a neoadjuvant therapy.
- a method for treating cancer comprising the steps of: identifying an individual with increased potential for recurrence of cancer by assaying a cancer sample from the individual for expression of at least two genes selected from the group consisting of FOXMl, UHRFl, PTTGl, E2F1, MYBL2, HMGB2, ATAD2, E2F8, ZNF367 and TCF19, wherein higher expression of at least two genes selected from the group consisting of FOXMl, UHRFl, PTTGl, E2F1, MYBL2, HMGB2, ATAD2, E2F8, ZNF367 and TCF19 correlates with increased potential for recurrence of cancer compared with an individual with cancer who has lower expression of the at least two genes; and
- the individual is treated with a therapeutically effective amount of a neoadjuvant therapy.
- the individual is treated with a therapeutically effective amount of an adjuvant therapy.
- the method further comprises the step of assaying the cancer sample for expression of the pi gene (or a protein encoded by said gene) in combination with assaying the at least two genes (or proteins encoded by said genes), whereby dysregulated expression of pi correlates with potential for recurrence of cancer when compared with an individual with cancer who has moderate expression of ⁇ 1 ⁇ 4 .
- the neoadjuvant therapy and adjuvant therapy is an agent selected from, but not limited to, trastuzumab (Herceptin®), lapatinib (Tykerb®), neratinib, afatinib (Tovok®), pertuzumab, CDK4/6 inhibitors (such as palbociclib (PD 0332991, Pfizer), Abemaciclib (LY2835219; Lilly, USA), and LEE011 (Novartis, Switzerland)), cyclophosphamide, methotrexate, 5-fluorouracil, gemcitabine, adriamycin (doxorubicin), epirubucin, docetaxel (Taxotere®), paclitaxel (Taxol®), capecitabine (Xeloda®), and tamoxifen.
- trastuzumab Herceptin®
- lapatinib Tykerb®
- neratinib
- the invention also relates to a method of treating an individual to prevent or inhibit recurrence of the cancer comprising a step of identifying a cancer patient at risk of recurrence using a method of the invention, and then treating the cancer patient with an agent or agents to prevent or inhibit recurrence of the cancer.
- the agent or agents comprise adjuvant or neoadjuvant therapy, or a combination of both.
- a method of predicting risk of recurrence of cancer in an individual with cancer comprising a step of assaying a cancer sample from the individual for positive expression of at least four genes, or proteins encoded by said genes, selected from FOXMl, UHRFl, PTTGl, E2F1, MYBL2, HMGB2, ATAD2, E2F8, ZNF367 and TCF19, wherein positive expression of the at least four genes, or proteins encoded by said genes, correlates with increased risk of recurrence of cancer compared with an individual with cancer who does not exhibit positive expression of the at least four genes or proteins encoded by those genes.
- a method of predicting risk of recurrence of cancer in an individual with cancer following treatment with CDK4/6 inhibitors comprising a step of assaying a cancer sample from the individual for positive expression of at least four genes, or proteins encoded by said genes, selected from FOXM1, UHRF1, PTTG1, E2F1, MYBL2, HMGB2, ATAD2, E2F8, ZNF367 and TCF19, wherein positive expression of the at least four genes correlates with increased risk of recurrence of cancer in an individual with cancer following treatment with CDK4/6 inhibitors compared with an individual with cancer who does not exhibit positive expression of the at least four genes or proteins encoded by those genes.
- a method of predicting risk of recurrence of breast cancer in an early stage, node negative breast cancer patient comprising a step of assaying a cancer tumour sample from the patient for positive expression of at least four genes, or proteins encoded by those genes, selected from FOXM1, UHRF1, PTTG1, E2F1, MYBL2, HMGB2, ATAD2, E2F8, ZNF367 and TCF19, wherein positive expression of the at least four genes, or proteins encoded by those genes, correlates with increased risk of recurrence of cancer compared with a patient with cancer who does not exhibit positive expression of the at least four genes or proteins encoded by those genes.
- a 5-year survival rate or a 10-year survival rate of an individual diagnosed with breast cancer comprising a step of assaying a cancer tumour sample from the individual for positive expression of at least four genes, or proteins encoded by those genes, selected from FOXM1, UHRF1, PTTG1, E2F1, MYBL2, HMGB2, ATAD2, E2F8, ZNF367 and TCF19, wherein positive expression of the at least four genes, or proteins encoded by those genes, correlates with decreased chance of 5-year survival rate or 10-year survival rate compared with an individual with cancer who does not exhibit positive expression of the at least four genes or proteins encoded by those genes.
- the methods further comprising the step of assaying for the expression of p i giNK4A gene or a protein encoded by said gene, wherein dysregulated expression of ⁇ 1 ⁇ 4 ⁇ in combination with positive expression of the at least four genes or proteins encoded by those genes, correlates with increased risk of recurrence of cancer or a decreased chance of 5-year survival rate or 10-year survival rate compared with an individual with cancer who does not exhibit dysregulated expression of pl6 WK4A and positive expression of the at least four genes or proteins encoded by those genes.
- a method of identifying a cancer patient that is suitable for treatment with a therapy for preventing recurrence or progression of the cancer comprising a step of assaying a cancer sample from the cancer patient for positive expression of at least four genes selected from FOXM1, UHRF1, PTTG1, E2F1, MYBL2, HMGB2, ATAD2, E2F8, ZNF367 and TCF19, wherein positive expression of the at least four genes or proteins encoded by those genes compared with an individual with cancer who does not exhibit positive expression of the at least two genes or proteins encoded by those genes, is indicative that the cancer patient is suitable for treatment with a therapy for preventing recurrence or progression of the cancer.
- a system for obtaining data from at least one test sample obtained from at least one individual comprising a determination module configured to receive at least one test sample and perform at least one test analysis on the test sample to assay for expression of at least four genes or proteins encoded by those genes selected from FOXM1, UHRF1, PTTG1, E2F1, MYBL2, HMGB2, ATAD2, E2F8, ZNF367 and TCF19; optionally, a storage system for storing expression data generated by the determination module; and a display module for displaying a content based in part on the data output from said determination module, wherein the content comprises a signal indicative of the expression of at the least two genes or proteins encoded by those genes.
- a method for monitoring the effectiveness of treatment of cancer in an individual with cancer comprising a step of assaying a cancer sample from the individual with cancer for expression of at least four genes or proteins encoded by said genes selected from FOXM1, UHRF1, PTTG1, E2F1, MYBL2 and HMGB2, wherein higher expression of at least four genes selected from FOXM1, UHRF1, PTTG1, E2F1, MYBL2, HMGB2, ATAD2, E2F8, ZNF367 and TCF19 correlates with ineffective treatment and poor outcome compared with an individual with cancer who has lower expression of the at least four genes or proteins encoded by those genes.
- a method of predicting risk of recurrence or progression of breast cancer in a patient, and treating the patient with a therapy for preventing recurrence of the cancer comprising a step of assaying a cancer sample from the patient for positive expression of at least four genes selected from FOXM1, UHRF1, PTTG1, E2F1, MYBL2, HMGB2, ATAD2, E2F8, ZNF367 and TCF19, wherein positive expression of the at least four genes, or proteins encoded by those genes, correlates with increased risk of recurrence or progression of cancer compared with a patient with cancer who does not exhibit positive expression of the at least four genes, or proteins encoded by those genes; and administering a neoadjuvant or an adjuvant therapy, or a combination of both, to the patient to prevent recurrence or progression of the cancer.
- the at least four genes, or proteins encoded by said genes are FOXM1, PTTG1, UHRF1 and HMGB2.
- FIG. 1 illustrates the Identification of master transcriptional regulators (MTRs) of breast cell proliferation.
- MTRs master transcriptional regulators
- A Western blot analysis of the proliferation marker EZH2 and the cellular senescence marker pl6INK4A in growing (low passage) and senescent (high passage) human mammary epithelial cells (HMECs) and mouse embryonic fibroblasts (MEFs). ⁇ -actin was used as a loading control.
- HMECs human mammary epithelial cells
- MEFs mouse embryonic fibroblasts
- ⁇ -actin was used as a loading control.
- B Duplicate transcriptomic profiling experiments in growing and senescent HMEC and MEF cultures were aligned in order to identify genes expressed at a consistently high level in proliferating cells.
- Heat-map analysis depicts all genes up- or down- regulated by more than two-fold in HMECs, and the corresponding change in MEFs.
- Cluster 4 represents a 'core proliferation' signature comprising the genes most significantly and consistently downregulated during serial passaging of both HMECs and MEFs.
- C Quantitative real-time PCR validation of gene expression changes of representative genes from each of the gene clusters shown in panel B. The ribosomal RNA gene, RPLPO, was used for normalization of these data.
- D Gene ontology analysis of individual gene clusters. Red line indicates a p- value of 0.05.
- FIG. 2 illustrates that E2F1, FOXM1 and MYBL2 bind core proliferative genes in HMECs.
- A Reverse engineering analysis using ARACNe predicts 6 upstream Master Transcriptional Regulators (MTRs) of the 'core proliferation' signature. Shown is a representative ARACNe network of the HMEC/MEF 'core proliferation' signature (Cluster 4) within the NKI dataset (van de Vijver et al , 2002). MTRs are highlighted in red, and cluster 4 genes are highlighted in green.
- Precipitated DNA was analyzed by qRT-PCR using primers directed towards the promoters of the indicated genes (SEQ ID NOs: 1 to 38).
- Anti-HA antibody was used as a negative control for ChIP, and the ⁇ -ACTB and CHD5 promoters were used as negative promoter controls for qRT-PCR.
- ChIP enrichments are presented as the percentage of protein bound, normalised to input. The error bars indicate standard deviation of three technical replicates.
- C Heat-map analysis showing ChlP-seq data for FOXMl, MYBL2 and E2Fl,in HMEC-Tert cells.
- Binding at the promoters of genes from Clusters 1-4 is indicated by increasing signal for each factor, FOXMl (red), MYBL2 (green) and E2F1 (blue). The region between -2 and +2 of the transcriptional start site (TSS) of these genes is shown.
- FOXMl red
- MYBL2 green
- E2F1 blue
- TSS transcriptional start site
- Figure 3 illustrates that master transcriptional regulators predict patient outcome.
- Master transcriptional regulators are predicted to be upstream of the 'Genomic Grade' poor prognosis signature. Shown is a representative ARACNe network of the 'Genomic Grade' signature (Sotiriou et al., 2006) within the Loi dataset (Loi et al., 2007). MTRs are highlighted in red, and Genomic Grade signature genes are highlighted in green.
- (D) Kaplan-Meier survival curves for FOXMl, UHRF1, HMGB2 and PTTG1 combined, compared to Ki67 and the St. Gallen criteria in TMA samples (n 408) in terms of recurrence -free survival.
- (E) Heat map illustrating the prognostic power of FOXMl, UHRF1, HMGB2 and PTTG1 and the 4 MTRs combined on the breast tumours from the TMA cohort (n 408) in terms of recurrence-free survival. Ki67 staining results and St. Gallen criteria were included for comparison. The scale represents - log 10 of the p-values calculated using log-rank test.
- Figure 4 illustrates that absent and high CDKN2A mRNA and pi 6 protein levels predict poor prognosis in breast cancer.
- A Correlations of the mRNA expression levels of CDKN2A with gene copy number alterations (CNA) in the RB 1 and CDKN2A gene loci using the GISTIC tool on data 457 breast cancers from TCGA (TCGA, 2012, Nature, 490, 61-70).
- Samples were stratified into 3 groups based on CDKN2A mRNA expression levels, cut at the 33rd and 66th percentile. Additionally, the undetected and high expression groups were combined and compared to the moderate expression group. Chi2 values and p-values were calculated using log-rank test.
- C Representative examples of immunohistochemical staining for pi 6 on low and high-risk tumors. Low risk tumors were defined as those which did not recur within the study timeframe, whereas high risk tumors did recur.
- Figure 5 illustrates that combined measurements of MTR and pl6(INK4A) levels outperforms estimates of currently used strategies.
- (B) Heat maps illustrating the prognostic value of CDKN2A alone, 6 MTRs combined, OncoMasTR RNA score, 70-gene signature, 21- gene signature and Ki67 in node negative samples without adjuvant chemotherapy in three individual breast cancer microarray datasets (Loi et al., 2007; Miller et al., 2005; and van de Vijver et al., 2002) and the combined dataset (n 457) in terms of recurrence-free survival.
- the 70-gene and 21 -gene signature predicted risk groups were estimated based on gene expression data using the genefu package in R.
- the scale represents -loglO of the p-values calculated using log-rank test.
- the prognostic values of the 4 MTRs alone, pl6 alone, the OncoMasTR IHC score, Ki67 and St. Gallen criteria were represented as a heat map based on the -loglO of p- values calculated using the log-rank test.
- Figure 6 illustrates the performance of the OncoMasTR RNA score in ER-positive patients.
- (A) Kaplan-Meier survival curves comparing the prognostic value of the OncoMasTR RNA score (6 MTRs and CDKN2A) with the 21 -gene and 70-gene signatures in ER-positive patients who did not receive adjuvant chemotherapy, in the combined microarray dataset (n 536) in terms of recurrence-free survival.
- (B) Kaplan-Meier survival curves as in panel A. in lymph-node negative, ER-positive patients who did not receive adjuvant chemotherapy, in the combined microarray dataset (n 366).
- Figure 7 illustrates the performance of the OncoMasTR RNA score as measured by Taqman qRT-PCR.
- Figure 8 illustrates the performance of the OncoMasTR IHC score in terms of Distant Metastasis-free survival.
- Figure 9 illustrates the prognostic value of additional MTRs - ATAD2 and TCF19.
- the gene expression values for ATAD2 and TCF19 were split into low/high groups by the median within each of the three datasets. There are no probes mapping to E2F8 and ZNF367 in the NKI dataset.
- TGCA Cancer Genome Atlas
- Figure 11 illustrates a Forest plot of the top 100 combinations of MTRs from the list of 10 MTRs described here, with at least 4 MTRs in each combination.
- Figure 12 illustrates Kaplan-Meier plots of the top 24 MTR combinations.
- the black line refers to high expression of the marker combination and grey refers to low expression of the marker combination.
- Figure 13 illustrates the MTR10 and CDKN2A signature score in pablociclib treated human cell lines.
- cancer sample should be understood to mean tumour cells, tumour tissue, or other biological material derived from a tumour, for example conditioned media.
- MTRs Master Transcriptional Regulators
- TFs Transcription Factors
- the term "positive expression” as applied to a gene or a protein encoded by that gene should be understood to mean a level of expression of the gene or protein encoded by that gene that is increased above an average level of expression of the same gene or protein encoded by that same gene found in a cohort of matched control individuals with cancer (the "control group”).
- the cohort of matched individuals may consist of individuals who did not experience a recurrence of a cancer following surgery to remove the cancer.
- a 'standard' control for example, for Immunohistochemistry (IHC), a cell line or cell lines where the expression level of the biomarker is known, or for qPCR (quantitative Polymerase Chain Reaction), a similar standard control or a pool of a number of samples is known.
- IHC Immunohistochemistry
- qPCR quantitative Polymerase Chain Reaction
- normal expression or “moderate expression” as applied to a gene or protein should be understood to mean a level of expression of the gene (or protein encoded by that gene) that is equivalent to a level of expression of the same gene or protein encoded by that same gene found in a cohort of matched control individuals with cancer.
- the cohort of matched individuals may consist of individuals who did not experience a recurrence of a cancer following surgery to remove the cancer.
- the method used to set thresholds is different for the microarray analysis, qRT-PCR analysis, and protein expression. For microarrays, the threshold is relative (samples were split into three equal groups, so the threshold is dataset dependent), and for the qPCR and protein expression it is set at specific points.
- expression levels of 'low', 'moderate' and 'high' refer to expression values that fall within the lower, middle or upper third of the expression range; or alternatively, 'low' and 'high' expression can refer to expression values that fall within the lower or upper half of the expression range.
- 'low' and 'high' expression can refer to expression values that fall within the lower or upper half of the expression range.
- specific thresholds have been set, but in general, the term “dysregulated” refers to tumours with expression values falling above or below set values in the range of expression.
- moderate and "normal” the terms refer to tumours with expression values falling within set values in the range of expression.
- the normalised qRT-PCR thresholds for 'moderate' expression are 0.7 and 1.99.
- the normalised protein thresholds (using IHC) are 1% and 50% of positive cells. That is, a moderate score here refers to a tumour with >1% and ⁇ 50% tumour cells positive for ⁇ 1 ⁇ 4 ⁇
- the term "adjuvant therapy” should be understood to mean any treatment given after primary treatment to increase the chances of long-term survival.
- the term “neoadjuvant therapy” should be understood to mean treatment given before primary treatment to increase the chances of long-term survival.
- Primary treatment is generally surgery.
- Adjuvant therapy and neoadjuvant therapy are generally selected from chemotherapy, hormonal therapy, targeted therapy, radiation therapy, immunotherapy or a combination thereof.
- sample should be understood to mean tumour cells, tumour tissue, non-tumour tissue, conditioned media, blood or blood derivatives (serum, plasma etc), urine, or cerebrospinal fluid.
- Detection of expression generally involves immunohistological staining of a tumour biopsy tissue or a control biopsy tissue using suitable means such as immunohistochemical staining; however, many other means of detecting the biomarkers of the invention will be apparent to those skilled in the art.
- suitable means such as immunohistochemical staining
- PCR quantitative polymerase chain reaction
- RT-PCR reverse transcriptase PCR
- qRT-PCR quantitative real time RT-PCR
- ELISA Western Blot
- protein determination on polyacrylamide gels and the like.
- cancer should be understood to mean a cancer that is treated by chemotherapeutic regimens.
- An example of such a cancer include multiple myeloma, prostate cancer, glioblastoma, lymphoma, fibrosarcoma; myxosarcoma; liposarcoma; chondrosarcom; osteogenic sarcoma; chordoma; angiosarcoma; endotheliosarcoma; lymphangiosarcoma; lymphangioendotheliosarcoma; synovioma; mesothelioma; Ewing's tumour; leiomyosarcoma; rhabdomyosarcoma; colon carcinoma; pancreatic cancer; breast cancer; node-negative, ER- positive breast cancer; early stage, node positive breast cancer; early stage, node positive, ER- positive breast cancer; ovarian cancer; squamous cell carcinoma; basal cell carcinoma; adenocarcinoma; sweat gland carcinoma; sebaceous gland carcinoma; papillary carcinoma; papillary adenocarcinomas; cyst
- the term "early stage” as applied to a cancer, especially a breast cancer should be understood to mean tumours which are locally invasive but have not spread to the regional axillary lymph nodes or any other region of the body outside the breast tissue. That is, the cancer has not spread beyond the breast or the lymph nodes in the armpit on the same side of the body nor to any other part of the body.
- the term "early stage, node positive breast cancer” should be understood to mean tumours which are locally invasive and have spread to between 1-3 regional axillary lymph nodes, but not to any other region of the body outside the breast tissue.
- tumour-negative as applied to a cancer, especially a breast cancer, should be understood to mean tumours which have not spread to the regional axillary lymph nodes or any region outside the breast tissue.
- breast cancer patient or “patient” means a patient who has a primary breast cancer tumour and awaits treatment for the cancer or has already undergone or is undergoing treatment for the primary tumour.
- the term should also be understood to include a patient who has had a primary breast cancer and is in remission, for example remission following treatment including one or more of tumour resection, first line chemotherapy, radiotherapy, hormonal therapy, other targeted therapy, or a combination of the above.
- the patient will be a breast cancer patient who has, or is undergoing, treatment for a primary tumour and who has been identified as having potential for developing a metastatic phenotype.
- the patient has an ER-positive, node negative breast cancer.
- recurrence should be understood to mean the recurrence of the cancer which is being sampled in the patient, in which the cancer has returned to the sampled area after treatment, for example, if sampling breast cancer, recurrence of the breast cancer in the (source) breast tissue.
- the term should also be understood to mean recurrence of a primary cancer whose site is different to that of the cancer initially sampled, that is, the cancer has returned to a non-sampled area after treatment, such as non-locoregional recurrences.
- the term "survival rate” should be understood to mean the period of time during which a patient diagnosed with cancer such as breast cancer, will likely survive.
- the survival rate is expressed as a 5-year survival rate, a 10-year survival rate, a 15-year survival rate, a 20-year survival rate, a 25-year survival rate, a 30-year survival rate, a 35-year survival rate, a 40-year survival rate, a 45-year survival rate, or a 50-year survival rate.
- the survival rate is expressed as a 5-year survival rate or a 10-year survival rate.
- treatment should be understood to mean its generally accepted meaning which encompasses prohibiting, preventing, restraining, and slowing, stopping or reversing progression or severity of a metastatic, recurrent or existing breast cancer phenotype or other cancer phenotype.
- the term "at least two” should be understood to mean and encompass that at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine or all genes can be selected from the group consisting of FOXM1, UHRF1, PTTG1, E2F1, MYBL2, HMGB2, ATAD2, E2F8, ZNF367 and TCF19.
- the computer readable storage media can be any available tangible media that can be accessed by a computer.
- Computer readable storage media includes volatile and non-volatile, removable and non-removable tangible media implemented in any method or technology for storage of information such as computer readable instructions, data structures, program modules or other data.
- Computer readable storage media includes, but is not limited to, RAM (random access memory), ROM (read only memory), EPROM (erasable programmable read only memory), EEPROM (electrically erasable programmable read only memory), flash memory or other memory technology, CD-ROM (compact disc read only memory), DVDs (digital versatile disks) or other optical storage media, magnetic cassettes, magnetic tape, magnetic disk storage or other magnetic storage media, other types of volatile and non-volatile memory, and any other tangible medium which can be used to store the desired information and which can accessed by a computer including and any suitable combination of the foregoing.
- RAM random access memory
- ROM read only memory
- EPROM erasable programmable read only memory
- EEPROM electrically erasable programmable read only memory
- flash memory or other memory technology CD-ROM (compact disc read only memory), DVDs (digital versatile disks) or other optical storage media, magnetic cassettes, magnetic tape, magnetic disk storage or other magnetic storage media, other types of volatile and non-vol
- Computer-readable data embodied on one or more computer-readable storage media may define instructions, for example, as part of one or more programs that, as a result of being executed by a computer, instruct the computer to perform one or more of the functions described herein, and/or various embodiments, variations and combinations thereof.
- Such instructions may be written in any of a plurality of programming languages, for example, Java, J#, Visual Basic, C, C#, C++, Fortran, Pascal, Eiffel, Basic, COBOL assembly language, and the like, or any of a variety of combinations thereof.
- the computer-readable storage media on which such instructions are embodied may reside on one or more of the components of either of a system, or a computer readable storage medium described herein, may be distributed across one or more of such components.
- the computer-readable storage media may be transportable such that the instructions stored thereon can be loaded onto any computer resource to implement the aspects of the present invention discussed herein.
- the instructions stored on the computer-readable medium, described above are not limited to instructions embodied as part of an application program running on a host computer. Rather, the instructions may be embodied as any type of computer code (e.g. , software or microcode) that can be employed to program a computer to implement aspects of the present invention.
- the computer executable instructions may be written in a suitable computer language or combination of several languages.
- the functional modules of certain embodiments of the invention include at minimum a determination system, a storage device, optionally a comparison module, and a display module.
- the functional modules can be executed on one, or multiple, computers, or by using one, or multiple, computer networks.
- the determination system has computer executable instructions to provide e.g. , expression levels of at least two genes (or a protein encoded by said genes) selected from the group consisting of FOXMl, UHRFl, PTTGl, E2F1, MYBL2 and HMGB2, and optionally including pl6 WK4A , in computer readable form.
- the determination system can comprise any system for assaying a breast cancer tumour sample for expression of genes (or proteins encoded by said genes) selected from the group consisting of FOXMl, UHRFl, PTTGl, E2F1, MYBL2, HMGB2, ATAD2, E2F8, ZNF367, TCF19 and p i giNK4A.
- Standard procedures such as immunohistochemistry, a Western Blot, a Northern Blot, a Southern Blot, quantitative polymerase chain reaction (PCR), reverse transcriptase PCR (RT- PCR), quantitative real time RT-PCR (qRT-PCR), an enzyme -linked immunosorbent assay (ELISA), protein determination on polyacrylamide gels, RNA sequencing, RNA microarrays and other RNA hybridisation or amplification techniques, and such methods known to those skilled in the art, may be employed.
- PCR polymerase chain reaction
- RT- PCR reverse transcriptase PCR
- qRT-PCR quantitative real time RT-PCR
- ELISA enzyme -linked immunosorbent assay
- the information determined in the determination system can be read by the storage device.
- the "storage device” is intended to include any suitable computing or processing apparatus or other device configured or adapted for storing data or information. Examples of an electronic apparatus suitable for use with the present invention include a stand-alone computing apparatus, data telecommunications networks, including local area networks (LAN), wide area networks (WAN), Internet, Intranet, and Extranet, and local and distributed computer processing systems. Storage devices also include, but are not limited to: magnetic storage media, such as floppy discs, hard disc storage media, magnetic tape, optical storage media such as CD-ROM, DVD, electronic storage media such as RAM, ROM, EPROM, EEPROM and the like, general hard disks and hybrids of these categories such as magnetic/optical storage media.
- the storage device is adapted or configured for having recorded thereon nucleic acid sequence information.
- Such information may be provided in digital form that can be transmitted and read electronically, e.g., via the Internet, on diskette, via USB (universal serial bus) or via any other suitable mode of communication.
- stored refers to a process for encoding information on the storage device.
- Those skilled in the art can readily adopt any of the presently known methods for recording information on known media to generate manufactures comprising information relating to FOXM1, UHRF1, PTTG1, E2F1, MYBL2, HMGB2, ATAD2, E2F8, ZNF367, TCF19 and p j giNK4A eX p ress [ on [ n a sample.
- the reference data stored in the storage device to be read by the comparison module is compared.
- the “comparison module” can use a variety of available software programs and formats for the comparison operative to compare FOXM1, UHRF1, PTTG1, E2F1, MYBL2, HMGB2, ATAD2, E2F8, ZNF367, TCF19 and ⁇ 1 ⁇ expression information data determined in the determination system to reference samples and/or stored reference data.
- the comparison module is configured to use pattern recognition techniques to compare information from one or more entries to one or more reference data patterns.
- the comparison module may be configured using existing commercially-available or freely-available software for comparing patterns, staining, and may be optimized for particular data comparisons that are conducted.
- the comparison module provides computer readable information related to the expression levels of FOXM1, UHRF1, PTTG1, E2F1, MYBL2, HMGB2, ATAD2, E2F8, ZNF367, TCF19 and pi of the sample.
- the comparison module may include an operating system (e.g., UNIX) on which runs a relational database management system, a World Wide Web application, and a World Wide Web server.
- World Wide Web application includes the executable code necessary for generation of database language statements (e.g., Structured Query Language (SQL) statements).
- SQL Structured Query Language
- the executables will include embedded SQL statements.
- the World Wide Web application may include a configuration file which contains pointers and addresses to the various software entities that comprise the server as well as the various external and internal databases which must be accessed to service user requests.
- the Configuration file also directs requests for server resources to the appropriate hardware— as may be necessary should the server be distributed over two or more separate computers.
- the World Wide Web server supports a TCP/IP protocol.
- Local networks such as this are sometimes referred to as "Intranets.”
- An advantage of such Intranets is that they allow easy communication with public domain databases residing on the World Wide Web (e.g., the GenBank or Swiss Pro World Wide Web site).
- users can directly access data (via Hypertext links for example) residing on Internet databases using a HTML interface provided by Web browsers and Web servers.
- the comparison module provides a computer readable comparison result that can be processed in computer readable form by predefined criteria, or criteria defined by a user, to provide a content based in part on the comparison result that may be stored and output as requested by a user using a display module.
- the methods described herein therefore provide for systems (and computer readable media for causing computer systems) to perform methods as described in the Statements of Invention above, for example methods for diagnosing metastatic potential or recurrence potential of a breast cancer or a non-breast cancer in an individual or methods for identifying a breast cancer patient or a non-breast cancer patient suitable for treatment or prevention of metastatic or recurrent cancer with a suitable chemotherapeutic adjuvant or non-adjuvant therapeutic.
- Systems and computer readable media described herein are merely illustrative embodiments of the invention for performing methods of diagnosis in an individual, and are not intended to limit the scope of the invention. Variations of the systems and computer readable media described herein are possible and are intended to fall within the scope of the invention.
- the modules of the machine may assume numerous configurations. For example, function may be provided on a single machine or distributed over multiple machines.
- HMEC-tert cells were immortalised using a pBABE-hTERT-hygro construct.
- Mouse embryonic fibroblasts (MEFs) were derived from embryonic day 13.5 C57BL6 mouse embryos and maintained in DMEM media supplemented with 10% (v/v) FBS (Hyclone), lOOU/ml penicillin and lOOU/ml streptomycin (Gibco).
- RNA sequencing derived from embryonic day 13.5 C57BL6 mouse embryos and maintained in DMEM media supplemented with 10% (v/v) FBS (Hyclone), lOOU/ml penicillin and lOOU/ml streptomycin (Gibco).
- the moderate group was given a score of 1 and the low and high groups were combined and given a score of 2.
- To generate the OncoMasTR RNA score the combined MTR score and the INK4A score were summed together and the final scores were divided into 2 or 3 groups. Duplicate samples were removed in the combined microarray dataset.
- the genefu package in R was used to estimate the risk groups which approximate the Oncotype Dx® assay (based on 21- gene signature), and the MammaPrint assay (based on 70-gene signature) (Haibe-Kains et al).
- the Van de Vijver dataset the previously defined 70-gene risk groups were used (van de Vijver et al., 2002).
- SEQ ID NO: 3 For: CAA CAA TAG CCT ATC CAA CAT CCA G and SEQ ID NO: 4 Rev: GGA GCC CAG TCC ATC AGA ACT C;
- SEQ ID NO: 5 For: CTGCCTGAAGAGCACCAGATTG and SEQ ID NO: 6 Rev: CAAGGATCATGAGAGGCACTCC;
- SEQ ID NO: 7 For: CACTGACCAGCAATGCCAGTAC and SEQ ID NO: 8 Rev: CCCCTTGACAAGGTCTGGATTC;
- SEQ ID NO: 9 For: GCTCCTAAAAGGCCACCATCTG and SEQ ID NO: 10 Rev: TGATCTTTGGGCGATGTTCAG;
- SEQ ID NO: 17 For:
- SEQ ID NO: 25 For:
- SEQ ID NO: 27 For:
- SEQ ID NO: 31 For:
- SEQ ID NO: 33 For:
- SEQ ID NO: 35 For:
- SEQ ID NO: 37 For:
- ChIP analyses were performed as described previously (Bracken et al., 2006).
- DNA from 10 independent ChIP experiments was pooled and quantified using a Qubit fluorometer (Invitrogen). Sequencing libraries were generated using lOOng of immunoprecipitated DNA using the ChlP-SEQ Sample Prep Kit (Illumina). Amplified library DNA was purified by gel isolation and quality checked to unsure the absence of adaptor dimer contamination using the Bioanalyzer 2100 and DNA High Sensitivity Chip assay (Agilent). DNA libraries were quantified and diluted to 10 pM. Diluted libraries were used directly for cluster generation and sequencing analysis using the Genome Analyser II (Illumina) following the protocol of the manufacturer.
- the larger 231 -gene signature from which the 70-gene signature was derived was used for this analysis.
- the Genomic Grade signature was developed from a training dataset of 64 ER-positive breast tumors, and is composed of genes differentially expressed between low and high histologic grade.
- the larger 207-gene set list from which the 97-gene Genomic Grade Index was derived was used for ARACNe analysis (Sotiriou et al., 2006).
- Kaplan-Meier survival curves were used for survival analysis and Chi square and p-values were calculated using log-rank test.
- a p-value of less than 0.05 was considered significant.
- TMA tissue microarray
- the tissue microarray (TMA) used in this study was derived from a reference cohort of 512 consecutive invasive breast cancer cases diagnosed at the Department of Pathology, Malmo University Hospital, Malmo, Sweden, between 1988 and 1992, and has been previously described (Svensson et al., 2005). In brief, the median age was 65 years (range 27-96) and median follow-up time regarding disease-specific and overall survival was 11 years (range 0- 17). Patients with recurrent disease and previous systemic therapies were excluded, as well as a number of misclassified ductal carcimona in situ (DCIS) cases. Two hundred and sixty-three patients were dead at the last follow-up (December 2004), 90 of which were classified as breast cancer-specific deaths. Tissue cores (1mm) from areas representative of invasive cancer were extracted from donor blocks and arrayed in duplicate. This study has been approved by the Ethics Committee at Lund University and Malmo University Hospital.
- TMA slides were deparaffinised in xylene and rehydrated in descending gradient alcohols. Heat-mediated antigen retrieval was performed using 10 mM sodium citrate buffer (pH 6.0) in a PT module (Lab Vision, UK) for 15 min at 95 °C. The Lab Vision IHC kit (Lab Vision, UK) was used for staining. Endogenous peroxidase activity was blocked by incubation with 3% hydrogen peroxide for 10 min. Sections were blocked for 10 min in UV blocking agent and the relevant primary antibody was incubated for 1 hr.
- Sections were washed in phosphate buffered saline with 0.1% Tween 20 (PBS-T), following which primary antibody enhancer was applied for 20 min, and sections were washed in PBS-T. Sections were then incubated with HRP polymer for 15 min, washed in PBS-T and then developed for 10 min using diaminobenzidine (DAB) solution (LabVision, UK). All incubations and washing stages were carried out at room temperature. The sections were counterstained in haematoxylin, dehydrated in alcohol and xylene and mounted using DPX mounting medium. As a negative control, the primary antibody was substituted with PBS-T.
- DAB diaminobenzidine
- TMA sections had been previously been stained in the Ventana Benchmark (Ventana Medical Systems Inc, USA) using prediluted antibodies to ER (clone 6F11, Ventana), PR (clone 16, Ventana) and Her2 (Pathway CB-USA 760-2694), or in the Dako Techmate 500 (Dako, Denmark) for Ki-67 (1 :200, M7240, Dako).
- PTTG1 and pl6 WK4A the percentage of positive tumor nuclei was the most significant variable in relation to outcome and was used in all further analysis.
- HMGB2 a modified Alfred score (intensity plus percentage) was used and, for FOXM1, the percentage of cytoplasmic positivity within tumor cells was the most significant variable.
- FOXM1 the percentage of cytoplasmic positivity within tumor cells was the most significant variable.
- a threshold for positivity was applied independently for each variable, to create a binary score with low (0) and high (1) expression.
- pl6 WK4A the 'negative' (0% positive cells) and 'high' (>50 positive cells) expression groups were combined and given a score of 1, and compared to the 'moderate' group with a score of 0.
- the sum of the binary scores for all four MTRs was generated. Tumors with high expression of >1 MTR were classified as having a high MTR score.
- the binary 4MTR score was combined with the binary pi score, and divided into two groups with a threshold of >2.
- the applicant set out to identify a set of 'core proliferation' genes that are consistently highly expressed in actively growing cells in a lineage-independent fashion.
- the applicant isolated human mammary epithelial cells (HMECs) and mouse embryonic fibroblasts (MEFs) and passaged them towards cellular senescence, as characterised by an increase in the levels of p i giNK4A (Zindy et al., 1997), and a decrease in the levels of the E2F target gene, EZH2 (Bracken et al., 2003) ( Figure 1A).
- MTRs upstream master transcriptional regulators
- ARACNe upstream master transcriptional regulators
- MTRs Forkhead Box Ml (FOXM1), ubiquitin-like PHD and RING finger 1 (UHRF1), Securin or Pituitary Tumour-Transforming Gene 1 (PTTG1), E2F Transforming Factor 1 (E2F1), v-myb myeloblastosis viral oncogene homolog (avian)-like 2 (MYBL2) and High Mobility Group Box 2 (HMGB2), which were relatively consistent across the three independent breast cancer datasets, supporting the idea that the MTRs would prove to be more reliable indicators of tumor cell proliferation than their downstream target genes.
- Four additional genes were also identified consistently across datasets as being upstream of the 'core proliferation' genes. These are ATAD2, E2F8, ZNF367 and TCF19.
- Table 1 Top ranking master transcriptional regulators of the indicated expression signatures as predicted by ARACNe
- UHRF1 is generally considered to be a transcriptional repressor, being required for the maintenance of DNA methylation during cell division (Bostick et al., 2007). Therefore, UHRF1 is unlikely to directly regulate core proliferation genes, and is more likely to be a co-regulated proliferative gene. Supporting this possibility, E2F1, MYBL2, and FOXM1 also bind the promoter of the UHRF1 gene in HMEC cells.
- the Applicant also carried out unbiased survival analysis of 565 node-negative patients from four independent breast cancer gene expression datasets (Buffa et al, 2011; Ivshina et al, 2006; Loi et al., 2007; van de Vijver et al , 2002), in order to identify the genes associated with patient survival in ranked order (Table 2). Strikingly, this analysis identified several of the proliferation MTRs as among the top 20 genes associated with breast cancer outcome in these node-negative patients, with several of these proliferation MTRs scoring higher than conventional clinical biomarkers (ER, PR, Ki67) or genes incorporated into the Oncotype Dx® assay (BIRC5, CCNB l, BCL2, CTSL2). This result illustrated the power of these MTRs as prognostic biomarkers, and inspired us to investigate them further.
- Proliferative MTRs are excellent predictors of breast cancer prognosis on the RNA and protein levels.
- the stained TMAs were manually scored and the results analysed in relation to recurrence -free survival for the 430 tumours with information on all four MTRs (Figure 3D).
- Each MTR was individually associated with poor prognosis, and the combination of all four MTRs was more powerful at stratifying the patients in relation to survival, compared to existing prognostic indicators such as Ki67 or the St. Gallen criteria, a prognostic index based on age, nodal status, tumour size, ER/PR status and tumour grade (Goldhirsch et al., 2001) (Figure 3D).
- the results from this Kaplan-Meier analysis were also represented in a heat-map format to indicate the strength of the association with recurrence -free survival (Figure 3E). To the knowledge of the inventors, this heat-map arrangement has not been previously used to present large-scale survival analysis, and provides an intuitive way of determining the best prognostic combination in any particular dataset.
- the other crucial pathways, besides proliferation control, involved in breast cancer progression were taken into account. Additional genes from the unbiased analysis of four independent breast cancer datasets (described above and in Table 2) were selected, which strongly correlate with survival, and represent other aspects of tumour progression as distinct from proliferation, such as migration/invasion, apoptosis and hormone signalling pathways (Table 3). When combined with the proliferation MTRs, these genes add a further layer of information, and increase the predictive power of the gene combination even further. These genes form the basis of the OncoMasTR pathway panel which, when combined with the OncoMasTR core genes, further improve the prognostic power of the method.
- Disruption of cellular senescence pathways can be inferred using a combination of MTRs and j)16 mK4A levels and is a strong predictor of poor outcome in breast cancer
- the applicant reasoned that the breast cancers with either very high or very low pl6 WK4A protein levels had bypassed the cellular senescence checkpoint, and this could potentially explain their poor prognosis.
- the breast cancers with low pl6 WK4A protein levels were most likely to have a deletion in the INK4A gene locus, while those with aberrantly high levels likely had mutations in the INK4A gene or deregulation of downstream E2F-pRB pathway members such as Cyclin Dl or pRB.
- the tumors with moderate expression of INK4A were most likely enriched in cells that had not bypassed the cellular senescence checkpoint and, therefore, had a more favourable prognosis.
- a combination of measuring proliferative MTRs and ⁇ TM 1 ⁇ levels (OncoMasTR score) outperforms currently used approaches for predicting breast cancer prognosis.
- the prognostic ability of a combination of ⁇ 6 m 4 and the proliferative MTRs were evaluated next. To do this, a score encompassing both proliferative MTRs and ⁇ 6 m 4 expression was developed, termed the 'OncoMasTR RNA score', and compared with estimates of other leading multi-gene prognostic assays (Figure 5A). This revealed that the OncoMasTR RNA score compared favourably to surrogate estimations of the MammaPrintTM and OncotypeDx® signatures, using low/high categories for comparison with MammaPrintTM, and low/moderate/high categories for comparison with Oncotype Dx®.
- the applicant combined the pl6 ]NK4A protein and the IHC -based 4-MTR panel, called the 'OncoMasTR IHC score', and tested this combination in all patients and in lymph node-negative patients, in relation to both recurrence- free survival (Figure 5C) and breast cancer-specific survival (Figure 5D).
- OncoMasTR RNA score outperforms surrogate estimates of MammaPrintTM and Oncotype Dx® in ER-positive patients
- OncoMasTR RNA score In order to further evaluate the potential clinical utility of the OncoMasTR RNA score, its prognostic power was examined in 366 ER-positive, lymph node-negative patients, which reflects the inclusion criteria for the Oncotype Dx® assay.
- the OncoMasTR RNA score outperformed surrogate estimates of both the MammaPrintTM (low/high groups), and Oncotype Dx® (low/mod/high groups) assays in both the entire cohort (Figure 6A), and lymph node- negative patient cohort ( Figure 6B).
- OncoMasTR RNA score was also assessed using a Taqman® qRT-PCR approach in 151 ER-positive, lymph node -negative patients using DMFS as an endpoint, matched to the cohort used for IHC validation (Figure 7). This demonstrated that the OncoMasTR RNA score, when measured by Taqman® qRT-PCR analysis, showed analogous performance to the microarray-based analysis. Furthermore, the OncoMasTR IHC score also demonstrated utility in this group of patients, using either recurrence -free survival, or distant metastasis-free survival (Figure 8) as an endpoint.
- the OncoMasTR score has independent prognostic value in all patients and lymph node- negative patients
- the applicant performed multivariate analysis using Cox proportional hazards models.
- the OncoMasTR score was found to contribute added prognostic information to a standard clinicopathological variable model, in terms of recurrence -free survival, at both mRNA (Table 4) and protein (Table 5) levels. This was also observed in the lymph node-negative patient cohort.
- OncoMasTR score on top of the standard clinical model is superior to all other prognostic indicators, including Ki67, the 70-gene signature (MammaPrintTM) and the 21-gene signature (Oncotype Dx®). Furthermore, the OncoMasTR RNA score was found to provide significant additional prognostic information to a model comprising the standard clinical variables together with the Oncotype Dx® surrogate estimation.
- CDKN2A 2.23 0.135 13.82 ⁇ 0.001
- This current project describes the validation of the OncoMasTR panel as a breast cancer prognostic on independent cohorts, however the panel may also be used for other cancer types such as those listed above.
- a publically available prostate cancer transcriptomic dataset was analysed (Taylor et al., 2010), revealing that the OncoMasTR panel showed prognostic capability in terms of metastasis-free survival in this cancer type (see Figure 10).
- Prostate cancer patients with high expression of the 6 MTR panel (FOXM1, E2F1, MYBL2, UHRF1, PTTG1, HMGB2) were found to have a poor outcome in comparison to patients with low expression of these genes.
- a method of prediction based on the expression of these MTRs and pl6 WK4A will be capable of addressing the unmet need of early stage breast cancer patients, and provide them with the necessary tools to make better informed treatment decisions.
- the addition of additional pathway genes, or novel MTRs such as ATAD2, E2F8, ZNF367 and TCF19, some of which have been demonstrated to predict poor prognosis in breast cancer patients (Figure 9); may also improve the prognostic capability of this assay even further.
- Such a test will improve on what is currently available based on the fact that each of these MTRs is upstream of many genes involved in breast cancer proliferation and thus, by measuring these MTRs, one is effectively measuring the status of a much larger 'proliferation signature'.
- This algorithm integrates gene expression and survival data from 26 datasets on 12 different microarray platforms corresponding to approximately 17,000 genes in up to 4,738 samples.
- the breakdown of the individual clinical information available with each dataset is described in detail in the original manuscript, along with the methods used for analysing/normalising the gene expression data.
- Cross-dataset survival analysis across multiple disparate microarray platforms is facilitated by gene centring the data to remove probe specific information and dichotomising the samples within each dataset before combining them to perform a global pooled survival analysis.
- disease free survival (DFS) was chosen as the survival endpoint and median gene expression was used to dichotomise the data.
- MTRs there are over a 1 ,000 combinations of MTRs with four or more genes that can be chosen from the list of 10 MTRs described herein, each of which can be combined and assessed for their prognostic potential.
- BreastMark was adapted in the following way. For each combination of MTRs, the processed datasets from BreastMark were taken and, within each dataset, the expression data of each MTR was divided at the median into two groups. Once the samples have been dichotomised, the gene expression data is no longer used, allowing comparisons across different datasets/platforms.
- MTR master transcriptional regulator
- the top 100 combination of MTRs can be seen in the forest plot in Figure 11 , and the individual Kaplan-Meier plots for the top 24 combinations can be seen in Figure 12.
- the samples were ranked based on the size of the hazard ratio once significance had been established (adjusting for multiple testing using the Benjamini and Hochberg method (Benjamini, Y., Drai, D., Elmer, G., Kafkafi, N. & Golani, I. Controlling the false discovery rate in behavior genetics research. Behavioural brain research 125, 279-284 (2001)). It should be noted that the sample sizes vary depending on the combination of MTRs used as not all MTRs are present in all 26 BreastMark datasets, e.g. ZNF367 is only present in four datasets totalling 295 samples.
- Palbociclib is an orally active, highly selective inhibitor of the cyclin-dependent kinases CDK4/6, which was initially assessed as a combination therapy with letrozole in advanced ER+ Her2+ breast cancer, in the PALOMA-1 trial (Richard S. Finn, 2014). Results from this trial have shown that the addition of palbociclib to a standard regimen extends survival by 10 months, which is a very promising result in these late-stage patients. Based on the mechanistic data underpinning OncoMasTR, the Applicant believes that it is likely to have predictive utility in terms of response to this novel therapy. Calculating the MTR10+CDKN2A signature score in pablociclib treated cell lines
- Pablociclib is an inhibitor of cyclin D kinases and its effects on human breast cancer cell lines were examined previously by Finn et al. Briefly, 47 human cell lines, representing the molecular subtypes of breast cancer, were treated with pablociclib and their gene expression profiles, along their IC50 values, were calculated. The gene expression data was downloaded from the Gene Expression Omnibus for the 47 cell lines, along with the accompanying IC50 data (accession number GSE 18496). The gene expression data for the 10 MTRs described here was split on a gene by gene basis using median expression across all cell lines as a cut-off. Those cell lines with greater or lower than median expression of a gene were given a value of 2 or 1 for that gene, respectively. This was repeated for each of the ten genes.
- Boonyaratanakornkit V., Melvin, V., Prendergast, P., Altmann, M., Ronfani, L., Bianchi, M. E., Taraseviciene, L., Nordeen, S. K., Allegretto, E. A., and Edwards, D. P. (1998).
- High-mobility group chromatin proteins 1 and 2 functionally interact with steroid hormone receptors to enhance their DNA binding in vitro and transcriptional activity in mammalian cells. Mol Cell Biol 18, 4471-4487.
- EZH2 is downstream of the pRB-E2F pathway, essential for proliferation and amplified in cancer.
- lymph-node-negative, oestrogen-receptor-positive breast cancer long-term findings from National Surgical Adjuvant Breast and Bowel Project randomised clinical trials. Lancet 364, 858-868. Garbe, J. C, Bhattacharya, S., Merchant, B., Bassett, E., Swisshelm, K., Feiler, H. S., Wyrobek, A. J., and Stampfer, M. R. (2009). Molecular distinctions between stasis and telomere attrition senescence barriers shown by long-term culture of normal human mammary epithelial cells. Cancer Res 69, 7557- 7568.
- pl6INK4a messenger RNA is a marker of poor prognosis.
- pRB family proteins are required for H3K27 trimethylation and Polycomb repression complexes binding to and silencing pl6INK4alpha tumor suppressor gene. Genes Dev 21, 49-54.
- ERK phosphorylation is linked to VEGFR2 expression and Ets-2 phosphorylation in breast cancer and is associated with tamoxifen treatment resistance and small tumours with good prognosis. Oncogene 24, 4370-4379.
- van 't Veer L. J., Dai, H., van de Vijver, M. J., He, Y. D., Hart, A. A., Mao, M., Peterse, H. L., van der Kooy, K., Marton, M. J., Witteveen, A. T., et al. (2002).
- Gene expression profiling predicts clinical outcome of breast cancer. Nature 415, 530-536.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Immunology (AREA)
- Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Molecular Biology (AREA)
- Organic Chemistry (AREA)
- Medicinal Chemistry (AREA)
- Hematology (AREA)
- Pathology (AREA)
- Analytical Chemistry (AREA)
- Biomedical Technology (AREA)
- Urology & Nephrology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Physics & Mathematics (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- Biotechnology (AREA)
- Pharmacology & Pharmacy (AREA)
- Veterinary Medicine (AREA)
- Public Health (AREA)
- Animal Behavior & Ethology (AREA)
- Genetics & Genomics (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Oncology (AREA)
- Cell Biology (AREA)
- Food Science & Technology (AREA)
- General Physics & Mathematics (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- General Chemical & Material Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Hospice & Palliative Care (AREA)
- Biophysics (AREA)
- General Engineering & Computer Science (AREA)
- Epidemiology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Investigating Or Analysing Biological Materials (AREA)
Priority Applications (11)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| EP15778623.7A EP3194621B1 (en) | 2014-09-19 | 2015-09-18 | A method of predicting risk of recurrence of cancer |
| ES15778623T ES2753625T3 (es) | 2014-09-19 | 2015-09-18 | Un método para predecir el riesgo de recaída del cáncer |
| JP2017515243A JP6730983B2 (ja) | 2014-09-19 | 2015-09-18 | 癌の再発リスクを予測する方法 |
| CA2961725A CA2961725C (en) | 2014-09-19 | 2015-09-18 | A method of predicting risk of recurrence of cancer |
| AU2015316711A AU2015316711B2 (en) | 2014-09-19 | 2015-09-18 | A method of predicting risk of recurrence of cancer |
| US15/511,890 US10557175B2 (en) | 2014-09-19 | 2015-09-18 | Method of predicting risk of recurrence of cancer |
| NZ730124A NZ730124A (en) | 2014-09-19 | 2015-09-18 | A method of predicting risk of recurrence of cancer |
| IL251141A IL251141B (en) | 2014-09-19 | 2017-03-14 | A method of predicting risk of recurrence of cancer |
| US16/722,041 US20200157643A1 (en) | 2014-09-19 | 2019-12-20 | Method of predicting risk of recurrence of cancer |
| US18/066,693 US20240002947A1 (en) | 2014-09-19 | 2022-12-15 | Method of predicting risk of recurrence of cancer |
| US18/366,436 US12545961B2 (en) | 2014-09-19 | 2023-08-07 | Method of predicting risk of recurrence of cancer |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| EP14185673.2 | 2014-09-19 | ||
| EP14185673 | 2014-09-19 |
Related Child Applications (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US15/511,890 A-371-Of-International US10557175B2 (en) | 2014-09-19 | 2015-09-18 | Method of predicting risk of recurrence of cancer |
| US16/722,041 Division US20200157643A1 (en) | 2014-09-19 | 2019-12-20 | Method of predicting risk of recurrence of cancer |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2016042164A1 true WO2016042164A1 (en) | 2016-03-24 |
Family
ID=51589137
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/EP2015/071524 Ceased WO2016042164A1 (en) | 2014-09-19 | 2015-09-18 | A method of predicting risk of recurrence of cancer |
Country Status (9)
| Country | Link |
|---|---|
| US (4) | US10557175B2 (enExample) |
| EP (1) | EP3194621B1 (enExample) |
| JP (1) | JP6730983B2 (enExample) |
| AU (1) | AU2015316711B2 (enExample) |
| CA (1) | CA2961725C (enExample) |
| ES (1) | ES2753625T3 (enExample) |
| IL (1) | IL251141B (enExample) |
| NZ (1) | NZ730124A (enExample) |
| WO (1) | WO2016042164A1 (enExample) |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106039312A (zh) * | 2016-05-25 | 2016-10-26 | 中山大学肿瘤防治中心 | Znf367基因在制备治疗乳腺癌药物、诊断及预后评估试剂中的应用 |
| WO2017189976A1 (en) * | 2016-04-29 | 2017-11-02 | Board Of Regents, The University Of Texas System | Targeted measure of transcriptional activity related to hormone receptors |
| WO2018228990A1 (en) * | 2017-06-14 | 2018-12-20 | The Institute Of Cancer Research: Royal Cancer Hospital | Cyclin dependent kinase 4/6 inhibitors for use in methods of treating cancer |
| WO2021072280A1 (en) * | 2019-10-09 | 2021-04-15 | The University Of North Carolina At Chapel Hill | Dna copy number alterations (cnas) to determine cancer phenotypes |
| EP4253567A1 (en) * | 2022-03-31 | 2023-10-04 | OncoAssure Limited | A method of predicting risk of an aggressive or recurrent cancer |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US10557175B2 (en) | 2014-09-19 | 2020-02-11 | The Provost, Fellows, Scholars And Other Members Of Board Of Trinity College Dublin | Method of predicting risk of recurrence of cancer |
| USD875753S1 (en) * | 2018-03-06 | 2020-02-18 | Ventana Medical Systems, Inc. | Display screen or portion thereof with graphical user interface for biological slide scanning |
| WO2025239278A1 (ja) * | 2024-05-16 | 2025-11-20 | 公益財団法人がん研究会 | リンパ管侵襲またはリンパ節転移の可能性を判定するための検査方法 |
Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2005039382A2 (en) | 2003-06-24 | 2005-05-06 | Genomic Health | Prediction of likelihood of cancer recurrence |
| US20080275652A1 (en) | 2005-05-13 | 2008-11-06 | Universite Libre De Bruxelles | Gene-based algorithmic cancer prognosis |
| US7914988B1 (en) | 2006-03-31 | 2011-03-29 | Illumina, Inc. | Gene expression profiles to predict relapse of prostate cancer |
| WO2012030840A2 (en) * | 2010-08-30 | 2012-03-08 | Myriad Genetics, Inc. | Gene signatures for cancer diagnosis and prognosis |
| WO2013011479A2 (en) * | 2011-07-19 | 2013-01-24 | Koninklijke Philips Electronics N.V. | Assessment of cellular signaling pathway activity using probabilistic modeling of target gene expression |
| WO2014066796A2 (en) * | 2012-10-25 | 2014-05-01 | Myriad Genetics, Inc. | Breast cancer prognosis signatures |
| WO2014130825A1 (en) | 2013-02-21 | 2014-08-28 | Myriad Genetics, Inc. | Gene signatures for lung cancer prognosis and therapy selection |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US10557175B2 (en) * | 2014-09-19 | 2020-02-11 | The Provost, Fellows, Scholars And Other Members Of Board Of Trinity College Dublin | Method of predicting risk of recurrence of cancer |
-
2015
- 2015-09-18 US US15/511,890 patent/US10557175B2/en active Active
- 2015-09-18 NZ NZ730124A patent/NZ730124A/en unknown
- 2015-09-18 ES ES15778623T patent/ES2753625T3/es active Active
- 2015-09-18 CA CA2961725A patent/CA2961725C/en active Active
- 2015-09-18 AU AU2015316711A patent/AU2015316711B2/en active Active
- 2015-09-18 EP EP15778623.7A patent/EP3194621B1/en active Active
- 2015-09-18 WO PCT/EP2015/071524 patent/WO2016042164A1/en not_active Ceased
- 2015-09-18 JP JP2017515243A patent/JP6730983B2/ja active Active
-
2017
- 2017-03-14 IL IL251141A patent/IL251141B/en active IP Right Grant
-
2019
- 2019-12-20 US US16/722,041 patent/US20200157643A1/en not_active Abandoned
-
2022
- 2022-12-15 US US18/066,693 patent/US20240002947A1/en not_active Abandoned
-
2023
- 2023-08-07 US US18/366,436 patent/US12545961B2/en active Active
Patent Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2005039382A2 (en) | 2003-06-24 | 2005-05-06 | Genomic Health | Prediction of likelihood of cancer recurrence |
| US20080275652A1 (en) | 2005-05-13 | 2008-11-06 | Universite Libre De Bruxelles | Gene-based algorithmic cancer prognosis |
| US7914988B1 (en) | 2006-03-31 | 2011-03-29 | Illumina, Inc. | Gene expression profiles to predict relapse of prostate cancer |
| WO2012030840A2 (en) * | 2010-08-30 | 2012-03-08 | Myriad Genetics, Inc. | Gene signatures for cancer diagnosis and prognosis |
| WO2013011479A2 (en) * | 2011-07-19 | 2013-01-24 | Koninklijke Philips Electronics N.V. | Assessment of cellular signaling pathway activity using probabilistic modeling of target gene expression |
| WO2014066796A2 (en) * | 2012-10-25 | 2014-05-01 | Myriad Genetics, Inc. | Breast cancer prognosis signatures |
| WO2014130825A1 (en) | 2013-02-21 | 2014-08-28 | Myriad Genetics, Inc. | Gene signatures for lung cancer prognosis and therapy selection |
Non-Patent Citations (53)
| Title |
|---|
| "Comprehensive molecular portraits of human breast tumours", NATURE, vol. 490, 2012, pages 61 - 70 |
| "Computational Methods in Molecular Biology", 1998, ELSEVIER |
| "Ouelette and Bzevanis Bioinformatics: A Practical Guide for Analysis of Gene and Proteins", 2001, WILEY & SONS, INC. |
| BENJAMINI, Y.; DRAI, D.; ELMER, G.; KAFKAFI, N.; GOLANI, I.: "Controlling the false discovery rate in behavior genetics research", BEHAVIOURAL BRAIN RESEARCH, vol. 125, 2001, pages 279 - 284 |
| BOFFETTA, P.; KALDOR, J. M.: "Secondary malignancies following cancer chemotherapy", ACTA ONCOL, vol. 33, 1994, pages 591 - 598 |
| BOONYARATANAKORNKIT, V.; MELVIN, V.; PRENDERGAST, P.; ALTMANN, M.; RONFANI, L.; BIANCHI, M. E.; TARASEVICIENE, L.; NORDEEN, S. K.;: "High-mobility group chromatin proteins 1 and 2 functionally interact with steroid hormone receptors to enhance their DNA binding in vitro and transcriptional activity in mammalian cells", MOL CELL BIOL, vol. 18, 1998, pages 4471 - 4487, XP002139580 |
| BOSTICK, M.; KIM, J. K.; ESTEVE, P. 0.; CLARK, A.; PRADHAN, S.; JACOBSEN, S. E.: "UHRFl plays a role in maintaining DNA methylation in mammalian cells", SCIENCE, vol. 317, 2007, pages 1760 - 1764 |
| BRACKEN, A. P.; DIETRICH, N.; PASINI, D.; HANSEN, K. H.; HELIN, K.: "Genome-wide mapping of Polycomb target genes unravels their roles in cell fate transitions", GENES DEV, vol. 20, 2006, pages 1123 - 1136, XP055024661, DOI: doi:10.1101/gad.381706 |
| BRACKEN, A. P.; PASINI, D.; CAPRA, M.; PROSPERINI, E.; COLLI, E.; HELIN, K.: "EZH2 is downstream of the pRB-E2F pathway, essential for proliferation and amplified in cancer", THE EMBO JOURNAL, vol. 22, 2003, pages 5323 - 5335 |
| BUFFA, F. M.; CAMPS, C.; WINCHESTER, L.; SNELL, C. E.; GEE, H. E.; SHELDON, H.; TAYLOR, M.; HARRIS, A. L.; RAGOUSSIS, J.: "microRNA-associated progression pathways and potential therapeutic targets identified by integrated mRNA and microRNA expression profiling in breast cancer", CANCER RES, vol. 71, 2011, pages 5635 - 5645 |
| CARDOSO, F.; VAN'T VEER, L.; RUTGERS, E.; LOI, S.; MOOK, S.; PICCART-GEBHART, M. J.: "Clinical application of the 70-gene profile: the MINDACT trial", J CLIN ONCOL, vol. 26, 2008, pages 729 - 735, XP008101264, DOI: doi:10.1200/JCO.2007.14.3222 |
| CARRO, M. S.; LIM, W. K.; ALVAREZ, M. J.; BOLLO, R. J.; ZHAO, X.; SNYDER, E. Y.; SULMAN, E. P.; ANNE, S. L.; DOETSCH, F.; COLMAN,: "The transcriptional network for mesenchymal transformation of brain tumours", NATURE, vol. 463, 2010, pages 318 - 325, XP055032072, DOI: doi:10.1038/nature08712 |
| CLARKE, M. F.: "The prognostic role of a gene signature from tumorigenic breast-cancer cells", N ENGL J MED, vol. 356, 2007, pages 217 - 226, XP055005585, DOI: doi:10.1056/NEJMoa063994 |
| CURTIS, C.; SHAH, S. P.; CHIN, S. F.; TURASHVILI, G.; RUEDA, O. M.; DUNNING, M. J.; SPEED, D.; LYNCH, A. G.; SAMARAJIWA, S.; YUAN,: "The genomic and transcriptomic architecture of 2,000 breast tumours reveals novel subgroups", NATURE, 2012 |
| FAN, C.; OH, D. S.; WESSELS, L.; WEIGELT, B.; NUYTEN, D. S.; NOBEL, A. B.; VAN'T VEER, L. J.; PEROU, C. M.: "Concordance among gene-expression-based predictors for breast cancer", N ENGL J MED, vol. 355, 2006, pages 560 - 569, XP009076969, DOI: doi:10.1056/NEJMoa052933 |
| FINN, BREAST CANCER RES., vol. 11, no. 5, 2009, pages R77 |
| FISHER, B.; JEONG, J. H.; BRYANT, J.; ANDERSON, S.; DIGNAM, J.; FISHER, E. R.; WOLMARK, N.: "Treatment of lymph-node-negative, oestrogen-receptor-positive breast cancer: long-term findings from National Surgical Adjuvant Breast and Bowel Project randomised clinical trials", LANCET, vol. 364, 2004, pages 858 - 868, XP004759457, DOI: doi:10.1016/S0140-6736(04)16981-X |
| GOLDHIRSCH, A.; GLICK, J. H.; GELBER, R. D.; COATES, A. S.; SENN, H. J.: "Meeting highlights: International Consensus Panel on the Treatment of Primary Breast Cancer. Seventh International Conference on Adjuvant Therapy of Primary Breast Cancer", J CLIN ONCOL, vol. 19, 2001, pages 3817 - 3827 |
| HAIBE-KAINS, B.; DESMEDT, C.; PIETTE, F.; BUYSE, M.; CARDOSO, F.; VAN'T VEER, L.; PICCART, M.; BONTEMPI, G.; SOTIRIOU, C.: "Comparison of prognostic gene expression signatures for breast cancer", BMC GENOMICS, vol. 9, 2008, pages 394, XP021042134, DOI: doi:10.1186/1471-2164-9-394 |
| HARA, E.; SMITH, R.; PARRY, D.; TAHARA, H.; STONE, S.; PETERS, G.: "Regulation of pl6CDKN2 expression and its implications for cell immortalization and senescence", MOL CELL BIOL, vol. 16, 1996, pages 859 - 867, XP055385008 |
| HOKAMP, K.; ROCHE, F. M.; ACAB, M.; ROUSSEAU, M. E.; KUO, B.; GOODE, D.; AESCHLIMAN, D.; BRYAN, J.; BABIUK, L. A.; HANCOCK, R. E.: "ArrayPipe: a flexible processing pipeline for microarray data", NUCLEIC ACIDS RES, vol. 32, 2004, pages W457 - 459 |
| HUI R ET AL: "INK4a gene expression and methylation in primary breast cancer: overexpression of p16INK4a messenger RNA is a marker of poor prognosis", CLINICAL CANCER RESEARCH, THE AMERICAN ASSOCIATION FOR CANCER RESEARCH, US, vol. 6, 1 January 2000 (2000-01-01), pages 2777 - 2787, XP003010132, ISSN: 1078-0432 * |
| HUI, R.; MACMILLAN, R. D.; KENNY, F. S.; MUSGROVE, E. A.; BLAMEY, R. W.; NICHOLSON, R. I.; ROBERTSON, J. F.; SUTHERLAND, R. L.: "INK4a gene expression and methylation in primary breast cancer: overexpression of p16INK4a messenger RNA is a marker of poor prognosis", CLIN CANCER RES, vol. 6, 2000, pages 2777 - 2787, XP003010132 |
| IVANESA PARDO ET AL: "Next-generation transcriptome sequencing of the premenopausal breast epithelium using specimens from a normal human breast tissue bank", BREAST CANCER RESEARCH, CURRENT SCIENCE, LONDON, GB, vol. 16, no. 2, 17 March 2014 (2014-03-17), pages R26, XP021184163, ISSN: 1465-5411, DOI: 10.1186/BCR3627 * |
| IVSHINA, A. V.; GEORGE, J.; SENKO, 0.; MOW, B.; PUTTI, T. C.; SMEDS, J.; LINDAHL, T.; PAWITAN, Y.; HALL, P.; NORDGREN, H. ET AL.: "Genetic reclassification of histologic grade delineates new clinical subtypes of breast cancer", CANCER RES, vol. 66, 2006, pages 10292 - 10301, XP002510499, DOI: doi:10.1158/0008-5472.CAN-05-4414 |
| KOTAKE, Y.; CAO, R.; VIATOUR, P.; SAGE, J.; ZHANG, Y.; XIONG, Y.: "pRB family proteins are required for H3K27 trimethylation and Polycomb repression complexes binding to and silencing p16INK4alpha tumor suppressor gene", GENES DEV, vol. 21, 2007, pages 49 - 54 |
| LAOUKILI, J.; KOOISTRA, M. R.; BRAS, A.; KAUW, J.; KERKHOVEN, R. M.; MORRISON, A.; CLEVERS, H.; MEDEMA, R. H.: "FoxMl is required for execution of the mitotic programme and chromosome stability", NAT CELL BIOL, vol. 7, 2005, pages 126 - 136 |
| LI, Y.; NICHOLS, M. A.; SHAY, J. W.; XIONG, Y.: "Transcriptional repression of the D-type cyclin-dependent kinase inhibitor p16 by the retinoblastoma susceptibility gene product pRb", CANCER RES, vol. 54, 1994, pages 6078 - 6082 |
| LOI, S.; HAIBE-KAINS, B.; DESMEDT, C.; LALLEMAND, F.; TUTT, A. M.; GILLET, C.; ELLIS, P.; HARRIS, A.; BERGH, J.; FOEKENS, J. A. ET: "Definition of clinically distinct molecular subtypes in estrogen receptor-positive breast carcinomas through genomic grade", J CLIN ONCOL, vol. 25, 2007, pages 1239 - 1246, XP002490628, DOI: doi:10.1200/JCO.2006.07.1522 |
| MADDEN, S. F.: "BreastMark: an integrated approach to mining publicly available transcriptomic datasets relating to breast cancer outcome", BREAST CANCER RES, vol. 15, 2013, pages R52, XP021167355, DOI: doi:10.1186/bcr3444 |
| MARGOLIN, A. A.; WANG, K.; LIM, W. K.; KUSTAGI, M.; NEMENMAN, I.; CALIFANO, A.: "Reverse engineering cellular networks", NAT PROTOC, vol. 1, 2006, pages 662 - 671 |
| MILDE-LANGOSCH, K.; BAMBERGER, A. M.; RIECK, G.; KELP, B.; LONING, T.: "Overexpression of the p16 cell cycle inhibitor in breast cancer is associated with a more malignant phenotype", BREAST CANCER RES TREAT, vol. 67, 2001, pages 61 - 70 |
| MOSLEY, J. D.; KERI, R. A.: "Cell cycle correlated genes dictate the prognostic power of breast cancer gene lists", BMC MED GENOMICS, vol. 1, 2008, pages 11, XP021040894 |
| NATURE, vol. 490, 2012, pages 61 - 70 |
| OH, I. H.; REDDY, E. P.: "The C-terminal domain of B-Myb acts as a positive regulator of transcription and modulates its biological functions", MOL CELL BIOL, vol. 18, 1998, pages 499 - 511 |
| PEURALA, E.; KOIVUNEN, P.; HAAPASAARI, K. M.; BLOIGU, R.; JUKKOLA-VUORINEN, A.: "The prognostic significance and value of cyclin Dl, CDK4 and p16 in human breast cancer", BREAST CANCER RES, vol. 15, 2013, pages R5, XP021140563, DOI: doi:10.1186/bcr3376 |
| RASHIDI; BUEHLER: "Bioinformatics Basics: Application in Biological Science and Medicine", 2000, CRC PRESS |
| RICHARD S.; FINN, J. P. C.; ISTVAN LANG; KATALIN BOER; IGOR M. BONDARENKO; SERGEY O. KULYK; JOHANNES ETTL; RAVINDRANATH PATEL; TAM: "Final results of a randomized Phase II study of PD 0332991, a cyclin-dependent kinase (CDK)-4/6 inhibitor, in combination with letrozole vs letrozole alone for first-line treatment of ER+/HER2- advanced breast cancer (PALOMA-1; TRIO-18", PROCEEDINGS OF THE 105TH ANNUAL MEETING OF THE AMERICAN ASSOCIATION FOR CANCER RESEARCH, 2014 |
| SETUBAL; MEIDANIS ET AL.: "Introduction to Computational Biology Methods", 1997, PWS PUBLISHING COMPANY |
| SOTIRIOU, C.; WIRAPATI, P.; LOI, S.; HARRIS, A.; FOX, S.; SMEDS, J.; NORDGREN, H.; FARMER, P.; PRAZ, V.; HAIBE-KAINS, B. ET AL.: "Gene expression profiling in breast cancer: understanding the molecular basis of histologic grade to improve prognosis", J NATL CANCER INST, vol. 98, 2006, pages 262 - 272, XP002490627, DOI: doi:10.1093/jnci/djj052 |
| SPARANO, J. A.: "TAILORx: trial assigning individualized options for treatment (Rx", CLIN BREAST CANCER, vol. 7, 2006, pages 347 - 350 |
| STAMPFER, M. R.: "Molecular distinctions between stasis and telomere attrition senescence barriers shown by long-term culture of normal human mammary epithelial cells", CANCER RES, vol. 69, 2009, pages 7557 - 7568, XP055370055, DOI: doi:10.1158/0008-5472.CAN-09-0270 |
| SVENSSON, S.; JIRSTROM, K.; RYDEN, L.; ROOS, G.; EMDIN, S.; OSTROWSKI, M. C.; LANDBERG, G.: "ERK phosphorylation is linked to VEGFR2 expression and Ets-2 phosphorylation in breast cancer and is associated with tamoxifen treatment resistance and small tumours with good prognosis", ONCOGENE, vol. 24, 2005, pages 4370 - 4379 |
| TAM, S. W.; SHAY, J. W.; PAGANO, M.: "Differential expression and cell cycle regulation of the cyclin-dependent kinase 4 inhibitor pl6Ink4", CANCER RES, vol. 54, 1994, pages 5816 - 5820 |
| TAYLOR, B. S.; SCHULTZ, N.; HIERONYMUS, H.; GOPALAN, A.; XIAO, Y.; CARVER, B. S.; ARORA, V. K.; KAUSHIK, P.; CERAMI, E.; REVA, B.: "Integrative genomic profiling of human prostate cancer", CANCER CELL, vol. 18, 2010, pages 11 - 22, XP055280056, DOI: doi:10.1016/j.ccr.2010.05.026 |
| TONG, Y.; EIGLER, T.: "Transcriptional targets for pituitary tumor-transforming gene-1", J MOL ENDOCRINO, vol. 143, 2009, pages 179 - 185 |
| TONG, Y.; TAN, Y.; ZHOU, C.; MELMED, S.: "Pituitary tumor transforming gene interacts with Spl to modulate Gl/S cell phase transition", ONCOGENE, vol. 26, 2007, pages 5596 - 5605 |
| VAN 'T VEER, L. J.; DAI, H.; VAN DE VIJVER, M. J.; HE, Y. D.; HART, A. A.; MAO, M.; PETERSE, H. L.; VAN DER KOOY, K.; MARTON, M. J: "Gene expression profiling predicts clinical outcome of breast cancer", NATURE, vol. 415, 2002, pages 530 - 536, XP008138701, DOI: doi:10.1038/415530a |
| WANG, Y.; KLIJN, J. G.; ZHANG, Y.; SIEUWERTS, A. M.; LOOK, M. P.; YANG, F.; TALANTOV, D.; TIMMERMANS, M.; MEIJER-VAN GELDER, M. E.: "Gene-expression profiles to predict distant metastasis of lymph-node-negative primary breast cancer", LANCET, vol. 365, 2005, pages 671 - 679, XP002713581, DOI: doi:10.1016/S0140-6736(05)70933-8 |
| WIRAPATI, P.; SOTIRIOU, C.; KUNKEL, S.; FARMER, P.; PRADERVAND, S.; HAIBE-KAINS, B.; DESMEDT, C.; IGNATIADIS, M.; SENGSTAG, T.; SC: "Meta-analysis of gene expression profiles in breast cancer: toward a unified understanding of breast cancer subtyping and prognosis signatures", BREAST CANCER RES, vol. 10, 2008, pages R65, XP021046844, DOI: doi:10.1186/bcr2124 |
| WU, L.; TIMMERS, C.; MAITI, B.; SAAVEDRA, H. I.; SANG, L.; CHONG, G. T.; NUCKOLLS, F.; GIANGRANDE, P.; WRIGHT, F. A.; FIELD, S. J.: "The E2F1-3 transcription factors are essential for cellular proliferation", NATURE, vol. 414, 2001, pages 457 - 462 |
| YAO GENG ET AL: "Diagnostic and prognostic value of plasma and tissue ubiquitin-like, containing PHD and RING finger domains 1 in breast cancer patients", CANCER SCIENCE, vol. 104, no. 2, 13 February 2013 (2013-02-13), JP, pages 194 - 199, XP055238902, ISSN: 1347-9032, DOI: 10.1111/cas.12052 * |
| ZINDY, F.; QUELLE, D. E.; ROUSSEL, M. F.; SHERR, C. J.: "Expression of the p16INK4a tumor suppressor versus other INK4 family members during mouse development and aging", ONCOGENE, vol. 15, 1997, pages 203 - 211, XP000869882, DOI: doi:10.1038/sj.onc.1201178 |
Cited By (10)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2017189976A1 (en) * | 2016-04-29 | 2017-11-02 | Board Of Regents, The University Of Texas System | Targeted measure of transcriptional activity related to hormone receptors |
| US11459617B2 (en) | 2016-04-29 | 2022-10-04 | Board Of Regents, The University Of Texas System | Targeted measure of transcriptional activity related to hormone receptors |
| IL262643B1 (en) * | 2016-04-29 | 2023-05-01 | Univ Texas | Targeted measurement of hormone receptor-associated transcriptional activity |
| IL262643B2 (en) * | 2016-04-29 | 2023-09-01 | Univ Texas | Targeted measurement of hormone receptor-associated transcriptional activity |
| CN106039312A (zh) * | 2016-05-25 | 2016-10-26 | 中山大学肿瘤防治中心 | Znf367基因在制备治疗乳腺癌药物、诊断及预后评估试剂中的应用 |
| CN106039312B (zh) * | 2016-05-25 | 2019-07-23 | 中山大学肿瘤防治中心 | Znf367基因在制备治疗乳腺癌药物、诊断及预后评估试剂中的应用 |
| WO2018228990A1 (en) * | 2017-06-14 | 2018-12-20 | The Institute Of Cancer Research: Royal Cancer Hospital | Cyclin dependent kinase 4/6 inhibitors for use in methods of treating cancer |
| WO2021072280A1 (en) * | 2019-10-09 | 2021-04-15 | The University Of North Carolina At Chapel Hill | Dna copy number alterations (cnas) to determine cancer phenotypes |
| EP4253567A1 (en) * | 2022-03-31 | 2023-10-04 | OncoAssure Limited | A method of predicting risk of an aggressive or recurrent cancer |
| WO2023186985A1 (en) | 2022-03-31 | 2023-10-05 | Oncoassure Limited | A method of predicting risk of an aggressive or recurrent cancer |
Also Published As
| Publication number | Publication date |
|---|---|
| ES2753625T3 (es) | 2020-04-13 |
| CA2961725C (en) | 2023-04-04 |
| IL251141B (en) | 2019-09-26 |
| US10557175B2 (en) | 2020-02-11 |
| US20180148788A1 (en) | 2018-05-31 |
| JP6730983B2 (ja) | 2020-07-29 |
| US20200157643A1 (en) | 2020-05-21 |
| EP3194621B1 (en) | 2019-08-14 |
| CA2961725A1 (en) | 2016-03-24 |
| AU2015316711A1 (en) | 2017-04-06 |
| IL251141A0 (en) | 2017-04-30 |
| AU2015316711B2 (en) | 2021-10-21 |
| JP2017536085A (ja) | 2017-12-07 |
| US12545961B2 (en) | 2026-02-10 |
| US20240002947A1 (en) | 2024-01-04 |
| US20240229147A1 (en) | 2024-07-11 |
| EP3194621A1 (en) | 2017-07-26 |
| NZ730124A (en) | 2023-05-26 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US12545961B2 (en) | Method of predicting risk of recurrence of cancer | |
| US20200263257A1 (en) | Method of predicting breast cancer prognosis | |
| Zhang et al. | Downregulation of long non-coding RNA HCG11 predicts a poor prognosis in prostate cancer | |
| RU2654587C2 (ru) | Способ предсказания рецидива рака молочной железы при эндокринном лечении | |
| US10196697B2 (en) | Prostate cancer classification | |
| Pedersen et al. | MicroRNA-based classifiers for diagnosis of oral cavity squamous cell carcinoma in tissue and plasma | |
| US20170107577A1 (en) | Determining Cancer Aggressiveness, Prognosis and Responsiveness to Treatment | |
| US20110165566A1 (en) | Methods of optimizing treatment of breast cancer | |
| AU2017341084A1 (en) | Classification and prognosis of cancer | |
| Tan et al. | Long noncoding RNA VPS9D1-AS1 overexpression predicts a poor prognosis in non-small cell lung cancer | |
| WO2015073949A1 (en) | Method of subtyping high-grade bladder cancer and uses thereof | |
| JP2018527886A (ja) | 転移性疾患の予測的遺伝子シグネチャー | |
| US20160222461A1 (en) | Methods and kits for diagnosing the prognosis of cancer patients | |
| Montalbo et al. | Prognostic value of circulating microRNAs in upper tract urinary carcinoma | |
| CN110225984A (zh) | 鉴别癌症风险的方法和治疗选择 | |
| Yu et al. | MicroRNA-200a-3p and GATA6 are abnormally expressed in patients with non-small cell lung cancer and exhibit high clinical diagnostic efficacy | |
| AU2009337963B2 (en) | Prognosis of breast cancer patients by monitoring the expression of two genes | |
| US20140086911A1 (en) | Methods and Products for Predicting CMTC Class and Prognosis in Breast Cancer Patients | |
| Gao et al. | A tumor microenvironment-related mRNA–ncRNA signature for prediction early relapse and chemotherapeutic sensitivity in early-stage lung adenocarcinoma | |
| JP2007167058A (ja) | がんの予後予測方法 | |
| WO2017151768A1 (en) | Data processing and classification for determining an effectiveness score for immunotherapy | |
| Ehman | Investigating Differential Expression of MicroRNAs Related to Recurrence in the Luminal Breast Cancer Subtype | |
| AU2015204286A1 (en) | Prognosis of breast cancer patients by monitoring the expression of two genes | |
| HK1201329B (en) | Method of predicting breast cancer prognosis |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 15778623 Country of ref document: EP Kind code of ref document: A1 |
|
| ENP | Entry into the national phase |
Ref document number: 2017515243 Country of ref document: JP Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 251141 Country of ref document: IL |
|
| ENP | Entry into the national phase |
Ref document number: 2961725 Country of ref document: CA |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| REEP | Request for entry into the european phase |
Ref document number: 2015778623 Country of ref document: EP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2015778623 Country of ref document: EP |
|
| ENP | Entry into the national phase |
Ref document number: 2015316711 Country of ref document: AU Date of ref document: 20150918 Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 15511890 Country of ref document: US |