WO2016025801A1 - Compositions and methods for treating diseases associated with nonsense-mediated decay resistant mrna - Google Patents

Abstract

Provided herein are compositions and methods for increasing nonsense-mediated decay (NMD) of premature termination codon (PTC)-containing mRNAs associated with disease. Provided herein is a method of increasing nonsense-mediated mRNA decay (NMD) of a premature termination codon (PTC)-containing mRNA in a cell comprising contacting the cell with an agent that increases binding of UPF1 downstream of the PTC in the PTC-containing mRNA, wherein an increase in UPF1 binding increases binding of phosphorylated UPF1 (pUPF1) downstream of the PTC in the PTC-containing mRNA.

Description

COMPOSITIONS AND METHODS FOR TREATING DISEASES ASSOCIATED WITH NONSENSE-MEDIATED DECAY RESISTANT mRNA This application claims the benefit of U.S. Provisional Application No. 62/037,424, filed August 14, 2014, which is hereby incorporated herein in its entirety. STATEMENT REGARDING FEDERALLY FUNDED RESEARCH

This invention was made with government support under grant numbers R01

GM74593 and R01 GM59614 awarded by the National Institutes of Health. The government has certain rights in the invention.

BACKGROUND

Nonsense-mediated mRNA decay (NMD) controls the quality of eukaryotic gene expression and also degrades physiologic mRNAs. NMD in human cells degrades newly synthesized mRNAs that are aberrant because they contain a premature termination codon (PTC) and thereby have the potential to encode a toxic truncated protein. NMD also degrades approximately 5-10% of naturally occurring mRNAs, often as a means of maintaining cellular homeostasis or regulating developmental processes that include axon guidance, synaptic strength and neuronal expression. However, numerous disorders are associated with NMD factor deficiencies. These disorders are often associated with PTC-containing mRNAs that are not targeted for degradation and are thus resistant to NMD. Therefore, compositions and methods for treating disorders associated with NMD-resistant mRNAs are necessary. SUMMARY

Provided herein is a method of increasing nonsense-mediated mRNA decay (NMD) of a premature termination codon (PTC)-containing mRNA in a cell comprising contacting the cell with an agent that increases binding of UPF1 downstream of the PTC in the PTC- containing mRNA, wherein an increase in UPF1 binding increases binding of phosphorylated UPF1 (UPF1) downstream of the PTC in the PTC-containing mRNA.

Also provided is a method of treating a disorder associated with expression of a PTC- containing mRNA that is resistant to nonsense-mediated mRNA decay (NMD) in a subject, comprising administering to the subject with a disorder associated with expression of a PTC- containing mRNA that is resistant to nonsense-mediated mRNA decay (NMD) an agent that increases binding of UPF1 and/or phosphorylated UPF1 (pUPF1) downstream of the PTC in the PTC-containing mRNA. Further provided is a method of identifying an agent that increases NMD of a PTC- containing mRNA comprising: contacting a cell that expresses the PTC-containing mRNA with an agent to be tested; and determining the level of pUPF1 and/or pUPF1 binding in the 3’ UTR of the (PTC)-containing mRNA, wherein an increase in UPF1 and/or pUPF1 binding indicates that the tested agent is an agent that increases NMD. DESCRIPTION OF DRAWINGS

Figures 1a-1m show the specificity of anti-p-UPF1(S1116), and evidence that p- UPF1(S1116) provides a viable assay for p-UPF1 function during NMD. Figure 1 (a):

Western blotting of lysates of HEK293T cells using twice affinity-purified anti-p- UPF1(S1116). Figure 1(b): Western blotting of lysates of HEK293T cells (5 x 10⁶/well of 6- well plate) that had been transiently transfected with 30 nM Control siRNA(−) or UPF1 siRNA (+) and 50-100 ng of pCMV-MYC or the specified UPF1 siRNA-resistant (^R) MYC- UPF1 expression vector to obtain the same level of MYC protein production. Calnexin controls for protein loading, UPF1 siRNA downregulated UPF1 to <10% of normal (i.e. of Control siRNA), and MYC-UPF1 was expressed at 2-fold the level of endogenous UPF1. Figure 1 (c,d): Transfections described in a using 30 nM of UPF1 siRNA were repeated so that 100 ng of Gl Norm or Gl Ter expression plasmid was introduced together with 50 ng of the MUP mRNA expression plasmid. Figure 1(c): Histograms represent the level of Gl mRNA normalized to the level of MUP mRNA, where the normalized level of Gl Norm mRNA in the presence of each MYC or MYC-UPF expression vector is defined as 100%, and the normalized level of Gl Ter in the presence of each MYC or MYC-UPF1 is presented as a percentage of the normalized level of Gl Norm mRNA. *, p<0.05; **, p<0.01. Figure 1(d): As in Figure 1(c) but GPx1 mRNAs were analyzed. Taken together, results from Figures 19(c) and 1(d) demonstrate that the relative ability of UPF1 variants to replace cellular UPF1 function during NMD is UPF1 (WT) > UPF1(S1089A) > UPF1(S1116A) > UPF1(4SA), the latter of which harbors four Ser-to-Ala substitutions (S1073A, S1078A, S1096A and S1116A). Figure 1(e): MS/MS identification of a tryptic peptide containing phosphorylated S1116. The sequence of the parent ion is shown above with the predicted y- ion series (m/2: 695, 614, 550 and m/1: 1099, 961, 904, 847, 748, 647, 590, 477 and 310) and b-ion series (m/1: 363, 500, 557, 614, 713, 814, 871, 985, 1152 and 1280 and m/2: 408, 436, 493 and 640) masses labeled. The MS/MS spectrum is displayed below with observed y-ions (310, 477, 550, 590, 614, 647, 695, 748, 847, 904, 961 and 1099) and b-ions (363, 408, 436, 493, 500, 557, 614, 640, 713, 814, 871, 985, 1152 and 1280) labeled. Figure 1(f): Western blotting of lysates of HEK293T cells (8 x 10⁷/150-mm dish) exposed to 100 nM wortmanin or 200 nM okadaic acid for 3 hr, revealing that wortmanin decreased and okadaic acid increased the reactivity of anti-p-UPF1(S1116), anti-p-UPF1(S1078, S1096) and anti-p- UPF1(S1089) with total-cell UPF1, which is normally largely hypophosphorylated. In contrast, neither wortmanin nor okadaic acid affected the reactivity of anti-UPF1 with total- cell UPF1. Figure 1(g): Western blotting of lysates of HEK293T cells (8 x 10⁷/150-mm dish) transfected with 23 nM of Control siRNA (−), SMG1 siRNA or SMG5 siRNA for 48 hr, demonstrating that, relative to Control siRNA, SMG1 siRNA decreased and SMG5 siRNA increased the reactivity of anti-p-UPF1(S1116), anti-p-UPF1 (S1078, S1096) and anti-p- UPF1 (S1089) with total-cell UPF1.

Cumulative distribution functions (CDFs) of log2 (ratio) of RNA fragment abundance (either UPF1 vs. total RNA or p-UPF1 vs. control). RNA fragment abundance was calculated as reads per kilobase per million mapped reads (RPKM) based on exonic regions. Figure 1(h): UPF1 binding to bona fide NMD targets (Table 4) vs. total RNA as provided in

Gregersen et al. (Mol. Cell. 54: 573-585 (2014)); Figure 1(i): UPF1 binding to bona fide NMD targets (Table 4) vs. total RNA (called mRNA UT) as provided in Zünd et al. (Nat. Struct. Mol. Biol. 20: 936-943 (2013)); Figure 1(j): p-UPF1 vs. Control using NMD targets defined on the basis of SMG6 downregulation in Yepiskoposyan et al. (2011). Figure 1(k): p- UPF1 vs. Control using NMD targets defined on the basis of SMG7 downregulation in Yepiskoposyan et al. (2011). Figure 1(l): p-UPF1 vs. Control using NMD targets defined on the basis of UPF1 downregulation in Viegas et al. (Nucleic Acids Res. 35: 4542-4551 (2007)). Figure 1(m): p-UPF1 vs. Control using NMD targets defined on the basis of UPF2

downregulation in Wittmann et al. (Mol. Cell. Biol. 26: 1272-1287 (2006)). Notably, all studies analyzed HeLa cells except for Gregersen et al. (2014), which analyzed HEK293 cells. P values were calculated from two biological replicates of our experiments and are based on the Kolmogorov-Smirnov (K-S) test.

Figures 2a-2k show that p-UPF1 provides a useful marker of NMD targets. Figure 2(a): Scheme used to define HEK293T-cell transcriptome-wide p-UPF1 binding sites using RIP-Seq. Three types of cDNA libraries were made, namely, Control (Ctl), rabbit IgG (rIgG) IP, and rabbit anti-phosphorylated human UPF1(S1116) IP (p-UPF1). Figure 2(b-e):

Cumulative distribution functions (CDFs) of log₂ (ratio) of RNA fragment abundance (p- UPF1 vs. Ctl). RNA fragment abundance was calculated by reads per kilobase per million mapped reads (RPKM) based on exonic regions. Genes detected in both p-UPF-1 and Ctl samples with≥ 20 total reads were used for plotting. P values were calculated from two biological replicates and were based on the Kolmogorov–Smirnov (K-S) test. Target sets are, from left to right, bona fide NMD targets and putative NMD targets defined by Tani et al. (RNA Biol. 9: 1370-1379 (2012) as Group B, Mendell et al. (Nat. Genet. 36: 1073-1078 (2004)), and Yepiskoposyan et al. (RNA 17: 2108-2118 (2011)). Figure 2(f-k): Examples of p-UPF1 association with individual bona fide NMD targets. Amounts of sequencing reads are indicated by numbers of reads per million mapped reads (RPM). As a control, rIgG samples provide a background with which reads in p-UPF1 samples should be compared.

Figures 3(a-g) show that p-UPF1, SMG5 and SMG7 preferentially bind to PTC- containing mRNAs compared to their PTC-free counterparts. Figure 3(a): Diagrams of spliced Gl and GPx1 PTC-free (Norm) and Gl and GPx1 PTC-containing (39 Ter and 46 Ter, respectively) mRNAs. Boxes represent coding regions, vertical lines within boxes show spliced junctions, and horizontal lines denote UTRs. Figure 3(b): HEK293T cells (8 x 10⁷/150-mm dish) were transiently transfected with phCMV-MUP (2 µg) and either pmCMV-Gl Norm (4 µg) + pmCMV-GPx1 Ter (4 µg) or pmCMV-Gl Ter (4 µg) + pmCMV- GPx1 Norm (4 µg). Immunoprecipitations (IPs) of lysates were performed using anti(α)- UPF1. (Upper) Western blotting (WB) before (−) or after IP using anti-UPF1 or, as a control for nonspecific IP, normal rabbit serum (NRS), where lanes under the wedge analyze serial 3- fold dilutions of lysate. (Lower) RT−PCR, where the level of Gl mRNA or GPx1 mRNA before and after IP was normalized to the level of MUP mRNA, the normalized level after IP was calculated as a ratio of the normalized level before IP, and the ratio for Gl Norm mRNA or GPx1 Norm mRNA is defined as 100%. Lanes under the wedge analyze serial 2-fold dilutions of lysate RNA. Figure 3(c): As in Figure 3(b) only IP was performed using anti-p- UPF1(S1116) or, as a control, rIgG. Figure 3(d): As in Figure 3(b) only IP was performed using anti-SMG5. Figure 3(e): As in Figure 3(b) except IP was performed using anti-SMG7. Figure 3(f): RT−qPCR of Gl mRNA from samples analyzed in Figure(b-e) and Fig. 4. Figure 3(g): As in f for GPx1 mRNA. All quantitations derive from three-to-four independently performed experiments and represent the mean plus standard deviations.

Figures 4(a-i) show that enhanced binding of UPF1 to a PTC-containing mRNA compared to its PTC-free counterpart typifies UPF1 but not UPF2, UPF3X, SMG1, CBP20, eRF1 or eRF3. Figure 4(a): Diagram of mRNAs that derive from pcDNA3-Gl Norm and either pcDNA3-Gl Norm or pcDNA3-Gl Ter, each harboring six copies of the MS2 coat protein- binding site (MS2bs) in their 3'UTR. Figure 4(b): HEK293T cells (8 x 10⁷/150-mm dish) were transiently transfected with 4 μg of one of the plasmids diagrammed in a, 2 μg of phCMV-MUP and 8 μg of pcDNA-HA-MS2CP. After two days, cells were harvested, protein was analyzed by Western blotting, and RNA was analyzed by RT−PCR. Results reveal that comparable levels of HA-MS2CP were expressed prior to (−) anti-HA IP, comparable levels of HA-MS2CP were present after (+) IP, and Gl Ter-6MS2bs mRNA was associated with ~6-fold more cellular UPF1 after IP than was Gl Norm-6MS2bs mRNA. Figure 4(c-h): As in Figure 3(b), except the specified antibodies were used. Notably, goat (g)IgG was used to control for the nonspecific IP of anti-UPF2, whereas rabbit (r)IgG was used to control for the nonspecific IP of the remaining antibodies. (i) As in Figures 3f and 3g except the co-IP of endogenous GADD45A mRNA, which is an NMD target, was compared to the co-IP of endogenous β-actin mRNA, which is not an NMD target. The level of each mRNA was normalized to the level of endogenous GAPDH mRNA. Quantitations derive from three independently performed experiments and represent the mean ± standard deviations.

Figures 5(a-l) show that SMG5 and SMG7 augment p-UPF1 binding to NMD targets. Figure 5(a): Western blotting prior to (−) IP of lysates of HEK293T cells (5 x 10⁶/well of 6- well plate) transiently transfected with 60 pmole of the specified or control (Ctl) siRNA/well and, one day later, with 0.4 μg of pmCMV Gl Norm or Ter, 0.4 μg or pmCMV-GPx1 Norm or Ter and 0.2 μg of pmCMV-MUP. Figure 5(b): As in Figure 5(a) only after IP using anti(α)-UPF1 or, as an IP control, normal rabbit serum (NRS). Figure 5(c): RT−qPCR of Gl mRNA as in Fig. 3f. The ratio for Gl Norm mRNA in control siRNA downregulation is defined as 100%. Figure 5(d): RT−qPCR of GPx1 mRNA as in c. Figure 5(e): As in Figure 5(a) using the specified siRNA. Figure 5(f): As in Figure 5(b) using the specified IP. Figure 5(g): As in Figure 5(c). Figure 5(h): As in Figure 5(d). Figure 5(i): As in Figure 5(a) using the specified siRNA. Figure 5(j): As in Figure 5(b) using the specified IP. Figure 5(k): Gl mRNA was quantitated as in Figure 5(c)c but normalized to the level of immunoprecipitated p-UPF1 as exemplified in Figure 5(j). Figure 5(l): As in Figure 5(k) but for GPx1 mRNA.

Quantitations derive from three independently performed experiments and represent the mean plus standard deviations.

Figures 6(a-k) show that DNA oligo-directed RNase H cleavage maps p-UPF1 binding to NMD target 3'UTRs. Figure 6(a): Diagrams of spliced IRE-Gl PTC-containing (39 Ter) mRNA. Upward-facing arrows indicate a site of DNA oligo-directed RNase H cleavage, and the ratio to the right of scissors specifies the number of 3'UTR nts in the 5'-cleavage product (CP)/ number of 3'UTR nts in the 3'-CP. Figure 6(b): RT−qPCR of RNA from HeLa cells stably expressing IRE-Gl Ter mRNA (1 x 10⁷/150-mm dish) that were cultured in the presence of 100 μM desferoximine (Df) or hemin (H) for 8 hr. The level of IRE-Gl Ter mRNA was normalized to the level of cellular SMG7 mRNA and the normalized level in the presence of Df is defined as 100%. Figure 6(c): Western blotting of lysates of HeLa cells stably expressing IRE-Gl Ter mRNA that were cultured in the presence of Df or H for 8 hr and subsequently analyzed before (−) or after IP using the specified antibody(α).Figure 6(d): RT−qPCR of IRE-Gl Ter mRNA to quantitate the level of cleavage, where the level in the absence (−) of DNA oligo is defined as 100%. Figure 6(e): RT−qPCR of the 5'-CP of IRE-Gl mRNA essentially as in b except the RT primer and PCR primer pair were specific for the 5'- CP. Figure 6(f): As in Figure 6(e) but the RT primer and PCR primer pair were specific for the 3'-CP. Figure 6 (g): As in Figure 6(c) but anti-p-UPF1(S1116) and, as a control, rIgG were used in the IPs. Figure 6(h): As in Figure 6(e). Figure 6(i): As in Figure 6(f).

Quantitations derive from four independently performed experiments and represent the mean plus standard deviations. Figure 6(j): Western blotting of lysates of HeLa cells stably expressing IRE-Gl Ter mRNA (1 x 10⁷/150-mm dish) that were transiently transfected with 450 pmoles of Control (Ctl) siRNA or XRN1 siRNA or 225 pmoles of Control siRNA + 225 pmoles of XRN1 siRNA and, two days later, were cultured in the presence of Df or H for 8 hr prior to lysis. Figure 6(k): 5'-RACE of full-length (FL) and decay intermediates of IRE-Gl mRNA, and RT−PCR of SMG7 mRNA in lysates from Figure 6(j).

Figures 7a-d show that UPF1 recognition of NMD targets requires ATPase and helicase activities and regulated UPF1 phosphorylation. Figure 7(a): Diagrams of UPF1 variants, denoting the cysteine-histidine-rich region (CH) and the serine-glutamine (SQ) SMG1 phosphorylation sites. Horizontal arrows denote amino acid changes at positions specified by downward-facing arrowheads. Figure 7(b): HEK293T cells (8 x 10⁷/150-mm dish) were transiently transfected with 0.6 μg of pmCMV-MYC-UPF1(WT), 2 μg of MYC- UPF1(C126S), 1 μg of MYC-UPF1(4SA), 0.5 μg of MYC-UPF1(dNT), 4 μg of MYC- UPF1(G495R/G497E), 0.8 μg of MYC-UPF1(R843C) or, as a negative control, 0.5 μg of pmCMV-MYC. Cell lysates were treated with (+) or without (−) RNase A and subsequently immunoprecipitated using anti(α)-MYC. Western blotting before (−) or after (α-MYC) IP. For samples after IP, 5-fold less immunoprecipitate was loaded in the analysis of MYC-UPF1 compared to the analysis of other proteins. Figure 7(c): HEK293T cells were transiently transfected as described in b except that transfections included 0.5 μg of phCMV-MUP and 1 μg each of pmCMV-Gl and pmCMV-GPx1, either Norm or Ter. Cell lysates were immunoprecipitated using anti-MYC and analyzed by western blotting. Figure 7(d):

RT−qPCR of full-length Gl or GPx1 mRNA from samples in Figure 7(c). The level of Gl or GPx1 mRNA before IP was normalized to the level of MUP mRNA and, given the comparable IP efficiencies, the normalized level of Gl Norm or GPx1 Norm mRNA after IP that co-immunoprecipitated with MYC-UPF1(WT) is defined as 100%. Diagrams are of Gl mRNA or GPx1 mRNA as in Fig. 3a, and the arrows specify PCR primer positions.

Quantitations derive from two-to-three independently performed experiments and represent the mean plus standard deviations.

Figures 8(a-h) show that HA-SMG5 or HA-SMG6, which was expressed at∼2-fold the level of its cellular counterpart, co-immunoprecipitates with MYC-UPF1(dNT), corroborating data in Fig. 7b that MYC-UPF1(dNT) co-immunoprecipitates with SMG5 and SMG6; also helicase and ATPase assays using E. coli-produced UPF1(WT),

UPF1(G495R/G497E) and UPF1(R843C); and demonstration that ATP hydrolysis disrupts stable UPF1 binding to RNA. Figure 8(a): Western blotting of lysates of HEK293T cells (8 x 10⁷/150-mm dish) that were transiently transfected with 0.6 μg of the specified MYC-UPF1 expression vector and 3 μg of either pcDNA-HA or pcDNA-HA-SMG5. Lysates were (+) or were not (−) immunoprecipitated using anti-HA, and IPs were (+) or were not (−) performed in the presence of RNase A. Figure 8(b): As in Figure 8(a) but HA-SMG5 was replaced with HA-SMG6. Figure 8(c): Coomassie blue-staining of the various E. coli-produced UPF1(115- 915) derivatives after cleavage with Prescission protease before (−) or after (+) purification using GSTrap to remove the protease and GST tag. Figure 8(d): Helicase activity assays, where the asterisks denote the 5 @-[γ³²P]-label in either the DNA strand of the DNA−RNA duplex (upper arrow) or the released single-stranded DNA (lower arrow). Wedges specify increasing amounts (25 or 75 ng) of UPF1(115-915). Figure 8(e): ATPase activity assays. Quantitations derive from three independently performed experiments and represent the mean plus standard deviations. Figure 8(f): Diagrams (not to scale) of the human UPF1 helicase domain site-specifically labeled with Cy5 using pentamutant sortase A and of Cy3-labeled RNA. Bacterially produced human UPF1( 295-914) helicase domain, which lacks the CH domain and manifests ATPase and helicase activities and the capacity to bind RNA, was fused to the requisite five-amino acid sortase A recognition site. This protein was then site- specifically labeled at its C-terminus with synthetically produced triglycine-Cy5 (red), under the agency of the pentamutant sortase A transpeptidase (SrtA 5^o). Importantly, the UPF1 helicase domain C-terminus resides in close proximity to bound RNA. Figure 8(g): Coomassie blue-staining (left) and in-gel fluorescence of UPF1(295-914)-LPETGG(His)₆ (right) using the same final preparation of sortase-labeled protein as in Figure 8(h) and a 2-hr incubation under the specified conditions. Reactions were prepared as detailed in the

Examples, resolved by electrophoresis in 12.5% SDS-polyacrylamide, and the gel was scanned using a Typhoon 9410 Variable Mode Imager in the Cy5 channel. The same gel was then stained with Coomassie blue to visualize total protein. Figure 8(h) Changes in the efficiency of energy transfer between RNA-Cy3 (donor) and UPF1(295-914)-Cy5 (acceptor) induced by various nucleotides. Changes in FRET efficiency (ΔE=E_+nucl.– E_{no nucl}) were normalized using FRET observed in the absence of nucleotides (ΔE/E_{no nucl.} = (E_+nucl.– E_{no nucl.})/E_{no nucl.}). Error bars show standard deviations calculated from triplicate measurements.

Figures 9(a-e) show that PP2Ac dephosphorylates p-UPF1 after mRNA decay initiates. Figure 9(a): Western blotting of lysates of HEK293T cells (5 x 10⁶/each of 6-well plate) transiently transfected with 60 pmole of the specified siRNA and, one day later, with 0.4 μg of pmCMV-Gl Norm or Ter, 0.4 μg or pmCMV-GPx1 Norm or Ter, and 0.2 μg of pmCMV-MUP. Figure 9(b): Using samples from a, RT−qPCR of Gl Norm or Ter mRNA as described in Fig. 2f for Gl mRNA before IP. Figure 9(c): As in Figure 9(b) but analyzed as in Figure 3(g) for GPx1 mRNA before IP. Figure 9(d): Using samples from a, RT−qPCR of endogenous NMD targets GADD45A and GADD45B mRNAs. mRNA levels were normalized to the level of the corresponding pre-mRNA using PCR primers. Quantitations in b-d derive from three independently performed experiments and represent the mean plus standard deviations as statistically analyzed using the two-tailed t test. Figure 9(e): As in Figure 2(b), (f), and (g) but using anti-PP2Ac or mouse IgG (mIgG) in the IPs. Two-to-three independently performed experiments represent the mean plus standard deviations. *, p<0.05; **, p<0.01.

Figures 10(a) and 10(b) depict a model for the dynamics of UPF1 binding to cellular mRNAs. Figure 10(a): Steady-state UPF1 binds and hydrolyzes ATP as a means to dissociate from non-productive mRNA binding, e.g. binding that does not lead to UPF1

phosphorylation and the subsequent p-UPF1-mediated recruitment of degradative activities and mRNA decay. UPF1 binding to translationally active mRNAs is largely restricted to 3'UTRs at least in part because translating ribosomes remove UPF1 from 5'UTRs and coding regions. Figure 10(b): Regulated UPF1 phosphorylation by transiently associating SMG1 requires UPF1 recognition of a termination codon as one that triggers NMD, e.g. as one situated sufficiently upstream of a 3'UTR EJC (not shown). p-UPF1 recruits SMG6 and/or SMG5−SMG7, which directly or indirectly trigger mRNA decay, respectively. While the binding of SMG6 is sufficiently transient as to be undetectable, SMG5−SMG7 stabilize p- UPF1 binding to NMD target 3'UTRs. PP2A returns p-UPF1 to a dephosphorylated state after mRNA decay is initiated.

Figures 11(a-c) show that a pseudoknot (ψ) can convert PTC-containing dRLUC-Gl mRNA that is immune to NMD to an NMD target. Figure 11(a): Diagram of dRLUC-Gl mRNA showing the PTC at position 39 (39Ter), which triggers NMD, and the PTCs that fail to trigger NMD at positions 90, 96 or 101. AUG, initiation codon; Norm Ter, normal termination codon. Figure 11(b): Histogram of RT-qPCR analyses of RNA from HEK293 cells that were transiently transfected with a test plasmid encoding the specified dRLUC-Gl mRNA and a reference plasmid encoding MUP mRNA. The level of each dRLUC-Gl mRNA was normalized to the level of MUP mRNA and presented as a percentage (%) of the normalized level of dRLUC-Gl Norm Ter, which is defined as 100. Figure 11(c): Histogram of RT-qPCR analyses after UPF1 IP. Shown are normalized values after IP as a ratio of normalized values before IP. Results are from 3 independent experiments.

Figures 12a and 12b show that morpholinos MP1_Gl and MP2_Gl promote the NMD of NMD-insensitive reporter dRLUC-Gl 101 Ter mRNA in human HEK293T cells. Figure 12(a): Diagram of dRLUC-Gl mRNA showing the PTC that fails to trigger NMD at position 101. AUG, normal initiation codon; Norm Ter, normal termination codon. Figure 12(b):

Shown is a histogram representation of RT-qPCR analyses in which the level of dRLUC-Gl mRNA was normalized to the level of MUP mRNA and presented as a percentage (%) of the normalized value of dRLUC-Gl Norm Ter, which is defined as 100.

Figure 13 shows that, consistent with data obtained using NMD reporters in Figure 5, SMG5 and SMG7 augment p-UPF1 binding to the endogenous NMD target GADD45A mRNA. Figure 13(a): As in Figures 5(c) and (d) except for GADD45A mRNA, using β-actin mRNA as a non-NMD target control. Figure 13(b): As in Figures 5(g) and 5(h) but assaying GADD45A and β-actin mRNAs. Figure 13(c): As in Figure 5(k) and (l), but assaying

GADD45A and β-actin mRNAs. Quantitations derive from three-four independently performed experiments and represent the mean plus standard deviations. DESCRIPTION

Numerous inherited and acquired human diseases are due to frame-shift or nonsense mutations that generate a PTC and result in the premature termination of mRNA translation. Cells eliminate these mRNAs using NMD, a pathway that evolved to eliminate mRNA transcripts that contain a PTC, because the resulting truncated proteins can be cytotoxic. PTCs residing either less than about 55 nucleotides upstream of the last exon-exon junction or downstream of this junction generally fail to trigger NMD, thus yielding PTC-containing mRNAs that are resistant to NMD. As a consequence, the resulting protein is often sufficiently abundant to be harmful to the complex in which its full-length counterpart normally functions, yielding a dominant-negative influence. There are numerous diseases of this type, where the subject has only one defective allele yet manifests a deleterious phenotype. Compositions and methods are provided herein for the treatment of these diseases.

Provided herein is a method of increasing nonsense-mediated mRNA decay (NMD) of a premature termination codon (PTC)-containing mRNA in a cell comprising contacting the cell with an agent that increases binding of UPF1 downstream of the PTC in the PTC- containing mRNA, wherein an increase in UPF1 binding increases binding of phosphorylated UPF1 (pUPF1) downstream of the PTC in the PTC-containing mRNA.

As used throughout, UPF1 is a UPF1 regulator of nonsense transcripts that is part of a post-splicing complex involved in both mRNA nuclear export and mRNA surveillance. This protein is also known as HUPF1, NORF1, RENT1 or smg-2. Examples of amino acid sequences for UPF1 can be found under GenBank Accession Nos. NP_001284478.1 and NP_002902.2. Examples of nucleic acid sequences encoding UPF1 are available under GenBank Accession Nos. NM_001297549 and NM_002911.3.

In the methods set forth herein, binding of UPF1 to a PTC-containing mRNA results in an increase in phosphorylation of the UPF1 bound to the PTC-containing mRNA, thus resulting in an increase in pUPF1 bound to the PTC-containing mRNA. The increase in binding occurs downstream of the PTC and can occur about 60, 100, 125, 150, 175, 200, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500, 525, 550 or more nucleotides downstream of the PTC. The accumulation of UPF1 and/or pUPF1 downstream of the PTC results in an increase in NMD of PTC-containing mRNAs. The increase in binding of UPF1 and/or pUPF1 can be an increase of about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 200%, 300%, 400% or greater as compared to a control cell or a control value. This increase in binding increases NMD which results in a decrease in the amount of PTC- containing mRNAs in the cell. This decrease can be about 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or any percentage in between as compared to a control cell or a control value. In the methods provided herein, a control can be a cell that comprises a premature termination codon (PTC)-containing mRNA and has not been contacted with an agent that increases UPF1 and/or UPF1 binding.

The methods provided herein can be used to increase NMD of a particular disease- associated PTC-containing mRNA. In other words, the methods can be used to specifically target defective PTC-containing mRNAs without significantly affecting mRNAs with normal termination codons, thus avoiding the toxicity associated with nonsense-suppression therapies that suppress all PTCs and normal termination codons. Further, the methods can be used to specifically target defective PTC-containing mRNAs without affecting the normal mRNAs, i.e., mRNAs that do not contain a PTC, of a subject with a disease associated with only one defective allele. In any of the methods set forth herein, the PTC-containing mRNA can be an NMD-resistant mRNA.

In the methods set forth herein, an agent can increase binding of UPF1 or pUPF1 by increasing the retention time of UPF1 and/or pUPF1 on the PTC-containing mRNA, by increasing the number of UPF1 and/or pUPF1 molecules bound to the 3’-untranslated region (UTR) of the PTC-containing mRNA, or by increasing the affinity of UPF1 and/or pUPF1 for the PTC-containing mRNA. An agent can also increase binding of pUPF1 by increasing phosphorylation of UPF1 that is bound to or binds to the PTC-containing mRNA after administration of the agent. An agent can also increase binding of UPF1 and/or pUPF1 by inhibiting the dissociation of UPF1 from the PTC-containing mRNA or by inhibiting the 5’ to 3’ translocation of UPF1 along the 3’ UTR of the PTC-containing mRNA.

In any of the methods provided herein, the agent can be selected from the group consisting of an antisense nucleic acid, an siRNA, a morpholino, a locked nucleic acid (LNA), an miRNA, a peptide, a protein, an antibody, and a small molecule.

The agents, for example, an antisense nucleic acid, can specifically bind to the PTC- containing mRNA downstream of the PTC. Binding of the antisense nucleic acid

downstream of the PTC causes an increase in binding of UPF1, for example, an accumulation of UPF1 between the PTC and the nucleic acid binding site. As used throughout, the term “specifically binds” refers to a binding reaction where the agent preferentially binds to a particular target mRNA and does not bind in a significant amount to other mRNAs present in a cell. Examples of morpholinos that specifically bind to a PTC-containing SOX10 mRNA include, but are not limited to, a morpholino comprising SEQ ID NO: 1 (5’- gtccaactcagccacatcaaaggtc-3’) or SEQ ID NO: 2 (5’-ccatataggagaaggccgagtagag-3’). SEQ ID NO: 1 and SEQ ID NO: 2 target a nucleic acid sequence about 119 nucleotides and 510 nucleotides from the PTC, respectively. Examples of morpholinos that specifically bind to a PTC-containing myelin protein zero (MPZ) mRNA include, but are not limited to, a morpholino comprising SEQ ID NO: 5 (5’-ctaaccgctatttcttatcttgcg-3’). SEQ ID NO: 5 targets a nucleic acid sequence about 84 nucleotides from the PTC. Examples of LNAs that specifically bind to a PTC-containing SOX10 mRNA include, but are not limited to, SEQ ID NO: 3 (5’actcagccacatcaa-3’) or SEQ ID NO: 4 (5’-agaaggccgagtaga-3’). SEQ ID NO: 3 and SEQ ID NO: 4 target a nucleic acid sequence about 124 nucleotides and 511 nucleotides from the PTC, respectively. A non-limiting example of a LNA that specifically binds to a PTC- containing MPZ mRNA is an LNA comprising SEQ ID NO: 6 (5’-tttcttatccttgcg-3’). SEQ ID NO: 6 targets a nucleic acid sequence about 84 nucleotides from the PTC. Based on the available sequences for PTC-containing mRNAs that are resistant to NMD, and the location of the PTC in these mRNAs relative to the normal termination codon, one of skill in the art would know how to make other antisense nucleic acids that specifically bind a PTC- containing mRNA in order to effect an increase in UPF1 and/or pUPF1 binding, and subsequently NMD of the NMD-resistant mRNA. Other agents include, but are not limited to, inhibitors of phosphatase 2A.

Examples for targeting human β-globin thalassemic transcripts harboring a PTC at position 121 or 127 include, without limitation, HBB-1 LNA mixmer 5'- CATTAGCCACACCAG-3' (SEQ ID NO: 79) and HBB-2 LNA mixmer 5'- GTGATACTTGTGGGC-3' (SEQ ID NO: 80).

In the methods provided herein, the cell can be in vitro or in vivo, i.e., in a subject. As used throughout, by subject is meant an individual. Preferably, the subject is a mammal such as a primate, and, more preferably, a human. Non-human primates are subjects as well. The term subject includes domesticated animals, such as cats, dogs, etc., livestock (for example, cattle, horses, pigs, sheep, goats, etc.) and laboratory animals (for example, ferret, chinchilla, mouse, rabbit, rat, gerbil, guinea pig, etc.). Thus, veterinary uses and medical formulations are contemplated herein.

Also provided is a method of treating a disorder associated with expression of a PTC- containing mRNA that is resistant to NMD in a subject, comprising administering to the subject with a disorder associated with expression of a PTC-containing mRNA that is resistant to NMD an agent that increases binding of UPF1 and/or pUPF1 to the PTC- containing mRNA downstream of the PTC. In the methods provided herein, the disorder can be any disorder associated with expression of a PTC-containing mRNA that is resistant to NMD in a subject. These include, but are not limited to, the disorders set forth in Table 1. Table 1. PTC position and human disease phenotype

One or more agents provided herein can be in a pharmaceutically acceptable carrier. The term carrier means a compound, composition, substance, or structure that, when in combination with a compound or composition, aids or facilitates preparation, storage, administration, delivery, effectiveness, selectivity, or any other feature of the compound or composition for its intended use or purpose. For example, a carrier can be selected to minimize any degradation of the active ingredient and to minimize any adverse side effects in the subject. Such pharmaceutically acceptable carriers include sterile biocompatible pharmaceutical carriers, including, but not limited to, saline, buffered saline, artificial cerebral spinal fluid, dextrose, and water. Modes of administration of the compositions used in the invention are exemplified below. Any of the inhibitors described herein can be delivered by any of a variety of routes including: by injection (e.g., subcutaneous, intramuscular, intravenous, intra-arterial, intraperitoneal), by continuous intravenous infusion, cutaneously, dermally, transdermally, orally (e.g., tablet, pill, liquid medicine, edible film strip), by implanted osmotic pumps, by suppository, or by aerosol spray. Routes of administration include, but are not limited to, topical, intradermal, intrathecal, intralesional, intratumoral, intrabladder, intravaginal, intra- ocular, intrarectal, intrapulmonary, intracranial, intraventricular, intraspinal, dermal, subdermal, intra-articular, placement within cavities of the body, nasal inhalation, pulmonary inhalation, impression into skin, and electroporation.

In an example in which a nucleic acid is employed, such as, an antisense, a morpholino, an siRNA molecule, or a locked nucleic acid, the nucleic acid can be delivered intracellularly (for example by expression from a nucleic acid vector or by receptor-mediated mechanisms), or by an appropriate nucleic acid expression vector which is administered so that it becomes intracellular, for example by use of a retroviral vector (see U.S. Patent No. 4,980,286), or by direct injection, or by use of microparticle bombardment (such as a gene gun; Biolistic, Dupont), or coating with lipids or cell-surface receptors or transfecting agents, or by administering it in linkage to a homeobox-like peptide which is known to enter the nucleus (for example Joliot et al., Proc. Natl. Acad. Sci. USA 1991, 88:1864-8). Nucleic acid carriers also include, polyethylene glycol (PEG), PEG-liposomes, branched carriers composed of histidine and lysine (HK polymers), chitosan-thiamine pyrophosphate carriers, surfactants, nanochitosan carriers, and D5W solution. The present disclosure includes all forms of nucleic acid delivery, including synthetic oligos, naked DNA, plasmid and viral delivery, integrated into the genome or not. Nucleic acids can also be delivered

gymnotically. See for example, Soifer et al.“Silencing of gene expression by gymnotic delivery of antisense oligonucleotides,” Methods Mol. Biol. 815: 333-46 (2012), hereby incorporated in its entirety by this reference. As mentioned above, vector delivery can be via a viral system, such as a retroviral vector system which can package a recombinant retroviral genome (see e.g., Pastan et al., Proc. Natl. Acad. Sci. U.S.A. 85:4486, 1988; Miller et al., Mol. Cell. Biol.6:2895, 1986). The exact method of introducing the altered nucleic acid into mammalian cells is, of course, not limited to the use of retroviral vectors. Other techniques are widely available for this procedure including the use of adenoviral vectors (Mitani et al., Hum. Gene Ther. 5:941-948, 1994), adeno-associated viral (AAV) vectors (Goodman et al., Blood 84:1492-1500, 1994), lentiviral vectors (Naidini et al., Science 272:263-267, 1996), and pseudotyped retroviral vectors (Agrawal et al., Exper. Hematol. 24:738-747, 1996).

Physical transduction techniques can also be used, such as liposome delivery and receptor-mediated and other endocytosis mechanisms (see, for example, Schwartzenberger et al., Blood 87:472-478, 1996) to name a few examples. This invention can be used in conjunction with any of these or other commonly used gene transfer methods.

The effective amount of an agent can depend on the nature of the disease and can be determined by standard clinical techniques. Therefore, these amounts will vary. For example, the dosage can be anywhere from 0.01 mg/kg to 100 mg/kg. Multiple dosages can also be administered depending on the disease, and the subject’s condition. In addition, in vitro assays can be employed to identify optimal dosage ranges. The precise dose to be employed in the formulation will also depend on the route of administration, and the seriousness of the disease or disorder, and should be decided according to the judgment of the practitioner and each subject's circumstances. Effective doses can be extrapolated from dose- response curves derived from in vitro or animal model test systems.

The disclosure also provides a pharmaceutical pack or kit comprising one or more containers filled with one or more of the ingredients of the pharmaceutical compositions. Optionally associated with such container(s) can be a notice in the form prescribed by a governmental agency regulating the manufacture, use or sale of pharmaceuticals or biological products, which notice reflects approval by the agency of manufacture, use or sale for human administration. Instructions for use of the composition can also be included.

Depending on the intended mode of administration, the pharmaceutical composition can be in the form of solid, semi-solid, or liquid dosage forms, such as, for example, tablets, suppositories, pills, capsules, powders, liquids, aerosols, or suspensions, preferably in unit dosage form suitable for single administration of a precise dosage. The compositions will include a therapeutically effective amount of the compound described herein or derivatives thereof in combination with a pharmaceutically acceptable carrier and, in addition, can include other medicinal agents, pharmaceutical agents, carriers, or diluents. By

pharmaceutically acceptable is meant a material that is not biologically or otherwise undesirable, which can be administered to an individual along with the selected compound without causing unacceptable biological effects or interacting in a deleterious manner with the other components of the pharmaceutical composition in which it is contained.

As used herein, the term carrier encompasses any excipient, diluent, filler, salt, buffer, stabilizer, solubilizer, lipid, or other material well known in the art for use in pharmaceutical formulations. The choice of a carrier for use in a composition will depend upon the intended route of administration for the composition. The preparation of pharmaceutically acceptable carriers and formulations containing these materials is described in, e.g., Remington: The Science and Practice of Pharmacy 22d edition Loyd V. Allen et al., editors, Pharmaceutical Press (2012). Examples of physiologically acceptable carriers include buffers such as phosphate buffers, citrate buffer, and buffers with other organic acids; antioxidants including ascorbic acid; low molecular weight (less than about 10 residues) polypeptides; proteins, such as serum albumin, gelatin, or immunoglobulins; hydrophilic polymers such as

polyvinylpyrrolidone; amino acids such as glycine, glutamine, asparagine, arginine or lysine; monosaccharides, disaccharides, and other carbohydrates including glucose, mannose, or dextrins; chelating agents such as EDTA; sugar alcohols such as mannitol or sorbitol; salt- forming counterions such as sodium; and/or nonionic surfactants such as TWEEN® (ICI, Inc.; Bridgewater, New Jersey), polyethylene glycol (PEG), and PLURONICSTM (BASF; Florham Park, NJ).

Compositions containing one or more of the compounds described herein or pharmaceutically acceptable salts or prodrugs thereof suitable for parenteral injection can comprise physiologically acceptable sterile aqueous or nonaqueous solutions, dispersions, suspensions or emulsions, and sterile powders for reconstitution into sterile injectable solutions or dispersions. Examples of suitable aqueous and nonaqueous carriers, diluents, solvents or vehicles include water, ethanol, polyols (propyleneglycol, polyethyleneglycol, glycerol, and the like), suitable mixtures thereof, vegetable oils (such as olive oil) and injectable organic esters such as ethyl oleate. Proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersions and by the use of surfactants.

These compositions can also contain adjuvants such as preserving, wetting, emulsifying, and dispensing agents. Prevention of the action of microorganisms can be promoted by various antibacterial and antifungal agents, for example, parabens,

chlorobutanol, phenol, sorbic acid, and the like. Isotonic agents, for example, sugars, sodium chloride, and the like can also be included. Prolonged absorption of the injectable pharmaceutical form can be brought about by the use of agents delaying absorption, for example, aluminum monostearate and gelatin.

Solid dosage forms for oral administration of the compounds described herein or pharmaceutically acceptable salts or prodrugs thereof include capsules, tablets, pills, powders, and granules. In such solid dosage forms, the compounds described herein or derivatives thereof is admixed with at least one inert customary excipient (or carrier) such as sodium citrate or dicalcium phosphate or (a) fillers or extenders, as for example, starches, lactose, sucrose, glucose, mannitol, and silicic acid, (b) binders, as for example,

carboxymethylcellulose, alignates, gelatin, polyvinylpyrrolidone, sucrose, and acacia, (c) humectants, as for example, glycerol, (d) disintegrating agents, as for example, agar-agar, calcium carbonate, potato or tapioca starch, alginic acid, certain complex silicates, and sodium carbonate, (e) solution retarders, as for example, paraffin, (f) absorption accelerators, as for example, quaternary ammonium compounds, (g) wetting agents, as for example, cetyl alcohol, and glycerol monostearate, (h) adsorbents, as for example, kaolin and bentonite, and (i) lubricants, as for example, talc, calcium stearate, magnesium stearate, solid polyethylene glycols, sodium lauryl sulfate, or mixtures thereof. In the case of capsules, tablets, and pills, the dosage forms can also comprise buffering agents.

Solid compositions of a similar type can also be employed as fillers in soft and hard- filled gelatin capsules using such excipients as lactose or milk sugar as well as high molecular weight polyethyleneglycols, and the like.

Solid dosage forms such as tablets, dragees, capsules, pills, and granules can be prepared with coatings and shells, such as enteric coatings and others known in the art. They can contain opacifying agents and can also be of such composition that they release the active compound or compounds in a certain part of the intestinal tract in a delayed manner.

Examples of embedding compositions that can be used are polymeric substances and waxes. The active compounds can also be in micro-encapsulated form, if appropriate, with one or more of the above-mentioned excipients.

Liquid dosage forms for oral administration of the compounds described herein or pharmaceutically acceptable salts or prodrugs thereof include pharmaceutically acceptable emulsions, solutions, suspensions, syrups, and elixirs. In addition to the active compounds, the liquid dosage forms can contain inert diluents commonly used in the art, such as water or other solvents, solubilizing agents, and emulsifiers, as for example, ethyl alcohol, isopropyl alcohol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propyleneglycol, 1,3- butyleneglycol, dimethylformamide, oils, in particular, cottonseed oil, groundnut oil, corn germ oil, olive oil, castor oil, sesame oil, glycerol, tetrahydrofurfuryl alcohol,

polyethyleneglycols, and fatty acid esters of sorbitan, or mixtures of these substances, and the like.

Besides such inert diluents, the composition can also include additional agents, such as wetting, emulsifying, suspending, sweetening, flavoring, or perfuming agents. Suspensions, in addition to the active compounds, can contain additional agents, as for example, ethoxylated isostearyl alcohols, polyoxyethylene sorbitol and sorbitan esters, microcrystalline cellulose, aluminum metahydroxide, bentonite, agar-agar and tragacanth, or mixtures of these substances, and the like.

As used throughout, treat, treating, and treatment refer to a method of reducing or delaying one or more effects or symptoms of a disease or disorder, for example, a disease or disorder associated with PTC-containing mRNAs that are resistant to NMD. The subject can be diagnosed with a disease or disorder. Treatment can also refer to a method of reducing the underlying pathology rather than just the symptoms. The effect of the administration to the subject can have the effect of, but is not limited to, reducing one or more symptoms of the disease or disorder, a reduction in the severity of the disease or disorder, the complete ablation of the disease or disorder, or a delay in the onset or worsening of one or more symptoms. For example, a disclosed method is considered to be a treatment if there is about a 10% reduction in one or more symptoms of the disease in a subject when compared to the subject prior to treatment or when compared to a control subject or control value. Thus, the reduction can be about a 10, 20, 30, 40, 50, 60, 70, 80, 90, 100%, or any amount of reduction in between.

Further provided is a method of identifying an agent that increases NMD of a PTC- containing mRNA comprising: contacting a cell that expresses the PTC-containing mRNA with an agent to be tested; and determining the level of pUPF1 binding in the 3’ UTR of the (PTC)-containing mRNA, wherein an increase in pUPF1 binding indicates that the tested agent is an agent that increases NMD. In the methods of identifying an agent that increases NMD of a PTC-containing mRNA, the PTC-containing mRNA can be an mRNA that is resistant to NMD, for example, and not to be limiting, a PTC-containing mRNA associated with a disease or disorder listed in Table 1. The method can further comprise determining the level of NMD after administration of the agent, wherein an increase in NMD indicates that the agent is an agent that increases NMD.

Methods of determining the level of binding of pUPF1 are known in the art. For example, and not to be limiting, after contacting the cell with a test agent, an antibody specific for pUPF1 can be used to isolate transcripts associated with pUPF1 from cell lysates, in order to determine if an increase in pUPF1 binding occurs (see Examples). Other methods include, but are not limited to, immunoprecipitation, immunofluorescence,

immunohistochemistry, etc. as well as any other method now known or later developed for quantitating protein in or produced by a cell. The level of NMD after administration of the agent can be determined by detecting the amount of the PTC-containing mRNA in the cell after administration of the agent. A decrease in the amount of PTC-containing mRNA is indicative of an increased in NMD. The amount of PTC-containing mRNA can be determined by methods standard in the art for quantitating nucleic acid in a cell, such as in situ hybridization, quantitative PCR, RT-PCR, Taqman assay, Northern blotting, etc., as well as any other method now known or later developed for quantitating the amount of a nucleic acid in a cell.

Disclosed are materials, compositions, and components that can be used for, can be used in conjunction with, can be used in preparation for, or are products of the disclosed methods and compositions. These and other materials are disclosed herein, and it is understood that when combinations, subsets, interactions, groups, etc. of these materials are disclosed that while specific reference of each various individual and collective combinations and permutations of these compounds may not be explicitly disclosed, each is specifically contemplated and described herein. For example, if a method is disclosed and discussed and a number of modifications that can be made to a number of molecules including in the method are discussed, each and every combination and permutation of the method, and the modifications that are possible are specifically contemplated unless specifically indicated to the contrary. Likewise, any subset or combination of these is also specifically contemplated and disclosed. This concept applies to all aspects of this disclosure including, but not limited to, steps in methods using the disclosed compositions. Thus, if there are a variety of additional steps that can be performed, it is understood that each of these additional steps can be performed with any specific method steps or combination of method steps of the disclosed methods, and that each such combination or subset of combinations is specifically contemplated and should be considered disclosed. EXAMPLE I METHODS

Cell transfections and lysis

Human embryonic kidney (HEK) 293T cells or HeLa cells stably expressing IRE-Gl Ter mRNA were propagated in Dulbecco’s Modified Eagle’s Medium (DMEM)

supplemented with 10% fetal bovine serum (See Kurosaki and Maquat“Rules that govern UPF1 binding to mRNA 3’UTRs,” PNAS USA 110: 3357-3362 (2013)). DMEM for HeLa- cell growth additionally contained 100 μM hemin (Sigma, St. Louis, MO) or deferoxamine mesylate (Sigma) as described before. When specified, cells were treated with 100 nM wortmanin (Caymen Chemicals, Ann Arbor, MI) or 200 nM okadaic acid (Sigma), or transiently transfected with 20-30 nM siRNA (Dharmacon, Lafayette, CO; Table 2) using Lipofectamine RNAiMAX (Life Technologies, Grand Island, NY) and/or plasmid DNAs using Lipofectamine 2000 (Life Technologies). Cell lysates were prepared using hypotonic gentle lysis buffer (10 mM Tris (pH 7.4), 10 mM NaCl, 10 mM EDTA, 0.5% w/w TRITON X-100) with protease inhibitor cocktail (Roche, Basel, Switzerland). Protein was analyzed after the addition of NaCl to 150 mM, and RNA was extracted and purified using TRizol Reagent (Life Technologies).

Table 2 List of siRNA target sequences used in the specified figures

p-UPF1-bound RNA IP (RIP) and fragmentation for cDNA library construction

HEK293T cells (24 x 10⁷/3 x 150-mm dishes) were incubated in 200 nM okadaic acid for three hours. Cellular RNAs bound by p-UPF1 were immunoprecipitated using anti-p- UPF1(S1116) (Millipore, Darmstadt, Germany); anti-phospho-Upf1(Ser1127)) and

Dynabeads protein A magnetic beads (Life Technologies). The RNA in bead-bound RNA−p- UPF1(S1116) complexes was digested to primarily < 100 nts by incubation for 30 min at 4°C with RNase I (1U/µl; Life Technologies); for RNA size estimations after RNase I digestion, ~200 ng of RNA were radio-labeled using γ³²P-ATP (Perkin Elmer, Waltham, MA) and T4 polynucleotide kinase (New England Biolabs, Ipswich, MA) and subsequently visualized using a Typhoon 9410 Variable Mode Imager (GE Healthcare, Little Chafont,

Buckinghamshire, UK) after electrophoresis in 6M urea−15% polyacrylamide. After extensive washing, bound complexes were eluted using IP elution buffer (See Kurosaki and Maquat (2013)), and RNA fragments were purified using TRIzol Reagent and then separated in 6M urea−15% polyacrylamide in parallel with a DynaMarker Prestain Marker for Small RNA (BioDynamics Laboratory, Hackensack, NJ). Small-range RNAs (~25-40 nts) were excised from 6M urea−15% polyacrylamide and agitated overnight at 25°C in RNA extraction buffer (20 mM Tris, 300mM sodium acetate, 2 mM EDTA, 0.2 % v/v SDS). RNAs were eluted from 6M urea−15% polyacrylamide gel using a Coaster Spin-X column

(Corning, Corning, NY) and further purified using TRIzol Reagent followed by ethanol precipitation. In parallel, control IPs using rabbit IgG were performed. Additionally, samples were prepared without IP.

cDNA library construction for RIP-Seq

Purified 25-40-nt RNA fragments were treated with recombinant shrimp alkaline phosphatase (New England Biolabs) to remove 3'-phosphates and subsequently

phosphorylated at 5'-hydroxyl groups using T4 polynucleotide kinase (New England

Biolabs). Phosphorylated RNA fragments were purified with RNeasy Mini Columns (Qiagen, Hilden, Germany). A 3'-adenylated adapter was ligated to the phosphorylated RNA fragments using truncated T4 RNA ligase (New England Biolabs). An RT primer was annealed to the adapted RNAs to prevent adapter self-ligation, followed by 5' RNA adapter ligation using T4 RNA ligase (New England Biolabs). After RT of adapter-ligated RNAs, cDNAs were amplified using 15 PCR cycles. Amplified cDNAs were purified in 8% polyacrylamide, and the quality and quantity of cDNAs were assessed using an Agilent Bioanalyzer and qPCR. cDNAs were then sequenced using the Illumina HiSeq 2500 platform.

Computational analysis of RIP-Seq data

The 3'-adapter sequence was first removed, and reads with a length of <15 nts were discarded. Reads were mapped to the human genome (hg19) using Bowtie2 (local mode). Reads with a mapping quality score (MAPQ) of≥10 were selected for further analysis.

mRNA abundance was measured using reads per kilobase per million reads (RPKM) based on exonic regions of RefSeq sequences. The 3'-ends of genes in HEK293 cells were defined using the 3'READS method (See Hoque et al.“Analysis of alternative cleavage and polyadenylation by 3’ region extraction and deep sequencing,” Nat. Methods 10: 133-139 (2013)).

Plasmids constructions

pCMV-MYC-UPF1(C126S) was generated by site-directed mutagenesis of pmCMV- MYC-UPF1(WT) using the primer 5'-ACGCCTGCAGTTACTCTGGAATACACGATCC-3' (SEQ ID NO: 20) (sense, where underlined nucleotides are mutagenic) and a complementary antisense primer. The resulting blunt-ended PCR fragment was then circularized by ligation. To construct pCMV-MYC-UPF1(4SA), pSR-HA-UPF1 (4SA) was PCR-amplified using the primer pair 5'-AATCGACGAAAGCACCCAGGCCACC-3' (sense) (SEQ ID NO: 21) and 5’-GATAGCGGCCGCTTAATACTGGGCC-3' (antisense) (SEQ ID NO: 22), where underlined nucleotides specify a NotІ site) (See Kashima et al.“Binding of a novel SMG-1- Upf1-eRF1-eRF3 complex (SURF) to the exon junction complex triggers Upf1

phosphorylation and nonsense-mediated mRNA decay,” Genes Dev. 20, 355–367 (2006)). The resulting PCR fragment was digested using BstXІ and NotІ, and the generated 0.9-kbp fragment was purified from an agarose gel and inserted into the BstXІ and NotІ sites of pCMV-MYC-UPF1(WT).

To construct pCMV-MYC-UPF1 (dNT), pCMV-MYC-UPF1 was amplified using the primer pair 5'-GGAATTCTGGCGGGCGCGGGCGCTGCGGCG-3' (sense, where underlined nucleotides specify a EcoRІ site) (SEQ ID NO: 23) and 5'- AAGGCCCGGTACCGCTTCTC-3' (antisense, where underlined nucleotides specify a KpnІ site) (SEQ ID NO: 24). The resulting PCR fragment was digested using EcoRІ and KpnІ, and inserted into the EcoRІ and KpnІ sites of pCMV-MYC-UPF1(WT).

To generate pCMV-MYC-UPF1 (R843C), pCI-neo-hUPF1 (R843C) was digested using BsaBІ and BclІ. The resulting 536-bp fragment was inserted into the BsaBІ and BclІ sites of pCMV-MYC-UPF1(WT) (See Sun et al.“A mutated human homologue to yeast Upf1 protein has a dominant-negative effect on the decay of nonsense-containing mRNAs in mammalian cells,” Proc. Natl. Acad. Sci. U. S. A. 95:10009–10014 (1998)).

To construct pCMV-MYC-UPF1(S1089A) or pcMV-MYC-UPF1(S1116A), pCMV- MYC-UPF1(WT) was mutagenized using, respectively, the primer pair 5'- GGTGACGAGTTTAAAGCACAAATCGACGTGG-3' (sense; where underlined nucleotides are mutagenic) (SEQ ID NO: 25) and the corresponding antisense primer or the primer pair 5'-GTGACGGGGCTGGCCCAGTATTAAAAG-3' (sense; where underlined nucleotides are mutagenic) (SEQ ID NO: 26) and the corresponding antisense primer. To generate pcDNA3-Gl(∆ intron 2)-MS2bs, 5'- GTGGATCCTGAGAACTTCAGGCTCCTGGGCAACGTGCTGGTCTGTGTGCTGGCCC ATCACTTTGGCAAAGAATTCA-3' (SEQ ID NO: 27), where underlined nucleotides denote a BamHІ or EcoRІ site, was annealed to a complementary DNA oligonucleotide. The annealed product was cleaved with BamHІ and EcoRІ and inserted into the BamHІ and EcoRІ sites of pcDNA3-Gl-MS2bs (See Lykke-Andersen et al.“Human Upf proteins target an mRNA for nonsense-mediated decay when bound downstream of a termination codon,” Cell 103:1121–1131 (2000)).

To generate pcDNA3-Gl and pcDNA3-Gl(∆ intron 2), pcDNA3-Gl-MS2bs and pcDNA3-Gl(∆ intron 2)-MS2bs were digested using NotІ and XbaІ to remove the MS2bs sequence. The ends of the resulting 6.8-kbp fragments were made blunt using Klenow fragment (New England Biolabs) and circularized by ligation.

To construct pcDNA3-HA-SMG5, pEYFP-C1-SMG5 was PCR-amplified using the primer pair 5'-ATATCTCGAGATGAGCCAAGGCCCCC-3' (sense) (SEQ ID NO: 28) and 5'-GCGCTCGAGTTATCAACCAATTTCCTTCCACTGCTT-3' (antisense) (SEQ ID NO: 29), where underlined nucleotides specify a XhoІ site (See Unterholzner et al. SMG7 acts as a molecular link between mRNA surveillance and mRNA decay. Mol. Cell 16: 587–596 (2004). The resulting 3-kbp PCR fragment was inserted into the XhoІ site of pcDNA3-HA.

To construct pcDNA3-HA-SMG7, pEYFP-N1-SMG7 was digested with XhoІ and SmaІ. The resulting 3.4-kbp fragment was inserted into the XhoІ and ApaІ sites of pcDNA3- HA, where ApaІ was made blunt using T4 DNA polymerase (New England Biolabs) prior to insertion (See Unterholzner et al.).

To generate pPET30b-hUPF1(295-914)-Srt, which encodes UPF1 residues 295-914 followed by two glycine residues upstream of the sortase recognition site (Leu-Pro-Glu-Thr- Gly) followed by a flexible linker (Gly-Gly-Gly-Ser) and finally by the vector-derived hexahistidine tag, human UPF1 residues 295-914 (hUPF1 295-914-Srt) in sortase-ready form was PCR-amplified using the primer pair: 5'-CGATCG CATATG CGG TAC GAG GAC GCC TAC C-3' (SEQ ID NO: 30) and 5'- CAATGCCTCGAGGCTGCCTCCTCCTGTCTCTGGTAATCCTCCGCTGAACTGCATG AGGCTCTCAC-3' (SEQ ID NO: 31), where the underlined nucleotides denote and NdeI and XbaI restriction site, respectively. Both the PCR fragment and pET30b+ were digested using NdeI and XbaI, and the resulting PCR product was inserted into pET30b+, the ends of which had been dephosphorylated using Antarctic phosphatase (New England Biolabs). The integrity of all constructs was validated using DNA sequencing Immunoprecipitations

Samples were generated before and after IP in the presence or absence of RNase A as reported in Kurosaki and Maquat (2013). IPs utilized antibodies that are described under western blotting. DNA oligo-directed RNase H cleavage experiments were performed by using specific DNA oligonucleotides (Oligo 1 is 5'-AAGGGTAGACCAC-3' (SEQ ID NO: 32); Oligo 2 is 5'-TTGAGGTTGTCCAG-3' (SEQ ID NO: 33); Oligo 3 is 5'- TGCCAAAGTGATG -3'(SEQ ID NO: 34) as described in Kurosaki and Maquat (2013). Western blotting

Proteins were electrophoresed in 6-14% polyacrylamide and transferred to either a nitrocellulose (GE Healthcare) or polyvinylidene difluoride (Millipore) membrane. Blots were probed using anti-UPF1 (1:2000), anti-MYC (1:1000; Calbiochem, Darmstadt,

Germany), anti-p(S/T)Q (1:500; Cell Signaling, Beverly, MA), anti-p-UPF1 S1116 (1:1000; Millipore), anti-p-UPF1 S1089 (1:1000; Millipore anti-phospho-Upf1(Ser1100)), anti-p- UPF1 S1078, S1096 (1:250; clone 7H1), anti-calnexin (1:2000; Enzo Life Sciences,

Farmingdale, NY), anti-UPF2 (1:200; Santa Cruz Biotechnology, Dallas, Texas), anti-UPF3X (1:1000), anti-CBP20 (1:200; Santa Cruz Biotechnology), anti-eIF4A3 (1:1000; Bethyl Laboratories, Montgomery, Texas), anti-MLN51 (1:1000; Bethyl Laboratories), anti-Magoh (1:200; Santa Cruz Biotechnology), anti-eRF3 (1:1000; Sigma), anti-β-actin (1:1000; Sigma), anti-ferritin heavy chain (1:1000: Abcam, Cambridge, MA), anti-HA (1:1000; Roche

Diagnostics), anti-GAPDH (1:200; Santa Cruz Biotechnology), anti-vimentin (1:200; Santa Cruz Biotechnology), anti-CBP80 (1:1000; Bethyl Laboratories), anti-eIF4E (1:200; Santa Cruz Biotechnology), anti-PABPC1 (1:200; Santa Cruz Biotechnology), anti-PP2Ac (1:1000; Bethyl Laboratories), anti-SMG5 (1:1000; Abcam), anti-SMG6 (1:1000; Abcam), anti-SMG7 (1:1000; Bethyl Laboratories), or anti-SMG1 (1:1000; Cell Signaling).

RT−PCR

RT−PCR was performed essentially as described in Kurosaki and Maquat (2013). Briefly, total-cell cDNA before or after oligo-directed RNase H-mediated RNP cleavage was synthesized using SuperScript III reverse transcriptase (Invitrogen, Carlsbad, CA) and either random hexamers or an mRNA-specific primer (Table 3). RT−PCR products were electrophoresed in 6% polyacrylamide and quantitated using a Typhoon 9410 Variable Mode Imager. Table 3 List of RT, PCT or PCR rimers used in the s ecified fi ures

RT−qPCR

RT-coupled to real-time (q)PCR was undertaken essentially as specified in Table 3 using the 7500 Fast Real-Time PCR System (Applied Biosystems, Grand, Island, NY) and Fast SYBR Green Master Mix (Applied Biosystems).

5'RACE

5'RACE was performed using 5'RACE System for Rapid Amplification of cDNA Ends (Invitrogen) and the specified RT and PCR primers (Table 3).

Mass spectrometry

HEK 293T cells (8 x 10⁷/150-mm dish) that had been transiently transfected with 23 nM of SMG5 siRNA were collected and lysed using hypotonic gentle lysis buffer with complete mini protease inhibitor cocktail (Roche) and PhosSTOP phosphatase inhibitor cocktail (Roche). Cellular UPF1 was immunoprecipitated using anti-UPF1 in the presence of RNase A (Sigma) as reported in Gong et al.“SMD and NMD are competitive pathways that contribute to myogenesis: effects on PAX3 and myogenin mRNAs,” Genes Dev. 23: 54–66 (2009). Purified UPF1 was isolated in 6% SDS-polyacrylamide and subjected in-gel trypsin digestion. Prior to tandem mass spectrometry, phosphopeptides were passed over an immobilized iron-based affinity column (PROS MC 20μm column; Applied Biosystems) to increase the recovery of p-UPF1 peptides. Enriched phospho-peptides were analyzed using an Orbitrap Elite Hybrid Ion Trap-Orbitap Mass Spectrometer with Dionex Ultimate 3000 Rapid Separation LC systems (Thermo Fisher Scientific, Watltham, MA) at the Whitehead Institute Proteomics Core Facility (http://jura.wi.mit.edu/massspec/home.html). Scaffold (version Scaffold_4.2.1, Proteome Software Inc.) was used to validate MS/MS-based peptide identifications.

In vitro UPF1 helicase and ATPase activity assays

E. coli-produced human UPF1(115-915) variants were generated and purified as described in Park et al.“Staufen2 functions in Staufen1-mediated mRNA decay by binding to itself and its paralog and promoting UPF1 helicase but not ATPase activity,” Proc. Natl. Acad. Sci. U. S. A. 110: 405–412 (2013). Also as described in Park et al., a 44-nt RNA was in vitro-transcribed using T7 polymerase and MEGAscript (Ambion, Grand Island, NY), and an 18-nt DNA was labeled at its 5'-end using γ[³²P] and T4 polynucleotide kinase (New England Biolabs). Each was gel-purified, annealed in DNA−RNA duplex forming buffer (10 mM 2-(N-morpholino)ethanesulfonic acid (MES) (pH 5.0), 50 mM potassium acetate and 0.1 mM EDTA) by first incubating for 3 min at 95 ºC and subsequently gradually cooling over a period of 1 hr to 37 ºC. UPF1 helicase assays were performed using 25-75 ng of UPF1(115- 915) in 20 μl of helicase reaction mixture (50 mM MES (pH 6.0), 50 mM potassium acetate, 5 mM magnesium acetate, 0.5 mM dithiothreitol, 2 mM ATP, 0.25 nM γ³²P-labeled

DNA−RNA duplex, 100 μM unlabeled 18 nt-DNA, 10 units of RNase OUT RNase inhibitor (Invitrogen) and 0.1 mg/ml BSA. After incubating for 30 min at 37 ºC, the reaction was terminated by adding 40 μl of helicase stop buffer (300 mM sodium acetate, 25 mM EDTA, 10% v/v Ficoll-400, 10% v/v glycerol, 0.5% w/v SDS, 0.05% w/v bromophenol blue and 0.05% xylene cyanol). Samples were electrophoresed in 16% polyacrylamide.

ATPase assays were performed using 75 ng of a UPF1(115-915) derivative in 20 μl of ATPase buffer (50 mM MES, 50 mM potassium acetate, 5 mM magnesium acetate, 0.5 mM DTT) with 0.2 μg/μl poly (rU) (Midland Certified Reagent Co., Midland, Texas), 100 μM ATP and 1 μCi of γ³²P-ATP (Perkin Elmer). The reaction mixture was incubated for 1 hr at 37 ºC, and then quenched by adding 400 μl of ATPase stop buffer (10% w/w acid-washed charcoal (Sigma) in 10 mM EDTA) and incubating for 1 hr at 4 ºC. The charcoal was removed by centrifuging for 10 min at 15,000 x g, and radioactivity in 100 μl of the resulting supernatant was quantitated using liquid scintillation (Beckman LS6000SC, Brea, CA).

Protein production, solid-phase peptide synthesis, and GGGC(Cy5) sortase-compatible probe construction

Pentamutant sortase (SrtA 5o) was produced as described in Popp et al.“Sortagging: a versatile method for protein labeling,” Nat Chem Biol. 3:-708 (2007). BL21CodonPlus competent cells (Agilent) were transformed with hUPF1(295-914)-Srt, grown in 2X YPD medium to an OD₆₀₀ of 0.6, and induced for 3 h at 30^oC with 500 µM IPTG (Sigma). Cells were harvested and lysed by sonication in lysis buffer (20mM Tris pH7.5, 1mM MgCl₂, 1 µM ZnCl₂, 20 mM Imidazole, 300 mM NaCl, 1 mM DTT, 10% glycerol), purified using Ni-NTA chromatography (Qiagen) as described in Popp et al., and further purified using a Superdex 75 Prep Grade column (GE Healthcare) equilibrated in elution buffer (20mM Tris pH7.5, 1mM MgCl₂, 2µM ZnCl₂, 200 mM NaCl, 2 mM DTT).

The Gly-Gly-Gly-Cys-NH₂ peptide was synthesized manually on Rink-Amide resin (Novabiochem, Darmstadt, Germany) using standard solid-phase peptide synthesis protocols. Cy5-maleimide (Lumiprobe, Hallandale Beach, FL) was coupled to the liberated and deprotected peptide in solution. Three equivalents of liberated peptide were incubated with one equivalent of reactive dye in 250 µL of phosphate buffered saline (PBS) overnight at room temperature with agitation. Two equivalents of DTT were then added to quench any unreacted probe, the crude reaction was diluted into H₂O/0.1% Trifluoroacetic acid (TFA), and the GGGC(Cy5) conjugate was separated from free peptide with a syringe-driven Bond Elut JR C18 Cartridge (Agilent, Santa Clara, CA) using a step gradient of 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 100% acetonitrile in H₂O/0.1% TFA.

Sortase labeling of hUPF1(295-914)-Srt

hUPF1(295-914)-Srt was site-specifically labeled with the purified GGGC(Cy5) probe by incubating 75 µM hUPF1(295-914)-Srt with 12 µM SrtA 5^o and 500 µM

GGGC(Cy5) probe in sortase reaction buffer (50 mM Tris pH 8.0, 300 mM NaCl, 10 mM CaCl₂) for 2 h at 25^oC. Labeled hUPF1(295-914)-Srt was then purified from SrtA5^o and free probe using a Superdex S75 column (GE Healthcare) equilibrated in elution buffer (20mM Tris pH7.5, 1mM MgCl₂, 2 µM ZnCl₂, 200 mM NaCl, 2 mM DTT).

Förster resonance energy transfer measurements and data analyses

Aminoallyl-uridine at position 29 of the 50-nucleotide RNA 5'- CAAAACAAAACAAAACAACAAUAGCUAC/aminoallyl

U/GCAGACUCUCUCUCUCUCGUC-3' (SEQ ID NO: 76) (IDT) was derivatized with Cy3- NHS ester (Click Chemistry Tools, Scottsdale, AZ) according to standard procedures. Cy3- labeled RNA (250 nM) was incubated with hUPF1(295-914)-Cy5 (250 nM) for 5 minutes at room temperature in the buffer containing 50 mM Hepes•KOH, pH 7.5, 50 mM KCl, 1 mM MgCl₂, 2 µM ZnCl₂ and 6 mM β-mercaptoethanol. Then ATP, ADP, ADPNP or ADP•BeF₂ was added to a final concentration of 2 mM. Following a 15-min incubation at room temperature, fluorescence measurements were taken using a Fluoromax -4 fluorescence spectrophotometer (Horiba Int. Corp., Kyoto, JP). A sample volume of 30 μl was used to overfill the clear window of the 10 µl cuvette (Starna Cells, Atascadero, CA). Two emission spectra were taken for each sample by exciting fluorescence at 540 nm (emission from 555 to 800 nm) and 635 nm (emission from 650 to 800 nm). The slit width for both excitation and emission monochromators was set to a 5 nm spectral bandwidth. All experiments were repeated at least three times. Changes in FRET efficiency (E) normalized by FRET observed in the absence of nucleotides (ΔE/E_{no nucl.} = (E_+nucl.– E_{no nucl.})/E_{no nucl}) were calculated using the ratioA method described in Hickerson set al.“Measurement of internal movements within the 30 S ribosomal subunit using Förster resonance energy transfer,” J. Mol. Biol. 354: 459–472 (2005); and Majumdar et al.“Measurements of internal distance changes of the 30S ribosome using FRET with multiple donor-acceptor pairs: quantitative spectroscopic methods,” J. Mol. Biol. 351: 1123–1145 (2005). RatioA was calculated from the ratio of the extracted integrated intensity of the acceptor (Cy5) fluorescence, which is excited both directly (by 540 nm light) and by energy transfer, divided by the integrated intensity of the acceptor excited directly by 635 nm light. ΔE/E_{no nucl.} was determined according to the equation: ΔE/E_{no nucl.} = (ratioA_+nucl.– ratioA_{no nucl} )/(ratioA_{no nucl.}– ε_Cy5(540)/ ε_Cy5(635) where ε_Cy5(540) and ε_Cy5(635) are Cy5 extinction coefficients at 540 and 635 nm, respectively. Stop-flow fast-mixing reagents and methodology

A 76-nucleotide RNA (5'- GGGAGUGAAACGAUGUUCUACGUAAAAGAACGCCAACAACAACAACAACAAC AAGGUUUUUCUUCUGAAGAUAAAG-3') (SEQ ID NO: 77) was synthesized in vitro using run-off transcription of a 96-nucleotide DNA template (5'- CTTTATCTTCAGAAGAAAAACCTTGTTGTTGTTGTTGTTGTTGGCGTTCTTTTACG TAGAACATCGTTTCACTCCCTATAGTGAGTCGTATTAGAA-3' (SEQ ID NO: 78) (IDT) and T7 polymerase and, subsequently, labeled with the Cy3 at its 5'- or 3'-end. Briefly, the 5' phosphate was reacted with 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride and imidazole, then treated with cystamine, and reduced using tris(2- carboxyethyl)phosphine. The released 5'-sulfhydryl group was then reacted with a maleimide derivative of Cy3 (Click Chemistry Tools). The 3'-end was labeled using RNA ligase I (New England Biolabs) and pCp-Cy3 (Jena Bioscience). The kinetics of UPF1 translocation and/or dissociation were measured using stopped flow fast-mixing experiments (Fischer and

Lohman 2004). Cy3-labeled RNA (100 nM) was incubated with UPF1(295-914)-Cy5 (100 nM) for 5 minutes at room temperature in 50 mM Hepes-KOH, pH 7.5, 50 mM KCl, 1 mM MgCl2, 2 μM ZnCl2 and 6 mM β-mercaptoethanol. UPF1-RNA complexes were mixed with ATP using a stopped-flow fluorometer (Applied Photophysics). Final concentrations after mixing were: 50 nM UPF1, 50 nM RNA and 1 mM ATP. Cy3 fluorescence was excited at 545 nm, and fluorescence emission of Cy5 was detected using a 645 nm long-pass filter. All stopped-flow experiments were done at 23 ^oC, and monochromator slits were adjusted to 9.3 nm. No significant decrease in Cy5 fluorescence was observed in the absence of ATP (i.e. upon mixing of UPF1-RNA with buffer only).

RESULTS

Anti p-UPF1(S1116) as an assay for p-UPF1 function during NMD

First, anti p-UPF1(S1116) is highly specific (Fig. 1A), having been affinity-purified using a phosphorylated S1116-containing peptide as immunogen. Anti-p-UPF1(S1116) recognizes phosphorylated S1116 but fails to bind to the same peptide lacking phosphorylated S1116. Second, changing S1116 to A1116 (Fig. 1B) inhibits NMD as determined by comparing the levels of β-globin (Gl) Norm mRNA, which is free of a premature termination codon (PTC), and Gl Ter mRNA, which contains a PTC that triggers NMD (Fig. 1C) or glutathione peroxidase 1 (GPx1) Norm and Ter mRNAs (Fig. 1D). Third, liquid chromatography tandem mass spectrometry revealed that S1116 is indeed

phosphorylated in HEK293T cells (Fig. 1E). Fourth, UPF1 phosphorylation at S1116 is inhibited by either wortmanin, which inhibits PIKs that include SMG1, or SMG1 siRNA (Fig. 1F,G). Fifth, treatments that increase or decrease S1116 phosphorylation also, respectively, increase or decrease S1096 phosphorylation (Fig. 1F,G), the latter of which influences the efficiency of NMD. Sixth, phosphorylated S1116 constitutes the site of SMG5−SMG7 binding. Seven, UPF1 phosphorylation at S1116 is augmented by either okadaic acid, which is a potent inhibitor of serine/threonine phosphatases that include protein phosphatase 2A (PP2A) and results in an accumulation of cellular p-UPF1, or SMG5 siRNA (Fig. 1F,G).

p-UPF1, unlike UPF1, marks cellular NMD targets

Steady-state, i.e. largely hypophosphorylated UPF1 binding to cellular transcripts cannot be used as an identifier of NMD targets. Steady-state UPF1 may manifest a sufficient degree of nonspecific binding to RNA to partially mask regulated UPF1 binding to NMD targets (see below). Additionally, the ability of ribosomes to remove UPF1 from mRNA 5'UTRs and coding regions leaves 3'UTRs as the primary sites of UPF1 binding , but 3'UTR length cannot be reliably used to identify NMD targets because other hallmarks, such as the presence of a 3'UTR EJC, must be considered.

Since NMD involves UPF1 phosphorylation, whether assays of phosphorylated UPF1 (p-UPF1) could identify NMD targets by mapping transcriptome-wide p-UPF1 binding sites in vivo was determined. An antigen-purified anti-p-UPF1(S1116) antibody was used to isolate transcripts associated with p-UPF1 from okadaic acid-treated human embryonic kidney (HEK)293T cells. Seven lines of evidence justify using p-UPF1(S1116), which is the only available antibody capable of immunoprecipitating p-UPF1 as a highly specific assay for p-UPF1 function during NMD (Figure 1A-G). Under the conditions used, okadaic acid generated a ~5-fold accumulation of cellular p-UPF1 (Figure 1F).

Cell lysates were immunoprecipitated using anti-p-UPF1(S1116) or, as a control, rabbit (r)IgG (Figure 2a), and RNA fragments that were primarily <100 nts using limited RNase I digestion were subsequently generated. As a second control (Ctl), cell lysates were generated without IP or RNase I treatment. Immunoprecipitated complexes were eluted from antibody-bound beads using denaturing buffer. Eluted RNA fragments were subjected to denaturing polyacrylamide gel electrophoresis, and those of∼25-40 nts were purified for cDNA library construction (Figure 2).

1.6-9.7 million single-end reads were obtained from each of the six cDNA libraries, i.e. biological replicates of three libraries. Of these, ~20-25% of the reads in Ctl and p-UPF1 samples could be mapped to a unique genomic sequence, in contrast to only ~2% of the reads in rIgG samples, indicating low nonspecific binding of RNAs to rIgG. Plotting the ratio of RNA fragment abundance (reads per kilobase per million mapped reads, RPKM) in p-UPF1 samples to those in Ctl samples using bona fide NMD targets based on a minimum of two criteria -- upregulation upon UPF1 downregulation plus a longer half-life upon UPF1 downregulation (Table 4) demonstrated that NMD targets had significantly more p-UPF1 binding compared to other transcripts (p = 9x10^-7, Kolmogorov–Smirnov test, Figure 2b). In contrast, the level of steady-state UPF1 binding to the same bona fide NMD targets using data provided by Gergerson et al. (2014) or Zund et al. (2013) failed to show significantly more UPF1 binding compared with other transcripts (Figure 1H,I). A similar result was obtained using putative NMD targets defined by Tani et al. (2002) as group B based on an elongated half-life upon UPF1 downregulation (Figure 2c), Mendell et al. (2004) or

Yepiskoposyan et al. (2011) based on an increase in abundance upon UPF1 downregulation (Figure 2d,e), or Yepiskoposyan et al. (2011) based an increase in abundance upon SMG6 or SMG7 downregulation (Figure 1J,K). However, for unclear reasons, putative NMD targets defined by Viegas et al. (2008) or Wittmann et al. (2006) based on, respectively, UPF1 or UPF2 downregulation (Figure 1L,M) did not.

Following global analysis of p-UPF1 binding to the HEK293T-cell transcriptome using RIP-Seq, the distribution of p-UPF1 on selected NMD targets was examined. After subtracting background p-UPF1 binding, data revealed that p-UPF1 is enriched on those NMD target 3'UTRs examined (Figure 2f-k). This pattern of p-UPF1 binding requires mRNA translation, without which only insignificant levels of p-UPF1 binding are observed.

NMD targets are enriched in p-UPF1, SMG5 and SMG7 but not UPF2, UPF3X, SMG1, SMG6, eRF1 or eRF3

Finding that p-UPF1 is enriched on NMD targets led to inquiring whether other mRNP proteins are likewise enriched. Before assaying other proteins, the prediction was initially tested, deriving from the RIP-seq data (Fig. 2), that p-UPF1 would be enriched on Gl and GPx1 Ter mRNA 3'UTRs compared to their corresponding PTC-free counterparts.

Lysates of HEK293T cells transiently expressing either PTC-free β-globin (Gl) Norm mRNA + PTC-containing glutathione peroxidase 1 (GPx1) Ter mRNA or Gl Ter mRNA + GPx1 Norm mRNA (Fig. 3a) were prepared, each together with mRNA that encodes the major urinary protein (MUP) and controls for variations in cell transfection efficiencies and RNA recovery (See Kurosaki and Maquat (2013)). A fraction of each cell lysate was

immunoprecipitated using anti-UPF1, which reacts with all of cellular UPF1 regardless of its phosphorylation status (Figure 1 f,g), or anti-p-UPF1(S1116).

Western blotting revealed that for each sample anti-UPF1 immunoprecipitated comparable amounts of UPF1 (Fig. 3b), and anti-p-UPF1(S1116) immunoprecipitated comparable amounts of p-UPF1(S1116) (Fig. 3c). RT−PCR demonstrated that the levels of Gl and GPx1 Ter mRNAs were, respectively, ~40% and ~30% of the corresponding PTC-free mRNAs prior to IP (Fig. 3b,c). Gl and GPx1 Ter mRNAs co-immunoprecipitated with UPF1 ~5-7-fold more efficiently than did their PTC-free counterparts (Fig. 3b,c; Fig. 3f,g which show RT−qPCR data). An ~5−6-fold increase in UPF1 binding to PTC-containing compared to PTC-free mRNA was also found after anti-HA IP of lysates of cells co-expressing HA- tagged MS2 coat protein and either Gl Norm mRNA or Gl Ter mRNA, each harboring six copies of the MS2 coat protein-binding site in its 3'UTR (Fig. 4a,b). It is noted that these studies compared UPF1 binding to a PTC-containing transcript and its PTC-free counterpart, the first of which differs from the latter by having a longer 3'UTR and a 3'UTR EJC that cumulatively enhance UPF1 binding. This comparison is distinct from the comparison of cellular mRNAs that are and are not NMD targets– a comparison that failed to show total- cell UPF1 enrichment on NMD targets (See Gregersen et al.“MOV10 is a 5’ to 3’ RNA helicase contributing to UPF1 mRNA target degradation by translocation along 3’ UTRs,” Mol. Cell (2014) and Kurosaki (2013)), partly because the NMD-inducing features of the bulk of cellular NMD targets are often diverse and undefined.

Anti-p-UPF1(S1116) IPs demonstrated that Gl and GPx1 Ter mRNAs co- immunoprecipitated ~4−5-fold more efficiently with p-UPF1 than did their PTC-free counterparts. Based on the finding that Gl and GPx1 Ter mRNAs co-immunoprecipitated with SMG5 and SMG7 ~2−3-fold more efficiently than did their PTC-free counterparts (Fig. 3d-g), at least some of this p-UPF1 appears to be bound by SMG5 and SMG7, each of which preferentially binds cellular p-UPF1. In conclusion, steady-state UPF1 and p-UPF1 preferentially bind PTC-containing NMD targets relative to their PTC-free counterparts to the same order of magnitude.

Like SMG5 and SMG7, UPF2, UPF3X, SMG1, eRF1 and eRF3 form complexes with UPF1 at various stages of the NMD pathway. However, unlike SMG5 and SMG7, each protein was not enriched on PTC-containing relative to PTC-free mRNAs (Fig. 3f,g; Fig. 4c- h; the slight 1.3-1.4-fold increase observed with UPF3X was not pursued). Their lack of enrichment suggests that (i) SURF forms only transiently on NMD targets, (ii) the peripheral EJC constituents UPF2 and UPF3X spend comparable time on NMD targets and their PTC- free counterparts, and (iii) SMG1-mediated UPF1 phosphorylation occurs through transient interactions of SMG1 with NMD target-bound UPF1. In control experiments, CBP20 was also not enriched on PTC-containing mRNAs (Fig. 3f,g and Fig. 4f) as expected. As additional controls, p-UPF1, SMG5, and SMG7, unlike UPF2, UPF3X, SMG1, eRF1, PP2Ac, or CBP20, were enriched on endogenous mRNA for growth arrest and DNA damage- inducible 45A (GADD45A), which is an NMD target compared with endogenous b-actin mRNA, which is not an NMD target (Fig. 4i). Neither PTC-containing nor PTC-free mRNAs detectably co-immunoprecipitated with SMG6, which also forms a complex with UPF1. Since SMG6 is an endonuclease that mediates the NMD of PTC-containing Gl mRNA and other NMD targets, it was concluded that the time between SMG6 binding and mRNA decay is undetectably short. SMG1 is not required for preferential UPF1 binding to PTC-containing vs. PTC-free mRNAs

Since anti-UPF1 measures both hypophosphorylated UPF1 and p-UPF1, finding that UPF1 binding and p-UPF1 binding are enhanced to the same extent on PTC-containing mRNAs does indicate whether enhanced UPF1 binding occurs before or after SMG1- mediated UPF1 phosphorylation. Furthermore, the degrees to which other mRNP constituents influence UPF1 or p-UPF1 binding have never been characterized. Therefore, individual mRNA-binding proteins that are known to form a complex with UPF1 either before or after UPF1 phosphorylation (Fig. 3a,b) were downregulated to <15% of their normal levels.

RT−qPCR was used to quantitate the levels of Gl and GPx1 Norm or Ter mRNAs before and after IP using anti-UPF1 or, as a control for nonspecific IP, normal rabbit serum (NRS; Fig. 5c,d).

Analyses of samples after IP revealed that the co-IP of Gl and GPx1 Ter mRNAs with UPF1 was reduced ~2-fold by UPF2 siRNA, ~3-4-fold by UPF3X siRNA, ~5-fold by eIF4A3 siRNA, or ~3-fold by eRF3 siRNA (Fig. 5c,d). These findings are consistent with results demonstrating that UPF1 binding to an NMD target 3'UTR is augmented by the interaction between UPF1 and eRF3 at a PTC and between UPF1 and a 3'UTR EJC. Finding that SMG1 siRNA failed to influence UPF1 binding to either NMD target (Fig. 5c,d), provides the first evidence that cellular UPF1 phosphorylation is not required for enhanced UPF1 binding to PTC-containing vs. PTC-free mRNAs and suggests that hypophosphorylated UPF1 initially binds to NMD target 3'UTRs. In contrast, the co-IP of Gl and GPx1 Ter mRNAs with UPF1 was reduced ~2-3-fold by SMG5 siRNA. Considering that SMG5 is enriched on NMD targets (Fig.3d,f,g), SMG5 may physically stabilize UPF1 binding to NMD targets– in particular the p-UPF1 fraction of cellular UPF1. In support of these data and the conclusions that we draw from them, similar but less dramatic results were obtained when the co-IP of GADD45A mRNA with UPF1 was quantitated (relative to co-IP of b-actin mRNA with UPF1) in the presence of siRNA to each of the six mRNA-associated proteins (Fig. 13).

SMG5 and SMG7 augment p-UPF1 binding to NMD targets

To further investigate the finding that SMG5 siRNA reduces UPF1 binding to Gl and GPx1 Ter mRNAs, similar assays of UPF1 binding in the presence of SMG6 siRNA, SMG7 siRNA or the catalytic subunit of PP2A (PP2Ac) siRNA were performed (Fig. 5e,f). Results revealed that SMG7 but neither SMG6 nor PP2Ac significantly contribute to the preferential binding of UPF1 to PTC-containing mRNAs (Fig. 5g,h). Since SMG5 and SMG7 form a stable heterodimer that is critical for NMD, and disrupting the SMG5−SMG7 heterodimer greatly reduces SMG5 binding to UPF1, the finding that either SMG5 siRNA or SMG7 siRNA reduces UPF1 binding to an NMD target suggests that it is the heterodimer that associates with and enhances the binding of UPF1 to PTC-containing mRNAs.

Given that SMG5 and SMG7 interact with p-UPF1, it was determined whether SMG5 and/or SMG7 enhance p-UPF1 binding to NMD targets. Using lysates of cells in which SMG5, SMG6 or SMG7 was downregulated to <10% of normal (Fig. 5i), after anti-p- UPF1(S1116) IP (Fig. 5j) SMG5 and SMG7, unlike SMG6, were found to contribute to p- UPF1 binding to Gl and GPx1 Ter mRNAs (Fig. 5k,l). It is likely that the SMG5−SMG7 heterodimer stabilizes p-UPF1 binding to an NMD target.

DNA oligo-directed RNase H cleavage demonstrates that p-UPF1 binds NMD target 3'UTRs

Since UPF1 binds along the length of the 3'UTRs of translationally active NMD targets, it seemed reasonable that the p-UPF1 that was observed bound to Gl and GPx1 Ter mRNAs (Fig. 3c,f,g) would likewise be a translation-dependent 3'UTR-association. To test this hypothesis and examine p-UPF1 distribution along the 3'UTR, HeLa cells that stably express IRE-Gl Ter mRNA (Fig. 6a), which harbors in its 5'UTR the iron-responsive element (IRE) from ferritin heavy-chain mRNA were utilized. Cells were cultured for one day in medium containing the iron-chelator deferoxamine mesylate (Df), which represses IRE-Gl mRNA translation, and subsequently washed and cultured for 8 hr in Df or hemin, which promotes IRE-Gl mRNA translation. Lysates from cells cultured in the presence of hemin were subsequently immunoprecipitated using anti-UPF1 (or, as a control, NRS) or anti-p- UPF1(S1116) (or, as a control, rIgG). After extensive washing, UPF1-bound RNAs were incubated with RNase H in the absence or presence of one of three antisense DNA

oligonucleotides (Fig. 6a) while associated with antibody−protein A-agarose beads. By so doing, cleavage products (CPs) that do not associate with UPF1 can be distinguished from those that do. IRE-Gl Ter mRNA 5'-CPs consisted of 185, 320 or 434 nts and contain, respectively, 0, 114 or 228 nts of 3'UTR (where 3'UTR nt 1 is defined as the nt immediately downstream of Ter; Fig. 6a). The corresponding 3'-CPs consisted of 439, 303 or 190 nts, all of which derive from the 3'UTR (except for the Oligo 1 3'-CP, which contains 5 nts of coding region plus Ter; Fig. 6a). In control experiments performed before IP, Df (but not hemin) increased the level of IRE-Gl Ter mRNA prior to RNase H-mediated cleavage, i.e. inhibited NMD (Fig. 6b), and also blocked the production of ferritin (Fig. 6c,g). Cleavage was complete as indicated by the loss of full-length IRE-Gl Ter mRNA (Fig. 6d). Relative to Df, hemin enhanced by ~ 4-6 or ~3-4 fold the amount of uncleaved IRE-Gl Ter mRNA that co-immunoprecipitated with UPF1 or p-UPF1(S1116), respectively (Fig. 6e,f,h,i), consistent with enhanced binding of p- UPF1 to an NMD target relative to its PTC-free counterpart requiring a translation termination event that triggers NMD. Since the same conclusion can be drawn for UPF1, there is likely to be a precursor-product relationship between NMD target-bound UPF1 and p-UPF1.

In the presence of hemin, 5'-CPs of IRE-Gl Ter mRNA containing 0, 114 or 228 nts of 3'UTR co-immunoprecipitated with, respectively, ~1.5-fold, ~2.5-fold or ~4.5-fold more UPF1 than did uncleaved mRNA in the presence of Df (Fig. 6e), whereas each of the corresponding 3'-CPs containing 431, 303 or 190 nts of 3'UTR co-immunoprecipitated with 5-fold more UPF1 than did uncleaved mRNA in the presence of Df (Fig. 6f). As concluded previously, these results are consistent with UPF1 removal from the 5'UTR, coding region and first ~35 nts of the 3'UTR by translating ribosomes. Furthermore, there is at least one UPF1 molecule bound to each 3'-CP.

p-UPF1 binding also increased with increased 5'-CP length to levels that were, respectively, ~1 fold, ~1.5-fold or ~3-fold the level of binding to uncleaved mRNA exposed to Df (Fig. 6h), while p-UPF1 binding decreased with decreasing 3'-CP length to levels that were, respectively, ~4-fold, ~3-fold or ~2-fold (Fig. 6i). Therefore, the probability of p-UPF1 binding along the Gl Ter mRNA 3'UTR decreases as the distance from the termination codon increases. A diminishing distribution of p-UPF1 relative to distance downstream of the termination codon appears to typify the 3'UTRs of some (Fig. 2f,h,k) but not all (Fig. 2g,i,j) NMD targets.

Given its preferential binding to p-UPF1, SMG6 endonuclease presumably cleaves NMD targets after it is recruited by p-UPF1 (Fig. 7b). Thus, whether p-UPF1 binding sites coincide with sites of endonucleolytic cleavage was determined. To define these sites, 5'- RACE was used to map the 5'-ends of IRE-Gl Ter mRNA 3'-CPs in lysates of cells exposed to one or more siRNAs and, subsequently, Df or hemin. The 5'-to- 3' exonuclease XRN1 was downregulated (Fig. 6j) so as to allow SMG6-generated 3'-CPs to accumulate. As controls, (i) both XRN1 and SMG6 were downregulated (Fig. 6j) to inhibit the formation of SMG6- generated 3'-CPs and (ii) Control siRNA (Fig. 6j) was used since SMG6-generated 3'-CPs would be degraded by XRN1 and thus fail to accumulate. As expected, full-length IRE-Gl Ter mRNA was readily detectable when cells were exposed to Df alone, which inhibits IRE- Gl Ter mRNA translation and thus NMD, or hemin after XRN1+SMG6 siRNAs, which allows for IRE-Gl Ter mRNA translation but inhibits the decay step (Fig. 6k). In contrast, the level of IRE-Gl Ter mRNA was reduced when cells were exposed to hemin after either Control siRNA or XRN1 siRNA (Fig. 6k). The majority of decay intermediates that were unique to cells treated with hemin after XRN1 siRNA mapped to near the PTC and ~35-nt upstream of the EJC (Fig. 6k), i.e. roughly coincident with where p-UPF1 binds (Fig. 6i). This suggests that p-UPF1 binding sites overlap with SMG6 cleavage sites.

FRET analyses of sortase-labeled UPF1 demonstrate that UPF1 binding to RNA is more stable in the presence of ADP or non-hydrolyzable ATP than in the presence of ATP To understand how UPF1 binding to RNA is influenced by is ability to bind and hydrolyze ATP, human UPF1(295-914) was site-specifically modified using Sortase labeling so its C-terminus harbors a Cy5 dye (Fig. 8f,g). This region of UPF1includes the ATP- binding and helicase domains, but lacks the N-terminal cysteine-histidine (CH) domain since the CH-domain was previously shown to inhibit UPF1 helicase and ATPase activities.

UPF1(295-914) generates a Förster resonance energy transfer (FRET) signal when the Cy5 dye is in close proximity to a donor Cy3-labeled 50-nt RNA (Fig. 8h). Concentrations of UPF1 and RNA (250 nM) were near the previously reported K_D for UPF1 binding to RNA in the presence of ADP or ATP analogues. In agreement with previous observations, the highest efficiency of energy transfer corresponding to the greatest level of UPF1 binding was observed in the absence of nucleotides. Equally modest decreases in FRET were observed in the presence of ADP or the non-hydrolyzable analogues of ATP, AMPPNP or ADP-Be_x (Fig. 8h). Consistent with previous measurements, these data indicate that UPF1 bound by either ATP or ADP bind RNAs with similar affinities. In contrast to the experiments performed in the presence of ADP and AMPPNP, incubation of the UPF1−RNA complex with ATP led to a dramatic decrease in FRET efficiency indicating extensive dissociation of UPF1 from RNA (Fig. 8h). Hence, ATP hydrolysis, rather than ATP binding, leads to the observed dissociation of UPF1 from RNA.

UPF1 recognition of NMD targets requires its ATPase and helicase activities

Neither SMG1 siRNA nor PP2A siRNA detectably affect the differential binding of UPF1 to NMD targets compared to their PTC-free counterparts (Fig. 5), consistent with UPF1 phosphorylation occurring after UPF1 binding to an NMD target. To further examine how and when UPF1 phosphorylation occurs during NMD, a series of UPF1 variants were constructed to analyze their phosphorylation status, relative binding to PTC-containing vs. PTC-free mRNAs, and also their effects on mRNP composition. Lysates were generated from HEK293T cells transiently expressing MYC alone, MYC-UPF1(WT), which is primarily hypophosphorylated, or one of five MYC-UPF1 variants (Fig. 7a,b, lanes 2-13) that have been shown to inhibit NMD. Their relative phosphorylation status was found to be MYC- UPF1(G495R/G497E) >> MYC-UPF1(dNT) > MYC-UPF1(WT) > MYC-UPF1(C126S)≈ MYC-UPF1(4SA)≈ MYC-UPF1(R843C) (Fig. 7a, b).

EJC-interacting UPF2 co-immunoprecipitated in a largely RNase A-insensitive fashion with MYC-UPF1(WT) and all of its variants except for MYC-UPF1(C126S) (Fig. 7b), which harbors a point mutation in the cysteine-histidine-rich (CH) domain that disrupts UPF2 binding. Thus, the interaction of UPF2 with UPF1, which is known to be direct, is

independent of UPF1 phosphorylation. Core EJC constituents MLN51 and Magoh and the more peripherally associated UPF3X were not detectable in the IP of MYC-UPF1(C126S), indicating dependence on UPF2 for their co-IP with UPF1 (Fig. 7b). UPF2, UPF3X, MLN51, Magoh, CBP80, poly(A) tail-binding protein (PABP)C1, SMG6 and SMG7 co- immunoprecipitated more efficiently with MYC-UPF1(dNT) than with MYC-UPF1(WT) (Fig. 7b). Although these SMG6 data contradict a report that localized SMG6 binding to the N-terminus of UPF1, these results were corroborated with the demonstration that MYC- UPF1(dNT) co-immunoprecipitates with both HA-SMG5 or HA-SMG6 (Fig. 8a,b). That MYC-UPF1(dNT) is phosphorylated at a level that exceeds that of MYC-UPF1(WT) is consistent with its increased co-IP with SMG5, SMG6 and SMG7 (Fig. 7b and Fig. 8a,b).

SMG5, SMG6 and SMG7 indeed interact most efficiently with p-UPF1 in a partially (SMG6) or entirely (SMG5−SMG7) RNase A-insensitive manner as indicated by assays of hyperphosphorylated MYC-UPF1(G495R/G497E) (Fig. 7b). The weak-to-nonexistent co-IP of eIF4E with MYC-UPF1(WT) and all variants but MYC-UPF1(G495R/G497E) agrees with the bulk of NMD targeting CBP80−CBP20-bound mRNAs.

As expected, MYC-UPF1(WT) exhibited ~10- and ~5-fold more binding to, respectively, Gl Ter and GPx1 Ter mRNAs compared to their PTC-free counterparts (Fig. 7c,d). The failure of MYC-UPF1(C126S) to detectably co-immunoprecipitate with Gl or GPx1 Ter mRNA above the level of binding to, respectively, Gl or GPx1 Norm mRNA (Fig. 7c,d) is consistent with its failure to co-immunoprecipitate with CBP80 or PABPC1 (Fig. 7b) and indicates that UPF2 binding to UPF1 is important for NMD target recognition (Fig. 7c,d). MYC-UPF1(4SA), which includes S1116A, resembled MYC-UPF1(WT) in its interactions not only with mRNP proteins (Fig. 7b) but also with PTC-containing and PTC-free mRNAs (Fig. 7c,d), providing further evidence that UPF1 phosphorylation occurs on Ter mRNAs (Fig. 7c,d). MYC-UPF1(dNT) still distinguished PTC-containing and PTC-free mRNAs (Fig. 7c,d), but its abnormal interactions with mRNP proteins, including NMD factors (Fig. 7b), suggests that the UPF1 N-terminus contributes to proper mRNP configuration.

Consistent with the enhanced co-IP of CBP80 and PABPC1 with MYC- UPF1(G495R/G497E) (Fig. 7b), Gl and GPx1 Norm and Ter mRNAs co-immunoprecipitated more efficiently with MYC-UPF1(G495R/G497E) than with MYC-UPF1(WT) (Fig. 7c,d). Given that MYC-UPF1 (G495R/G497E) fails to support NMD and its binding to mRNA was not significantly enhanced by the presence of a PTC in either Gl or GPx1 mRNA (Fig. 7c,d), it is likely that binding is largely nonspecific. In support of this conclusion, the abnormally elevated amounts of SMG5, SMG6 and SMG7 that co-immunoprecipitated with MYC- UPF1(G495R/G497E) were incapable of degrading mRNA. Assays of E. coli-produced human UPF1 (Fig. 8c) revealed that the G495R/G497E mutations inhibit UPF1 ATPase and helicase activities (Fig. 8d,e).

Förster resonance energy transfer (FRET) analyses showed that UPF1 is efficiently released from RNA when in the presence of ATP compared to in the presence of ADP or the non-hydrolyzable ATP analogues AMPPNP or ADP-Be_x (Fig. 8f-h). This was determined using human UPF1(295-914) that was site-specifically modified by Sortase labeling so its C- terminus harbors a Cy5 dye (Fig. 8f,g) that generates a FRET signal when the Cy5 dye is in close proximity to a donor Cy3-labeled 50-nt RNA (Fig. 8h). Hence, ATP hydrolysis, rather than simply ATP binding, leads to dissociation of UPF1 from RNA, in keeping with the hypothesis that UPF1 is a helicase that translocates along RNA in a 5'-to-3' direction. The large decrease in FRET observed in the presence of ATP is likely due to movement of UPF1 away from the donor fluorophore attached to RNA and/or dissociation of UPF1 from the 3'- end of donor-labeled RNA.

As expected from the failure of mRNP constituents to co-immunoprecipitate with hypophosphorylated MYC-UPF1(R843C) (Fig. 7b), Gl and GPx1 Norm and Ter mRNAs failed to co-immunoprecipitate as well (Fig. 7c,d). Thus, the interaction between MYC- UPF1(R843C) and EJC constituents likely occurs while not bound to RNA. The R843C mutation inhibits UPF1 helicase, but not ATPase activity (Fig. 8a,b). Just as MYC- UPF1(G495R/G497E) is hyperphosphorylated because it fails to dissociate from RNA, MYC-UPF1(R843C) is hypophosphorylated because it fails to detectably bind RNA. Thus, the R843C mutation apparently uncouples ATPase activity from RNA binding.

In conclusion, UPF1 binds both PTC-containing and PTC-free mRNAs

indiscriminately in the absence of ATP and requires the ability to cleave ATP to recognize an NMD target. The enhanced binding of UPF1 to PTC-containing relative to PTC-free mRNAs requires that UPF1 have an intact CH domain, which allows interaction with EJCs, and also possess helicase activity, which requires ATP hydrolysis.

PP2Ac siRNAs upregulate the level of p-UPF1 without inhibiting NMD

Current models indicate that PP2A is responsible for dephosphorylating p-UPF1 despite never testing if PP2A directly contributes to mRNA degradative activities and/or restores UPF1 to its largely hypophosphorylated steady-state. To assay for PP2A function in NMD, three individual siRNAs targeting PP2Ac were separately used to downregulate the level of PP2Ac to <10-25% of normal without affecting the level of cellular UPF1 but increasing the level of cellular p-UPF1 ~2– 4-fold (Fig. 9a). Remarkably, no PP2Ac siRNA inhibited the NMD of Gl or GPx1 Ter mRNA (Fig. 9b,c), or endogenous NMD targets GADD45A mRNA and GADD45B mRNA (Fig. 9d). In striking contrast, downregulating SMG1 to ~10% of normal, which decreased the level of cellular p-UPF1 ~2.5-fold, efficiently inhibited the NMD of both reporter and both endogenous NMD targets (Fig. 9b-d). Furthermore, IPs using anti-PP2Ac revealed that PP2Ac is not enriched on either Gl or GPx1 Ter mRNA (Fig. 9e). It was concluded that PP2A only indirectly functions in NMD via its role in p-UPF1 recycling to a hypophosphosphorylated status. These data indicate that the level of hypophosphorylated UPF1 does not limit UPF1 phosphorylation and, thus, NMD.

As set forth herein, by using transcriptome-wide deep sequencing of cellular RNAs, it was established that p-UPF1 provides the first reliable marker of cellular NMD targets (Fig. 1 and Fig. 2). A complete inventory of the cellular mRNAs targeted by NMD has been lacking because UPF1 binding does not provide a marker of cellular NMD targets, direct NMD targets form a collection with myriad incompletely defined cis-acting NMD triggers (uORFs, 3'UTR EJCs, 3'UTR length, etc.), and experimentally downregulating NMD factors by nature identifies both direct and indirect NMD targets. Thus, showing that p-UPF1 serves as the discriminating mark of direct cellular NMD targets is essential towards elucidating how NMD regulates a multitude of cellular processes. These results also indicate that SMG5 and SMG7 binding should also identify direct NMD targets (Fig. 3). Either p-UPF1 or UPF1 can be used as an NMD-target marker when analyses are confined to 3'UTRs provided that a comparison is made between a PTC-containing mRNA and its PTC-free counterpart (Figs. 3,6,7).

The role of ATP hydrolysis on UPF1 binding to RNA was also examined. While it was known that UPF1 switches between ATP- and ADP-bound states, how the cycle of ATP hydrolysis is involved in NMD remained unresolved. Here, it was demonstrated that, using ensemble FRET and IPs of UPF1 variants from cellular lysates, that UPF1 dissociation from RNA requires the binding and hydrolysis of ATP (Fig. 7 and Fig. 8f-h). When expressed in HEK293T cells, neither MYC-UPF1(R843C), which manifests ATPase but not helicase activity, nor MYC-UPF1(G495R-G497E), which manifests neither ATPase nor helicase activity, can discriminate between mRNAs that are and are not NMD targets (Fig. 7). Since MYC-UPF1(G495R/G497E) cannot dissociate from nonspecific interactions with RNA, it co-immunoprecipitates with three to four orders of magnitude more RNA than does MYC- UPF1(R843C), which fails to detectably bind RNA (Fig. 7 and Fig. 8c-e). Furthermore, since MYC-UPF1(G495R/G497E) is hyperphosphorylated whereas MYC-UPF1(R843C) is hypophosphorylated (Fig. 7), and since UPF1 phosphorylation occurs on RNA (Fig. 7), it was concluded that prolonged UPF1 binding to RNA results in UPF1 hyperphosphorylation.

Taken together, these findings unveil the following model in which a number of important new links have been added (Fig. 10a). Steady-state hypophosphorylated UPF1 associates and dissociates from mRNAs that are and are not NMD targets nonspecifically in a mechanism that depends on ATP binding and hydrolysis (Fig. 7 and Fig. 8f-h). Translating ribosomes also regulate the distribution of UPF1 along mRNAs to dissociate nonspecifically bound UPF1 from the 5'UTRs and coding regions or to specifically recruit UPF1 to the 3'UTRs of NMD targets (Figs. 2, 3, 5 and 6). Data indicate that UPF1 moves along the mRNA 3'UTR in a 5'-to-3' direction (Fig. 8f-h), facilitating mRNA scanning.

In later steps (Fig. 10b), NMD-targets are marked as such by regulated SMG1- mediated UPF1 phosphorylation (Fig. 1g), which is enhanced by cap-bound CBP80−CBP20 and UPF factors bound to an EJC that is situated downstream of the PTC (Figs. 5, 7).

Notably, UPF1 phosphorylation occurs while UPF1 is bound to the 3'UTR via a transient association with SMG1 (Figs. 3, 7, 9 and Fig. 1g). How many UPF1 molecules load onto a 3'UTR, and which are converted to p-UPF1 molecules remain unknown. p-UPF1 recruits the endonuclease SMG6 and also SMG5−SMG7, the latter of which stabilize p-UPF1 binding to an NMD target 3'UTR (Figs. 3, 5, 7) and recruit mRNA degradative activities (Fig. 7).

Although NMD targets cannot be detected in IPs of SMG6, they are cleaved by SMG6 (Fig. 6j,k). Thus, SMG6 spends relatively little time on an NMD target prior to its decay. Since data indicate that p-UPF1dephosphorylation occurs after the initiation of mRNA decay (Fig. 9), it is likely p-UPF1 that moves along the mRNA 3'UTR to facilitate mRNP remodeling and decay.

Taken together, these data elucidate how UPF1 ATPase and helicase activities contribute to the identification of NMD targets, which are marked by regulated UPF1 phosphorylation. Accordingly, UPF1 phosphorylation is tightly controlled by the remaining NMD factors. EXAMPLE II

Experiments were conducted to determine if a PTC-containing mRNA that is resistant to NMD could be converted to an NMD target. A pseudoknot (Ψ) was inserted 86 nucleotides (nt) upstream of the normal human β-globin (GI) transition termination codon (Norm Ter) in dRLUC-GI mRNA (Fig. 11A), which encodes modified Renilla luciferase (dRLUC) fused to human β-globin (GI) protein. Using this plasmid, a PTC was generated at GI position 90, 96 or 101 so that the Ψ resides 89-nt, 71-nt r 56-nt downstream of each PTC, respectively (Fig.11a). In the absence of the Ψ, none of the PTCs triggers NMD, resembling many PTCs in patients with a dominantly inherited form of the hemolytic anemia called β- thalassemia. The Ψ did not significantly affect the level of Norm Ter mRNA, suggesting that the ribosome largely unwinds and translates the Ψ. However, the Ψ increased the level of each PTC-containing mRNA (Fig. 11b) in a way that correlated with an increase in UPF1 binding (Fig. 11c). This shows that a physical barrier to 5’ to 3’ progression downstream of a PTC promotes NMD even if that PTC fails to trigger NMD in the absence of a barrier.

In another experiment, two phosphorodiamidate morpholino oligomers (PMOs), MP1_Gl (5'-GTGGTGGCCCAGCACAATCACGATC -3') (SEQ ID NO: 81) and MP2_Gl (5'- GGCCACTCCAGCCACCACCTTCTGG -3') (SEQ ID NO: 82), were used. Each anneals to the 3'UTR of dRLUC-Gl mRNA 23-nt and 86-nt downstream of 101Ter (Fig. 12a) As shown in Figure 12b, each PMO also promotes the NMD of dRLUC-Gl mRNA harboring 101Ter but does not significantly reduce the abundance of Norm Term mRNA. Publications cited herein and the material for which they are cited are hereby specifically incorporated by reference in their entireties. A number of embodiments have been described. Nevertheless, it will be understood that various modifications may be made. Accordingly, other embodiments are within the scope of the following claims.

Claims

What is claimed is: 1. A method of increasing nonsense-mediated mRNA decay (NMD) of a premature termination codon (PTC)-containing mRNA in a cell comprising contacting the cell with an agent that increases binding of UPF1 downstream of the PTC in the PTC- containing mRNA, wherein an increase in UPF1 binding increases binding of phosphorylated UPF1 (UPF1) downstream of the PTC in the PTC-containing mRNA.

2. The method of claim 1, wherein the PTC-containing mRNA is a NMD-resistant

mRNA.

3. The method of claim 1 or 2, wherein the agent increases binding pUPF1 to the PTC- containing mRNA, by increasing phosphorylation of UPF1 that is bound to the PTC- containing mRNA.

4. The method of any of claims 1-3, wherein the agent increases binding of UPF1 and/or pUPF1 by increasing the number of UPF1 and/or pUPF1 molecules that are bound to the 3’-untranslated region (UTR) of the PTC-containing mRNA.

5. The method of any of claims 1-4, wherein the agent increases binding of UPF1 and/or pUPF1 by inhibiting the disassociation of UPF1 from the PTC-containing mRNA.

6. The method of any of claims 1-5, wherein the agent increases binding of pUPF1 by inhibiting the 5’ to 3’ translocation of UPF1 along the 3’ UTR of the PTC-containing mRNA.

7. The method of any of claims 1-6, wherein the cell is in a subject.

8. The method of any of claims 1-7, wherein the agent is selected from the group

consisting of an siRNA, a morpholino, a locked nucleic acid, a peptide, a protein, an antibody, and a small molecule.

9. A method of treating a disorder associated with expression of a PTC-containing

mRNA that is resistant to NMD in a subject, comprising administering to the subject with a disorder associated with expression of a PTC-containing mRNA that is resistant to NMD an agent that increases binding of UPF1 and/or pUPF1 to the pretermination codon (PTC)-containing mRNA downstream of the PTC.

10. The method of claim 9, wherein the agent increases binding of UPF1 and/or pUPF1 to the PTC-containing mRNA by increasing phosphorylation of UPF1 that is bound to the PTC-containing mRNA.

11. The method of claim 9 or 10, wherein the agent increases binding of UPF1 and/or pUPF1 by increasing the number of pUPF1 molecules that are bound to the 3’- untranslated region (UTR) of the PTC-containing mRNA.

12. The method of any of claims 9-11, wherein the agent increases binding of pUPF1 downstream of the PTC.

13. The method of any of claims 9-12, wherein the agent increases binding of UPF1

and/or pUPF1 by inhibiting the disassociation of UPF1 from the PTC-containing mRNA.

14. The method of any of claims 9-13, the agent increases binding of pUPF1 by inhibiting the 5’ to 3’ translocation of UPF1 along the 3’ UTR of the PTC-containing mRNA.

15. The method of any of claims 9-14, wherein the agent is an inhibitor of protein

phosphatase 2A.

16. The method of any of claims 9-15, wherein the disorder is β-Thalassemia or

neurocristopathy.

17. The method of any of claims 9-16, wherein the agent is selected from the group

consisting of a siRNA, a morpholino, a locked nucleic acid, a peptide, a protein, an antibody, and a small molecule.

18. The method of claim 17, wherein the disorder is a neurocristopathy,

19. The method of claim 18, wherein the agent is a morpholino that specifically binds to a PTC-containing SOX10 mRNA downstream of the PTC.

20. The method of claim 19, wherein the morpholino comprises SEQ ID NO: 1 (5’- gtccaactcagccacatcaaaggtc-3’) or SEQ ID NO: 2 (5’-ccatataggagaaggccgagtagag-3’).

21. The method of claim 18, wherein the agent is a locked nucleic acid (LNA) that

specifically binds to a PTC-containing SOX10 mRNA downstream of the PTC.

22. The method of claim 21, wherein the LNA comprises SEQ ID NO: 3

(5’actcagccacatcaa-3’) or SEQ ID NO: 4 (5’-agaaggccgagtaga-3’).

23. The method of claim 18, wherein the agent is a morpholino that specifically binds to a PTC-containing myelin-protein zero (MPZ) mRNA downstream of the PTC.

24. The method of claim 23, wherein the morpholino comprises SEQ ID NO: 5 (5’- ctaaccgctatttcttatcttgcg-3’).

25. The method of claim 18, wherein the agent is a locked nucleic acid (LNA) that

specifically binds to a PTC-containing MPZ mRNA downstream of the PTC.

26. The method of claim 25, wherein the LNA comprises SEQ ID NO: 6 (5’- tttcttatccttgcg-3’).

27. A method of identifying an agent that increases NMD of a PTC-containing mRNA comprising:

a) contacting a cell that expresses the PTC-containing mRNA with an agent to be tested; and

b) determining the level of pUPF1 binding in the 3’ UTR of the (PTC)- containing mRNA, wherein an increase in pUPF1 binding indicates that the tested agent is an agent that increases NMD.

28. The method of claim 27, wherein the PTC-containing mRNA is an mRNA that is resistant to NMD.

29. The method of claim 27 or 28, further comprising determining the level of NMD after administration of the agent, wherein an increase in NMD indicates that the agent is an agent that increases NMD.