JP2021500864A - Compositions and Methods for TTR Gene Editing and Treatment of ATTR Amyloidosis - Google Patents

Abstract

Compositions and methods for editing within the TTR gene, such as the introduction of double-strand breaks, are provided. Compositions and methods for treating subjects with amyloidosis (ATTR) associated with transthyretin are provided. [Selection diagram] None

Description

This application has priority over US Provisional Application No. 62 / 556,236 filed September 29, 2017, and US Provisional Application No. 62 / 671,902 filed May 15, 2018. Claiming interests, these provisional applications are incorporated in their entirety by reference.

The application contains a sequence listing electronically submitted in ASCII format, which sequence listing is incorporated herein by reference in its entirety. The aforementioned ASCII copy made on September 27, 2018 is 2018-09-27_01155-0013-PCT_ST25. It is named txt and has a size of 417,471 bytes.

Transthyretin (TTR) is a protein produced by the TTR gene that normally functions to transport retinol and thyroxine throughout the body. TTR is synthesized primarily in the liver and in small proportions in the choroid plexus and retina. TTR normally circulates in the blood as a soluble tetrameric protein.

Pathogenic variants of TTR that can disrupt tetramer stability may be encoded by mutant alleles of the TTR gene. Mutant TTR can result in misfolded TTR that can produce amyloid (ie, aggregates of misfolded TTR proteins). In some cases, pathogenic variants of TTR can lead to amyloidosis, or disease resulting from the accumulation of amyloid. For example, misfolded TTR monomers can polymerize in tissues such as peripheral nerves, heart, and gastrointestinal tract to become amyloid fibrils. Amyloid plaques can also include wild-type TTR deposited on misfolded TTR.

Misfolding and deposition of wild-type TTR is also observed in men aged 60 years or older and is associated with cardiac rhythm problems, heart failure, and carpal tunnels.

Amyloidosis characterized by TTR deposition is "ATTR", "TTR-related amyloidosis", "TTR amyloidosis" or "ATTR amyloidosis", "ATTR familial amyloidosis" (if associated with a gene mutation in the family), or " Sometimes referred to as "ATTR wt" or "wild ATTR" (if resulting from misfolding and deposition of wild TTR).

ATTR can exhibit a wide range of symptoms, and patients with different classes of ATTR can have different characteristics and prognosis. Some classes of ATTR include familial amyloid polyneuropathy (FAP), familial amyloid cardiomyopathy (FAC), and wild-type TTR amyloidosis (wt-TTR amyloidosis). FAP generally exhibits sensorimotor neuropathy, and FAC and wt-TTR amyloidosis generally exhibit congestive heart failure. FAP and FAC are usually associated with gene mutations in the TTR gene, and more than 100 different mutations in the TTR gene are associated with ATTR. In contrast, wt-TTR amyloidosis is associated with aging and not with gene mutations in TTR. It is estimated that approximately 50,000 patients worldwide may have FAP and FAC.

Although more than 100 mutations in TTR are associated with ATTR, certain mutations are more closely associated with neuropathy and / or cardiomyopathy. For example, mutations in TTR at T60 are more associated with both cardiomyopathy and neuropathy, mutations at V30 are more associated with neuropathy, and mutations at V122 are more associated with cardiomyopathy.

Extensive therapeutic approaches have been studied for the treatment of ATTR, but there are no approved drugs that stop disease progression and improve quality of life. Liver transplantation has been studied for the treatment of ATTR, but its use is declining as it carries significant risks and disease progression may continue after transplantation. Small molecule stabilizers such as diflunisal and tafamidis appear to slow the progression of ATTR, but these agents do not stop disease progression.

Approaches using short interfering RNA (siRNA) knockdowns, antisense knockdowns, or monoclonal antibodies that target amyloid fibrils for disruption are also currently being studied, with results for short-term suppression of TTR expression. While presenting desired preliminary data, there is a need for treatment that can produce suppression of long-term persistence of TTR.

Therefore, the following embodiments are provided. In some embodiments, the invention substantially reduces or knocks out TTR gene expression using a guide RNA in conjunction with an RNA-guided DNA binding agent such as the CRISPR / Cas system. , Thereby providing compositions and methods that substantially reduce or eliminate the production of TTR proteins associated with ATTR. Substantial reduction or elimination of TTR protein production associated with ATTR through alteration of the TTR gene can be long-term reduction or elimination.

Embodiment 1: A method of inducing double-strand breaks (DSBs) within the TTR gene, comprising delivering the composition to cells, wherein the composition is:
a. SEQ ID NO: Guide RNA containing a guide sequence selected from 5-82;
b. SEQ ID NO:: A guide RNA containing at least 17, 18, 19, or 20 contiguous nucleotides of a sequence selected from 5 to 82; or c. SEQ ID NO: Guide containing a guide sequence that is at least 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, or 90% identical to the sequence selected from 5-82. RNA
including,
Method.

Embodiment 2: A method of modifying the TTR gene, which comprises delivering the composition to a cell, wherein the composition is (i) an RNA-guided DNA-binding agent or a nucleic acid encoding an RNA-guided DNA-binding agent and (ii). ) Contains guide RNA,
a. SEQ ID NO: Guide sequence selected from 5 to 82;
b. SEQ ID NO:: At least 17, 18, 19, or 20 contiguous nucleotides of the sequence selected from 5-82; or c. SEQ ID NO:: Contains a guide sequence that is at least 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, or 90% identical to the sequence selected from 5-82.
Method.

Embodiment 3: A method of treating amyloidosis (ATTR) associated with TTR, comprising administering the composition to a subject in need thereof, thereby treating ATTR, wherein the composition is (i). ) RNA-guided DNA-binding agent or RNA-guided DNA-binding agent-encoding nucleic acid and (ii) guide RNA, the guide RNA
a. SEQ ID NO: Guide sequence selected from 5 to 82;
b. SEQ ID NO:: At least 17, 18, 19, or 20 contiguous nucleotides of the sequence selected from 5-82; or c. SEQ ID NO:: Contains a guide sequence that is at least 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, or 90% identical to the sequence selected from 5-82.
Method.

Embodiment 4: A method of reducing the serum concentration of TTR, which comprises administering the composition to a subject in need thereof, thereby reducing the serum concentration of TTR, wherein the composition is (i). The guide RNA comprises an RNA-guided DNA-binding agent or a nucleic acid encoding an RNA-guided DNA-binding agent and (ii) a guide RNA.
a. SEQ ID NO: Guide sequence selected from 5 to 82;
b. SEQ ID NO:: At least 17, 18, 19, or 20 contiguous nucleotides of the sequence selected from 5-82; or c. SEQ ID NO:: Contains a guide sequence that is at least 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, or 90% identical to the sequence selected from 5-82.
Method.

Embodiment 5: A method of reducing or preventing the accumulation of TTR-containing amyloid or amyloid fibrils in a subject, wherein the composition is administered to the subject in need thereof, thereby accumulating amyloid or amyloid fibrils. The composition comprises (i) a nucleic acid encoding an RNA-guided DNA-binding agent or an RNA-guided DNA-binding agent and (ii) a guide RNA, wherein the guide RNA comprises reducing.
a. SEQ ID NO: Guide sequence selected from 5 to 82;
b. SEQ ID NO:: At least 17, 18, 19, or 20 contiguous nucleotides of the sequence selected from 5-82; or c. SEQ ID NO:: Contains a guide sequence that is at least 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, or 90% identical to the sequence selected from 5-82.
Method.

Embodiment 6: A composition comprising a guide RNA, wherein the guide RNA is
a. SEQ ID NO: Guide sequence selected from 5 to 82;
b. SEQ ID NO:: At least 17, 18, 19, or 20 contiguous nucleotides of the sequence selected from 5-82; or c. SEQ ID NO:: Contains a guide sequence that is at least 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, or 90% identical to the sequence selected from 5-82.
Composition.

Embodiment 7: A composition comprising a vector encoding a guide RNA, wherein the guide RNA is:
a. SEQ ID NO: Guide sequence selected from 5 to 82;
b. SEQ ID NO:: At least 17, 18, 19, or 20 contiguous nucleotides of the sequence selected from 5-82; or c. SEQ ID NO:: Contains a guide sequence that is at least 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, or 90% identical to the sequence selected from 5-82.
Composition.

Embodiment 8: The composition of embodiment 6 or 7 for use in inducing double-strand breaks (DSBs) within the TTR gene in cells or subjects.

Embodiment 9: The composition of embodiment 6 or 7 for use in modifying the TTR gene in a cell or subject.

Embodiment 10: The composition of embodiment 6 or 7 for use in the treatment of amyloidosis (ATTR) associated with TTR in a subject.

Embodiment 11: The composition of embodiment 6 or 7 for use in reducing the serum concentration of TTR in a subject.

Embodiment 12: The composition of embodiment 6 or 7 for use in reducing or preventing the accumulation of amyloid or amyloid fibrils in a subject.

Embodiment 13: A composition for use in any one of embodiments 1-5 or any one of embodiments 8-12, wherein the composition reduces serum TTR levels.

Embodiment 14: A composition for the method or use of Embodiment 13, wherein serum TTR levels are reduced by at least 50% compared to serum TTR levels prior to administration of the composition.

Embodiment 15: Serum TTR levels are 50-60%, 60-70%, 70-80%, 80-90%, 90-95%, 95-98 as compared to serum TTR levels prior to administration of the composition. A composition for the method or use of Embodiment 13, which is reduced by%, 98-99%, or 99-100%.

Embodiment 16: A composition for the method or use of any one of embodiments 1-5 or 8-15, wherein the composition results in editing of the TTR gene.

Embodiment 17: A composition for the method or use of Embodiment 16, where editing is calculated as a percentage of the population being edited (editing percentage).

Embodiment 18: A composition for the method or use of embodiment 17, wherein the editing percentage is 30-99% of the population.

Embodiment 19: Editing percentages are 30-35%, 35-40%, 40-45%, 45-50%, 50-55%, 55-60%, 60-65%, 65-70% of the population. A composition for the method or use of embodiment 17, which is 70-75%, 75-80%, 80-85%, 85-90%, 90-95%, or 95-99%.

Embodiment 20: A composition for use in any one method of embodiments 1-5 or any one of embodiments 8-19, wherein the composition reduces amyloid deposits in at least one tissue.

Embodiment 21: A composition for the method or use of embodiment 20, wherein at least one tissue comprises one or more of the stomach, colon, sciatic nerve, or dorsal root ganglion.

Embodiment 22: A composition for the method or use of embodiment 20 or 21, wherein amyloid deposition is measured 8 weeks after administration of the composition.

Embodiment 23: A composition for any one method or use of embodiments 20-22, wherein amyloid deposition is compared to a level measured prior to administration of the negative control or composition.

Embodiment 24: A composition for any one of embodiments 20-23, wherein amyloid deposition is measured in a biopsy sample and / or by immunostaining.

Embodiment 25: Amyloid deposits are 30-35%, 35-40%, 40-45%, 45-50%, 50-55%, 55-60%, 60-65% of the amyloid deposits seen in the negative control. , 65-70%, 70-75%, 75-80%, 80-85%, 85-90%, 90-95%, or 95-99% reduction, any one of embodiments 20-24. Composition for one method or use.

Embodiment 26: 30-35%, 35-40%, 40-45%, 45-50%, 50-55%, 55-60% of amyloid deposits seen prior to administration of the composition. Embodiments 20-25, reduced by 60-65%, 65-70%, 70-75%, 75-80%, 80-85%, 85-90%, 90-95%, or 95-99%. A composition for any one method or use of.

Embodiment 27: A composition for any one method or use of embodiments 1-5 or 8-26, wherein the composition is administered or delivered at least twice.

Embodiment 28: A composition for the method or use of embodiment 27, wherein the composition is administered or delivered at least 3 times.

Embodiment 29: A composition for the method or use of embodiment 27, wherein the composition is administered or delivered at least 4 times.

Embodiment 30: A composition for the method or use of Embodiment 27, wherein the composition is administered or delivered up to 5, 6, 7, 8, 9, or 10 times.

Embodiment 31: Administration or delivery is performed at intervals of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 days, embodiments 27- A composition for any one of the thirty methods or uses.

Embodiment 32: Administration or delivery is performed at intervals of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 weeks, embodiments 27- A composition for any one of the thirty methods or uses.

Embodiment 33: Administration or delivery is performed at intervals of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 months, embodiment 27. Compositions for any one method or use of ~ 30.

Embodiment 34: The method or composition of any one of embodiments 1-33, wherein the guide sequence is selected from SEQ ID NOs: 5-82.

Embodiment 35: The method or composition of any one of embodiments 1-34, wherein the guide RNA is at least partially complementary to the target sequence present in the human TTR gene.

36: The method or composition of embodiment 35, wherein the target sequence is in exons 1, 2, 3, or 4 of the human TTR gene.

Embodiment 37: The method or composition of embodiment 35, wherein the target sequence is in exon 1 of the human TTR gene.

38: The method or composition of embodiment 35, wherein the target sequence is in exon 2 of the human TTR gene.

39: The method or composition of embodiment 35, wherein the target sequence is in exon 3 of the human TTR gene.

Embodiment 40: The method or composition of embodiment 35, wherein the target sequence is in exon 4 of the human TTR gene.

Embodiment 41: The method or composition of any one of embodiments 1-40, wherein the guide sequence is complementary to the target sequence in the normal chain of the TTR.

Embodiment 42: The method or composition of any one of embodiments 1-40, wherein the guide sequence is complementary to the target sequence in the negative strand of the TTR.

Embodiment 43: The first guide sequence is complementary to the first target sequence in the normal strand of the TTR gene, and the composition is complementary to the second target sequence in the negative strand of the TTR gene. The method or composition of any one of embodiments 1-40, further comprising a second guide sequence.

Embodiment 44: Embodiments 1-43, wherein the guide RNA comprises a crRNA comprising a guide sequence and further comprising a nucleotide sequence of SEQ ID NO: 126, the nucleotide of SEQ ID NO: 126 following the guide sequence at its 3'end. Any one method or composition of.

Embodiment 45: The method or composition of any one of embodiments 1-44, wherein the guide RNA is dual guide (dgRNA).

Embodiment 46: of embodiment 45, wherein the dual guide RNA comprises crRNA and trRNA, the crRNA comprises a nucleotide sequence of SEQ ID NO: 126, and the nucleotide of SEQ ID NO: 126 follows the guide sequence at its 3'end. Method or composition.

Embodiment 47: The method or composition of any one of embodiments 1-43, wherein the guide RNA is a single guide (sgRNA).

Embodiment 48: The method or composition of embodiment 47, wherein the sgRNA comprises a guide sequence having the pattern of SEQ ID NO: 3.

Embodiment 49: The method or composition of Embodiment 47, wherein the sgRNA comprises the sequence of SEQ ID NO: 3.

Embodiment 50: of Embodiment 48 or 49, wherein each N in SEQ ID NO: 3 is any natural or unnatural nucleotide, N forms a guide sequence, and the guide sequence targets Cas9 to the TTR gene. Method or composition.

51: The method or composition of any one of embodiments 47-50, wherein the sgRNA comprises any one of the guide sequences of SEQ ID NOs: 5-82 and the nucleotide of SEQ ID NO: 126.

Embodiment 52: The sgRNA is at least 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, or 90% with the sequence selected from SEQ ID NOs: 87-124. The method or composition of any one of embodiments 47-51, comprising the same guide sequence.

53: The method or composition of embodiment 47, wherein the sgRNA comprises a sequence selected from SEQ ID NOs: 87-124.

Embodiment 54: The method or composition of any one of embodiments 1-53, wherein the guide RNA comprises at least one modification.

55: The method or composition of embodiment 54, wherein at least one modification comprises a 2'-O-methyl (2'-O-Me) modified nucleotide.

Embodiment 56: The method or composition of embodiment 54 or 55, wherein at least one modification comprises a phosphorothioate (PS) bond between nucleotides.

Embodiment 57: The method or composition of any one of embodiments 54-56, wherein at least one modification comprises a 2'-fluoro (2'-F) modified nucleotide.

58: The method or composition of any one of embodiments 54-57, wherein at least one modification comprises a modification at one or more of the first five nucleotides at the 5'end.

Embodiment 59: The method or composition of any one of embodiments 54-58, wherein at least one modification comprises a modification in one or more of the last five nucleotides at the 3'end.

Embodiment 60: The method or composition of any one of embodiments 54-59, wherein at least one modification comprises a PS bond between the first four nucleotides.

Embodiment 61: The method or composition of any one of embodiments 54-60, wherein at least one modification comprises a PS bond between the last four nucleotides.

Embodiment 62: The method or composition of any one of embodiments 54-61, wherein at least one modification comprises a 2'-O-Me modified nucleotide in the first three nucleotides at the 5'end.

Embodiment 63: The method or composition of any one of embodiments 54-62, wherein at least one modification comprises a 2'-O-Me modified nucleotide in the last three nucleotides at the 3'end.

Embodiment 64: The method or composition of any one of embodiments 54-63, wherein the guide RNA comprises a modified nucleotide of SEQ ID NO: 3.

Embodiment 65: The method or composition of any one of embodiments 1-64, wherein the composition further comprises a pharmaceutically acceptable excipient.

Embodiment 66: The method or composition of any one of embodiments 1-65, wherein the guide RNA is associated with lipid nanoparticles (LNPs).

Embodiment 67: The method or composition of embodiment 66, wherein the LNP comprises a CCD lipid.

Embodiment 68: The method or composition of embodiment 67, wherein the CCD lipid is Lipid a or Lipid B.

Embodiment 69: The method or composition of embodiments 66-68, wherein the LNP comprises triglycerides.

Embodiment 70: The method or composition of embodiment 69, wherein the triglyceride is DSPC.

Embodiment 71: The method or composition of any one of embodiments 66-70, wherein the LNP comprises a helper lipid.

Embodiment 72: The method or composition of embodiment 71, wherein the helper lipid is cholesterol.

Embodiment 73: The method or composition of any one of embodiments 66-72, wherein the LNP comprises a stealth lipid.

Embodiment 74: The method or composition of embodiment 73, wherein the stealth lipid is PEG2k-DMG.

Embodiment 75: The method or composition of any one of embodiments 1-74, wherein the composition further comprises an RNA-guided DNA binder.

Embodiment 76: The method or composition of any one of embodiments 1-75, wherein the composition further comprises mRNA encoding an RNA-guided DNA binder.

Embodiment 77: The method or composition of embodiment 75 or 76, wherein the RNA-guided DNA binder is Cas Crybase.

Embodiment 78: The method or composition of embodiment 77, wherein the RNA-guided DNA binder is Cas9.

Embodiment 79: The method or composition of any one of embodiments 75-78, wherein the RNA-guided DNA binder is modified.

80: The method or composition of any one of embodiments 75-79, wherein the RNA-guided DNA binder is nickase.

Embodiment 81: The method or composition of embodiment 79 or 80, wherein the modified RNA-guided DNA binder comprises a nuclear localization signal (NLS).

Embodiment 82: The method or composition of any one of embodiments 75-81, wherein the RNA-guided DNA binder is Cas from a Type II CRISPR / Cas system.

Embodiment 83: The method or composition of any one of embodiments 1-82, wherein the composition is a pharmaceutical formulation and further comprises a pharmaceutically acceptable carrier.

Embodiment 84: A composition for any one method or use of embodiments 1-5 or 8-83, wherein the composition reduces or prevents amyloid or amyloid fibrils, including TTR.

Embodiment 85: A composition for the method or use of embodiment 84, wherein the amyloid or amyloid fibrils are in the nerve, heart, or gastrointestinal tract (gastrointestinal track).

Embodiment 86: A composition for the method or use of any one of embodiments 1-5 or 8-83, wherein the non-homologous end joining (NHEJ) results in a mutation during the repair of the DSB in the TTR gene.

Embodiment 87: A composition for the method or use of Embodiment 86, wherein NHEJ results in the deletion or insertion of nucleotides during the repair of DSB in the TTR gene.

Embodiment 88: A composition for the method or use of Embodiment 87, wherein deletion or insertion of nucleotides induces a frameshift or nonsense mutation in the TTR gene.

Embodiment 89: A composition for the method or use of Embodiment 87, in which a frameshift or nonsense mutation is induced in at least 50% of the hepatocyte TTR gene.

Embodiment 90: Frameshift or nonsense mutations are 50% -60%, 60% -70%, 70% or 80%, 80% -90%, 90-95%, 95% -99%, or 99%. A composition for the method or use of embodiment 89, which is induced in the TTR gene of ~ 100% hepatocytes.

Embodiment 91: A composition for any one method or use of embodiments 87-90, in which nucleotide deletion or insertion occurs in the TTR gene at least 50-fold or more than at the off-target site.

Embodiment 92: Nucleotide deletion or insertion is 50 to 150 times, 150 to 500 times, 500 to 1500 times, 1500 to 5000 times, 5000 to 15000 times, 15000 times more than at the off-target site. A composition for the method or use of embodiment 91 that occurs in the TTR gene up to 30,000 times, or 30,000 to 60,000 times more.

Embodiment 93: Nucleotide deletion or insertion occurs in primary human hepatocytes at an off-target site less than 3, 2, 1, or 0 or equal to 3, 2, 1, or 0 and optionally off-target. A composition for the method or use of any one of embodiments 87-92, wherein the site does not occur in the protein coding region of the genome of primary human hepatocytes.

Embodiment 94: Nucleotide deletions or insertions occur in fewer off-target sites in primary human hepatocytes than in Cas9 overexpressing cells where nucleotide deletions or insertions occur, optionally. A composition for the method or use of embodiment 93, wherein the off-target site does not occur in the protein coding region of the genome of primary human hepatocytes.

Embodiment 95: A composition for the method or use of Embodiment 94, wherein the Cas9 overexpressing cells are HEK293 cells that stably express Cas9.

Embodiment 96: The number of off-target sites in primary human hepatocytes is determined by analyzing genomic DNA from primary human hepatocytes transfected with Cas9 mRNA and guide RNA in vitro, optionally. A composition for the method or use of any one of embodiments 93-95, wherein the off-target site does not occur in the protein coding region of the genome of primary human hepatocytes.

Embodiment 97: Oligonucleotides in which the number of off-target sites in primary human hepatocytes comprises analyzing genomic DNA from primary human hepatocytes transfected with Cas9 mRNA, guide RNA, and donor oligonucleotides in vitro. A composition for the method or use of any one of embodiments 93-95, as determined by the insertion assay, where, optionally, off-target sites do not occur in the protein coding region of the genome of primary human hepatocytes.

Embodiment 98: The sequence of the guide RNA
a) SEQ ID NO: 92 or 104;
b) SEQ ID NO: 87, 89, 96, or 113;
c) SEQ ID NO: 100, 102, 106, 111, or 112; or d) SEQ ID NO: 88, 90, 91, 93, 94, 95, 97, 101, 103, 108, or 109
And optionally, the method or composition of any one of embodiments 1-43 or 47-97, wherein the guide RNA does not produce indels at off-target sites that occur in the protein coding region of the genome of primary human hepatocytes. Stuff.

Embodiment 99: A composition for any one method or use of embodiments 1-5 or 8-98, wherein administering the composition reduces the level of TTR in the subject.

Embodiment 100: A composition for the method or use of Embodiment 99, wherein the level of TTR is reduced by at least 50%.

Embodiment 101: The level of TTR is 50% -60%, 60% -70%, 70% or 80%, 80% -90%, 90-95%, 95% -99%, or 99% -100%. A reduced composition for the method or use of embodiment 100.

Embodiment 102: A composition for the method or use of embodiment 100 or 101, wherein the level of TTR is measured in serum, plasma, blood, cerebrospinal fluid, or sputum.

Embodiment 103: A composition for the method or use of embodiment 100 or 101, wherein the level of TTR is measured in the liver, choroid plexus, and / or retina.

Embodiment 104: A composition for any one method or use of embodiments 99-103, wherein the level of TTR is measured via an enzyme-linked immunosorbent assay (ELISA).

Embodiment 105: A composition for the method or use of any one of embodiments 1-5 or 8-104, wherein the subject has an ATTR.

Embodiment 106: A composition for the method or use of any one of embodiments 1-5 or 8-105, wherein the subject is human.

Embodiment 107: A composition for the method or use of embodiment 105 or 106, wherein the subject has ATTRwt.

Embodiment 108: A composition for the method or use of embodiment 105 or 106, wherein the subject has a hereditary ATTR.

Embodiment 109: A composition for the method or use of any one of embodiments 1-5, 8-106, or 108, wherein the subject has a family history of ATTR.

Embodiment 110: A composition for the method or use of any one of embodiments 1-5, 8-106, or 108-109, wherein the subject has familial amyloid polyneuropathy.

Embodiment 111: A composition for the method or use of any one of embodiments 1-5 or 8-110, wherein the subject has only ATTR neurological symptoms or predominantly ATTR neurological symptoms.

Embodiment 112: A composition for the method or use of any one of embodiments 1-5 or 8-110, wherein the subject has familial amyloid cardiomyopathy.

Embodiment 113: Composition for any one method or use of embodiments 1-5, 8-109, or 112, wherein the subject has only ATTR cardiac symptoms or predominantly ATTR cardiac symptoms. Stuff.

Embodiment 114: A composition for the method or use of any one of embodiments 1-5 or 8-113, wherein the subject expresses a TTR with a V30 mutation.

Embodiment 115: A composition for the method or use of embodiment 114, wherein the V30 mutation is V30A, V30G, V30L, or V30M.

Embodiment 116: A composition for the method or use of any one of embodiments 1-5 or 8-113, wherein the subject expresses a TTR with a T60 mutation.

Embodiment 117: A composition for the method or use of embodiment 116, wherein the T60 mutation is T60A.

Embodiment 118: A composition for the method or use of any one of embodiments 1-5 or 8-113, wherein the subject expresses a TTR with a V122 mutation.

Embodiment 119: A composition for the method or use of embodiment 118, wherein the V122 mutation is V122A, V122I, or V122 (−).

Embodiment 120: A composition for the method or use of any one of embodiments 1-5 or 8-119, wherein the subject expresses wild-type TTR.

Embodiment 121: A composition for the method or use of any one of embodiments 1-5, 8-107, or 120, wherein the subject does not express a TTR with a V30, T60, or V122 mutation.

Embodiment 122: A composition for the method or use of any one of embodiments 1-5, 8-107, or 120-121, wherein the subject does not express a TTR with a pathological mutation.

Embodiment 123: A composition for the method or use of embodiment 121, wherein the subject is homozygous for a wild-type TTR.

Embodiment 124: Composition for any one method or use of embodiments 1-5 or 8-123, wherein the subject has amelioration, stabilization, or slowing of change in the symptoms of sensorimotor neuropathy after administration. Stuff.

Embodiment 125: For the method or use of Embodiment 124, in which improvement, stabilization, or slowing of change in sensory neuropathy is measured using electromyography, nerve conduction studies, or patient-reported outcomes. Composition.

Embodiment 126: A composition for any one method or use of Embodiments 1-5 or 8-125, wherein the subject has amelioration, stabilization, or slowing of change in the symptoms of congestive heart failure.

Embodiment 127: The method of embodiment 126, wherein amelioration, stabilization, or slowing of change in congestive heart failure is measured using cardiac biomarker testing, pulmonary function testing, chest x-ray, or electrocardiography. Or a composition for use.

Embodiment 128: A composition for the method or use of any one of embodiments 1-5 or 8-127, wherein the composition or pharmaceutical formulation is administered via a viral vector.

Embodiment 129: A composition for any one method or use of embodiments 1-5 or 8-127, wherein the composition or pharmaceutical formulation is administered via lipid nanoparticles.

Embodiment 130: Composition for any one method or use of embodiments 1-5 or 8-129, wherein the subject is tested for a particular mutation in the TTR gene prior to administration of the composition or formulation. Stuff.

Embodiment 131: The method or composition of any one of embodiments 1-130, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 5.

Embodiment 132: The method or composition of any one of embodiments 1-30, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 6.

Embodiment 133: The method or composition of any one of embodiments 1-30, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 7.

Embodiment 134: The method or composition of any one of embodiments 1-30, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 8.

Embodiment 135: The method or composition of any one of embodiments 1-30, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 9.

Embodiment 136: The method or composition of any one of embodiments 1-30, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 10.

137: The method or composition of any one of embodiments 1-30, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 11.

138: The method or composition of any one of embodiments 1-30, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 12.

139: The method or composition of any one of embodiments 1-30, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 13.

Embodiment 140: The method or composition of any one of embodiments 1-30, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 14.

Embodiment 141: The method or composition of any one of embodiments 1-130, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 15.

Embodiment 142: The method or composition of any one of embodiments 1-130, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 16.

143: The method or composition of any one of embodiments 1-130, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 17.

Embodiment 144: The method or composition of any one of embodiments 1-130, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 18.

Embodiment 145: The method or composition of any one of embodiments 1-130, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 19.

146: The method or composition of any one of embodiments 1-130, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 20.

147: The method or composition of any one of embodiments 1-130, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 21.

148: The method or composition of any one of embodiments 1-130, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 22.

149: The method or composition of any one of embodiments 1-130, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 23.

Embodiment 150: The method or composition of any one of embodiments 1-30, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 24.

151: The method or composition of any one of embodiments 1-130, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 25.

Embodiment 152: The method or composition of any one of embodiments 1-130, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 26.

153: The method or composition of any one of embodiments 1-130, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 27.

154: The method or composition of any one of embodiments 1-130, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 28.

Embodiment 155: The method or composition of any one of embodiments 1-130, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 29.

156: The method or composition of any one of embodiments 1-130, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 30.

157: The method or composition of any one of embodiments 1-130, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 31.

158: The method or composition of any one of embodiments 1-130, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 32.

Embodiment 159: The method or composition of any one of embodiments 1-130, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 33.

Embodiment 160: The method or composition of any one of embodiments 1-30, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 34.

161: The method or composition of any one of embodiments 1-130, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 35.

Embodiment 162: The method or composition of any one of embodiments 1-130, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 36.

163: The method or composition of any one of embodiments 1-30, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 37.

Embodiment 164: The method or composition of any one of embodiments 1-130, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 38.

Embodiment 165: The method or composition of any one of embodiments 1-130, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 39.

Embodiment 166: The method or composition of any one of embodiments 1-130, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 40.

167: The method or composition of any one of embodiments 1-30, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 41.

168: The method or composition of any one of embodiments 1-130, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 42.

Embodiment 169: The method or composition of any one of embodiments 1-130, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 43.

Embodiment 170: The method or composition of any one of embodiments 1-30, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 44.

171: The method or composition of any one of embodiments 1-130, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 45.

172: The method or composition of any one of embodiments 1-130, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 46.

173: The method or composition of any one of embodiments 1-30, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 47.

Embodiment 174: The method or composition of any one of embodiments 1-130, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 48.

Embodiment 175: The method or composition of any one of embodiments 1-130, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 49.

176: The method or composition of any one of embodiments 1-30, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 50.

177: The method or composition of any one of embodiments 1-130, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 51.

178: The method or composition of any one of embodiments 1-130, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 52.

179: The method or composition of any one of embodiments 1-130, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 53.

180: The method or composition of any one of embodiments 1-30, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 54.

181: The method or composition of any one of embodiments 1-130, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 55.

182: The method or composition of any one of embodiments 1-130, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 56.

183: The method or composition of any one of embodiments 1-130, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 57.

184: The method or composition of any one of embodiments 1-130, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 58.

Embodiment 185: The method or composition of any one of embodiments 1-130, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 59.

186: The method or composition of any one of embodiments 1-130, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 60.

187: The method or composition of any one of embodiments 1-30, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 61.

188: The method or composition of any one of embodiments 1-130, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 62.

Embodiment 189: The method or composition of any one of embodiments 1-130, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 63.

Embodiment 190: The method or composition of any one of embodiments 1-30, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 64.

191: The method or composition of any one of embodiments 1-130, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 65.

Embodiment 192: The method or composition of any one of embodiments 1-130, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 66.

193: The method or composition of any one of embodiments 1-130, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 67.

Embodiment 194: The method or composition of any one of embodiments 1-130, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 68.

Embodiment 195: The method or composition of any one of embodiments 1-130, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 69.

Embodiment 196: The method or composition of any one of embodiments 1-130, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 70.

Embodiment 197: The method or composition of any one of embodiments 1-130, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 71.

Embodiment 198: The method or composition of any one of embodiments 1-130, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 72.

199: The method or composition of any one of embodiments 1-130, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 73.

Embodiment 200: The method or composition of any one of embodiments 1-30, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 74.

Embodiment 201: The method or composition of any one of embodiments 1-130, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 75.

Embodiment 202: The method or composition of any one of embodiments 1-30, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 76.

Embodiment 203: The method or composition of any one of embodiments 1-30, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 77.

Embodiment 204: The method or composition of any one of embodiments 1-30, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 78.

Embodiment 205: The method or composition of any one of embodiments 1-130, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 79.

Embodiment 206: The method or composition of any one of embodiments 1-30, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 80.

Embodiment 207: The method or composition of any one of embodiments 1-30, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 81.

Embodiment 208: The method or composition of any one of embodiments 1-30, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 82.

Embodiment 209: Use of the composition or formulation of any of embodiments 6-208 for the preparation of a medicament for treating a human subject with ATTR.

Also disclosed is the use of any of the compositions or formulations of the preceding embodiments for the preparation of a medicament for treating a human subject having an ATTR. Also disclosed is either a preceding composition or formulation for use in the treatment of ATTR or in modification of the TTR gene (eg, formation of indels in the TTR gene, or frameshift or nonsense mutation formation). Will be done.

FIG. 1 shows a block diagram of chromosome 18 having a region of the TTR gene targeted by the guide sequences provided in Table 1. FIG. 2 shows off-target analysis of certain dual guide RNAs targeting TTR in HEK293_Cas9 cells. For each dual guide RNA tested, the on-target site is indicated by a black square, while the black circle represents a potential off-target site. FIG. 3 shows off-target analysis of certain single guide RNAs targeting TTR in HEK_Cas9 cells. For each single guide RNA tested, the on-target site is indicated by a black square, while the white circles represent the potential off-target site. FIG. 4 shows a dose response curve of a human TTR-specific sgRNA containing lipid nanoparticles in primary human hepatocytes. FIG. 5 shows the dose response curve of human TTR-specific sgRNA containing lipid nanoparticles in primary cynohepatocytes. FIG. 6 shows the dose response curve of cynomolgus monkey TTR-specific sgRNA containing lipid nanoparticles in primary cynomolgus monkey hepatocytes. FIG. 7 shows the edit percent (edit%) of TTR after administration and the reduction of secreted TTR in HUH7 cells of the guide sequence provided on the x-axis. Values are normalized to the amount of alpha-1-antitrypsin (AAT) protein. FIG. 8 shows a Western blot analysis of intracellular TTR after administration of a targeted guide (listed in Table 1) in HUH7 cells. FIG. 9 shows the liver edit percentage of TTR observed after administration of the LNP formulation to mice with humanized (G481-G499) or mouse (G282) TTR. Note: The first three "0" s in each guide ID are omitted from the figure, for example "G481" is "G000481" in Tables 2 and 3. 10A-B show serum TTR levels observed after the dosing regimen pointing to the horizontal axis as μg / ml (FIG. 10A) or a percentage of TSS controls (FIG. 10B). MPK = mg / kg throughout. Same as above. 11A-B show serum TTR levels observed after the dosing regimen pointing to the horizontal axis for a dose of 1 mg / kg (FIG. 11A) or 0.5 mg / kg (FIG. 11B). Data for a single 2 mg / kg dose are included in the right column in both panels. Same as above. 12A-B show the liver edit percentages observed after the dosing regimen pointing to the horizontal axis for a dose of 1 mg / kg (FIG. 12A) or 0.5 mg / kg (FIG. 12B). FIG. 12C shows the liver editing percentages observed after a single dose of 0.5, 1, or 2 mg / kg. Same as above. Same as above. FIG. 13 shows the liver edit percentage observed after administration of the LNP formulation to humanized mice for the TTR gene. Note: The first three "0" s in each guide ID are omitted from the figure, for example "G481" is "G000481" in Tables 2 and 3. 14A-B show a correlation between liver editing (FIG. 14A) after administration of the LNP formulation to humanized mice for the TTR gene and serum human TTR levels (FIG. 14B). Note: The first three "0" s in each guide ID are omitted from the figure, for example "G481" is "G000481" in Tables 2 and 3. Same as above. 15A-B show the dose response for edit percent (FIG. 15A) and serum TTR levels (FIG. 15B) in wild-type mice after administration of the LNP formulation containing Guide G502, which is cross-homologous between mice and cynomolgus monkeys. Indicates that there is. Same as above. FIG. 16 shows a dose response curve of a human TTR-specific sgRNA containing lipid nanoparticles in primary cynomolgus monkey hepatocytes. FIG. 17 shows the dose response curve of cynomolgus monkey TTR-specific sgRNA containing lipid nanoparticles in primary human hepatocytes. FIG. 18 shows the dose response curve of cynomolgus monkey TTR-specific sgRNA containing lipid nanoparticles in primary cynomolgus monkey hepatocytes. 19A-D show serum TTR (% of TSS; FIGS. 19A and 19C) and editing results (FIGS. 19B and 19D) after administration of the LNP formulation at the indicated ratios and amounts. Same as above. Same as above. Same as above. FIG. 20 shows an off-target analysis of a particular single guide RNA in primary human hepatocytes (PHH) targeting TTR. In the graph, the black squares represent the identification of on-target cleavage sites and the white circles represent the identification of potential off-target sites. 21A-B show the edit percentages at the on-target (ONT, FIG. 21A) and two off-target sites (OT2 and OT4) in primary human hepatocytes after administration of G000480 with lipid nanoparticles. FIG. 21B is a rescaled version of the OT2, OT4, and negative control data in FIG. 21A. Same as above. 22A-B show the edit percentages at the on-target (ONT, FIG. 22A) and off-target sites (OT4) in primary human hepatocytes after administration of G000486 with lipid nanoparticles. FIG. 22B is a rescaled version of the OT4 and negative control data in FIG. 22A. Same as above. 23A-B show the edit percentage at the TTR locus (FIG. 23A) and the number of insertion and deletion events (FIG. 23B). FIG. 23A shows the edit percentage at the TTR locus in the control and treatment (administered TTR-specific sgRNA with lipid nanoparticles) group. FIG. 23B shows the number of insertion and deletion events at the TTR locus when editing was observed in the treatment group of FIG. 23A. Same as above. 24A-B show TTR levels (μg / mL) in circulating serum (FIG. 24A) and cerebrospinal fluid (CSF) (FIG. 24B) for control and treatment (administered TTR-specific sgRNA with lipid nanoparticles) groups, respectively. ) Is shown. Treatment resulted in a knockdown of> 99% of TTR levels in serum. Same as above. 25A-D show the stomach (FIG. 25A), colon (FIG. 25B), sciatic nerve (FIG. 25C), and dorsal root ganglion (DRG) from control and treated (administered TTR-specific sgRNA with lipid nanoparticles) mice. ) (Fig. 25D) shows an immunohistochemical image with staining for TTR. The bar graph on the right shows the reduction in TTR staining after 8 weeks of treatment in treated mice as measured by the percentage of occupied area for each tissue species. Same as above. Same as above. Same as above. 26A-C are administered LNP formulations over a dose range having guides G000480, G000488, G000489 and G000502 and containing Cas9 mRNA (SEQ ID NO: 1) in a weight ratio of 1: 1 to the guide. The results of liver TTR editing (FIG. 26A) and serum TTR (μg / mL (FIG. 26B) and percentage of TSS-treated controls (FIG. 26C)) from the humanized TTR mice are shown, respectively. Same as above. Same as above. 27A-C are administered LNP formulations over a dose range having guides G000481, G000482, G000486 and G000499 and containing Cas9 mRNA (SEQ ID NO: 1) in a weight ratio of 1: 1 to the guide. The results of liver TTR editing (FIG. 27A) and serum TTR (μg / mL (FIG. 27B) and percentage of TSS-treated controls (FIG. 27C)) from the humanized TTR mice are shown, respectively. Same as above. Same as above. FIGS. 28A-C show a dose range of LNP formulations having guides G000480, G000481, G000486, G000499 and G000502 and containing Cas9 mRNA (SEQ ID NO: 1) in a weight ratio of 1: 2 to the guide. The results of liver TTR editing (FIG. 28A) and serum TTR (μg / mL (FIG. 28B) and percentage of TSS-treated controls (FIG. 28C)) from the treated humanized TTR mice are shown, respectively. Same as above. Same as above. FIG. 29 shows the relative expression of TTR mRNA in primary human hepatocytes (PHH) after treatment with LNP containing Cas9 mRNA and gRNA as indicated, compared to a negative (untreated) control. FIG. 30 shows the relative expression of TTR mRNA in primary human hepatocytes (PHH) after treatment with LNP containing Cas9 mRNA and gRNA as indicated, compared to a negative (untreated) control.

A particular embodiment of the invention, the example of which is illustrated in the accompanying drawings, is referred to in more detail. Although the invention is described in combination with the embodiments shown, it will be understood that they are not intended to limit the invention to those embodiments. Conversely, the invention is intended to cover all alternatives, modifications, and equivalents that may be included in the invention as defined by the appended claims.

Prior to describing the teachings in detail, it should be understood that the disclosure is not limited to a particular composition or method step and may be modified. As used herein and in the appended claims, the singular forms "a", "an" and "the" include references to multiple unless the context clearly stipulates otherwise. It should be noted that. Thus, for example, a reference to a "conjugate" includes a plurality of conjugates, a reference to a "cell" includes a plurality of cells, and so on.

The numerical range includes the numbers that define the range. It is understood that the measured and measurable values are approximate, taking into account the significant figures and errors associated with the measurement. Also, "comprise", "contain" (comprises), "contain" (comprising), "contain" (contain), "contain" (constains), "contain" (contining), "contain". The use of (include), "includes", and "include" is not intended to be limited. It should be understood that both the above summary and detailed description are exemplary and descriptive and do not limit teaching.

Unless otherwise stated in the above provisions, embodiments herein that state to "contain" various components are also assumed to be "consisting of" or "essentially consisting of" the described components. Embodiments herein to describe that the various components "consist of" are also assumed to "contain" or "essentially consist of" the components described and the various components "consisting of". Embodiments herein stating that "becomes essentially" are also assumed to "consist of" or "contain" the described component (this interchangeability is claimed). Does not apply to the use of these terms in the scope of. The term "or" is used in an inclusive sense, that is, it is equivalent to "and / or" unless the context explicitly indicates otherwise.

The section headings used herein are for documentary purposes only and should not be construed in any way as limiting the desired subject matter. If any material incorporated by reference conflicts with any term defined herein or any other representation of the specification, this specification shall prevail. Although the teachings are described in combination with various embodiments, it is not intended that the teachings be limited to such embodiments. On the contrary, the teachings include various alternatives, modifications, and equivalents as understood by those skilled in the art.

I. Definitions Unless otherwise stated, the following terms and phrases used herein are intended to have the following meanings:

"Polynucleotide" and "nucleic acid" are used herein to refer to a multimer compound containing a nucleoside or nucleoside analog having a nitrogen-containing heterocyclic base or base analog linked along the backbone, conventional RNA, Includes DNA, RNA-DNA mixtures, and polymers that are analogs of these. Nucleic acid "skeletons" include sugar-phosphodiester bonds, peptide-nucleic acid bonds ("peptide nucleic acid" or PNA; PCT WO 95/32305), phosphorothioate linkages, methylphosphonate linkages, or one or more combinations thereof. It can consist of various connections. The sugar moiety of the nucleic acid can be ribose, deoxyribose, or a similar compound with a substitution, such as a 2'methoxy or 2'halide substitution. Nitrogen-containing bases are conventional bases (A, G, C, T, U), analogs thereof (eg, modified uridines such as 5-methoxyuridine, pseudouridine, or N1-methylpseudouridine, or others); inosine; purine or pyrimidine derivatives (e.g., N 4 ^- methyl deoxyguanosine, deaza or azapurines, deaza or aza pyrimidine, pyrimidine bases (e.g., 5-methyl cytosine having a substituent at the 5-position or 6-position), 2,6 or purine bases having substituent groups at the 8-position, 2-amino-6-methylamino purine, ^{O 6,} - methylguanine, 4-thio - pyrimidine, 4-amino - pyrimidine, 4-dimethylhydrazine - pyrimidine, and ^{O 4} -Alkyl-pyrimidine; US Pat. No. 5,378,825 and PCT WO 93/13121). General Discussion The Biochemistry of the Nucleic Acids 5-36, Adams et al. , Ed. , 11th ed. , 1992. Nucleic acids can contain one or more "debase" residues whose backbone is nitrogen-free for the position of the polymer (US Pat. No. 5,585,481). Nucleic acids can contain only normal RNA or DNA sugars, bases and linkages, or can contain both normal components and substitutions (eg, normal bases with 2'methoxy linkages, or normal Bases and polymers containing one or more base analogs). The nucleic acid is one or more "locked nucleic acids" (LNAs), having bicyclic flanose units locked in RNA that mimics the sugar structure, which enhances hybridization affinity for complementary RNAs and DNA sequences. Includes analogs containing LNA nucleotide monomers (Vester and Wangel, 2004, Biochemistry 43 (42): 13233-41). RNA and DNA have different sugar moieties and can vary depending on the presence of uracil or its analogs in RNA and thymine or its analogs in DNA.

"Guide RNA", "gRNA", and "guide" are interchangeable herein to refer to either crRNA (also known as CRISPR RNA) or a combination of crRNA and trRNA (also known as tracrRNA). Used for. The crRNA and trRNA can be associated as a single RNA molecule (single guide RNA, sgRNA) or as two separate RNA molecules (dual guide RNA, dgRNA). "Guide RNA" or "gRNA" refers to each type. The trRNA may be a naturally occurring sequence or a trRNA sequence that is modified or modified as compared to a naturally occurring sequence.

As used herein, a "guide sequence" is complementary to the target sequence and directs the guide RNA to the target sequence for binding or modification (eg, cleavage) with an RNA-guided DNA binding agent. Refers to a sequence in a guide RNA that functions as such. The "guide sequence" is also sometimes referred to as the "targeted sequence" or "spacer sequence". The guide sequence can be, for example, 20 base pairs long in the case of Streptococcus pyogenes (ie, Spy Cas9) and the associated Cas9 homolog / ortholog. Shorter or longer sequences can also be used as guides, the sequences being, for example, 15, 16, 17, 18, 19, 21, 22, 23, 24, or 25 nucleotides in length. For example, in some embodiments, the guide sequence comprises at least 17, 18, 19, or 20 contiguous nucleotides of the sequence selected from SEQ ID NOs: 5-82. In some embodiments, the target sequence is, for example, in a gene or on a chromosome and is complementary to a guide sequence. In some embodiments, the degree of complementarity or identity between the guide sequence and its corresponding target sequence is about 75%, 80%, 85%, 88%, 90%, 95%, 96%, It may be 97%, 98%, 99%, or 100%. For example, in some embodiments, the guide sequence is approximately 75%, 80%, 85%, 88 with at least 17, 18, 19, or 20 contiguous nucleotides of the sequence selected from SEQ ID NO: 5-82. Includes sequences with%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity. In some embodiments, the guide sequence and target region may be 100% complementary or identical. In other embodiments, the guide sequence and target region may contain at least one mismatch. For example, the guide and target sequences may contain 1, 2, 3, or 4 mismatches, and the overall length of the target sequence is at least 17, 18, 19, 20 or more base pairs. In some embodiments, the guide sequence and target region may contain 1 to 4 mismatches, and the guide sequence contains at least 17, 18, 19, 20 or more nucleotides. In some embodiments, the guide sequence and target region may contain 1, 2, 3, or 4 mismatches, and the guide sequence contains 20 nucleotides.

As the target sequence of Cas protein, since the nucleic acid substrate of Cas protein is a double-stranded nucleic acid, both positive and negative strands of genomic DNA (that is, a given sequence and an inverse complement of the sequence) can be mentioned. .. Therefore, if the guide sequence is described as "complementary to the target sequence," it should be understood that the guide sequence may orient the guide RNA to bind to the inverse complementary strand of the target sequence. is there. Thus, in some embodiments, when the guide sequence binds to the inverse complementary strand of the target sequence, the guide sequence is the target sequence (eg, a PAM-free target, except for the substitution by U for T in the guide sequence. Sequence) is identical to a particular nucleotide.

As used herein, an "RNA-guided DNA-binding agent" is a polypeptide or complex of polypeptides having RNA and DNA-binding activity, or a DNA-binding subunit of such a complex, the DNA. It means that the binding activity is sequence-specific and depends on the sequence of RNA. Exemplary RNA-guided DNA binders include Cas clibase / nickase and its inactivated form (“dCas DNA binder”). The "Cas nuclease," also referred to as the "Cas protein," as used herein, includes Cas Clibase, Cas nickase, and dCas DNA binder. Cas Crybase / nickase and dCas DNA binders include the Csm or Cmr complex of the type III CRISPR system, its Cas10, Csm1, or Cmr2 subunit, the cascade complex of the type I CRISPR system, its Cas3 subunit, and class 2. Examples include Cas nuclease. As used herein, a "class 2 Cas nuclease" is a single-stranded polypeptide having RNA-guided DNA-binding activity, such as a Cas9 nuclease or a Cpf1 nuclease. Class 2 Cas nucleases include Class 2 Cas clibase and Class 2 Cas nickase (eg, H840A, D10A, or N863A variants) that further have RNA-guided DNA cribase or nickase activity, and classes in which clibase / nickase activity is inactivated. Examples include 2 dCas DNA binders. Class 2 Casnucleases include, for example, Cas9, Cpf1, C2c1, C2c2, C2c3, HF Cas9 (eg, N497A, R661A, Q695A, Q926A variants), HypaCas9 (eg, N692A, M694A, Q695A, H698A variants). 1.0) (eg, K810A, K1003A, R1060A variants), and eSPCas9 (1.1) (eg, K848A, K1003A, R1060A variants) proteins and modifications thereof. Zetsche et al. , Cell, 163: 1-13 (2015), Cpf1 protein is homologous to Cas9 and contains a RuvC-like nuclease domain. The Zetsche Cpf1 sequence is fully incorporated by reference. See, for example, Zetsche, Table S1 and Table S3. "Cas9" includes Spy Cas9, a variant of Cas9 listed herein, and its equivalents. For example, Makarova et al. , Nat Rev Microbiol, 13 (11): 722-36 (2015); Shmakov et al. , Molecular Cell, 60: 385-397 (2015).

"Modified uridine" is used herein to refer to a nucleoside other than thymidine that has the same hydrogen-bonding receptors as uridine and has one or more structural differences from uridine. In some embodiments, the modified uridine is a substituted uridine, i.e., a uridine in which one or more aproton substituents (eg, alkoxy, eg, methoxy) substitute protons. In some embodiments, the modified uridine is a pseudouridine. In some embodiments, the modified uridine is a substituted pseudouridine, i.e. a pseudouridine in which one or more aproton substituents (eg, alkyl, eg, methyl) substitute protons. In some embodiments, the modified uridine is either a substituted uridine, a pseudo-pseudouridine, or a substituted pseudo-uridine.

As used herein, "uridine position" refers to a position in a polynucleotide occupied by uridine or modified uridine. Thus, for example, a polynucleotide "100% of the uridine position is modified uridine" is in uridine in a normal RNA of the same sequence (all bases are standard A, U, C, or G bases). Contains modified uridine at any position. Unless indicated otherwise, U in the polynucleotide sequence of the sequence listing in or attached to this disclosure can be a uridine or a modified uridine.

As used herein, when the alignment of the first sequence with respect to the second sequence indicates that X% or more of the total position of the second sequence matches the first sequence. The first sequence is considered to "contain at least a sequence having at least X% identity" with respect to the second sequence. For example, sequence AAGA contains a sequence that has 100% identity to sequence AAG, because the alignment gives 100% identity in that it matches all three positions of the second sequence. Because. The difference between RNA and DNA (generally the exchange of thymidine with uridine or vice versa) and the presence of nucleoside analogs such as modified uridine, as long as the associated nucleotides (eg, thymidine, uridine, or modified uridine) have the same complement. Identity between polynucleotides (eg, adenosine for all of thymidine, uridine, or modified uridine; another example is cytosine and 5-methylcytosine, both of which have guanosine or modified guanosine as complements). Or it does not contribute to the difference in complementarity. Thus, for example, sequence 5'-AXG, where X is any modified uridine, eg, pseudopseudouridine, N1-methylpseudouridine, or 5-methoxyuridine) is considered to be 100% identical to AUG. This is because both are completely complementary to the same sequence (5'-CAU). Exemplary alignment algorithms are the Smith-Waterman algorithm and the Needleman-Wunsch algorithm, which are well known in the art. Those skilled in the art will understand which algorithm selection and parameterization is appropriate for a given pair of sequences to be aligned and generally have similar lengths,> 50% for amino acids or> 75 for nucleotides. For sequences with% expected identity, see www. ebi. ac. The Needleman-Wunsch algorithm with the default settings of the Needleman-Wunsch algorithm interface provided by EBI on the uk web server is generally suitable.

"MRNA" is used herein to refer to a non-DNA polynucleotide that contains an open reading frame that can be translated into a polypeptide (ie, can act as a substrate for translation by ribosomes and aminoacyl-tRNAs). Will be done. The mRNA can include a phosphate skeleton containing ribose residues or analogs thereof, eg, 2'-methoxyribose residues. In some embodiments, the sugar in the mRNA phosphate skeleton consists essentially of ribose residues, 2'-methoxyribose residues, or a combination thereof. In general, mRNA does not contain a substantial amount of thymidine residues (eg, 0 residues or 30, 20, 10, 5, 4, 3, or less than 2 thymidine residues; or 10%, 9%. , 8%, 7%, 6%, 5%, 4%, 4%, 3%, 2%, 1%, 0.5%, 0.2%, or less than 0.1% thymidine content). The mRNA can contain modified uridine in some or all of its uridine positions.

As used herein, the "minimum uridine content" of a given open reading frame (ORF) is (a) using the least uridine codon at every position and (b) the same as a given ORF. The uridine content of the ORF encoding the amino acid sequence. The least uridine codon (one or more) for a given amino acid has (one or one) the least uridine (usually 0 or 1 except for the codon for phenylalanine where the least uridine codon has two uridines). Multiple) codons. Modified uridine residues are considered to be equivalent to uridine for the purpose of assessing the minimum uridine content.

As used herein, the "minimum uridine dinucleotide content" of a given open reading frame (ORF) is (a) using the minimum uridine codon (as discussed above) at all positions. And (b) the lowest possible uridine dinucleotide (UU) content of the ORF that encodes the same amino acid sequence as the given ORF. Uridine dinucleotide (UU) content is a ratio in absolute terms as the number of UU dinucleotides in the ORF or as a percentage of the positions of uridine dinucleotide occupied by uridine (eg, AUUAU is 2 of 5 positions Since one is occupied by the uridine of the uridine dinucleotide, it can be expressed on the basis of (having a 40% uridine dinucleotide content). Modified uridine residues are considered to be equivalent to uridine for the purpose of assessing the minimum uridine dinucleotide content.

As used herein, "TTR" refers to transthyretin, the gene product of the TTR gene.

As used herein, "amyloid" refers to an abnormal aggregate of a protein or peptide that is normally soluble. Amyloid is insoluble and amyloid can produce protein deposits in organs and tissues. Proteins or peptides in amyloid can be misfolded into forms that allow many copies of the protein to attach to each other to form fibrils. Although some forms of amyloid may have normal function in the human body, "amyloid" as used herein refers to an abnormal or pathological aggregate of a protein. Amyloid may contain a single protein or peptide such as TTR, or may contain multiple proteins or peptides such as TTR and additional proteins.

As used herein, "amyloid fibril" refers to an insoluble fiber of amyloid that is resistant to degradation. Amyloid fibrils can cause symptoms based on a particular protein or peptide and the type of tissue and cells in which it aggregates.

As used herein, "amyloidosis" refers to a disease characterized by symptoms caused by the deposition of amyloid or amyloid fibrils. Amyloidosis can affect a number of organs such as the heart, kidneys, liver, spleen, nervous system, and digestive tract.

As used herein, "ATTR", "TTR-related amyloidosis", "TTR amyloidosis", "ATTR amyloidosis", or "amyloidosis associated with TTR" refers to amyloidosis associated with TTR deposition.

As used herein, "familial amyloid cardiomyopathy" or "FAC" refers to hereditary transthyretin amyloidosis (ATTR), which is primarily characterized by restrictive cardiomyopathy. Congestive heart failure is common in FAC. The average age of onset is about 60-70 years, and life expectancy of 4-5 years after diagnosis is estimated.

As used herein, "familial amyloid multiple neuropathy" or "FAP" refers to hereditary transthyretin amyloidosis (ATTR), which is primarily characterized by sensorimotor neuropathy. Autonomous neuropathy is common in FAP. Although neuropathy is a major feature, symptoms of FAP can also include cachexia, renal failure, and heart disease. The average age of onset of FAP is about 30 to 50 years, and life expectancy of 5 to 15 years after diagnosis is estimated.

As used herein, "wild-type ATTR" and "ATTRwt" are associated with pathological TTR mutations such as T60A, V30M, V30A, V30G, V30L, V122I, V122A, or V122 (-). Refers to ATTR that cannot be used. ATTRwt has also been referred to as senile systemic amyloidosis. Onset typically occurs in men aged 60 or older, with the most common symptoms being congestive heart failure and abnormal cardiac rhythms, such as atrial fibrillation. Additional symptoms include consequences of cardiac dysfunction, such as shortness of breath, fatigue, dizziness, swelling (particularly swelling of the legs), nausea, angina, sleep disorders, and weight loss. The history of carpal tunnel syndrome points to an increased risk of ATTRwt and, in some cases, can be an indicator of early disease. ATTRwt generally results in a decrease in cardiac function over time, but wild-type TTR deposits accumulate more slowly and may have a better prognosis than hereditary ATTR. Existing treatments are similar to other forms of ATTR (other than liver transplantation) and generally range from diuretics and limited fluid and salt intake to anticoagulants for the support or improvement of heart function and are severe. In some cases, there is a heart transplant. Nevertheless, like FAC, ATTRwt can result in death from heart failure, optionally within 3-5 years of diagnosis.

Guide sequences useful in the guide RNA compositions and methods described herein are shown in Table 1 and throughout this application.

As used herein, "hereditary ATTR" refers to an ATTR associated with a mutation in the sequence of the TTR gene. Known mutations in the TTR gene associated with ATTR include those that result in a TTR with a substitution of T60A, V30M, V30A, V30G, V30L, V122I, V122A, or V122 (-).

As used herein, "indel" refers to an insertion / deletion mutation consisting of a number of nucleotides that are inserted or deleted at the site of a double-strand break (DSB) in a target nucleic acid.

As used herein, "knockdown" refers to reduced expression of a particular gene product (eg, protein, mRNA, or both). Protein knockdown is by detecting the protein secreted by a tissue or cell population (eg, in serum or cell culture), or by detecting the total cell mass of the protein from the tissue or cell population of interest. Can be measured. Methods for measuring mRNA knockdown are known and include sequencing of mRNA isolated from the tissue or cell population of interest. In some embodiments, "knockdown" is an mRNA transcribed by a partial loss of expression of a particular gene product, eg, an in vivo population, such as that found in a tissue. May refer to a decrease in the amount of protein expressed or secreted.

As used herein, "knockout" refers to the loss of expression of a particular protein in a cell. Knockout is measured by detecting the amount of protein secretion from a tissue or cell population (eg, in serum or cell culture), or by detecting the total cell mass of protein in a tissue or cell population. Can be done. In some embodiments, the methods of the present disclosure "knock out" TTR in one or more cells (eg, a population of cells such as an in vivo population, such as those found in tissues). In some embodiments, the knockout is a complete loss of expression of the TTR protein in the cell, rather than the formation of a mutant TTR protein produced by, for example, Indel.

As used herein, "mutant TTR" refers to a gene product of TTR (ie, a TTR protein) that has a change in the amino acid sequence of TTR as compared to the wild-type amino acid sequence of TTR. The human wild-type TTR sequence is available at NCBI Gene ID: 7276; Ensembl: Ensembl: ENSG000000118271. For example, mutant forms of TTR associated with ATTR in humans include T60A, V30M, V30A, V30G, V30L, V122I, V122A, or V122 (-).

As used herein, the "mutant TTR" or "mutant TTR allele" changes in the nucleotide sequence of the TTR as compared to the wild-type sequence (NCBI gene ID: 7276; Ensembl: ENSG000000118271). Refers to the TTR sequence that has.

As used herein, a "ribonuclear protein" (RNP) or "RNP complex" is an RNA guide such as a Cas nuclease, such as Cas cribase, Cas nickase, or dCas DNA binding agent (eg Cas9). Refers to a guide RNA with a DNA binding agent. In some embodiments, the guide RNA guides an RNA-guided DNA-binding agent, such as Cas9, to the target sequence, the guide RNA hybridizes to the target sequence, the agent binds to the target sequence, and the agent is crybase or nickase. If, cleavage or nick formation can occur after binding.

As used herein, "target sequence" refers to a sequence of nucleic acids in a target gene that has complementarity to the guide sequence of the gRNA. The interaction of the target and guide sequences directs the RNA-guided DNA binder to bind within the target sequence and optionally undergo nick formation or cleavage (depending on the activity of the agent).

As used herein, "treatment" refers to any administration or application of a treatment for a disease or disorder in a subject, inhibiting the disease, preventing its onset, alleviating one or more symptoms of the disease. Includes cure of the disease, or prevention of recurrence of one or more symptoms of the disease. For example, treatment of ATTR may include alleviation of ATTR symptoms.

"Modified uridine" is used herein to refer to a nucleoside other than thymidine that has the same hydrogen-bonding receptors as uridine and has one or more structural differences from uridine. In some embodiments, the modified uridine is a substituted uridine, i.e., a uridine in which one or more aproton substituents (eg, alkoxy, eg, methoxy) substitute protons. In some embodiments, the modified uridine is a pseudouridine. In some embodiments, the modified uridine is a substituted pseudo-pseudouridine, i.e. a pseudo-pseudouridine in which one or more asymmetric substituents (eg, alkyl, eg, methyl) substitute protons, eg, N1-methyl pseudo-uridine. .. In some embodiments, the modified uridine is either a substituted uridine, a pseudo-pseudouridine, or a substituted pseudo-uridine.

As used herein, when the alignment of the first sequence with respect to the second sequence indicates that X% or more of the total position of the second sequence matches the first sequence. The first sequence is considered to "contain at least a sequence having at least X% identity" with respect to the second sequence. For example, sequence AAGA contains a sequence that has 100% identity to sequence AAG, because the alignment gives 100% identity in that it matches all three positions of the second sequence. Because. The difference between RNA and DNA (generally the exchange of thymidine with uridine or vice versa) and the presence of nucleoside analogs such as modified uridine, as long as the associated nucleotides (eg, thymidine, uridine, or modified uridine) have the same complement. Identity or complementarity between polynucleotides (eg, adenosine for all of thymidine, uridine, or modified uridine; another example is cytosine and 5-methylcytosine, both of which have guanosine as a complement). Does not contribute to the difference. Thus, for example, sequence 5'-AXG, where X is any modified uridine, eg, pseudopseudouridine, N1-methylpseudouridine, or 5-methoxyuridine) is considered to be 100% identical to AUG. This is because both are completely complementary to the same sequence (5'-CAU). Exemplary alignment algorithms are the Smith-Waterman algorithm and the Needleman-Wunsch algorithm, which are well known in the art. Those skilled in the art will understand which algorithm selection and parameterization is appropriate for a given pair of sequences to be aligned and generally have similar lengths,> 50% for amino acids or> 75 for nucleotides. For sequences with% expected identity, see www. ebi. ac. The Needleman-Wunsch algorithm with the default settings of the Needleman-Wunsch algorithm interface provided by EBI on the uk web server is generally suitable.

The term "about" or "approximate" means an acceptable error for a particular value determined by one of ordinary skill in the art, which is partly dependent on the method by which the value is measured or determined. ..

II. Composition A. Compositions Containing Guide RNAs (gRNAs) For example, compositions useful for editing TTR genes that use guide RNAs with RNA-guided DNA binding agents (eg, the CRISPR / Cas system) are provided herein. .. The composition may be administered to a subject having a wild-type or non-wild-type TTR gene sequence, eg, a subject having an ATTR wt or an ATTR that may be in a hereditary or familial form. The guide sequences that target the TTR gene are shown in SEQ ID NOs: 5-82 in Table 1.

Each of the above guide sequences further comprises an additional nucleotide to form a crRNA containing, for example, the following exemplary nucleotide sequence: GUUUUAGAGCUAUGCUGUUUUG (SEQ ID NO: 126) following the guide sequence at its 3'end. May be good. In the case of sgRNA, the guide sequence may include additional nucleotides, eg, the following exemplary nucleotide sequence in the 5'to 3'direction following the 3'end of the guide sequence: GUUUUAGAGCUAGAAAAUAGCAAGUAAAA An sgRNA containing the number: 125) may be formed.

In some embodiments, the sgRNA is modified. In some embodiments, the sgRNA comprises the modification pattern set forth in SEQ ID NO: 3 below, where N is any natural or unnatural nucleotide, and N as a whole as described herein. includes a guide sequences, and modified sgRNA the following sequence: mN * mN * mN * NNNNNNNNNNNNNNNNNGUUUUAGAmGmCmUmAmGmAmAmAmUmAmGmCAAGUUAAAAUAAGGCUAGUCCGUUAUCAmAmCmUmUmGmAmAmAmAmAmGmUmGmGmCmAmCmCmGmAmGmUmCmGmGmUmGmCmU * mU * mU * mU (SEQ ID NO: 3), with "N" is an arbitrary natural or unnatural nucleotide May be good. For example, in SEQ ID NO: 3, N replaced by any guide sequence disclosed herein is included herein. The modifications remain as shown in SEQ ID NO: 3, even though the guide nucleotides have been replaced by N. That is, the guide nucleotide replaces the "N", but the first three nucleotides are 2'OMe modified and the second nucleotide is between the first and second nucleotides. There is a phosphorothioate link between and between the third and third nucleotides and between the third and fourth nucleotides.

In some embodiments, any one of the sequences listed in Table 2 is included.

In addition to the alignment mapping of the guide ID with the corresponding sgRNA ID, the homology to the cynomolgus monkey genome and the matching guide ID of the cynomolgus monkey are provided in Table 3.

In some embodiments, the present invention comprises one or more guide RNAs comprising a guide sequence that directs an RNA-guided DNA binding agent, which may be a nuclease (eg, Casnuclease, eg Cas9), to a target DNA sequence in a TTR. A composition containing (gRNA) is provided. The gRNA may include a crRNA containing the guide sequences shown in Table 1. The gRNA may include a crRNA containing 17, 18, 19, or 20 contiguous nucleotides of the guide sequence shown in Table 1. In some embodiments, the gRNA is approximately 75%, 80%, 85%, 90%, 95%, 96 relative to at least 17, 18, 19, or 20 contiguous nucleotides of the guide sequence shown in Table 1. Contains crRNAs containing sequences with%, 97%, 98%, 99%, or 100% identity. In some embodiments, the gRNA is approximately 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% with respect to the guide sequences shown in Table 1. Contains a crRNA containing a sequence having the same identity as. The gRNA may further include trRNA. In embodiments of each composition and method described herein, crRNAs and trRNAs may be associated as a single RNA (sgRNA) or may be on separate RNAs (dgRNAs). .. In the context of sgRNA, crRNA and trRNA components may be covalently linked, for example, via a phosphodiester bond or other covalent bond.

In each embodiment of the compositions, uses, and methods described herein, the guide RNA may comprise two RNA molecules as "dual guide RNA" or "degRNA". The ggRNA includes, for example, a first RNA molecule containing crRNA containing the guide sequences shown in Table 1 and a second RNA molecule containing trRNA. The first and second RNA molecules may not be covalently linked, but may form RNA duplexes through base pairing between crRNA and trRNA moieties.

In each embodiment of the compositions, uses, and methods described herein, the guide RNA may comprise a single RNA molecule as a "single guide RNA" or "sgRNA". The sgRNA may include a crRNA (or portion thereof) containing the guide sequence shown in Table 1 covalently linked to the trRNA. The sgRNA may contain 17, 18, 19, or 20 contiguous nucleotides of the guide sequence shown in Table 1. In some embodiments, the crRNA and trRNA are covalently linked via a linker. In some embodiments, the sgRNA forms a stem-loop structure through base pairing between the crRNA and the parts of the trRNA. In some embodiments, the crRNA and trRNA are covalently linked via one or more bonds that are not phosphodiester bonds.

In some embodiments, the trRNA may comprise all or part of the trRNA sequence from the naturally occurring CRISPR / Cas system. In some embodiments, the trRNA comprises a cleaved or modified wild-type trRNA. The length of trRNA depends on the CRISPR / Cas system used. In some embodiments, trRNAs are 5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,25,30,40,50, Contains or consists of 60, 70, 80, 90, 100, or more than 100 nucleotides. In some embodiments, the trRNA may comprise certain secondary structures, such as one or more hairpin or stem-loop structures, or one or more bulge structures.

In some embodiments, the invention provides a composition comprising one or more guide RNAs comprising any one guide sequence of SEQ ID NO: 5-82.

In one aspect, the invention is at least 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, or 90% with any of the nucleic acids of SEQ ID NO: 5-82. A composition comprising a gRNA comprising the same guide sequence is provided.

In other embodiments, the composition comprises at least one, eg, at least two gRNAs, comprising a guide sequence selected from any two or more of the guide sequences of SEQ ID NO: 5-82. In some embodiments, the composition is at least 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, with any of the nucleic acids of SEQ ID NO: 5-82. Or it contains at least two gRNAs, each containing a 90% identical guide sequence.

In some embodiments, the gRNA is an sgRNA comprising any one of the sequences shown in Table 2 (SEQ ID NOs: 87-124). In some embodiments, the gRNA comprises any one of the sequences shown in Table 2 (SEQ ID NOs: 87-124, but without the modifications shown (ie, unmodified SEQ ID NOs: 87-124)). An sgRNA comprising. In some embodiments, the sgRNA is at least 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, with any of the nucleic acids of SEQ ID NOs: 87-124. Contains 91% or 90% identical sequences. In some embodiments, the sgRNA is at least 99%, 98%, 97%, 96%, 95%, 94% with any of the nucleic acids of SEQ ID NOs: 87-124. , 93%, 92%, 91%, or 90% identical, but without modifications as shown (ie, unmodified SEQ ID NOs: 87-124). In some embodiments, the sgRNA is , With or without modification, comprising any one of the guide sequences shown in Table 1 instead of the guide sequences shown in the sgRNA sequences in SEQ ID NOs: 87-124 of Table 2.

The guide RNA compositions of the present invention are designed to recognize (eg, hybridize to, for example) a target sequence in the TTR gene. For example, the TTR target sequence may be recognized and cleaved by the provided Cas Clibase containing a guide RNA. In some embodiments, an RNA-guided DNA-binding agent such as Cas Clibase may be directed to the target sequence of the TTR gene by the guide RNA, and the guide sequence of the guide RNA hybridizes with the target sequence, such as Cas Clibase. RNA-guided DNA binding agents cleave the target sequence.

In some embodiments, the selection of one or more guide RNAs is determined based on the target sequence within the TTR gene.

Mutations in one particular region of the gene (eg, frameshift mutations resulting from indels resulting from nuclease-mediated DSBs), without being bound by any particular theory, are in other regions of the gene. The location of the DSB is an important factor in the amount or type of protein knockdown that can occur, as it may be less tolerant than mutations in. In some embodiments, gRNAs that are complementary or complementary to the target sequence within the TTR are used to direct the RNA-guided DNA binder to a particular location in the TTR gene. In some embodiments, the gRNA is designed to have a guide sequence that is complementary or complementary to the target sequence in exon 1, exon 2, exon 3, or exon 4 of the TTR.

In some embodiments, the guide sequence is at least 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, or the target sequence present in the human TTR gene. 90% identical. In some embodiments, the target sequence may be complementary to the guide sequence of the guide RNA. In some embodiments, the degree of complementarity or identity between the guide sequence of the guide RNA and its corresponding target sequence is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%. , 99%, or 100%. In some embodiments, the target sequence and the guide sequence of the gRNA may be 100% complementary or identical. In other embodiments, the target sequence and the guide sequence of the gRNA may contain at least one mismatch. For example, the target sequence and the guide sequence of the gRNA may contain 1, 2, 3, or 4 mismatches, and the total length of the guide sequence is 20. In some embodiments, the target sequence and the guide sequence of the gRNA may contain 1 to 4 mismatches, with the guide sequence being 20 nucleotides.

In some embodiments, the compositions or formulations disclosed herein include an open reading frame (ORF) that encodes an RNA-guided DNA binder such as Cas nuclease as described herein. Contains mRNA. In some embodiments, mRNA comprising an ORF encoding an RNA-guided DNA binder such as Cas nuclease is provided, used, or administered.

In some embodiments, the RNA-guided DNA binder is a class 2 Cas nuclease. In some embodiments, the RNA-guided DNA binder has a crybase activity, which can also be referred to as double-stranded endonuclease activity. In some embodiments, the RNA-guided DNA binder comprises a Cas nuclease such as a Class 2 Cas nuclease (eg, which may be a Type II, Type V, or Type VI Cas nuclease). Class 2 Cas nucleases include, for example, Cas9, Cpf1, C2c1, C2c2, and C2c3 proteins and their modifications. Examples of Cas9 nucleases include S. cerevisiae. S. pyogenes, S. pyogenes. Included are S. aureus, and Cas9 nucleases of the Type II CRISPR system of other prokaryotes (eg, see the list in the next paragraph), as well as modified (eg, engineered or mutant) types of these. .. See, for example, US 2016/0312198 A1; US 2016/0312199 A1. Other examples of Cas nucleases include the Csm or Cmr complex of the Type III CRISPR system or its Cas10, Csm1, or Cmr2 subunit; and the Cascade complex of the Type I CRISPR system, or its Cas3 subunit. In some embodiments, the Cas nuclease may be from a type IIA, type IIB, or type IIC system. For discussions of various CRISPR systems and Cas nucleases, see, eg, Makarova et al. , NAT. REV. MICROBIOL. 9: 467-477 (2011); Makarova et al. , NAT. REV. MICROBIOL, 13: 722-36 (2015); Shmakov et al. , MOLECULAR CELL, 60: 385-397 (2015).

Non-limiting exemplary species from which Cas nuclease can be derived include Streptococcus pyogenes, Streptococcus thermophilus, Streptococcus sp., Staphylococcus aureus aureus. ), Listeria innocua, Lactobacillus gasseri, Francisella novicida, Wolinella succinogenes, Sutterella succinogenes, Sutterella wadsworth , Neisseria meningitidis, Campylobacter jejuni, Pasteurella multocida, Fibrobacter succinogene, Fibrobacter succinogene, Rhodospirylum rabisson, Rhodospirum Streptomyces pristinaespiralis, Streptomyces viridochromogenes, Streptomyces viridochromogenes, Streptomyces viridochromogenes, Streptomyces viridochromogenes, Streptomyces viridochromogenes, Streptomyces viridochromogenes, Streptomyces viridochromogenes, Streptomyces viridochromogenes -Roseum (Streptosporangium roseum), Alicyclobacillus acidocaldarius, Bacillus pseudomycoides, Bacillus selenitir educens), Exiguobacterium sibiricum, Lactobacillus delbrueckii, Lactobacillus salivarius, Lactobacillus salivarius, Lactobacillus buchneri, Lactobacillus buchneri, Lactobacillus buchneri , Microscilla marina, Burkholderiales bacteria, Polaromonas naphthalenivorans, Polaromonas sp., Crocosphaera watsonii, Cyantese Bacteria (Cyanothece sp.), Microcystis aeruginosa, Synechococcus sp., Acetohalobium arabaticum, Ammonifex degensii, Ammonifex degensii, Caldi becscii), Candidatus Desulforudis, Clostridium botulinum, Clostridium difficile, Finegoldia magna, Natranaerobius thermophilus thermophilus thermophilus thermophila・ Pelotomaculum thermopropionicum, Acidithiobacillus caldus, Acidithiobacillus ferrooxidans, Allochromatium vinosum, Marinobacta r sp.), Nitrosococcus halophilus, Nitrosococcus watsoni, Pseudoalteromonas haloplanktis, Ktedonobacter racemifer, Ktedonobacter racemifer, methanoobacter racemifer ), Anabaena variabilis, Nodularia spumigena, Nostoc sp., Arthrospira maxima, Arthrospira platensis, Arthrospira platensis, Arthrospira platensis ), Lyngbya sp., Microcoleus chthonoplastes, Oscillatoria sp., Petrotoga mobilis, Thermosipho africanus, Strekosipho africanus Pastococcus pasteurianus, Neisseria cinerea, Campylobacter lari, Parvibaculum lavamentivorans, Corynebacterium diphtheria, Acidoca Sp.), Lachnospiraceae bacterium ND2006, and Acaryochloris marina.

In some embodiments, the Casnuclease is the Cas9 nuclease of Streptococcus pyogenes. In some embodiments, the Casnuclease is the Cas9 nuclease of Streptococcus thermophilus. In some embodiments, the Casnuclease is the Cas9 nuclease of Neisseria meningitidis. In some embodiments, the Casnuclease is the Cas9 nuclease of Staphylococcus aureus. In some embodiments, the Cas nuclease is the Cpf1 nuclease of Francisella novicida. In some embodiments, the Cas nuclease is a Cpf1 nuclease from Acidaminococcus sp. In some embodiments, the Cas nuclease is the Cpf1 nuclease of the Lachnospiraceae bacterium ND2006. In a further embodiment, the Casnuclease is Francisella tularensis, Lachnospiraceae bacterium, Butyrivibrio proteoclasticus, Peregrinibacteria bacterium, Parcuberia. Bacteria, Smithella, Acidaminococcus, Candidatus Methanoplasma termitum, Eubacterium eligens, Moraxella bovoculi, Leptospira bovoculi ), Porphyromonas crevioricanis, Prevotella disiens, or Porphyromonas macacae Cpf1 nuclease. In certain embodiments, the Cas nuclease is a Cpf1 nuclease from the genus Acidaminococcus or the genus Lachnospiraceae.

Wild-type Cas9 has two nuclease domains: RuvC and HNH. The RuvC domain cleaves the non-target DNA strand and the HNH domain cleaves the target strand of DNA. In some embodiments, the Cas9 nuclease contains more than one RuvC domain and / or more than one HNH domain. In some embodiments, the Cas9 nuclease is wild-type Cas9. In some embodiments, Cas9 can induce double-strand breaks in the target DNA. In certain embodiments, the Cas nuclease may cleave dsDNA, cleave one strand of dsDNA, or may have neither DNA cribase nor nickase activity. An exemplary Cas9 amino acid sequence is provided as SEQ ID NO: 203. An exemplary Cas9 mRNA ORF sequence containing a start codon and a stop codon is provided as SEQ ID NO: 204. An exemplary Cas9 mRNA coding sequence suitable for inclusion in the fusion protein is provided as SEQ ID NO: 210.

In some embodiments, a chimeric Cas nuclease is used, in which one domain or region of the protein is replaced by a different portion of the protein. In some embodiments, the Cas nuclease domain may be replaced with a domain from a different nuclease, such as Fok1. In some embodiments, the Cas nuclease may be a modified nuclease.

In other embodiments, the Cas nuclease may be from a type I CRISPR / Cas system. In some embodiments, the Cas nuclease may be a component of the cascade complex of the Type I CRISPR / Cas system. In some embodiments, the Cas nuclease may be a Cas3 protein. In some embodiments, the Cas nuclease may be from the Type III CRISPR / Cas system. In some embodiments, the Cas nuclease may have RNA cleaving activity.

In some embodiments, the RNA-guided DNA binder has single-strand nickase activity, i.e. it can cleave one DNA strand to produce a single-strand break, also known as "nick". .. In some embodiments, the RNA-guided DNA binder comprises Cas nickase. Nickase is an enzyme that creates nicks in dsDNA, i.e., it cleaves one strand of the DNA double helix but not the other. In some embodiments, Cas nickase is a version of Cas nuclease (eg, in which the endonuclease cleaving active site is inactivated, eg, by one or more changes (eg, point mutations) in the catalytic domain. , Cas nuclease discussed above). See, for example, US Pat. No. 8,889,356 for a discussion of Cas Nixase and exemplary catalytic domain changes. In some embodiments, Cas nickases, such as Cas9 nickases, have an inactivated RuvC or HNH domain. An exemplary Cas9 nickase amino acid sequence is provided as SEQ ID NO: 206. An exemplary Cas9 nickase mRNA ORF sequence containing a start codon and a stop codon is provided as SEQ ID NO: 207. An exemplary Cas9 nickase mRNA coding sequence suitable for inclusion in the fusion protein is provided as SEQ ID NO: 211.

In some embodiments, the RNA-guided DNA binder is modified to contain only one functional nuclease domain. For example, the protein of the agent may be modified so that one of the nuclease domains is mutated or deleted in whole or in part to reduce its nucleic acid cleavage activity. In some embodiments, a nickase having a RuvC domain with reduced activity is used. In some embodiments, a nickase having an inert RuvC domain is used. In some embodiments, a nickase having an HNH domain with reduced activity is used. In some embodiments, a nickase having an inert HNH domain is used.

In some embodiments, the conserved amino acids within the Cas protein nuclease domain have been substituted to reduce or alter nuclease activity. In some embodiments, the Cas nuclease may include amino acid substitutions in the RuvC or RuvC-like nuclease domain. Illustrative amino acid substitutions in the RuvC or RuvC-like nuclease domain include D10A (based on the S. pyogenes Cas9 protein). For example, Zetsche et al. (2015) Cell Oct 22: 163 (3): 759-771. In some embodiments, the Cas nuclease may include amino acid substitutions in the HNH or HNH-like nuclease domain. Exemplary amino acid substitutions in the HNH or HNH-like nuclease domain include E762A, H840A, N863A, H983A, and D986A (based on the S. pyogenes Cas9 protein). For example, Zetsche et al. See (2015). Further exemplary amino acid substitutions include D917A, E1006A, and D1255A (based on the Francisella novicida U112 Cpf1 (FnCpf1) sequence (based on UniProtKB-A0Q7Q2 (CPF1_FRATN)).

In some embodiments, a nickase-encoding mRNA is provided in combination with a pair of guide RNAs that are complementary to the sense and antisense strands of the target sequence, respectively. In this embodiment, the guide RNA introduces the DSB by directing the nickase to the target sequence and producing a nick on the opposite strand of the target sequence (ie, double nick formation). In some embodiments, the use of double nick formation can improve specificity and reduce off-target effects. In some embodiments, the nickase is used with two separate guide RNAs that target the opposite strand of the DNA and produce a double nick in the target DNA. In some embodiments, nickase is used with two separate guide RNAs that are selected in close proximity to produce double nicks in the target DNA.

In some embodiments, the RNA-guided DNA binder lacks clibase and nickase activity. In some embodiments, the RNA-guided DNA-binding agent comprises a dCas DNA-binding polypeptide. The dCas polypeptide has DNA-binding activity and essentially lacks catalytic (cribase / nickase) activity. In some embodiments, the dCas polypeptide is a dCas9 polypeptide. In some embodiments, an RNA-guided DNA-binding agent lacking crybase and nickase activity, or dCas DNA-binding polypeptide, has one or more changes in its end-nuclease-cleaving active site, eg, within its catalytic domain (eg,). , A point mutation) is an inactivated version of Cas nuclease (eg, the Cas nuclease discussed above). See, for example, US 2014/0186958 A1; US 2015/016690 A1. An exemplary dCas9 amino acid sequence is provided as SEQ ID NO: 208. An exemplary dCas9 mRNA ORF sequence containing a start codon and a stop codon is provided as SEQ ID NO: 209. An exemplary dCas9 mRNA coding sequence suitable for inclusion in the fusion protein is provided as SEQ ID NO: 212.

In some embodiments, the RNA-guided DNA binder comprises one or more heterologous functional domains (eg, a fusion polypeptide or a fusion polypeptide).

In some embodiments, the heterologous functional domain may facilitate the transport of RNA-guided DNA binders into the cell's nucleus. For example, the heterologous functional domain may be a nuclear localization signal (NLS). In some embodiments, the RNA-guided DNA binder may be fused with 1-10 NLS. In some embodiments, the RNA-guided DNA binder may be fused with 1-5 NLS. In some embodiments, the RNA-guided DNA binder may be fused with one NLS. If one NLS is used, the NLS may be linked at the N-terminus or C-terminus of the RNA-guided DNA binder sequence. It may also be inserted within the RNA-guided DNA binder sequence. In other embodiments, the RNA-guided DNA binder may be fused with more than one NLS. In some embodiments, the RNA-guided DNA binder may be fused with 2, 3, 4, or 5 NLS. In some embodiments, the RNA-guided DNA binder may be fused with the two NLS. In certain situations, the two NLS may be the same (eg, two SV40 NLS) or different. In some embodiments, the RNA-guided DNA binder is fused to two SV40 NLS sequences linked at the carboxy terminus. In some embodiments, the RNA-guided DNA binder may be fused with two NLSs, one at the N-terminus and one at the C-terminus. In some embodiments, the RNA-guided DNA binder may be fused with three NLS. In some embodiments, the RNA-guided DNA binder may not be fused to NLS. In some embodiments, the NLS may be a mononode sequence such as, for example, SV40 NLS, PKKKRKV (SEQ ID NO: 274) or PKKKRRV (SEQ ID NO: 275). In some embodiments, the NLS may be a binode sequence such as NLS of nucleoplasmin, KRPAATKKAGQAKKKK (SEQ ID NO: 276). In certain embodiments, a single PKKKRKV (SEQ ID NO: 274) NLS may be linked at the C-terminus of the RNA-guided DNA binder. One or more linkers are optionally included in the fusion site.

In some embodiments, the heterologous functional domain may be capable of modifying the intracellular half-life of the RNA-guided DNA binder. In some embodiments, the half-life of the RNA-guided DNA binder may be increased. In some embodiments, the half-life of the RNA-guided DNA binder may be reduced. In some embodiments, the heterologous functional domain may be one that can increase the stability of the RNA-guided DNA binder. In some embodiments, the heterologous functional domain may be one that can reduce the stability of the RNA-guided DNA binder. In some embodiments, the heterologous functional domain may act as a signal peptide for proteolysis. In some embodiments, proteolysis may be mediated by proteolytic enzymes such as, for example, proteasomes, lysosomal proteases, or calpain proteases. In some embodiments, the heterologous functional domain may comprise a PEST sequence. In some embodiments, the RNA-guided DNA binder may be modified by the addition of a ubiquitin or polyubiquitin strand. In some embodiments, the ubiquitin may be a ubiquitin-like protein (UBL). Non-limiting examples of ubiquitin-like proteins include small ubiquitin-like modifiers (SUMO), ubiquitin cross-reactive proteins (UCRP, also known as interferon-stimulating gene 15 (ISG15)), ubiquitin-related modifier 1 (URM1), Nerve progenitor cell expression, developmentally down-regulated protein 8 (neuronal-precursor-cell-expressed developed developed protein-8; NEDD8; also called F-binding in S. cerevisiae), human leukocytes Type (human leukocyte engine F-associated; FAT10), autophagy 8 (ATG8) and 12 (ATG12), Fau ubiquitin-like protein (FUB1), membrane anchor type UBL (MUB), ubiquitin fold modifier 1 (UFM1), and Ubiquitin-like protein 5 (UBL5) can be mentioned.

In some embodiments, the heterologous functional domain may be a marker domain. Non-limiting examples of marker domains include fluorescent proteins, purified tags, epitope tags, and reporter gene sequences. In some embodiments, the marker domain may be a fluorescent protein. Non-limiting examples of suitable fluorescent proteins include green fluorescent proteins (eg, GFP, GFP-2, tagGFP, turboGFP, sfGFP, EGFP, Emerald, Azami Green, Monomeric Azami Green, CopGFP, AceGFP, ZsGreen1). Fluorescent protein (eg, YFP, EYFP, Citrine, Venus, YPet, PhiYFP, ZsYellow1), blue fluorescent protein (eg, EBFP, EBFP2, Azurite, mKalamar, GFPuv, Sappfire, T-sapphire) , Cerulean, CyPet, AmCyan1, Midoriishi-Cyan), red fluorescent protein (eg, mKate, mKate2, mPlum, DsRed momomer, mCherry, mRFP1, DsRed-Express, DsRed2, DsRed2, DsRed2, DsRed , MRasbury, mStrawbury, Jred), and orange fluorescent protein (morange, mKO, Kusabira-Orange, Monomeric Kusabira-Orange, mTangerine, tdTomato) or any other suitable. In other embodiments, the marker domain may be a purification tag and / or an epitope tag. Non-limiting exemplary tags include glutathione-S-transferase (GST), chitin binding protein (CBP), maltose binding protein (MBP), thioredoxin (TRX), poly (NANP), tandem affinity purification (TAP). Tags, myc, AcV5, AU1, AU5, E, ECS, E2, FLAG, HA, nus, Softag 1, Softag 3, Strep, SBP, Glu-Glu, HSV, KT3, S, S1, T7, V5, VSV- G, 6xHis, 8xHis, biotin carboxyl carrier protein (BCCP), polyHis, and calmodulin. Non-limiting exemplary reporter genes include glutathione-S-transferase (GST), horseradish peroxidase (HRP), chloramphenicol acetyltransferase (CAT), beta-galactosidase, beta-glucuronidase, luciferase, or fluorescent protein. Can be mentioned.

In additional embodiments, the heterologous functional domain may target the RNA-guided DNA binder to a particular organelle, cell type, tissue, or organ. In some embodiments, the heterologous functional domain may target the RNA-guided DNA binder to mitochondria.

In a further embodiment, the heterologous functional domain may be an effector domain. The effector domain may modify or affect the target sequence if the RNA-guided DNA binder is directed to its target sequence, for example, if the Cas nuclease is directed to the target sequence by gRNA. In some embodiments, the effector domain may be selected from a nucleic acid binding domain, a nuclease domain (eg, a non-Cas nuclease domain), an epigenetic modification domain, a transcription activation domain, or a transcription repressor domain. In some embodiments, the heterologous functional domain is a nuclease such as FokI nuclease. See, for example, US Pat. No. 9,023,649. In some embodiments, the heterologous functional domain is a transcriptional activator or repressor. For example, Qi et al. , "Repurposing CRISPR as an RNA-guided plateform for sequence-specific control of gene expression," Cell 152: 1173-83 (2013); Perez-Pinera et al. , "RNA-guided gene activation by CRISPR-Cas9-based transcription factor," Nat. Methods 10: 973-6 (2013); Mali et al. , "CAS9 transcriptional activators for target specific screening and paired niccases for co-operative genome engineering," Nat. Biotechnol. 31: 833-8 (2013); Gilbert et al. , "CRISPR-mediated modular RNA-guided regulation of transcrition in eukaryotes," Cell 154: 442-51 (2013). As such, RNA-guided DNA-binding agents are essentially transcription factors that can be directed and bound to the desired target sequence using the guide RNA.

B. Modified gRNA and mRNA
In some embodiments, the gRNA is chemically modified. One or more naturally occurring gRNAs containing one or more modified nucleosides or nucleotides are used in place of or in addition to standard A, G, C, and U residues and / Or referred to as a "modified" gRNA or "chemically modified" gRNA to describe the presence of naturally occurring components or constituents. In some embodiments, the modified gRNA is synthesized using non-standard nucleosides or nucleotides and is referred to herein as "modified." Modified nucleosides and nucleotides are (i) one or both of unlinked oxygen phosphates and / or one or more modifications of linked oxygen phosphates in the phosphodiester skeleton linkage, eg, substitutions (exemplary skeletons). Modifications); (iii) Changes in the 2'hydroxyl of ribose sugars, such as ribose sugars, eg, substitutions (exemplary sugar modifications); (iii) Large scale of the phosphate moiety by a "dephosphoric acid" linker. Substitution (exemplary skeletal modification); (iv) Modification or substitution of naturally occurring nucleobases such as non-standard nucleobases (exemplary base modification); (v) Substitution or modification of ribose phosphate skeleton (v) Illustrative skeletal modifications); (vi) 3'end or 5'end modifications of oligonucleotides, such as removal, modification or substitution of terminal phosphate groups, or partial, cap or linker conjugation (such 3'. Alternatively, the 5'cap modification may include sugar and / or skeletal modifications); and (vii) can include one or more of sugar modifications or substitutions (exemplary sugar modifications).

As mentioned above, in some embodiments, the compositions or formulations disclosed herein are open reading frames encoding RNA-guided DNA binders such as Cas nuclease as described herein. Contains mRNA containing (ORF). In some embodiments, mRNA comprising an ORF encoding an RNA-guided DNA binder such as Cas nuclease is provided, used, or administered. In some embodiments, the ORF encoding the RNA-guided DNA nuclease is a "modified RNA-guided DNA-binding agent ORF" or simply a "modified ORF", wherein the ORF is in one or more of the following methods: Used as a shortening to indicate that it is modified: (1) The modified ORF has a uridine content ranging from its minimum urine content to 150% of its minimum urine content; (2). The modified ORF has a uridine dinucleotide content in the range from its minimum uridine dinucleotide content to 150% of its minimum urine dinucleotide content; (3) the modified ORF has SEQ ID NOs: 201, 204, 210, It has at least 90% identity to any one of 214, 215, 223, 224, 250, 252, 254, 265, or 266; (4) the modified ORF has at least 75% codons as the least uridine. Consists of a set of codons, which are the codons listed in Table 3A of codons; or (5) the modified ORF comprises at least one modified uridine. In some embodiments, the modified ORF is modified in at least 2, 3, or 4 of the above methods. In some embodiments, the modified ORF comprises at least one modified uridine and is modified in at least 1, 2, 3, or all of (1)-(4) above.

In any of the above embodiments, the modified ORFs are listed in Table 3A, where at least 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 100% codons represent the least uridine codons. It may consist of a set of codons that are codons to be created.

In any of the above embodiments, the modified ORF is at least 90% relative to any one of SEQ ID NOs: 201, 204, 210, 214, 215, 223, 224, 250, 252, 254, 265, or 266. , 95%, 98%, 99%, or 100% identity may be included.

In any of the above embodiments, the modified ORF is 150% to 145%, 140%, 135%, 130%, 125%, 120%, 115%, 110% of its minimum uridine content to its minimum uridine content. It may have a uridine content in the range of 105%, 104%, 103%, 102%, or 101%.

In any of the above embodiments, the modified ORF is 150%, 145%, 140%, 135%, 130%, 125%, 120%, 115% of its minimum uridine dinucleotide content to its minimum uridine dinucleotide content. , 110%, 105%, 104%, 103%, 102%, or 101% may have a uridine dinucleotide content in the range.

In any of the above embodiments, the modified ORF may include modified uridines at at least one, more than one, or all uridine positions. In some embodiments, the modified uridine is a uridine modified at position 5, for example, with halogen, methyl, or ethyl. In some embodiments, the modified uridine is a pseudouridine modified at position 1, for example, with halogen, methyl, or ethyl. The modified uridine can be, for example, pseudouridine, N1-methyl-pseudouridine, 5-methoxyuridine, 5-iodouridine, or a combination thereof. In some embodiments, the modified uridine is 5-methoxyuridine. In some embodiments, the modified uridine is 5-iodouridine. In some embodiments, the modified uridine is a pseudouridine. In some embodiments, the modified uridine is N1-methyl-pseudouridine. In some embodiments, the modified uridine is a combination of pseudouridine and N1-methyl-pseudouridine. In some embodiments, the modified uridine is a combination of pseudouridine and 5-methoxyuridine. In some embodiments, the modified uridine is a combination of N1-methylpseudouridine and 5-methoxyuridine. In some embodiments, the modified uridine is a combination of 5-iodouridine and N1-methyl-pseudouridine. In some embodiments, the modified uridine is a combination of pseudouridine and 5-iodouridine. In some embodiments, the modified uridine is a combination of 5-iodouridine and 5-methoxyuridine.

In some embodiments, at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60% of uridine positions in mRNA according to the present disclosure. 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 100% are modified uridines. In some embodiments, 10% -25%, 15-25%, 25-35%, 35-45%, 45-55%, 55-65%, 65-75% of uridine positions in mRNA according to the present disclosure. %, 75-85%, 85-95%, or 90-100% are modified uridines, such as 5-methoxyuridine, 5-iodouridine, N1-methylpseudouridine, pseudouridine, or a combination thereof. In some embodiments, 10% -25%, 15-25%, 25-35%, 35-45%, 45-55%, 55-65%, 65-75% of the uridine positions in the mRNA according to the present disclosure. %, 75-85%, 85-95%, or 90-100% is 5-methoxyuridine. In some embodiments, 10% -25%, 15-25%, 25-35%, 35-45%, 45-55%, 55-65%, 65-75% of the uridine position in the mRNA according to the present disclosure. %, 75-85%, 85-95%, or 90-100% is pseudouridine. In some embodiments, 10% -25%, 15-25%, 25-35%, 35-45%, 45-55%, 55-65%, 65-75% of the uridine position in the mRNA according to the present disclosure. %, 75-85%, 85-95%, or 90-100% is N1-methylseudouridine. In some embodiments, 10% -25%, 15-25%, 25-35%, 35-45%, 45-55%, 55-65%, 65-75% of the uridine positions in the mRNA according to the present disclosure. %, 75-85%, 85-95%, or 90-100% is 5-iodouridine. In some embodiments, 10% -25%, 15-25%, 25-35%, 35-45%, 45-55%, 55-65%, 65-75% of uridine positions in mRNA according to the present disclosure. %, 75-85%, 85-95%, or 90-100% is 5-methoxyuridine, and the rest is N1-methylpseudouridine. In some embodiments, 10% -25%, 15-25%, 25-35%, 35-45%, 45-55%, 55-65%, 65-75% of the uridine position in the mRNA according to the present disclosure. %, 75-85%, 85-95%, or 90-100% is 5-iodouridine, and the rest is N1-methylseudouridine.

In some embodiments, the mRNA comprises at least one UTR from an expressed mammalian mRNA, such as a constitutively expressed mRNA. mRNA is believed to be constitutively expressed in mammals when it is continuously transcribed in at least one tissue of a healthy adult mammal. In some embodiments, the mRNA comprises 5'UTR, 3'UTR, or 5'and 3'UTR from expressed mammalian RNA, such as constitutively expressed mammalian mRNA. Actin mRNA is an example of constitutively expressed mRNA.

In some embodiments, the mRNA comprises at least one UTR from the hydroxysteroid 17-betadehydrogenase 4 (HSD17B4 or HSD), eg, a 5'UTR from the HSD. In some embodiments, the mRNA comprises at least one UTR from a globin mRNA, such as a human alpha globin (HBA) mRNA, a human beta globin (HBB) mRNA, or an African tumegael beta globin (XBG) mRNA. In some embodiments, the mRNA comprises 5'UTR, 3'UTR, or 5'and 3'UTR from globin mRNAs such as HBA, HBB, or XBG. In some embodiments, the mRNA comprises 5'UTR from bovine growth hormone, cytomegalovirus (CMV), mouse Hba-a1, HSD, albumin gene, HBA, HBB, or XBG. In some embodiments, the mRNA comprises 3'UTR from bovine growth hormone, cytomegalovirus, mouse Hba-a1, HSD, albumin gene, HBA, HBB, or XBG. In some embodiments, the mRNA is bovine growth hormone, cytomegalovirus, mouse Hba-a1, HSD, albumin gene, HBA, HBB, XBG, heat shock protein 90 (Hsp90), glyceraldehyde 3-phosphate dehydrogenase. Includes 5'and 3'UTR from (GAPDH), betaactin, alpha-tubulin, tumor protein (p53), or epidermal growth factor receptor (EGFR).

In some embodiments, the mRNA is a 5'and 3'UTR from the same source, eg, a constitutively expressed mRNA, eg, actin, albumin, or globin, eg, HBA, HBB, or XBG. Including.

In some embodiments, the mRNA does not contain the 5'UTR, eg, there are no additional nucleotides between the 5'cap and the start codon. In some embodiments, the mRNA comprises a Kozak sequence (described below) between the 5'cap and the start codon, but without any additional 5'UTR. In some embodiments, the mRNA does not contain the 3'UTR, eg, there are no additional nucleotides between the stop codon and the polyA tail.

In some embodiments, the mRNA comprises a Kozak sequence. The Kozak sequence can affect the translation initiation and overall yield of the polypeptide translated from the mRNA. The Kozak sequence contains a methionine codon that can function as a start codon. The smallest Kozak sequence is NNNRUGN and at least one of the following is true: the first N is A or G and the second N is G. In the context of nucleotide sequences, R means purine (A or G). In some embodiments, the Kozak sequence is RNNRUGN, NNNRUGG, RNNRUGG, RNNAUGN, NNNAUGG, or RNNAUGG. In some embodiments, the Kozak sequence is rccRUGg, which has 0 mismatches or up to 1 or 2 mismatches for lowercase positions. In some embodiments, the Kozak sequence is rccAUGg, which has 0 mismatches or up to 1 or 2 mismatches for lowercase positions. In some embodiments, the Kozak sequence is gccRccAUGG (SEQ ID NO: 277), which has 0 mismatches or up to 1, 2, or 3 mismatches for lowercase positions. In some embodiments, the Kozak sequence is gccAccAUG, which has zero mismatches or up to 1, 2, 3, or 4 mismatches for lowercase positions. In some embodiments, the Kozak sequence is GCACCAUG. In some embodiments, the Kozak sequence is gccgccRccAUGG (SEQ ID NO: 278), which has 0 mismatches or up to 1, 2, 3, or 4 mismatches for lowercase positions.

In some embodiments, the mRNA comprising an ORF encoding an RNA-guided DNA binding agent comprises a sequence having at least 90% identity to SEQ ID NO: 1 and optionally of SEQ ID NO: 1. The ORF (ie, SEQ ID NO: 204) has been replaced by an alternative ORF of any one of SEQ ID NOs: 210, 214, 215, 223, 224, 250, 252, 254, 265, or 266.

In some embodiments, the mRNA comprising an ORF encoding an RNA-guided DNA binding agent comprises a sequence having at least 90% identity to SEQ ID NO: 244 and optionally of SEQ ID NO: 244. The ORF (ie, SEQ ID NO: 204) has been replaced by an alternative ORF of any one of SEQ ID NOs: 210, 214, 215, 223, 224, 250, 252, 254, 265, or 266.

In some embodiments, the mRNA comprising an ORF encoding an RNA-guided DNA binding agent comprises a sequence having at least 90% identity to SEQ ID NO: 256 and optionally of SEQ ID NO: 256. The ORF (ie, SEQ ID NO: 204) has been replaced by an alternative ORF of any one of SEQ ID NOs: 210, 214, 215, 223, 224, 250, 252, 254, 265, or 266.

In some embodiments, the mRNA comprising an ORF encoding an RNA-guided DNA binding agent comprises a sequence having at least 90% identity to SEQ ID NO: 257 and optionally of SEQ ID NO: 257. The ORF (ie, SEQ ID NO: 204) has been replaced by an alternative ORF of any one of SEQ ID NOs: 210, 214, 215, 223, 224, 250, 252, 254, 265, or 266.

In some embodiments, the mRNA comprising an ORF encoding an RNA-guided DNA binding agent comprises a sequence having at least 90% identity to SEQ ID NO: 257 and optionally of SEQ ID NO: 258. The ORF (ie, SEQ ID NO: 204) has been replaced by an alternative ORF of any one of SEQ ID NOs: 210, 214, 215, 223, 224, 250, 252, 254, 265, or 266.

In some embodiments, the mRNA comprising an ORF encoding an RNA-guided DNA binding agent comprises a sequence having at least 90% identity to SEQ ID NO: 259 and optionally of SEQ ID NO: 259. The ORF (ie, SEQ ID NO: 204) has been replaced by an alternative ORF of any one of SEQ ID NOs: 210, 214, 215, 223, 224, 250, 252, 254, 265, or 266.

In some embodiments, the mRNA comprising an ORF encoding an RNA-guided DNA binding agent comprises a sequence having at least 90% identity to SEQ ID NO: 260 and optionally of SEQ ID NO: 260. The ORF (ie, SEQ ID NO: 204) has been replaced by an alternative ORF of any one of SEQ ID NOs: 210, 214, 215, 223, 224, 250, 252, 254, 265, or 266.

In some embodiments, the mRNA comprising an ORF encoding an RNA-guided DNA binding agent comprises a sequence having at least 90% identity to SEQ ID NO: 261 and optionally of SEQ ID NO: 261. The ORF (ie, SEQ ID NO: 204) has been replaced by an alternative ORF of any one of SEQ ID NOs: 210, 214, 215, 223, 224, 250, 252, 254, 265, or 266.

In some embodiments, the degree of identity with respect to the optionally substituted sequences of SEQ ID NOs: 243, 244, or 256-261 is 95%. In some embodiments, the degree of identity with respect to the optionally substituted sequences of SEQ ID NOs: 243, 244, or 256-261 is 98%. In some embodiments, the degree of identity with respect to the optionally substituted sequences of SEQ ID NOs: 243, 244, or 256-261 is 99%. In some embodiments, the degree of identity with respect to the optionally substituted sequences of SEQ ID NOs: 243, 244, or 256-261 is 100%.

In some embodiments, the mRNA disclosed herein comprises a 5'cap such as Cap0, Cap1, or Cap2. The 5'cap is generally 7-methylguanineribo linked through 5'triphosphate to the first nucleotide of the 5'to 3'strand of the mRNA, i.e. the 5'position of the nucleotide adjacent to the first cap. Nucleotides, which may be further modified, eg, as discussed below with respect to ARCA. At Cap0, both the ribose of the first and second cap-adjacent nucleotides of the mRNA contain 2'-hydroxyl. In Cap1, the ribose of the first and second transcribed nucleotides of mRNA contain 2'-methoxy and 2'-hydroxyl, respectively. In Cap2, both the ribose of the first and second cap-adjacent nucleotides of the mRNA contain 2'-methoxy. For example, Katibah et al. (2014) Proc Natl Acad Sci USA 111 (33): 12025-30; Abbas et al. (2017) Proc Natl Acad Sci USA 114 (11): E2106-E2115. Most endogenous higher eukaryotic mRNAs, such as mammalian mRNAs such as human mRNAs, contain Cap1 or Cap2. Cap0 and other cap structures different from Cap1 and Cap2 are immunogenic in mammals such as humans due to recognition as "non-self" by components of the innate immune system such as IFIT-1 and IFIT-5. This can result in elevated levels of cytokines such as type I interferon. Innate immune system components such as IFIT-1 and IFIT-5 can also compete with eIF4E for binding of mRNAs with caps other than Cap1 or Cap2 and can inhibit mRNA translation.

The cap can be included at the same time as the transfer. For example, ARCA (Anti-Reversal Cap Analog; Thermo Fisher Scientific, Catalog No. AM8045) is a 7-methylguanine 3'-methoxy linked to the 5'position of a guanine ribonucleotide that can be incorporated in vitro into the transcript at the start. A cap analog containing -5'triphosphate. ARCA results in a Cap0 cap in which the 2'position of the first cap-adjacent nucleotide is hydroxyl. For example, Stepinski et al. , (2001) "Synthesis and properties of mRNAs contouring the novel'anti-reverse'cap analogues 7-methyl (3'-O-methyl) GpppG and7-methyl"(3'-O-methyl) GpppG and7-methyl See. The structure of ARCA is shown below.

CleanCap ™ AG (m7G (5') ppp (5') (2'OMeA) pG; TriLink Biotechnology, Catalog No. N-7113) or CleanCap ™ GG (m7G (5') ppp (5') ( 2'OMeG) pG; TriLink Biotechnology, Catalog No. N-7133) can be used to provide the Cap1 structure at the same time as transcription. The 3'-O-methylated versions of CleanCap ™ AG and CleanCap ™ GG are also available from TriLink Biotechnology as Catalog Numbers N-7413 and N-7433, respectively. The structure of CleanCap ™ AG is shown below.

Alternatively, the cap may be added after RNA transcription. For example, a vaccinia capping enzyme is commercially available (New England BioLabs, Catalog No. M2080S), which is provided by the RNA triphosphatase and guanylyltransferase activity provided by its D1 subunit, as well as by its D12 subunit. It has a guanine methyltransferase. Therefore, it can add 7-methylguanine to RNA in the presence of S-adenosylmethionine and GTP to give Cap0. For example, Guo, P. et al. and Moss, B.I. (1990) Proc. Natl. Acad. Sci. USA 87, 4023-4027; Mao, X. et al. and Shuman, S.M. (1994) J. Biol. Chem. See 269, 24472-24479. For additional discussion of caps and cap forming approaches, see, eg, WO2017 / 053297 and Ishikawa et al. , Nucl. Acids. Symp. Ser. (2009) No. See 53,129-130.

In some embodiments, the mRNA further comprises a polyadenylation (poly A) tail. In some embodiments, the polyA tail comprises at least 20, 30, 40, 50, 60, 70, 80, 90, or 100 adenines, optionally up to 300 adenines. In some embodiments, the polyA tail comprises 95, 96, 97, 98, 99, or 100 adenine nucleotides. In some cases, the poly-A tail is "interrupted" by one or more non-adenine nucleotide "anchors" at one or more positions within the poly A-tail. The poly-A tail may contain at least eight contiguous adenine nucleotides, but may also contain one or more non-adenine nucleotides. As used herein, "non-adenine nucleotide" refers to any natural or non-natural nucleotide that does not contain adenine. Guanine, thymine, and cytosine nucleotides are exemplary non-adenine nucleotides. Thus, the poly-A tails on mRNA described herein may include nucleotides encoding RNA-guided DNA binders or contiguous adenine nucleotides located at 3'in the sequence of interest. In some cases, the polyA tail on the mRNA comprises a nucleotide encoding an RNA-guided DNA binding agent or a discontinuous adenine nucleotide located at 3'of the sequence of interest, and the non-adenine nucleotide is regular or irregular. It interrupts the adenine nucleotides at regular intervals.

In some embodiments, one or more non-adenine nucleotides are arranged to interrupt the contiguous adenine nucleotides, whereby the poly (A) binding protein binds to a stretch of contiguous adenine nucleotides. be able to. In some embodiments, the one or more non-adenine nucleotides are located after at least 8, 9, 10, 11, or 12 consecutive adenine nucleotides. In some embodiments, one or more non-adenine nucleotides are located after at least 8-50 consecutive adenine nucleotides. In some embodiments, one or more non-adenine nucleotides are located after at least 8-100 contiguous adenine nucleotides. In some embodiments, the non-adenine nucleotide is followed by 1, 2, 3, 4, 5, 6, or 7 adenine nucleotides, followed by at least 8 consecutive adenine nucleotides.

The poly-A tail may comprise a sequence of contiguous adenine nucleotides followed by one or more non-adenine nucleotides, and optionally an additional adenine nucleotide following it.

In some embodiments, the polyA tail comprises or contains one non-adenine nucleotide or one contiguous stretch of 2-10 non-adenine nucleotides. In some embodiments, the (s) non-adenine nucleotides are located after at least 8, 9, 10, 11, or 12 consecutive adenine nucleotides. In some cases, one or more non-adenine nucleotides are located after at least 8-50 consecutive adenine nucleotides. In some embodiments, the one or more non-adenine nucleotides are at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, It is located after 49 or 50 consecutive adenine nucleotides.

In some embodiments, the non-adenine nucleotide is guanine, cytosine, or thymine. In some cases, the non-adenine nucleotide is a guanine nucleotide. In some embodiments, the non-adenine nucleotide is a cytosine nucleotide. In some embodiments, the non-adenine nucleotide is a thymine nucleotide. In some cases, if more than one non-Adenine nucleotide is present, the non-Adenine nucleotides are a) guanine and thymine nucleotides; b) guanine and thymine nucleotides; c) thymine and thymine nucleotides; or d) guanine, It may be selected from thymine and cytosine nucleotides. An exemplary poly A tail containing non-adenine nucleotides is provided as SEQ ID NO: 4.

In some embodiments, the mRNA further comprises a polyadenylation (poly A) tail. In some cases, the poly-A tail is "interrupted" by one or more non-adenine nucleotide "anchors" at one or more positions within the poly A-tail. The poly-A tail may contain at least eight contiguous adenine nucleotides, but may also contain one or more non-adenine nucleotides. As used herein, "non-adenine nucleotide" refers to any natural or non-natural nucleotide that does not contain adenine. Guanine, thymine, and cytosine nucleotides are exemplary non-adenine nucleotides. Thus, the poly-A tails on mRNA described herein may include nucleotides encoding RNA-guided DNA binders or contiguous adenine nucleotides located at 3'in the sequence of interest. In some cases, the polyA tail on the mRNA comprises a nucleotide encoding an RNA-guided DNA binding agent or a discontinuous adenine nucleotide located at 3'of the sequence of interest, and the non-adenine nucleotide is regular or irregular. It interrupts the adenine nucleotides at regular intervals.

In some embodiments, one or more non-adenine nucleotides are arranged to interrupt the contiguous adenine nucleotides, whereby the poly (A) binding protein binds to a stretch of contiguous adenine nucleotides. be able to. In some embodiments, the one or more non-adenine nucleotides are located after at least 8, 9, 10, 11, or 12 consecutive adenine nucleotides. In some embodiments, one or more non-adenine nucleotides are located after at least 8-50 consecutive adenine nucleotides. In some embodiments, one or more non-adenine nucleotides are located after at least 8-100 contiguous adenine nucleotides. In some embodiments, the non-adenine nucleotide is followed by 1, 2, 3, 4, 5, 6, or 7 adenine nucleotides, followed by at least 8 consecutive adenine nucleotides.

The poly-A tail of the present invention may comprise a sequence of contiguous adenine nucleotides followed by one or more non-adenine nucleotides, and optionally an additional adenine nucleotide following it.

In some embodiments, the polyA tail comprises or contains one non-adenine nucleotide or one contiguous stretch of 2-10 non-adenine nucleotides. In some embodiments, the (s) non-adenine nucleotides are located after at least 8, 9, 10, 11, or 12 consecutive adenine nucleotides. In some cases, one or more non-adenine nucleotides are located after at least 8-50 consecutive adenine nucleotides. In some embodiments, the one or more non-adenine nucleotides are at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, It is located after 49 or 50 consecutive adenine nucleotides.

In some embodiments, the non-adenine nucleotide is guanine, cytosine, or thymine. In some cases, the non-adenine nucleotide is a guanine nucleotide. In some embodiments, the non-adenine nucleotide is a cytosine nucleotide. In some embodiments, the non-adenine nucleotide is a thymine nucleotide. In some cases, if more than one non-Adenine nucleotide is present, the non-Adenine nucleotides are a) guanine and thymine nucleotides; b) guanine and thymine nucleotides; c) thymine and thymine nucleotides; or d) guanine, It may be selected from thymine and cytosine nucleotides. An exemplary poly-A tail containing non-adenine nucleotides is provided as SEQ ID NO: 4.
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAACCGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA

Combined with chemical modifications such as those listed above, provided modified gRNAs and / or mRNAs containing nucleosides and nucleotides (collectively "residues") that may have 2, 3, 4, or more modifications. can do. For example, modified residues can have modified sugars and modified nucleobases. In some embodiments, every base of the gRNA is modified, for example, every base has a modified phosphate group, such as a phosphorothioate group. In certain embodiments, all or substantially all of the phosphate groups of the gRNA molecule are replaced by phosphorothioate groups. In some embodiments, the modified gRNA comprises at least one modified residue at or near the 5'end of the RNA. In some embodiments, the modified gRNA comprises at least one modified residue at or near the 3'end of the RNA.

In some embodiments, the gRNA comprises 1, 2, 3 or more modified residues. In some embodiments, at least 5% of the positions in the modified gRNA (eg, at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%. , At least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100%) It is a modified nucleoside or nucleotide.

Unmodified nucleic acids may be susceptible to degradation, for example by intracellular nucleases or those found in serum. For example, nucleases can hydrolyze phosphodiester bonds in nucleic acids. Thus, in one aspect, the gRNAs described herein can contain, for example, one or more modified nucleosides or nucleotides to introduce stability to intracellular or serum-based nucleases. In some embodiments, the modified gRNA molecules described herein are capable of exhibiting a reduced innate immune response when introduced into a cell population, both in vivo and ex vivo. The term "innate immune response" includes cellular responses to exogenous nucleic acids, such as single-stranded nucleic acids, with cytokine expression and release, in particular interferon, as well as induction of cell death.

In some embodiments of skeletal modification, the phosphate group of the modified residue can be modified by substituting one or more of the oxygen with different substituents. In addition, modified residues, such as modified residues present in the modified nucleic acid, can include large-scale substitutions of unmodified phosphate moieties with modified phosphate groups as described herein. In some embodiments, skeletal modifications of the phosphate skeleton can include changes that result in either an uncharged linker or a charged linker with an asymmetric charge distribution.

Examples of modified phosphate groups include phosphorothioate, phosphoroselenate, boranophosphate, boranophosphate ester, hydrogen phosphonate, phosphoramidate, alkyl or arylphosphonate and phosphate triester. The phosphorus atom in the unmodified phosphate group is achiral. However, the substitution of one of the above atoms or one of the non-bridge forming oxygens by a group of atoms can make the phosphorus atom chiral. The asymmetric phosphorus atom can have either an "R" configuration (Rp herein) or an "S" configuration (Sp herein). The skeleton can also be modified by substitution of bridge-forming oxygen (ie, the oxygen that links phosphate to the nucleoside) with nitrogen (crosslinked phosphoramidate), sulfur (crosslinked phosphorothioate) and carbon (crosslinked methylenephosphonate). .. Substitution can occur in either or both connected oxygen.

Phosphate groups can be replaced by non-phosphorus-containing ligation factors in certain skeletal modifications. In some embodiments, the charged phosphate group can be replaced by a neutral moiety. Examples of moieties capable of substituting a phosphate group include methylphosphonate, hydroxyamino, siloxane, carbonate, carboxymethyl, carbamate, amide, thioether, ethylene oxide linker, sulfonate, sulfonamide, thioform acetal, form acetal. , Oxime, methyleneimino, methylenemethylimino, methylenehydrazo, methylenedimethylhydrazo and methyleneoxymethylimino, but are not limited thereto.

Scaffolds capable of mimicking nucleic acids can also be constructed, in which the phosphate linker and ribose sugar are replaced by nuclease-resistant nucleosides or nucleotide surrogate. Such modifications may include skeletal and sugar modifications. In some embodiments, the nucleobase can be tether-linked by a surrogate backbone. Examples include, but are not limited to, morpholino, cyclobutyl, pyrrolidine and peptide nucleic acid (PNA) nucleoside surrogate.

Modified nucleosides and modified nucleotides can contain one or more modifications in the sugar group, i.e. sugar modification. For example, the 2'hydroxyl group (OH) can be modified, eg, substituted with a number of different "oxy" or "deoxy" substituents. In some embodiments, modification of the 2'hydroxyl group can enhance the stability of the nucleic acid because the hydroxyl can no longer be deprotonated to form a 2'-alkoxide ion. is there.

Examples of 2'hydroxyl group modifications are alkoxy or aryloxy (OR; "R" can be, for example, alkyl, cycloalkyl, aryl, aralkyl, heteroaryl or sugar); polyethylene glycol (PEG), O ( CH ₂ CH ₂ O) _n CH ₂ CH ₂ OR (R can be, for example, H or an optionally substituted alkyl, where n is 0 to 20 (eg, 0 to 4, 0 to 8, 0-10, 0-16, 1-4, 1-8, 1-10, 1-16, 1-20, 2-4, 2-8, 2-10, 2-16, 2-20, 4 ~ It can be an integer of 8, 4-10, 4-16, and 4-20))). In some embodiments, the 2'hydroxyl group modification can be 2'-O-Me. In some embodiments, the 2'hydroxyl group modification can be a 2'-fluoro modification, which replaces the 2'hydroxyl group with fluoride. In some embodiments, the 2'hydroxyl group modification can include a "locked" nucleic acid (LNA), where in LNA the 2'hydroxyl is, for example, a C _1-6 alkylene or a C _1-6 heteroalkylene bridge. May be connected to the 4'carbon of the same ribose sugar, and exemplary bridges include methylene, propylene, ether, or amino bridges; O-amino (amino is, for example, NH ₂ ; alkylamino, dialkyl). Amino, heterocyclyl, arylamino, diarylamino, heteroarylamino, or diheteroarylamino, ethylenediamine, or polyamino) and aminoalkoxy, O (CH ₂ ) _n -amino (amino is, for example, NH ₂ ; alkyl). Amino, dialkylamino, heterocyclyl, arylamino, diarylamino, heteroarylamino, or diheteroarylamino, ethylenediamine, or polyamino) can be mentioned. In some embodiments, the 2'hydroxyl group modification can include an "unlocked" nucleic acid (UNA), in which the ribose ring lacks a C2'-C3' bond. In some embodiments, the 2'hydroxyl group modification can include a methoxyethyl group (MOE), (OCH ₂ CH ₂ OCH ₃ , eg, a PEG derivative).

The "deoxy"2'modification includes hydrogen (ie, eg, a deoxyribose sugar in the overhang portion of a dsRNA in part); halo (eg, bromo, chloro, fluoro, or iodo); amino (amino is, for example, eg). , NH ₂ ; can be alkylamino, dialkylamino, heterocyclyl, arylamino, diarylamino, heteroarylamino, diheteroarylamino, or amino acids); NH (CH ₂ CH ₂ NH) _n CH 2CH ₂ -amino (amino is , For example, as described herein), -NHC (O) R (R can be, for example, alkyl, cycloalkyl, aryl, aralkyl, heteroaryl or sugar), cyano; Mercapto; alkyl-thio-alkyl; thioalkoxy; as well as alkyl, cycloalkyl, aryl, alkenyl and alkynyl, even if these are optionally substituted with, for example, aminos as described herein. Good) can be mentioned.

The sugar modification can include a sugar group that may also contain one or more carbons having a stereochemical configuration opposite to the corresponding carbon in ribose. Thus, the modified nucleic acid can include, for example, a nucleotide containing arabinose as a sugar. The modified nucleic acid can also include a debase sugar. These debased sugars can also be further modified at one or more of the constituent sugar atoms. The modified nucleic acid can also include one or more L-shaped sugars, such as L-nucleosides.

The modified nucleosides and modified nucleotides described herein that can be incorporated into a modified nucleic acid can include modified bases, also referred to as nucleic acid bases. Examples of nucleobases include, but are not limited to, adenine (A), guanine (G), cytosine (C), and uracil (U). These nucleic acid bases can be modified or totally substituted to provide modified residues that can be incorporated into the modified nucleic acid. Nucleotide bases of nucleotides can be selected independently of purines, pyrimidines, purine analogs, or pyrimidine analogs. In some embodiments, the nucleobase can include, for example, naturally occurring and synthetic derivatives of the base.

In embodiments using dual guide RNA, each of the crRNA and tracrRNA can contain modifications. Such modifications may be at one or both ends of crRNA and / or tracrRNA. In embodiments that include an sgRNA, one or more residues at one or both ends of the sgRNA may be chemically modified, or the entire sgRNA may be chemically modified. Certain embodiments include 5'end modifications. Certain embodiments include 3'end modifications. In certain embodiments, one or more or all of the nucleotides in the single strand overhang of the guide RNA molecule are deoxynucleotides.

In some embodiments, the guide RNA disclosed herein is US 62 / 431,756, entitled "Chemically Modified Guide RNAs," filed on December 8, 2016 (see its contents). Includes one of the modification patterns disclosed in (incorporated herein by).

In some embodiments, the invention comprises a gRNA containing one or more modifications. In some embodiments, the modification comprises a 2'-O-methyl (2'-O-Me) modified nucleotide. In some embodiments, the modification comprises a phosphorothioate (PS) bond between nucleotides.

The terms "mA", "mC", "mU", or "mG" can be used to represent nucleotides modified with 2'-O-Me.

The modification of 2'-O-methyl can be expressed as follows.

Another chemical modification that has been shown to affect the sugar ring of nucleotides is halogen substitution. For example, 2'-fluoro (2'-F) substitutions on the sugar ring of nucleotides can increase the binding affinity and nuclease stability of oligonucleotides.

In this application, the terms "fA", "fC", "fU", or "fG" can be used to represent nucleotides substituted with 2'-F.

The substitution of 2'-F can be expressed as follows.

A phosphorothioate (PS) link or bond refers to a bond in which sulfur replaces one non-crosslinkable phosphate oxygen in the phosphodiester bond, eg, in a bond between nucleotide bases. When phosphorothioates are used to produce oligonucleotides, modified oligonucleotides can also be referred to as S-oligos.

The "*" can be used to represent a PS modification. In this application, the terms A *, C *, U *, or G * can be used to refer to nucleotides linked to the next (eg, 3') nucleotide by PS binding.

In this application, the terms "mA *", "mC *", "mU *", or "mG *" are replaced by 2'-O-Me and by PS binding the following (eg, 3'). ) Can be used to represent nucleotides linked to nucleotides.

The illustration below shows the substitution of S for non-crosslinking oxygenated phosphate, which produces a PS bond instead of a phosphodiester bond.

Debased nucleotides refer to nucleotides lacking nitrogen-containing bases. The figure below represents an oligonucleotide with a base-deficient debase (also known as a depurine base) site.

Inverted bases refer to bases that have an inverted connection from the usual 5'to 3'linkage (ie, either a 5'to 5'linkage or a 3'to 3'linkage). For example

Debased nucleotides can be attached using inverted linkage. For example, a debased nucleotide may be attached to a terminal 5'nucleotide via a 5'to 5'linkage, or a debasement nucleotide may be attached to a terminal 3'via a 3'to 3'linkage. It may be attached to a nucleotide. An inverted debasen nucleotide at either the terminal 5'or 3'nucleotide may also be referred to as an inverted debasement cap.

In some embodiments, one or more of the first 3, 4, or 5 nucleotides at the 5'end and one or more of the last 3, 4, or 5 nucleotides at the 3'end are modified. ing. In some embodiments, modifications are known in the art to increase 2'-O-Me, 2'-F, inverted debase nucleotides, PS binding, or stability and / or performance. Nucleotide modification of.

In some embodiments, the first four nucleotides at the 5'end and the last four nucleotides at the 3'end are linked by a phosphorothioate (PS) bond.

In some embodiments, the first three nucleotides at the 5'end and the last three nucleotides at the 3'end include 2'-O-methyl (2'-O-Me) modified nucleotides. In some embodiments, the first three nucleotides at the 5'end and the last three nucleotides at the 3'end include 2'-fluoro (2'-F) modified nucleotides. In some embodiments, the first three nucleotides at the 5'end and the last three nucleotides at the 3'end contain inverted debase nucleotides.

In some embodiments, the guide RNA comprises a modified sgRNA. In some embodiments, the sgRNA comprises the modification pattern set forth in SEQ ID NO: 3, where N is any natural or unnatural nucleotide, and the entire N provides a guide sequence that directs the nuclease to the target sequence. Including.

In some embodiments, the guide RNA comprises the sgRNA set forth in any one of SEQ ID NOs: 87-124. In some embodiments, the guide RNA comprises an sgRNA comprising any one of the guide sequences of SEQ ID NO: 5-82 and nucleotides of SEQ ID NO: 125, the nucleotide of SEQ ID NO: 125 being the 3'of the guide sequence. It is at the end and the guide sequence may be modified as shown in SEQ ID NO: 3.

C. Ribonuclear Protein Complex In some embodiments, one or more gRNAs comprising one or more guide sequences from Table 1 or one or more sgRNAs and RNA guide DNA binding agents from Table 2, eg. Compositions comprising a nuclease, eg, Casnuclease such as Cas9, are included. In some embodiments, the encoded RNA-guided DNA binder has a cribase activity, which can also be referred to as double-stranded endonuclease activity. In some embodiments, the RNA-guided DNA binder comprises a Cas nuclease. Examples of Cas9 nucleases include S. cerevisiae. S. pyogenes, S. pyogenes. Included are S. aureus, and Cas9 nucleases of the Type II CRISPR system of other prokaryotes (eg, see the list in the next paragraph), as well as modified (eg, engineered or mutant) types of these. .. See, for example, US 2016/0312198 A1; US 2016/0312199 A1. Other examples of Cas nucleases include the Csm or Cmr complex of the Type III CRISPR system or its Cas10, Csm1, or Cmr2 subunit; and the Cascade complex of the Type I CRISPR system, or its Cas3 subunit. In some embodiments, the Cas nuclease may be from a type IIA, type IIB, or type IIC system. For discussions of various CRISPR systems and Cas nucleases, see, eg, Makarova et al. , NAT. REV. MICROBIOL. 9: 467-477 (2011); Makarova et al. , NAT. REV. MICROBIOL, 13: 722-36 (2015); Shmakov et al. , MOLECULAR CELL, 60: 385-397 (2015).

Non-limiting exemplary species from which Cas nuclease can be derived include Streptococcus pyogenes, Streptococcus thermophilus, Streptococcus sp., Staphylococcus aureus aureus. ), Listeria innocua, Lactobacillus gasseri, Francisella novicida, Wolinella succinogenes, Sutterella succinogenes, Sutterella wadsworth , Neisseria meningitidis, Campylobacter jejuni, Pasteurella multocida, Fibrobacter succinogene, Fibrobacter succinogene, Rhodospirylum rabisson, Rhodospirum Streptomyces pristinaespiralis, Streptomyces viridochromogenes, Streptomyces viridochromogenes, Streptomyces viridochromogenes, Streptomyces viridochromogenes, Streptomyces viridochromogenes, Streptomyces viridochromogenes, Streptomyces viridochromogenes, Streptomyces viridochromogenes -Roseum (Streptosporangium roseum), Alicyclobacillus acidocaldarius, Bacillus pseudomycoides, Bacillus selenitir educens), Exiguobacterium sibiricum, Lactobacillus delbrueckii, Lactobacillus salivarius, Lactobacillus salivarius, Lactobacillus buchneri, Lactobacillus buchneri, Lactobacillus buchneri , Microscilla marina, Burkholderiales bacteria, Polaromonas naphthalenivorans, Polaromonas sp., Crocosphaera watsonii, Cyantese Bacteria (Cyanothece sp.), Microcystis aeruginosa, Synechococcus sp., Acetohalobium arabaticum, Ammonifex degensii, Ammonifex degensii, Caldi becscii), Candidatus Desulforudis, Clostridium botulinum, Clostridium difficile, Finegoldia magna, Natranaerobius thermophilus thermophilus thermophilus thermophila・ Pelotomaculum thermopropionicum, Acidithiobacillus caldus, Acidithiobacillus ferrooxidans, Allochromatium vinosum, Marinobacta r sp.), Nitrosococcus halophilus, Nitrosococcus watsoni, Pseudoalteromonas haloplanktis, Ktedonobacter racemifer, Ktedonobacter racemifer, methanoobacter racemifer ), Anabaena variabilis, Nodularia spumigena, Nostoc sp., Arthrospira maxima, Arthrospira platensis, Arthrospira platensis, Arthrospira platensis ), Lyngbya sp., Microcoleus chthonoplastes, Oscillatoria sp., Petrotoga mobilis, Thermosipho africanus, Strekosipho africanus Pastococcus pasteurianus, Neisseria cinerea, Campylobacter lari, Parvibaculum lavamentivorans, Corynebacterium diphtheria, Acidoca Sp.), Lachnospiraceae bacterium ND2006, and Acaryochloris marina.

In some embodiments, the Casnuclease is the Cas9 nuclease of Streptococcus pyogenes. In some embodiments, the Casnuclease is the Cas9 nuclease of Streptococcus thermophilus. In some embodiments, the Casnuclease is the Cas9 nuclease of Neisseria meningitidis. In some embodiments, the Casnuclease is the Cas9 nuclease of Staphylococcus aureus. In some embodiments, the Cas nuclease is the Cpf1 nuclease of Francisella novicida. In some embodiments, the Cas nuclease is a Cpf1 nuclease from Acidaminococcus sp. In some embodiments, the Cas nuclease is the Cpf1 nuclease of the Lachnospiraceae bacterium ND2006. In a further embodiment, the Casnuclease is Francisella tularensis, Lachnospiraceae bacterium, Butyrivibrio proteoclasticus, Peregrinibacteria bacterium, Parcuberia. Bacteria, Smithella, Acidaminococcus, Candidatus Methanoplasma termitum, Eubacterium eligens, Moraxella bovoculi, Leptospira bovoculi ), Porphyromonas crevioricanis, Prevotella disiens, or Porphyromonas macacae Cpf1 nuclease. In certain embodiments, the Cas nuclease is a Cpf1 nuclease from the genus Acidaminococcus or the genus Lachnospiraceae.

In some embodiments, the gRNA with the RNA-guided DNA binder is called a ribonucleoprotein complex (RNP). In some embodiments, the RNA-guided DNA binder is a Cas nuclease. In some embodiments, the gRNA with the Cas nuclease is called the Cas RNP. In some embodiments, the RNP comprises a type I, type II, or type III component. In some embodiments, the Casnuclease is a Cas9 protein from the Type II CRISPR / Cas system. In some embodiments, the gRNA with Cas9 is referred to as Cas9 RNP.

Wild-type Cas9 has two nuclease domains: RuvC and HNH. The RuvC domain cleaves the non-target DNA strand and the HNH domain cleaves the target strand of DNA. In some embodiments, the Cas9 protein comprises more than one RuvC domain and / or more than one HNH domain. In some embodiments, the Cas9 protein is wild-type Cas9. In each of the composition, use, and method embodiments, Cas induces double-strand breaks in the target DNA.

Wild-type Cas9 has two nuclease domains: RuvC and HNH. The RuvC domain cleaves the non-target DNA strand and the HNH domain cleaves the target strand of DNA. In some embodiments, the Cas9 nuclease contains more than one RuvC domain and / or more than one HNH domain. In some embodiments, the Cas9 nuclease is wild-type Cas9. In some embodiments, Cas9 can induce double-strand breaks in the target DNA. In certain embodiments, the Cas nuclease may cleave dsDNA, cleave one strand of dsDNA, or may have neither DNA cribase nor nickase activity. An exemplary Cas9 amino acid sequence is provided as SEQ ID NO: 203. An exemplary Cas9 mRNA ORF sequence containing a start codon and a stop codon is provided as SEQ ID NO: 204. An exemplary Cas9 mRNA coding sequence suitable for inclusion in the fusion protein is provided as SEQ ID NO: 210.

In some embodiments, a chimeric Cas nuclease is used, in which one domain or region of the protein is replaced by a different portion of the protein. In some embodiments, the Cas nuclease domain may be replaced with a domain from a different nuclease, such as Fok1. In some embodiments, the Cas nuclease may be a modified nuclease.

In other embodiments, the Cas nuclease may be from a type I CRISPR / Cas system. In some embodiments, the Cas nuclease may be a component of the cascade complex of the Type I CRISPR / Cas system. In some embodiments, the Cas nuclease may be a Cas3 protein. In some embodiments, the Cas nuclease may be from the Type III CRISPR / Cas system. In some embodiments, the Cas nuclease may have RNA cleaving activity.

In some embodiments, the RNA-guided DNA binder has single-strand nickase activity, i.e. it can cleave one DNA strand to produce a single-strand break, also known as "nick". .. In some embodiments, the RNA-guided DNA binder comprises Cas nickase. Nickase is an enzyme that creates nicks in dsDNA, i.e., it cleaves one strand of the DNA double helix but not the other. In some embodiments, Cas nickase is a version of Cas nuclease (eg, in which the endonuclease cleaving active site is inactivated, eg, by one or more changes (eg, point mutations) in the catalytic domain. , Cas nuclease discussed above). See, for example, US Pat. No. 8,889,356 for a discussion of Cas Nixase and exemplary catalytic domain changes. In some embodiments, Cas nickases, such as Cas9 nickases, have an inactivated RuvC or HNH domain. An exemplary Cas9 nickase amino acid sequence is provided as SEQ ID NO: 206. An exemplary Cas9 nickase mRNA ORF sequence containing a start codon and a stop codon is provided as SEQ ID NO: 207. An exemplary Cas9 nickase mRNA coding sequence suitable for inclusion in the fusion protein is provided as SEQ ID NO: 211.

In some embodiments, the RNA-guided DNA binder is modified to contain only one functional nuclease domain. For example, the protein of the agent may be modified so that one of the nuclease domains is mutated or deleted in whole or in part to reduce its nucleic acid cleavage activity. In some embodiments, a nickase having a RuvC domain with reduced activity is used. In some embodiments, a nickase having an inert RuvC domain is used. In some embodiments, a nickase having an HNH domain with reduced activity is used. In some embodiments, a nickase having an inert HNH domain is used.

In some embodiments, the conserved amino acids within the Cas protein nuclease domain have been substituted to reduce or alter nuclease activity. In some embodiments, the Cas nuclease may include amino acid substitutions in the RuvC or RuvC-like nuclease domain. Illustrative amino acid substitutions in the RuvC or RuvC-like nuclease domain include D10A (based on the S. pyogenes Cas9 protein). For example, Zetsche et al. (2015) Cell Oct 22: 163 (3): See 759-771. In some embodiments, the Cas nuclease may include amino acid substitutions in the HNH or HNH-like nuclease domain. Exemplary amino acid substitutions in the HNH or HNH-like nuclease domain include E762A, H840A, N863A, H983A, and D986A (based on the S. pyogenes Cas9 protein). For example, Zetsche et al. See (2015). Further exemplary amino acid substitutions include D917A, E1006A, and D1255A (based on the Francisella novicida U112 Cpf1 (FnCpf1) sequence (based on UniProtKB-A0Q7Q2 (CPF1_FRATN)).

In some embodiments, a nickase-encoding mRNA is provided in combination with a pair of guide RNAs that are complementary to the sense and antisense strands of the target sequence, respectively. In this embodiment, the guide RNA introduces the DSB by directing the nickase to the target sequence and producing a nick on the opposite strand of the target sequence (ie, double nick formation). In some embodiments, the use of double nick formation can improve specificity and reduce off-target effects. In some embodiments, the nickase is used with two separate guide RNAs that target the opposite strand of the DNA and produce a double nick in the target DNA. In some embodiments, nickase is used with two separate guide RNAs that are selected in close proximity to produce double nicks in the target DNA.

In some embodiments, the RNA-guided DNA binder lacks clibase and nickase activity. In some embodiments, the RNA-guided DNA-binding agent comprises a dCas DNA-binding polypeptide. The dCas polypeptide has DNA-binding activity and essentially lacks catalytic (cribase / nickase) activity. In some embodiments, the dCas polypeptide is a dCas9 polypeptide. In some embodiments, an RNA-guided DNA-binding agent lacking crybase and nickase activity, or dCas DNA-binding polypeptide, has one or more changes in its end-nuclease-cleaving active site, eg, within its catalytic domain (eg,). , A point mutation) is an inactivated version of Cas nuclease (eg, the Cas nuclease discussed above). See, for example, US2014 / 0186958A1; US2015 / 0166980A1. An exemplary dCas9 amino acid sequence is provided as SEQ ID NO: 208. An exemplary Cas9 mRNA ORF sequence containing a start codon and a stop codon is provided as SEQ ID NO: 209. An exemplary Cas9 mRNA coding sequence suitable for inclusion in the fusion protein is provided as SEQ ID NO: 212.

In some embodiments, the RNA-guided DNA binder comprises one or more heterologous functional domains (eg, a fusion polypeptide or a fusion polypeptide).

In some embodiments, the heterologous functional domain may facilitate the transport of RNA-guided DNA binders into the cell's nucleus. For example, the heterologous functional domain may be a nuclear localization signal (NLS). In some embodiments, the RNA-guided DNA binder may be fused with 1-10 NLS. In some embodiments, the RNA-guided DNA binder may be fused with 1-5 NLS. In some embodiments, the RNA-guided DNA binder may be fused with one NLS. If one NLS is used, the NLS may be linked at the N-terminus or C-terminus of the RNA-guided DNA binder sequence. In some embodiments, the RNA-guided DNA binder may be fused to at least one NLS at the C-terminus. NLS may also be inserted within the RNA-guided DNA binder sequence. In other embodiments, the RNA-guided DNA binder may be fused with more than one NLS. In some embodiments, the RNA-guided DNA binder may be fused with 2, 3, 4, or 5 NLS. In some embodiments, the RNA-guided DNA binder may be fused with the two NLS. In certain situations, the two NLS may be the same (eg, two SV40 NLS) or different. In some embodiments, the RNA-guided DNA binder is fused to two SV40 NLS sequences linked at the carboxy terminus. In some embodiments, the RNA-guided DNA binder may be fused with two NLSs, one at the N-terminus and one at the C-terminus. In some embodiments, the RNA-guided DNA binder may be fused with three NLS. In some embodiments, the RNA-guided DNA binder may not be fused to NLS. In some embodiments, the NLS may be a mononode sequence such as, for example, SV40 NLS, PKKKRKV (SEQ ID NO: 274) or PKKKRRV (SEQ ID NO: 275). In some embodiments, the NLS may be a binode sequence such as NLS of nucleoplasmin, KRPAATKKAGQAKKKK (SEQ ID NO: 276). In certain embodiments, a single PKKKRKV (SEQ ID NO: 274) NLS may be linked at the C-terminus of the RNA-guided DNA binder. One or more linkers are optionally included in the fusion site. In some embodiments, one or more NLS from any of the preceding embodiments is RNA in combination with one or more additional heterologous functional domains, such as any of the heterologous functional domains described below. It is present in the guide DNA binder.

In some embodiments, the heterologous functional domain may be capable of modifying the intracellular half-life of the RNA-guided DNA binder. In some embodiments, the half-life of the RNA-guided DNA binder may be increased. In some embodiments, the half-life of the RNA-guided DNA binder may be reduced. In some embodiments, the heterologous functional domain may be one that can increase the stability of the RNA-guided DNA binder. In some embodiments, the heterologous functional domain may be one that can reduce the stability of the RNA-guided DNA binder. In some embodiments, the heterologous functional domain may act as a signal peptide for proteolysis. In some embodiments, proteolysis may be mediated by proteolytic enzymes such as, for example, proteasomes, lysosomal proteases, or calpain proteases. In some embodiments, the heterologous functional domain may comprise a PEST sequence. In some embodiments, the RNA-guided DNA binder may be modified by the addition of a ubiquitin or polyubiquitin strand. In some embodiments, the ubiquitin may be a ubiquitin-like protein (UBL). Non-limiting examples of ubiquitin-like proteins include small ubiquitin-like modifiers (SUMO), ubiquitin cross-reactive proteins (UCRP, also known as interferon-stimulating gene 15 (ISG15)), ubiquitin-related modifier 1 (URM1), Nerve progenitor cell expression, developmentally down-regulated protein 8 (neuronal-precursor-cell-expressed developed developed protein-8; NEDD8; also called F-binding in S. cerevisiae), human leukocytes Type (human leukocyte engine F-associated; FAT10), autophagy 8 (ATG8) and 12 (ATG12), Fau ubiquitin-like protein (FUB1), membrane anchor type UBL (MUB), ubiquitin fold modifier 1 (UFM1), and Ubiquitin-like protein 5 (UBL5) can be mentioned.

In some embodiments, the heterologous functional domain may be a marker domain. Non-limiting examples of marker domains include fluorescent proteins, purified tags, epitope tags, and reporter gene sequences. In some embodiments, the marker domain may be a fluorescent protein. Non-limiting examples of suitable fluorescent proteins include green fluorescent proteins (eg, GFP, GFP-2, tagGFP, turboGFP, sfGFP, EGFP, Emerald, Azami Green, Monomeric Azami Green, CopGFP, AceGFP, ZsGreen1). Fluorescent protein (eg, YFP, EYFP, Citrine, Venus, YPet, PhiYFP, ZsYellow1), blue fluorescent protein (eg, EBFP, EBFP2, Azurite, mKalamar, GFPuv, Sappfire, T-sapphire) , Cerulean, CyPet, AmCyan1, Midoriishi-Cyan), red fluorescent protein (eg, mKate, mKate2, mPlum, DsRed momomer, mCherry, mRFP1, DsRed-Express, DsRed2, DsRed2, DsRed2, DsRed , MRasbury, mStrawbury, Jred), and orange fluorescent protein (morange, mKO, Kusabira-Orange, Monomeric Kusabira-Orange, mTangerine, tdTomato) or any other suitable. In other embodiments, the marker domain may be a purification tag and / or an epitope tag. Non-limiting exemplary tags include glutathione-S-transferase (GST), chitin binding protein (CBP), maltose binding protein (MBP), thioredoxin (TRX), poly (NANP), tandem affinity purification (TAP). Tags, myc, AcV5, AU1, AU5, E, ECS, E2, FLAG, HA, nus, Softag 1, Softag 3, Strep, SBP, Glu-Glu, HSV, KT3, S, S1, T7, V5, VSV- G, 6xHis, 8xHis, biotin carboxyl carrier protein (BCCP), polyHis, and calmodulin. Non-limiting exemplary reporter genes include glutathione-S-transferase (GST), horseradish peroxidase (HRP), chloramphenicol acetyltransferase (CAT), beta-galactosidase, beta-glucuronidase, luciferase, or fluorescent protein. Can be mentioned.

In additional embodiments, the heterologous functional domain may target the RNA-guided DNA binder to a particular organelle, cell type, tissue, or organ. In some embodiments, the heterologous functional domain may target the RNA-guided DNA binder to mitochondria.

In a further embodiment, the heterologous functional domain may be an effector domain. The effector domain may modify or affect the target sequence if the RNA-guided DNA binder is directed to its target sequence, for example, if the Cas nuclease is directed to the target sequence by gRNA. In some embodiments, the effector domain may be selected from a nucleic acid binding domain, a nuclease domain (eg, a non-Cas nuclease domain), an epigenetic modification domain, a transcription activation domain, or a transcription repressor domain. In some embodiments, the heterologous functional domain is a nuclease such as FokI nuclease. See, for example, US Pat. No. 9,023,649. In some embodiments, the heterologous functional domain is a transcriptional activator or repressor. For example, Qi et al. , "Repurposing CRISPR as an RNA-guided plateform for sequence-specific control of gene expression," Cell 152: 1173-83 (2013); Perez-Pinera et al. , "RNA-guided gene activation by CRISPR-Cas9-based transcription factor," Nat. Methods 10: 973-6 (2013); Mali et al. , "CAS9 transcriptional activators for target specific screening and paired niccases for co-operative genome engineering," Nat. Biotechnol. 31: 833-8 (2013); Gilbert et al. , "CRISPR-mediated modular RNA-guided regulation of transcrition in eukaryotes," Cell 154: 442-51 (2013). As such, RNA-guided DNA-binding agents are essentially transcription factors that can be directed and bound to the desired target sequence using the guide RNA.

D. Determining the Efficacy of a GRNA In some embodiments, the effectiveness of a gRNA is determined when delivered or expressed with other components forming the RNP. In some embodiments, the gRNA is expressed with an RNA-guided DNA nuclease such as Cas protein. In some embodiments, the gRNA is delivered or expressed in a cell line that already stably expresses an RNA-guided DNA nuclease such as Cas protein. In some embodiments, the gRNA is delivered to the cell as part of the RNP. In some embodiments, the gRNA is delivered to the cell along with an mRNA encoding an RNA-guided DNA nuclease, such as Cas nuclease.

As described herein, the use of RNA-guided DNA nucleases and guide RNAs disclosed herein can result in double-strand breaks in DNA, the double-strand breaks being the cellular mechanism. An error can be generated in the form of an insertion / deletion (indel) mutation when repaired by. Many mutations due to indels alter the reading frame or introduce immature stop codons, thus producing non-functional proteins.

In some embodiments, the effectiveness of a particular gRNA is determined based on an in vitro model. In some embodiments, the in vitro model is a HEK293 cell (HEK293_Cas9) that stably expresses Cas9. In some embodiments, the in vitro model is a HUH7 human hepatocellular carcinoma cell. In some embodiments, the in vitro model is HepG2 cells. In some embodiments, the in vitro model is primary human hepatocytes. In some embodiments, the in vitro model is the primary cynomolgus monkey hepatocyte. With respect to the use of primary human hepatocytes, commercially available primary human hepatocytes can be used to provide greater consistency between experiments. In some embodiments, the number of off-target sites where deletion or insertion occurs in an in vitro model (eg, primary human hepatocytes) is, for example, the number of primary human livers transfected with Cas9 mRNA and guide RNA in vitro. Determined by analyzing genomic DNA from cells. In some embodiments, such determination involves analyzing genomic DNA from primary human hepatocytes transfected with Cas9 mRNA, guide RNA, and donor oligonucleotides in vitro. An exemplary procedure for such a decision is provided in the following examples.

In some embodiments, the effectiveness of a particular gRNA is determined across multiple in vitro cell models for the gRNA selection process. In some embodiments, cell line comparisons of data using selected gRNAs are performed. In some embodiments, cross-screening is performed on multiple cell models.

In some embodiments, the effectiveness of a particular gRNA is determined based on an in vivo model. In some embodiments, the in vivo model is a rodent model. In some embodiments, the rodent model is a mouse that expresses a human TTR gene, which may be a mutant human TTR gene. In some embodiments, the in vivo model is a non-human primatology, such as a cynomolgus monkey.

In some embodiments, the effectiveness of the guide RNA is measured by the edited percentage of TTR. In some embodiments, the edited percentage of TTR achieves knockdown of the TTR protein, for example, in cell culture medium in the case of the in vitro model, or in serum or tissue in the case of the in vivo model (achive). Compared to the edit percentage required for.

In some embodiments (embodies), the effectiveness of the guide RNA is measured by the number and / or frequency of indels in the off-target sequence within the genome of the target cell type. In some embodiments, an effective guide RNA is provided that produces indels at off-target sites at a very low frequency (eg, <5%) relative to the frequency of indel production in the cell population and / or at the target site. Will be done. Therefore, the present disclosure does not exhibit off-target indel formation in target cell types (eg, hepatocytes) or <5% off-target indels relative to the frequency of indel production in the cell population and / or at the target site. A guide RNA that produces the frequency of del formation is provided. In some embodiments, the disclosure provides a guide RNA that does not exhibit any off-target indel formation in a target cell type (eg, hepatocyte). In some embodiments, guide RNAs are provided that generate indels at less than five off-target sites, eg, as evaluated by one or more of the methods described herein. In some embodiments, for example, 4, 3, 2, or less than one or 4, 3, 2, or one as assessed by one or more of the methods described herein. A guide RNA is provided that produces an indel at an off-target site equal to. In some embodiments, the off-target site (s) does not occur in the protein coding region of the target cell (eg, hepatocyte) genome.

In some embodiments, the formation of insertion / deletion (“indel”) mutations in the target DNA and the detection of gene editing events such as homologous recombination repair (HDR) events are linear amplification using tagged primers and Isolation of tagged amplification products is utilized (hereinafter referred to herein as the "LAM-PCR" or "Linear Amplification (LA)" method).

In some embodiments, the method is induced to cause double-strand breaks (DSBs) and optionally isolates cellular DNA from cells provided with an HDR template to repair the DSBs. That; perform at least one cycle of linear amplification of DNA with tagged primers; isolate the linear amplification product containing the tag, thereby any amplification product amplified with untagged primers. Discard; optionally further amplify the isolated product; and analyze the linear amplification product, or further amplification product, eg, double-strand breaks, insertions, in the target DNA, Includes determining the presence or absence of deletions, or editing events such as HDR template sequences. In some cases, editing events can be quantified. The quantifications and the like used herein (including those in HDR and non-HDR editing events, such as indel situations) detect the frequency and / or type (s) of editing events in the population. Including that.

In some embodiments, only one cycle of linear amplification is performed.

In some cases, the tagged primer contains a molecular barcode. In some embodiments, the tagged primer comprises a molecular barcode and only one cycle of linear amplification is performed.

In some embodiments, the analytical step involves sequencing a linear amplification product or additional amplification product. Sequencing may include next-generation sequencing, as well as any method known to those of skill in the art, such as cloning a linear amplification product or additional amplification product into a plasmid and sequencing the plasmid or portion of the plasmid. Good. In another aspect, the analytical step comprises performing digital PCR (dPCR) or droplet digital PCR (ddPCR) on the linear amplification product or additional amplification products. In other cases, the analysis step involves contacting the linear amplification product or additional amplification product with a nucleic acid probe designed to identify DNA containing an HDR template sequence and linear amplification (s). Includes detecting probes bound to a product or additional amplification product (s). In some embodiments, the method further comprises determining the location of the HDR template in the target DNA.

In certain embodiments, the method further comprises sequencing the insertion site in the target DNA, where the insertion site is the location where the HDR template has been integrated into the target DNA, and the insertion site is. It may contain some target DNA sequences and some HDR template sequences.

In some embodiments, linear amplification of the target DNA with tagged primers spans 1-50 cycles, 1-60 cycles, 1-70 cycles, 1-80 cycles, 1-90 cycles, or 1-100 cycles. Will be done.

In some embodiments, linear amplification of the target DNA with a tagged primer comprises a denaturation step for separating the DNA duplex, an annealing step for binding the primers, and an extension step. In some embodiments, the linear amplification is isothermal (does not require a change in temperature). In some embodiments, the isothermal linear amplification is a loop-mediated isothermal amplification (LAMP), chain substitution amplification (SDA), helicase-dependent amplification, or nicking enzyme amplification reaction.

In some embodiments, the tagged primer is at least 50, at least 60, at least 70, at least 80, at least 90, at least 100, at least from the predicted editing event location, eg, insertion, deletion, or template insertion site. 110, at least 120, at least 130, at least 140, at least 150, at least 160, at least 170, at least 180, at least 190, at least 200, at least 210, at least 220, at least 230, at least 240, at least 250, at least 260, at least 270, Anneal to target DNA at least 280, at least 290, at least 300, at least 1,000, at least 5,000, or at least 10,000 nucleotides apart.

In some embodiments, the tagged primer comprises a molecular barcode. In some embodiments, the molecular barcode comprises a sequence that is not complementary to the target DNA. In some embodiments, the molecular barcode comprises 6, 8, 10, or 12 nucleotides.

In some embodiments, the tag on the primer is biotin, streptavidin, digoxigenin, DNA sequence, or fluorescein isothiocyanate (FITC).

In some embodiments, the linear amplification product (s) is isolated using a tag-specific capture reagent on the primer. In some embodiments, the capture reagent is on a bead, solid support, matrix, or column. In some embodiments, the isolation step involves contacting the linear amplification product (s) with a tag-specific capture reagent on the primer. In some embodiments, the capture reagent is biotin, streptavidin, digoxigenin, DNA sequence, or fluorescein isothiocyanate (FITC).

In some embodiments, the tag is biotin and the capture reagent is streptavidin. In some embodiments, the tag is streptavidin and the capture reagent is biotin. In some embodiments, the tag is at the 5'end of the primer, at the 3'end of the primer, or inside the primer. In some embodiments, the tag and / or capture reagent is removed after the isolation step. In some embodiments, the tag and / or capture reagent is not removed, and further amplification and analysis steps are performed in the presence of the tag and / or capture.

In some embodiments, the further amplification is non-linear. In some embodiments, the further amplification is digital PCR, qPCR, or RT-PCR. In some embodiments, the sequencing is next generation sequencing (NGS).

In some embodiments, the target DNA is genomic or mitochondrial DNA. In some embodiments, the target DNA is prokaryotic or eukaryotic genomic DNA. In some embodiments, the target DNA is mammalian DNA. The target DNA may be from non-dividing cells or dividing cells. In some embodiments, the target DNA may be from primary cells. In some embodiments, the target DNA is from a replicating cell.

In some cases, cellular DNA is sheared prior to linear amplification. In some embodiments, the sheared DNA has an average size of 0.5 kb to 20 kb. In some cases, cellular DNA is 0.5, 0.75, 1.0, 1.25, 1.5, 1.75, 2.0, 2.25, 2.5, 2.75, 3.0, 3.25, 3.5, 3.75, 4.0, 4.25, 4.5, 4.75, 5.0, 5.25, 5.5, 5.75, 6. 0, 6.25, 6.5, 6.75, 7.0, 7.25, 7.5, 7.75, 8.0, 8.25, 8.5, 8.75, 9.0, 9.25, 9.5, 9.75, 10.0, 10.25, 10.5, 10.75, 11.0, 11.25, 11.5, 11.75, 12.0, 12. 25, 12.5, 12.75, 13.0, 13.25, 13.5, 13.75, 14.0, 14.25, 14.5, 14.75, 15.0, 15.25, 15.5, 15.75, 16.0, 16.25, 16.5, 16.75, 17.0, 17.25, 17.5, 17.75, 18.0, 18.25, 18. It is sheared to an average size of 5, 18.75, 19.0, 19.25, 19.5, 19.75, or 20.0 kb. In some cases, cellular DNA is sheared to an average size of about 1.5 kb.

In some embodiments, the effectiveness of the guide RNA is measured by the secretion of TTR. In some embodiments, TTR secretion is measured using an enzyme-linked immunosorbent assay (ELISA) assay using cell culture medium or serum. In some embodiments, TTR secretion is measured in the same in vitro or in vivo system or model used to measure editing. In some embodiments, TTR secretion is measured in primary human hepatocytes. In some embodiments, TTR secretion is measured in HUH7 cells. In some embodiments, TTR secretion is measured in HepG2 cells.

ELISA assays are generally known to those of skill in the art and can be designed to determine serum TTR levels. In one exemplary embodiment, blood is collected and serum is isolated. The total TTR serum level may be determined using MousePrealbumin (Transthyretin) ELISA Kit (Aviva Systems Biology, Cat.OKIA00111) or a similar kit for measuring human TTR. If the kit is not available, an ELISA can be developed using a plate precoated with a capture antibody specific for the TTR being measured. The plates are then incubated for a period of time at room temperature and then washed. Enzyme-anti-TTR antibody conjugates are added and incubated (incubated). After the unbound antibody conjugate is removed and the plate is washed, a chromogenic substrate solution that reacts with the enzyme is added. The plate is read with a suitable plate reader for the absorbance specific to the enzyme and substrate used.

In some embodiments, the amount of TTR in the cell (such as from tissue) measures the effectiveness of the gRNA. In some embodiments, the amount of TTR in the cell is measured using a Western blot. In some embodiments, the cell used is a HUH7 cell. In some embodiments, the cells used are primary human hepatocytes. In some embodiments, the cell used is a primary cell obtained from an animal. In some embodiments, the amount of TTR is compared to the amount of glyceraldehyde 3-phosphate dehydrogenase GAPDH (housekeeping gene) to control changes in cell number.

III. LNP Formulation and Treatment of ATTR In some embodiments, a method of inducing double-strand breaks (DSBs) within the TTR gene, the guide sequence of any one or more of SEQ ID NOs: 5-82, Alternatively, a method is provided comprising administering a composition comprising a guide RNA comprising any one or more of the sgRNAs of SEQ ID NO: 87-124. In some embodiments, a gRNA comprising any one or more of the guide sequences of SEQ ID NOs: 5-82 is administered to induce DSB in the TTR gene. The guide RNA may be administered with an RNA-guided DNA nuclease such as Casnuclease (eg Cas9) or an mRNA or vector encoding an RNA-guided DNA nuclease such as Casnuclease (eg Cas9).

In some embodiments, a method of modifying the TTR gene, one or more of the guide sequences of SEQ ID NOs: 5-82, or any one or more of sgRNAs of SEQ ID NOs: 87-124. A method is provided that comprises administering a composition comprising a guide RNA comprising. In some embodiments, a gRNA comprising any one or more of the guide sequences of SEQ ID NOs: 5-82, or any one or more of the sgRNAs of SEQ ID NOs: 87-124 is administered to the TTR gene. Is modified. The guide RNA may be administered with an RNA-guided DNA nuclease such as Casnuclease (eg Cas9) or an mRNA or vector encoding an RNA-guided DNA nuclease such as Casnuclease (eg Cas9).

In some embodiments, a method of treating ATTR that comprises any one or more of the guide sequences of SEQ ID NOs: 5-82, or any one or more of the sgRNAs of SEQ ID NOs: 87-124. A method is provided that comprises administering a composition comprising a guide RNA comprising. In some embodiments, a gRNA comprising any one or more of the guide sequences of SEQ ID NOs: 5-82, or any one or more of the sgRNAs of SEQ ID NOs: 87-124 is administered to produce an ATTR. Be treated. The guide RNA may be administered with an RNA-guided DNA nuclease such as Casnuclease (eg Cas9) or an mRNA or vector encoding an RNA-guided DNA nuclease such as Casnuclease (eg Cas9).

In some embodiments, a method of reducing the serum concentration of TTR, one or more of the guide sequences of SEQ ID NOs: 5-82, or any one of the sgRNAs of SEQ ID NOs: 87-124. Alternatively, a method is provided that comprises administering a guide RNA comprising the plurality. In some embodiments, a gRNA comprising any one or more of the guide sequences of SEQ ID NOs: 5-82 or any one or more of the sgRNAs of SEQ ID NOs: 87-124 is administered to amyloid or amyloid. Accumulation of TTR in fibrils is reduced or prevented. The gRNA may be administered with an RNA-guided DNA nuclease such as Casnuclease (eg Cas9) or an mRNA or vector encoding an RNA-guided DNA nuclease such as Casnuclease (eg Cas9).

In some embodiments, a method of reducing or preventing TTR accumulation in amyloid or amyloid fibrils of interest, one or more of the guide sequences of SEQ ID NOs: 5-82, or SEQ ID NOs: : A method is provided comprising administering a composition comprising a guide RNA comprising any one or more of 87-124 sgRNAs. In some embodiments, a method of reducing or preventing the accumulation of TTR in amyloid or amyloid fibrils of interest, comprising a composition comprising any one or more of the sgRNAs of SEQ ID NOs: 87-113. Methods are provided, including administration. In some embodiments, a gRNA comprising any one or more of the guide sequences of SEQ ID NOs: 5-82 or any one or more of the sgRNAs of SEQ ID NOs: 87-124 is administered to amyloid or amyloid. Accumulation of TTR in fibrils is reduced or prevented. The gRNA may be administered with an RNA-guided DNA nuclease such as Casnuclease (eg Cas9) or an mRNA or vector encoding an RNA-guided DNA nuclease such as Casnuclease (eg Cas9).

In some embodiments, the guide sequence in Table 1 or a gRNA containing one or more sgRNAs from Table 2, along with an RNA-guided DNA nuclease such as Cas nuclease, induces a DSB and is non-repairing. Homologous end binding (NHEJ) results in mutations in the TTR gene. In some embodiments, NHEJ results in a deletion or insertion of a nucleotide (s), which induces a frameshift or nonsense mutation in the TTR gene.

In some embodiments, administering the guide RNA of the invention (eg, in the compositions provided herein) reduces the level of TTR (eg, serum level) in the subject and thus reduces it. Prevents TTR accumulation and aggregation in amyloid or amyloid fibrils.

In some embodiments, reducing or preventing the accumulation of TTR in amyloid or amyloid fibrils of a subject is the deposition of TTR in one or more tissues of the subject, such as stomach, colon, or nerve tissue. Includes reducing or preventing. In some embodiments, the nervous tissue comprises the sciatic nerve or the dorsal root ganglion. In some embodiments, TTR deposition is reduced in a few or four of the stomach, colon, dorsal root ganglion, and sciatic nerve. The level of deposition in a given tissue can be determined using a biopsy sample, for example using immunostaining. In some embodiments, reducing or preventing TTR accumulation in amyloid or amyloid fibrils of interest and / or reducing or preventing TTR deposition reduces serum TTR levels over a period of time. It is inferred based on that. Reducing serum TTR levels by the methods and uses provided herein, as discussed in Examples, is as discussed in the above and Examples, eg, measured 8 weeks after administration of the composition. It has been discovered that it can result in clearance of deposited TTR from tissues such as.

In some embodiments, the subject is a mammal. In some embodiments, the subject is a human. In some embodiments, the subject is a cow, pig, monkey, sheep, dog, cat, fish, or poultry.

In some embodiments, any one of the guide sequences in Table 1 (eg, in the compositions provided herein) for the preparation of a medicament for treating a human subject with ATTR or The use of guide RNAs comprising multiple or one or more sgRNAs from Table 2 is provided.

In some embodiments, the guide RNA, composition, and formulation are administered intravenously. In some embodiments, the guide RNA, composition, and formulation are administered during the hepatic circulation.

In some embodiments, a single dose of the composition comprising the guide RNA provided herein is sufficient to knock down the expression of the mutant protein. In some embodiments, a single dose of the composition comprising the guide RNA provided herein is sufficient to knock out the expression of the mutant protein in the cell population. In other embodiments, more than one dose of the composition provided herein comprising a guide RNA may be beneficial for maximizing editing through cumulative effects. For example, the compositions provided herein can be administered 2, 3, 4, 5, or more times, eg, twice. Administration is, for example, 1 to 2 years, for example, 1 to 7 days, 7 to 14 days, 14 to 30 days, 30 to 60 days, 60 to 120 days, 120 days to 183 days, 183 days to. It can be separated by a period ranging from 274 days, 274 days to 366 days, or 366 days to 2 years.

In some embodiments, the composition is 0.01-10 mg / kg (mpk), eg, 0.01-0.1 mpk, 0.1-0.3 mpk, 0.3-0.5 mpk, 0. Within the range of 5-1 mpk, 1-2 mpk, 2-3 mpk, 3-5 mpk, 5-10 mpk, or 0.1, 0.2, 0.3, 0.5, 1, 2, 3, 5, or 10 mpk Is administered in an effective amount of.

In some embodiments, the effectiveness of treatment with the compositions of the invention is seen 1 year, 2 years, 3 years, 4 years, 5 years, or 10 years after delivery. In some embodiments, the effectiveness of treatment with the compositions of the invention is assessed by measuring serum levels of TTR before and after treatment. In some embodiments, the efficacy of treatment with the composition evaluated through reduction of serum levels of TTR is 1 week, 2 weeks, 3 weeks, 4 weeks, 2 months, 3 months, It is found at 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, or 11 months.

In some embodiments, treatment slows or stops disease progression.

In some embodiments, treatment slows or stops the progression of FAP. In some embodiments, treatment results in amelioration, stabilization, or slowing of changes in the symptoms of sensorimotor or autonomous neuropathy.

In some embodiments, treatment results in amelioration, stabilization, or slowing of changes in FAC symptoms. In some embodiments, treatment results in amelioration, stabilization, or slowing of changes in the symptoms of restrictive cardiomyopathy or congestive heart failure.

In some embodiments, the effectiveness of treatment is measured by increasing the survival time of the subject.

In some embodiments, the effectiveness of treatment is measured by amelioration or slowing of progression of sensorimotor or autonomous neuropathy symptoms. In some embodiments, the effectiveness of treatment is measured by slowing the increase or decrease in the ability to move or perceive any body area. In some embodiments, the effectiveness of treatment is measured by slowing the ability to swallow, breathe, use the arms, hands, legs, or feet, or walk. In some embodiments, the effectiveness of treatment is measured by amelioration or slowing of progression of neuralgia. In some embodiments, neuralgia is characterized by pain, a burning sensation, a tingling sensation, or an abnormal sensation. In some embodiments, the effectiveness of treatment is measured by orthostatic hypotension, dizziness, gastrointestinal dysfunction, bladder dysfunction, or slowing improvement or increase in sexual dysfunction. In some embodiments, the effectiveness of treatment is measured by amelioration of frailty or slowing of progression. In some embodiments, therapeutic efficacy is measured using electromyography, nerve conduction studies, or patient-reported outcomes.

In some embodiments, the effectiveness of treatment is measured by amelioration of symptoms of congestive heart failure or CHF or slowing of progression. In some embodiments, the effectiveness of treatment is measured by dyspnea, dyspnea, fatigue, or slowing of reduction or increase in swelling in the ankles, feet, legs, abdomen, or jugular vein. In some embodiments, the effectiveness of treatment is measured by improving fluid composition or slowing progression throughout the body, which may be assessed by indicators such as weight gain, pollakiuria, or nocturnal cough. .. In some embodiments, therapeutic efficacy includes cardiac biomarker testing (eg, natriuretic peptide B [BNP] or N-terminal prob natriuretic peptide [NT-proBNP]), lung function testing, chest X. Measured using a line or electrocardiography.

A. Combination Therapy In some embodiments, the invention is either one or more of the guide sequences disclosed in Table 1 (eg, in the compositions provided herein) or any of the sgRNAs in Table 2. Includes combination therapies that include any one or more gRNAs, along with additional therapies suitable for alleviating the symptoms of ATTR.

In some embodiments, the additional therapy for ATTR is the treatment of sensorimotor or autonomous neuropathy. In some embodiments, the treatment of sensorimotor or autonomous neuropathy is a non-steroidal anti-inflammatory drug, antidepressant, anticonvulsant, antiarrhythmic medicine, or anesthetic. In some embodiments, the antidepressant is a tricyclic agent or a serotonin-norepinephrine reuptake inhibitor. In some embodiments, the antidepressant is amitriptyline, duloxetine, or venlafaxine. In some embodiments, the anticonvulsant is gabapentin, pregabalin, topiramate, or carbamazepine. In some embodiments, the additional therapy for sensorimotor neuropathy is transcutaneous electrical nerve stimulation.

In some embodiments, the additional therapy for ATTR is the treatment of restrictive cardiomyopathy or congestive heart failure (CHF). In some embodiments, the treatment for CHF is an ACE inhibitor, an aldosterone antagonist, an angiotensin receptor blocker, a beta blocker, digoxin, a diuretic, or isosorbide dinitrate / hydrarazine hydrochloride. In some embodiments, the ACE inhibitor is enalapril, captopril, ramipril, perindopril, imidapril, or quinapril. In some embodiments, the aldosterone antagonist is eplerenone or spironolactone. In some embodiments, the angiotensin receptor blocker is azilsartan, candesartan, eprosartan, irbesartan, losartan, olmesartan, telmisartan, or valsartan. In some embodiments, the beta blocker is acebutolol, atenolol, bisoprolol, metoprolol, nadolol, nebivolol, or propranolol. In some embodiments, the diuretic is chlorothiazide, chlorthalidone, hydrochlorothiazide, indapamide, metolazone, bumetanide, furosemide, torasemide, amiloride, or triamterene.

In some embodiments, the combination therapy is any one or more of the guide sequences disclosed in Table 1 (eg, in the compositions provided herein) or any one of the sgRNAs in Table 2. One or more gRNAs containing one or more are included with the siRNA targeting the TTR or mutant TTR. In some embodiments, the siRNA is any siRNA that can further reduce or eliminate expression of wild-type or mutant TTR. In some embodiments, the siRNA is the drug pattysilane (ALN-TTR02) or ALN-TTRsc02. In some embodiments, the siRNA is any one or more of the guide sequences disclosed in Table 1 (eg, in the compositions provided herein) or any one of the sgRNAs in Table 2. Alternatively, it is administered after any one of the gRNAs containing the plurality. In some embodiments, the siRNA is administered periodically after treatment with any of the gRNA compositions provided herein.

In some embodiments, the combination therapy is any one or more of the guide sequences disclosed in Table 1 (eg, in the compositions provided herein) or any one of the sgRNAs in Table 2. One or more gRNAs containing one or more are included with an antisense nucleotide that targets the TTR or mutant TTR. In some embodiments, the antisense nucleotide is any antisense nucleotide that can further reduce or eliminate the expression of wild-type or mutant TTR. In some embodiments, the antisense nucleotide is the drug inotelsen (IONS-TTR _Rx ). In some embodiments, the antisense nucleotide is either one or more of the guide sequences disclosed in Table 1 (eg, in the compositions provided herein) or any of the sgRNAs in Table 2. It is administered after any one of the gRNAs, including one or more. In some embodiments, the antisense nucleotide is administered periodically after treatment with any of the gRNA compositions provided herein.

In some embodiments, the combination therapy is any one or more of the guide sequences disclosed in Table 1 (eg, in the compositions provided herein) or any one of the sgRNAs in Table 2. One or more of the gRNAs, including one or more, is included with a small molecule stabilizer that promotes kinetic stabilization of the correctly folded tetrameric form of the TTR. In some embodiments, the small molecule stabilizer is the drug tafamidis (Bindakel®) or diflunisal. In some embodiments, the small molecule stabilizer is any one or more of the guide sequences disclosed in Table 1 (eg, in the compositions provided herein) or the sgRNA in Table 2. It is administered after any one of the gRNAs containing one or more of them. In some embodiments, the small molecule stabilizer is administered periodically after treatment with any of the gRNA compositions provided herein.

B. Delivery of gRNA Compositions In some embodiments, the guide RNA compositions described herein are either alone or encoded on one or more vectors and incorporated into lipid nanoparticles. Alternatively, it is administered via lipid nanoparticles. See, for example, PCT / US2017 / 024773 (whose contents are incorporated herein by reference in its entirety) entitled "LICID NANOPARTICLE FORMURATIONS FOR CRISPR / CAS COMPONENTS" filed on March 30, 2017. Any lipid nanoparticles (LNPs) known to those skilled in the art to be able to deliver nucleotides to a subject are mRNAs encoding RNA-guided DNA nucleases such as Cas or Cas9, in addition to the guide RNAs described herein, or It may be utilized with either Cas or an RNA-guided DNA nuclease such as the Cas9 protein itself.

Various embodiments of LNP formulations for RNA such as CRISPR / Cas Cargo are disclosed herein. Such LNP formulations may include (i) CCD lipids such as amine lipids, (ii) neutral lipids, (iii) helper lipids, and (iv) stealth lipids such as PEG lipids. Some embodiments of the LNP formulation include "amine lipids" along with helper lipids, triglycerides, and stealth lipids such as PEG lipids. "Lipid nanoparticles" means particles containing multiple (ie, more than one) lipid molecules that are physically associated with each other by intermolecular forces.

CCD lipid

Lipid compositions for delivery of CRISPR / Cas mRNA and guide RNA components to hepatocytes include CCD lipids.

In some embodiments, the CCD lipid is Lipid A and Lipid A is (9Z, 12Z) -3-((4,4-bis (octyloxy) butanoyl) oxy) -2-((((3). -(Diethylamino) propoxy) carbonyl) oxy) methyl) propyloctadeca-9,12-dienoate and 3-((4,4-bis (octyloxy) butanoyl) oxy) -2-((((3-3-3-) Also called (diethylamino) propoxy) carbonyl) oxy) methyl) propyl (9Z, 12Z) -octadeca-9,12-dienoate. Lipid A can be expressed as:

Lipid A may be synthesized according to WO2015 / 095340 (eg, pp. 84-86).

In some embodiments, the CCD lipid is lipid B, where lipid B is ((5-((dimethylamino) methyl) -1,3-phenylene) bis (oxy)) bis (octane-8,1- It is a diyl) bis (decanoate) and is also called ((5-((dimethylamino) methyl) -1,3-phenylene) bis (oxy)) bis (octane-8,1-diyl) bis (decanoate). Lipid B can be expressed as:

Lipid B may be synthesized according to WO2014 / 136806 (eg, pp. 107-09).

In some embodiments, the CCD lipid is lipid C, where lipid C is 2-((4-((((3- (dimethylamino) propoxy) carbonyl) oxy) hexadecanoyl) oxy) propane-1, 3-Diyl (9Z, 9'Z, 12Z, 12'Z) -bis (octadeca-9,12-dienoate). Lipid C can be expressed as:

In some embodiments, the CCD lipid is lipid D, where lipid D is 3-(((3- (dimethylamino) propoxy) carbonyl) oxy) -13- (octanoyloxy) tridecylic 3-octylundecano. Ate.

Lipid D can be expressed as:

Lipid C and Lipid D may be synthesized according to WO2015 / 095340.

The CCD lipid can also be an equivalent of Lipid A, Lipid B, Lipid C, or Lipid D. In certain embodiments, the CCD lipid is an equivalent of Lipid A, an equivalent of Lipid B, an equivalent of Lipid C, or an equivalent of Lipid D.

Amine lipid

In some embodiments, the LNP composition for delivery of the bioactive agent comprises an "aminelipid", where the amine lipid is an equivalent of lipid A, lipid B, lipid C, lipid D or lipid A (of lipid A). It is defined as the equivalent of lipid B, the equivalent of lipid C, and the equivalent of lipid D), such as acetal analogs.

In some embodiments, the amine lipid is Lipid A, which is (9Z, 12Z) -3-((4,4-bis (octyloxy) butanoyl) oxy) -2-((((3). -(Diethylamino) propoxy) carbonyl) oxy) methyl) propyloctadeca-9,12-dienoate and 3-((4,4-bis (octyloxy) butanoyl) oxy) -2-((((3-3-3-) It is also called (diethylamino) propoxy) carbonyl) oxy) methyl) propyl (9Z, 12Z) -octadeca-9,12-dienoate. Lipid A can be expressed as:

Lipid A may be synthesized according to WO2015 / 095340 (eg, pp. 84-86). In certain embodiments, the amine lipid is an equivalent of Lipid A.

In certain embodiments, the amine lipid is an analog of Lipid A. In certain embodiments, the lipid A analog is an acetal analog of lipid A. In certain LNP compositions, the acetal analogs are C4-C12 acetal analogs. In some embodiments, the acetal analog is a C5-C12 acetal analog. In additional embodiments, the acetal analog is a C5-C10 acetal analog. In a further embodiment, the acetal analog is selected from C4, C5, C6, C7, C9, C10, C11, and C12 acetal analogs.

Suitable amine lipids for use in the LNPs described herein are biodegradable in vivo. Amine lipids have low toxicity (eg, greater than 10 mg / kg or equal to 10 mg / kg tolerated in animal models without adverse effects). In certain embodiments, as an amine lipid-containing LNP, at least 75% of the amine lipid is in 8, 10, 12, 24, or 48 hours, or within 3, 4, 5, 6, 7, or 10 days. Examples include those that are cleared from plasma. In certain embodiments, as an amine lipid-containing LNP, at least 50% of the mRNA or gRNA is 8, 10, 12, 24, or 48 hours, or 3, 4, 5, 6, 7, or 10 days. Some are cleared from plasma within. In certain embodiments, as the amine lipid-containing LNP, at least 50% of the LNP is 8 by measuring, for example, lipid (eg, amine lipid), RNA (eg, mRNA), or other components. These include those that are cleared from plasma within 10, 12, 24, or 48 hours, or within 3, 4, 5, 6, 7, or 10 days. In certain embodiments, the lipid-encapsulated lipid, RNA, or nucleic acid components of LNP are measured against these free forms.

Lipid clearance may be measured as described in the literature. Maier, M.M. A. , Et al. Biodegradable Lipids Enabling Rapidly Eliminated Lipid Nanoparticles for Systemic Delivery of RNAi Therapeutics. Mol. The. See 2013, 21 (8), 1570-78 (“Maier”). For example, in Maier, an LNP-siRNA system containing luciferase-targeted siRNA was administered to 6-8 week old male C57Bl / 6 mice at 0.3 mg / kg by intravenous bolus injection via the temporal vein. Blood, liver, and spleen samples were collected 0.083, 0.25, 0.5, 1, 2, 4, 8, 24, 48, 96, and 168 hours after administration. Mice were perfused with saline and then treated with tissue recovery and blood samples to obtain plasma. All samples were processed and analyzed by LC-MS. In addition, Maier describes a procedure for assessing toxicity after administration of an LNP-siRNA formulation. For example, luciferase-targeted siRNA was administered to male Sprague dolly rats at a dose volume of 5 mL / kg at 0, 1, 3, 5, and 10 mg / kg (5 animals / group) via a single intravenous bolus injection. It was administered. After 24 hours, about 1 mL of blood was obtained from the jugular vein of a conscious animal and serum was isolated. Seventy-two hours after dosing, all animals were euthanized for autopsy. Evaluations of clinical signs, body weight, serum chemistry, organ weight and histopathology were performed. Although Maier describes methods for assessing siRNA-LNP formulations, these methods may be applied to assess the clearance, pharmacokinetics, and toxicity of administration of the LNP compositions of the present disclosure.

Amine lipids result in an increase in clearance rate. In some embodiments, the clearance rate is the lipid clearance rate, eg, the rate at which amine lipids are cleared from blood, serum, or plasma. In some embodiments, the clearance rate is the RNA clearance rate, eg, the rate at which mRNA or gRNA is cleared from blood, serum, or plasma. In some embodiments, the clearance rate is the rate at which the LNP is cleared from blood, serum, or plasma. In some embodiments, the clearance rate is the rate at which the LNP is cleared from tissue such as liver tissue or spleen tissue. In certain embodiments, high clearance rates result in a safety profile with virtually no adverse effects. Amine lipids reduce LNP accumulation in circulation and tissue. In some embodiments, reduced LNP accumulation in circulation and tissue results in a safety profile with virtually no adverse effects.

The amine lipids of the present disclosure may be ionizable depending on the pH of the medium containing them. For example, in a weakly acidic medium, the amine lipid may be protonated and have a positive charge. Conversely, in weakly basic media such as blood having a pH of about 7.35, amine lipids need not be protonated and have no charge. In some embodiments, the amine lipids of the present disclosure may be protonated at a pH of at least about 9. In some embodiments, the amine lipids of the present disclosure may be protonated at a pH of at least about 9. In some embodiments, the amine lipids of the present disclosure may be protonated at a pH of at least about 10.

The ability of amine lipids to have a charge relates to their intrinsic pKa. For example, each of the amine lipids of the present disclosure may independently have a pKa in the range of about 5.8 to about 6.2. For example, each of the amine lipids of the present disclosure may independently have a pKa in the range of about 5.8 to about 6.5. Cationic lipids with pKa in the range of about 5.1 to about 7.4 have been found to be effective, for example, for delivery of cargo in vivo, to the liver. Can be advantageous. In addition, cationic lipids with pKa in the range of about 5.3 to about 6.4 have been found to be effective for delivery in vivo, eg, to tumors. See, for example, WO2014 / 136806.

Additional lipids

Suitable "neutral lipids" for use in the lipid compositions of the present disclosure include, for example, various neutral, uncharged or zwitterionic lipids. Examples of suitable neutral lymphocytes for use in the present disclosure include 5-heptadecylbenzene-1,3-diol (resorcinol), dipalmitoylphosphatidylcholine (DPPC), dipalmitoylphosphatidylcholine (DSPC), phosphocholine (pohsphocholine). ) (DOPC), dipalmitoylphosphatidylcholine (DMPC), phosphatidylcholine (PLPC), 1,2-distearoyl-sn-glycero-3-phosphocholine (DAPC), phosphatidylethanolamine (PE), egg phosphatidylcholine (EPC), dipalmitoyl Dipalmitoylphosphatidylcholine (DLPC), dipalmitoylphosphatidylcholine (DMPC), 1-myristoyl-2-palmitoylphosphatidylcholine (MPPC), 1-palmitoyl-2-myristoylphosphatidylcholine (PMPC), 1-palmitoyl-2-stelophosphatidylphos ), 1,2-Dialaquidyl-sn-glycero-3-phosphochoyl (DBPC), 1-stearoyl-2-palmitoylphosphatidylcholine (SPPC), 1,2-diacosenoyl-sn-glycero-3-phosphochoyl (DEPC), palmitoylole Oil phosphatidylcholine (POPC), lithophosphatidylcholine, dipalmitoylphosphatidylethanolamine (DOPE), dipalmitoylphosphatidylcholine distearoylphosphatidylethanolamine (DSPE), dipalmitoylphosphatidylethanolamine (DMPE), dipalmitoylphosphatidylethanolamine (DPPE), Palmitoyl oleoylphosphatidylethanolamine (POPE), lysophosphatidylethanolamine and combinations thereof are included, but not limited to. In one embodiment, the neutral phospholipid may be selected from the group consisting of distearoylphosphatidylcholine (DSPC) and dimyristoylation phosphatidylethanolamine (DMPE). In another embodiment, the neutral phospholipid may be distearoylphosphatidylcholine (DSPC).

"Helper lipids" include steroids, sterols, and alkylresorcinols. Suitable helper lipids for use in the present disclosure include, but are not limited to, cholesterol, 5-heptadecylresorcinol, and cholesterol hemiscusinate. In one embodiment, the helper lipid may be cholesterol. In one embodiment, the helper lipid may be cholesterol hemiscusinate.

A "stealth lipid" is a lipid that changes the length of time that nanoparticles can exist in vivo (eg, in blood). Stealth lipids can assist in formulation processing, for example by reducing particle agglomeration and controlling particle size. The stealth lipids used herein may modulate the pharmacokinetic properties of LNP. Suitable stealth lipids for use in the lipid compositions of the present disclosure include, but are not limited to, stealth lipids having a hydrophilic head group linked to a lipid moiety. Information on stealth lipids suitable for use in the lipid compositions of the present disclosure and the biochemistry of such lipids can be found in Romberg et al. , Pharmaceutical Research, Vol. 25, No. 1,2008, pg. 55-71 and Hoekstra et al. , Biochimica et Biophysica Acta 1660 (2004) 41-52. Additional suitable PEG lipids are disclosed, for example, in WO 2006/007712.

In one embodiment, the hydrophilic head group of the stealth lipid comprises a polymer moiety selected from PEG-based polymers. Stealth lipids may include lipid moieties. In some embodiments, the stealth lipid is a PEG lipid.

In one embodiment, stealth lipids are PEG (sometimes referred to as poly (ethylene oxide)), poly (oxazoline), poly (vinyl alcohol), poly (glycerol), poly (N-vinylpyrrolidone), polyamino acids. And contains polymer moieties selected from polymers based on poly [N- (2-hydroxypropyl) methacrylamide].

In one embodiment, the PEG lipid comprises a polymeric moiety based on PEG (sometimes referred to as poly (ethylene oxide)).

The PEG lipid further comprises a lipid moiety. In some embodiments, the lipid moiety may be derived from diacylglycerols or diacylglycamides, with diacylglycerols or diacylglycamides independently containing saturated or unsaturated carbon atoms of about C4 to about C40. Examples include those containing a dialkylglycerol or dialkylglycamide group having an alkyl chain length including, and the chain may contain one or more functional groups such as amides or esters. In some embodiments, the alkyl chain length comprises about C10 to C20. The dialkylglycerol or dialkylglycamide group can further comprise one or more substituted alkyl groups. The chain length may be symmetrical or asymmetric.

Unless indicated otherwise, the term "PEG" as used herein means any polyethylene glycol or other polyalkylene ether polymer. In one embodiment, the PEG is a linear or branched chain polymer optionally substituted with ethylene glycol or ethylene oxide. In one embodiment, the PEG is unsubstituted. In one embodiment, the PEG is substituted with, for example, one or more alkyl, alkoxy, acyl, hydroxy, or aryl groups. In one embodiment, the term includes PEG copolymers such as PEG-polyurethane or PEG-polypropylene (see, eg, J. Milton Harris, Poly (ethylene glycol) chemistry: biotechnical and biomedical applications (1992)). In the embodiment of, the term does not include PEG copolymers. In one embodiment, the PEG is about 130-about 50,000, in the secondary embodiment about 150-about 30,000, in the secondary embodiment about 150-about 20,000, in the secondary embodiment. About 150 to about 15,000, about 150 to about 10,000 in the secondary embodiment, about 150 to about 6,000 in the secondary embodiment, about 150 to about 5,000 in the secondary embodiment, Approximately 150 to approximately 4,000 in the secondary embodiment, approximately 150 to approximately 3,000 in the secondary embodiment, approximately 300 to approximately 3,000 in the secondary embodiment, and approximately 1 in the secondary embodiment. It has a molecular weight of 000 to about 3,000, and in secondary embodiments from about 1,500 to about 2,500.

In certain embodiments, the PEG (eg, conjugated to a lipid moiety or lipid, eg stealth lipid) is "PEG-2K", also referred to as "PEG 2000", where PEG-2K is about 2, It has an average molecular weight of 000 daltons. PEG-2K is represented herein by the following formula (I), where n contains 45, i.e., a number average degree of polymerization of about 45 subunits. However, other PEG embodiments known in the art may be used, such as subunits (n = 23) with a number average degree of polymerization of about 23 and / or 68. Examples include those containing 10 subunits (n = 68). In some embodiments, n may be in the range of about 30 to about 60. In some embodiments, n may be in the range of about 35 to about 55. In some embodiments, n may be in the range of about 40 to about 50. In some embodiments, n may be in the range of about 42 to about 48. In some embodiments, n may be 45. In some embodiments, R may be selected from H, substituted alkyl, and unsubstituted alkyl. In some embodiments, R may be an unsubstituted alkyl. In some embodiments, R may be methyl.

In any of the embodiments described herein, the PEG lipids are PEG-dilauroylglycerol, PEG-dimiristoylglycerol (PEG-DMG) (Catalog # GM-020; NOF, Tokyo, Japan), PEG-di. Palmitoyl glycerol, PEG-distearoyl glycerol (PEG-DSPE) (Catalog # DSPE-020CN; NOF, Tokyo, Japan), PEG-dilauryl glycamide, PEG-dimyristyl glycamide, PEG-dipalmitoyl glycamide, and PEG. -Distearoyl glycamide, PEG-cholesterol (1- [8'-(cholesta-5-ene-3 [beta] -oxy) carboxamide-3', 6'-dioxaoctanyl] carbamoyl- [omega] -methyl -Poly (ethylene glycol), PEG-DMB (3,4-ditetradecoxylbenzayl)-[omega] -methyl-poly (ethylene glycol) ether), 1,2-dimiristoyl-sn-glycero-3 -Phophosphoethanolamine-N- [methoxy (polyethylene glycol) -2000] (PEG2k-DMG) (cat. # 880150P; Avanti Polar Lipids, Alabaster, Alabama, USA), 1,2-distearoyl-sn-glycero-3 -Phophosphoethanolamine-N- [methoxy (polyethylene glycol) -2000] (PEG2k-DSPE) (cat. # 880120C; Avanti Polar Lipids, Alabaster, Alabama, USA), 1,2-distearoyl-sn-glycerol, methoxy Polyethylene glycol (PEG2k-DSG; GS-020, NOF Tokyo, Japan), poly (ethylene glycol) -2000-dimethacrylate (PEG2k-DMA), and 1,2-distearyloxypropyl-3-amine-N-[ It may be selected from methoxy (polyethylene glycol) -2000] (PEG2k-DSA). In one embodiment, the PEG lipid may be PEG2k-DMG. In some embodiments, the PEG lipid may be PEG2k-DSG. In one embodiment, the PEG lipid may be PEG2k-DSP. In one embodiment, the PEG lipid may be PEG2k-DMA. .. In one embodiment, the PEG lipid may be PEG2k-C-DMA. In one embodiment, the PEG lipid may be compound S027 disclosed in WO 2016/010840 (paragraphs [00240]-[00244]). In one embodiment, the PEG lipid may be PEG2k-DSA. In one embodiment, the PEG lipid may be PEG2k-C11. In some embodiments, the PEG lipid may be PEG2k-C14. In some embodiments, the PEG lipid may be PEG2k-C16. In some embodiments, the PEG lipid may be PEG2k-C18.

LNP formulation

LNPs are (i) amine lipids for encapsulation and endosome escape, (ii) neutral lipids for stabilization, (iii) helper lipids also for stabilization, and (iv) stealth lipids such as It may contain PEG lipids.

In some embodiments, the LNP composition may comprise an RNA component comprising one or more RNA-guided DNA binding agents, Casnuclease mRNA, Class 2 Casnuclease mRNA, Cas9 mRNA, and gRNA. In some embodiments, the LNP composition may include a class 2 Cas nuclease and gRNA as an RNA component. In certain embodiments, the LNP composition may comprise RNA components, amine lipids, helper lipids, triglycerides, and stealth lipids. In certain LNP compositions, the helper lipid is cholesterol. In other compositions, the triglyceride is DSPC. In additional embodiments, the stealth lipid is PEG2k-DMG or PEG2k-C11. In certain embodiments, the LNP composition comprises Lipid A or an equivalent of Lipid A, helper lipids, triglycerides, stealth lipids, and guide RNAs. In certain compositions, the amine lipid is Lipid A. In certain compositions, the amine lipid is Lipid A or its acetal analog, the helper lipid is cholesterol, the triglyceride is DSPC, and the stealth lipid is PEG2k-DMG.

In certain embodiments, lipid compositions are described according to their respective molar ratios of component lipids in the formulation. The embodiments of the present disclosure provide lipid compositions described according to the respective molar ratios of the component lipids in the formulation. In one embodiment, the mol% of amine lipids may be from about 30 mol% to about 60 mol%. In one embodiment, the mol% of amine lipids may be from about 40 mol% to about 60 mol%. In one embodiment, the mol% of amine lipids may be from about 45 mol% to about 60 mol%. In one embodiment, the mol% of amine lipids may be from about 50 mol% to about 60 mol%. In one embodiment, the mol% of amine lipids may be from about 55 mol% to about 60 mol%. In one embodiment, the mol% of amine lipids may be from about 50 mol% to about 55 mol%. In one embodiment, the mol% of amine lipids may be about 50 mol%. In one embodiment, the molar% of amine lipids may be about 55 mol%. In some embodiments, the mole% of amine lipids in the LNP batch is ± 30%, ± 25%, ± 20%, ± 15%, ± 10%, ± 5%, or ± 2.5% of the target mole%. Is. In some embodiments, the mol% of amine lipids in the LNP batch is ± 4 mol%, ± 3 mol%, ± 2 mol%, ± 1.5 mol%, ± 1 mol%, ± 0. It is 5 mol%, or ± 0.25 mol%. All mol% numbers are given as the proportion of lipid components in the LNP composition. In certain embodiments, the variability between LNP lots of mol% amine lipids is less than 15%, less than 10%, or less than 5%.

In one embodiment, the mol% of triglycerides may be from about 5 mol% to about 15 mol%. In one embodiment, the mol% of triglycerides may be from about 7 mol% to about 12 mol%. In one embodiment, the mol% of triglycerides may be about 9 mol%. In some embodiments, the mol% triglyceride in the LNP batch is ± 30%, ± 25%, ± 20%, ± 15%, ± 10%, ± 5%, or ± of the target triglyceride mol%. It is 2.5%. In certain embodiments, the variability between LNP lots is less than 15%, less than 10%, or less than 5%.

In one embodiment, the mol% of helper lipids may be from about 20 mol% to about 60 mol%. In one embodiment, the mol% of helper lipids may be from about 25 mol% to about 55 mol%. In one embodiment, the mol% of helper lipids may be from about 25 mol% to about 50 mol%. In one embodiment, the mol% of helper lipids may be from about 25 mol% to about 40 mol%. In one embodiment, the mol% of helper lipids may be from about 30 mol% to about 50 mol%. In one embodiment, the mol% of helper lipids may be from about 30 mol% to about 40 mol%. In one embodiment, the mol% of helper lipids is adjusted based on the concentration of amine lipids, triglycerides, and PEG lipids so that the lipid content is 100 mol%. In some embodiments, the helper mole% of the LNP batch is ± 30%, ± 25%, ± 20%, ± 15%, ± 10%, ± 5%, or ± 2.5% of the target mole%. is there. In certain embodiments, the variability between LNP lots is less than 15%, less than 10%, or less than 5%.

In one embodiment, the mol% of the PEG lipid may be from about 1 mol% to about 10 mol%. In one embodiment, the mol% of the PEG lipid may be from about 2 mol% to about 10 mol%. In one embodiment, the mol% of the PEG lipid may be from about 2 mol% to about 8 mol%. In one embodiment, the mol% of the PEG lipid may be from about 2 mol% to about 4 mol%. In one embodiment, the mol% of the PEG lipid may be from about 2.5 mol% to about 4 mol%. In one embodiment, the mol% of the PEG lipid may be about 3 mol%. In one embodiment, the mol% of the PEG lipid may be about 2.5 mol%. In some embodiments, the mol% of PEG lipids in the LNP batch is ± 30%, ± 25%, ± 20%, ± 15%, ± 10%, ± 5%, or ± 2. It is 5%. In certain embodiments, the variability between LNP lots is less than 15%, less than 10%, or less than 5%.

In certain embodiments, the cargo is an mRNA encoding an RNA-guided DNA-binding agent (eg, Casnuclease, Class 2 Casnuclease, or Cas9), and a gRNA or nucleic acid encoding a gRNA, or a combination of an mRNA and a gRNA. including. In one embodiment, the LNP composition may comprise Lipid A or an equivalent thereof. In some embodiments, the amine lipid is Lipid A. In some embodiments, the amine lipid is a Lipid A equivalent, eg, an analog of Lipid A. In certain embodiments, the amine lipid is an acetal analog of Lipid A. In various embodiments, the LNP composition comprises amine lipids, triglycerides, helper lipids, and PEG lipids. In certain embodiments, the helper lipid is cholesterol. In certain embodiments, the triglyceride is DSPC. In certain embodiments, the PEG lipid is PEG2k-DMG. In some embodiments, the LNP composition may comprise Lipid A, helper lipids, triglycerides, and PEG lipids. In some embodiments, the LNP composition comprises amine lipids, DSPC, cholesterol, and PEG lipids. In some embodiments, the LNP composition comprises a PEG lipid containing DMG. In certain embodiments, the amine lipid is selected from Lipid A, and an equivalent of Lipid A, such as an acetal analog of Lipid A. In additional embodiments, the LNP composition comprises Lipid A, Cholesterol, DSPC, and PEG2k-DMG.

The embodiments of the present disclosure are also described according to the molar ratio between the positively charged amine group (N) of the amine lipid and the negatively charged phosphate group (P) of the encapsulated nucleic acid. I will provide a. This can be mathematically expressed by the equation N / P. In some embodiments, the LNP composition may include lipid components including amine lipids, helper lipids, triglycerides, and helper lipids; and nucleic acid components, with an N / P ratio of about 3-10. In some embodiments, the LNP composition may comprise a lipid component, including amine lipids, helper lipids, triglycerides, and helper lipids; and RNA components, with an N / P ratio of about 3-10. In one embodiment, the N / P ratio may be about 5-7. In one embodiment, the N / P ratio may be about 4.5-8. In one embodiment, the N / P ratio may be about 6. In one embodiment, the N / P ratio may be 6 ± 1. In one embodiment, the N / P ratio may be about 6 ± 0.5. In some embodiments, the N / P ratio is 30%, ± 25%, ± 20%, ± 15%, ± 10%, ± 5%, or ± 2.5% of the target N / P ratio. .. In certain embodiments, the variability between LNP lots is less than 15%, less than 10%, or less than 5%.

In some embodiments, the RNA component may include mRNAs such as the mRNAs disclosed herein, eg, mRNAs encoding Cas nuclease. In one embodiment, the RNA component may include Cas9 mRNA. In some compositions comprising an mRNA encoding a Cas nuclease, the LNP further comprises a gRNA nucleic acid, such as a gRNA. In some embodiments, the RNA component comprises Casnuclease mRNA and gRNA. In some embodiments, the RNA component comprises Class 2 Cas nuclease mRNA and gRNA.

In certain embodiments, the LNP composition comprises mRNAs disclosed herein, such as mRNAs encoding Cas nucleases such as class 2 Cas nucleases, amine lipids, helper lipids, triglycerides, and PEG lipids. It may be included. In certain LNP compositions containing mRNA encoding a Cas nuclease, such as Class 2 Cas nuclease, the helper lipid is cholesterol. In other compositions containing mRNA encoding a Cas nuclease, such as Class 2 Cas nuclease, the triglyceride is DSPC. In additional embodiments that include mRNA encoding a Cas nuclease, such as Class 2 Cas nuclease, the PEG lipid is PEG2k-DMG or PEG2k-C11. In certain compositions containing mRNAs encoding Cas nucleases, such as Class 2 Cas nucleases, amine lipids are selected from Lipid A and its equivalents, such as the acetal analogs of Lipid A.

In some embodiments, the LNP composition may comprise a gRNA. In certain embodiments, the LNP composition may comprise amine lipids, gRNAs, helper lipids, triglycerides, and PEG lipids. In certain LNP compositions containing gRNA, the helper lipid is cholesterol. In some compositions containing gRNA, the triglyceride is DSPC. In additional embodiments that include gRNA, the PEG lipid is PEG2k-DMG or PEG2k-C11. In certain embodiments, amine lipids are selected from Lipid A and its equivalents, such as the acetal analogs of Lipid A.

In one embodiment, the LNP composition may comprise an sgRNA. In one embodiment, the LNP composition may include Cas9 sgRNA. In one embodiment, the LNP composition may comprise a Cpf1 sgRNA. In some compositions comprising sgRNA, the LNP comprises amine lipids, helper lipids, triglycerides, and PEG lipids. In certain compositions containing sgRNA, the helper lipid is cholesterol. In other compositions containing sgRNA, the triglyceride is DSPC. In additional embodiments that include sgRNA, the PEG lipid is PEG2k-DMG or PEG2k-C11. In certain embodiments, amine lipids are selected from Lipid A and its equivalents, such as the acetal analogs of Lipid A.

In certain embodiments, the LNP composition comprises an mRNA and gRNA encoding a Cas nuclease, and the gRNA may be an sgRNA. In one embodiment, the LNP composition may include amine lipids, mRNA encoding Casnuclease, gRNA, helper lipids, triglycerides, and PEG lipids. In certain compositions containing mRNAs and gRNAs encoding Cas nuclease, the helper lipid is cholesterol. In some compositions comprising mRNA and gRNA encoding Cas nuclease, the triglyceride is DSPC. In additional embodiments that include mRNA and gRNA encoding Cas nuclease, the PEG lipid is PEG2k-DMG or PEG2k-C11. In certain embodiments, amine lipids are selected from Lipid A and its equivalents, such as the acetal analogs of Lipid A.

In certain embodiments, the LNP composition comprises a Cas nuclease mRNA such as Class 2 Cas mRNA and at least one gRNA. In certain embodiments, the LNP composition comprises a ratio of gRNA to Cas nuclease mRNA, such as Class 2 Cas nuclease mRNA, of about 25: 1 to about 1:25. In certain embodiments, the LNP formulation comprises a ratio of gRNA to Casnuclease mRNA, such as Class 2 Casnuclease mRNA, of about 10: 1 to about 1:10. In certain embodiments, the LNP formulation comprises a ratio of gRNA to Casnuclease mRNA, such as Class 2 Casnuclease mRNA, of about 8: 1 to about 1: 8. As measured herein, the ratio is by weight. In some embodiments, the LNP formulation comprises a ratio of gRNA to Cas nuclease mRNA, such as Class 2 Cas mRNA, of about 5: 1 to about 1: 5. In some embodiments, the range of ratios is about 3: 1 to 1: 3, about 2: 1 to 1: 2, about 5: 1 to 1: 2, about 5: 1 to 1: 1, about 3. : 1 to 1: 2, about 3: 1 to 1: 1, about 3: 1, about 2: 1 to 1: 1. In some embodiments, the gRNA to mRNA ratio is about 3: 1 or about 2: 1. In some embodiments, the ratio of gRNA to Cas nuclease mRNA, such as Class 2 Cas nuclease, is about 1: 1. The ratio may be about 25: 1, 10: 1, 5: 1, 3: 1, 1: 1, 1: 3, 1: 5, 1:10, or 1:25.

The LNP composition disclosed herein may include a template nucleic acid. The template nucleic acid may be formulated with an mRNA encoding a Cas nuclease, such as Class 2 Cas nuclease mRNA. In some embodiments, the template nucleic acid may be formulated with a guide RNA. In some embodiments, the template nucleic acid may be formulated with both the mRNA encoding the Cas nuclease and the guide RNA. In some embodiments, the template nucleic acid may be formulated separately from the mRNA or guide RNA encoding the Cas nuclease. The template nucleic acid may be delivered with or separately from the LNP composition. In some embodiments, the template nucleic acid may be single-strand or double-stranded, depending on the desired repair mechanism. The template may have a region of homology to the target DNA, or a sequence adjacent to the target DNA.

In some embodiments, the LNP is formed by mixing an aqueous RNA solution with an organic solvent-based lipid solution, such as 100% ethanol. Suitable solutions or solvents include, or may contain, water, PBS, Tris buffer, NaCl, citrate buffer, ethanol, chloroform, diethyl ether, cyclohexane, tetrahydrofuran, methanol, isopropanol. For example, a pharmaceutically acceptable buffer may be used for in vivo administration of LNP. In certain embodiments, buffers are used to keep the pH of the composition containing LNP at pH 6.5 or higher. In certain embodiments, buffers are used to keep the pH of the composition containing LNP at pH 7.0 or higher. In certain embodiments, the composition has a pH in the range of about 7.2 to about 7.7. In additional embodiments, the composition has a pH in the range of about 7.3 to about 7.7 or in the range of about 7.4 to about 7.6. In a further embodiment, the composition has a pH of about 7.2, 7.3, 7.4, 7.5, 7.6, or 7.7. The pH of the composition may be measured using a micro pH probe. In certain embodiments, a cryoprotectant is included in the composition. Non-limiting examples of cryoprotectants include sucrose, trehalose, glycerol, DMSO, and ethylene glycol. The exemplary composition may contain up to 10% cryoprotectant, such as sucrose. In certain embodiments, the LNP composition may comprise approximately 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10% cryoprotectant. In certain embodiments, the LNP composition may comprise approximately 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10% sucrose. In some embodiments, the LNP composition may comprise a buffer. In some embodiments, the buffer may include phosphate buffer (PBS), Tris buffer, citrate buffer, and mixtures thereof. In certain exemplary embodiments, the buffer comprises NaCl. In certain embodiments (emboidments), NaCl is omitted. An exemplary amount of NaCl may be in the range of about 20 mM to about 45 mM. An exemplary amount of NaCl may be in the range of about 40 mM to about 50 mM. In some embodiments, the amount of NaCl is about 45 mM. In some embodiments, the buffer is Tris buffer. An exemplary amount of tris may be in the range of about 20 mM to about 60 mM. An exemplary amount of tris may be in the range of about 40 mM to about 60 mM. In some embodiments, the amount of Tris is about 50 mM. In some embodiments, the buffer comprises NaCl and Tris. Certain exemplary embodiments of the LNP composition contain 5% sucrose and 45 mM NaCl in Tris buffer. In another exemplary embodiment, the composition contains an amount of about 5% w / v of sucrose, about 45 mM NaCl, and about 50 mM Tris at pH 7.5. The amounts of salt, buffer, and cryoprotectant may be modified to maintain the weight osmolal concentration of the overall formulation. For example, the final weight osmolarity may be maintained below 450 mOsm / L. In a further embodiment, the weight osmolal concentration is 350-250 mOsm / L. Certain embodiments have a final weight osmolal concentration of 300 +/- 20 mOsm / L.

In some embodiments, microfluidic mixing, T-mixing, or cross-mixing is used. In certain embodiments, the flow velocity, junction size, junction geometry, junction shape, tube diameter, solution, and / or RNA and lipid concentrations may be altered. The LNP or LNP composition may be concentrated or purified, for example, via dialysis, tangential flow filtration, or chromatography. LNPs may be stored, for example, as suspensions, emulsions, or lyophilized powders. In some embodiments, the LNP composition is stored at 2-8 ° C., and in certain embodiments, the LNP composition is stored at room temperature. In additional embodiments, the LNP composition is frozen and stored, for example at −20 ° C. or −80 ° C. In other embodiments, the LNP composition is stored at temperatures in the range of about 0 ° C to about -80 ° C. The frozen LNP composition may be thawed prior to use, for example, on ice at 4 ° C., room temperature, or 25 ° C. The frozen LNP composition may be maintained at various temperatures, such as 4 ° C., room temperature, 25 ° C., or 37 ° C. on ice.

In some embodiments, the LNP composition has an encapsulation of greater than about 80%. In some embodiments, the LNP composition has a particle size of less than about 120 nm. In some embodiments, the LNP composition has a pdi of less than about 0.2. In some embodiments, there are at least two of these features. In some embodiments, each of these three features is present. Analytical methods for determining these parameters are discussed below in the General Reagents and Methods section.

In some embodiments, microfluidic mixing, T-mixing, or cross-mixing is used. In certain embodiments, the flow velocity, junction size, junction geometry, junction shape, tube diameter, solution, and / or RNA and lipid concentrations may be altered. The LNP or LNP composition may be concentrated or purified, for example, via dialysis or chromatography. LNPs may be stored, for example, as suspensions, emulsions, or lyophilized powders. In some embodiments, the LNP composition is stored at 2-8 ° C., and in certain embodiments, the LNP composition is stored at room temperature. In additional embodiments, the LNP composition is frozen and stored, for example at −20 ° C. or −80 ° C. In other embodiments, the LNP composition is stored at temperatures in the range of about 0 ° C to about -80 ° C. The frozen LNP composition may be thawed prior to use, for example on ice, at room temperature, or at 25 ° C.

Dynamic light scattering (“DLS”) can be used to characterize the multidispersity index (“pdi”) and size of the LNPs of the present disclosure. DLS measures the scattering of light that results from feeding a sample to a light source. The PDI determined from the DLS measurement represents the distribution of particle size within the population (around the average particle size), with a perfectly uniform population having a PDI of 0. In some embodiments, the pdi may be in the range 0.005 to 0.75. In some embodiments, the pdi may be in the range 0.01-0.5. In some embodiments, the pdi may be in the range 0.02-0.4. In some embodiments, the pdi may be in the range 0.03 to 0.35. In some embodiments, the pdi may be in the range 0.1-0.35.

In some embodiments, the LNPs disclosed herein have a size of 1-250 nm. In some embodiments, the LNP has a size of 10-200 nm. In a further embodiment, the LNP has a size of 20-150 nm. In some embodiments, the LNP has a size of 50-150 nm. In some embodiments, the LNP has a size of 50-100 nm. In some embodiments, the LNP has a size of 50-120 nm. In some embodiments, the LNP has a size of 75-150 nm. In some embodiments, the LNP has a size of 30-200 nm. Unless otherwise indicated, all sizes referred to herein are the average size (diameter) of fully formed nanoparticles as measured by dynamic light scattering at Malvern Zesaizer. The nanoparticle sample is diluted in phosphate buffered saline (PBS) and has a counting rate of about 200-400 kcts. The data are presented as a weighted average of the intensity measurements. In some embodiments, the LNP is formed with an average encapsulation efficiency in the range of 50% to 100%. In some embodiments, the LNP is formed with an average encapsulation efficiency in the range of 50% to 70%. In some embodiments, the LNP is formed with an average encapsulation efficiency in the range of 70% to 90%. In some embodiments, the LNP is formed with an average encapsulation efficiency in the range of 90% to 100%. In some embodiments, the LNP is formed with an average encapsulation efficiency in the range of 75% to 95%.

In some embodiments, the LNP associated with the gRNA disclosed herein is for use in the preparation of a medicament for treating ATTR. In some embodiments, LNP associated with a gRNA disclosed herein is used in the preparation of a medicament for reducing or preventing the accumulation and aggregation of TTR in amyloid or amyloid fibrils in subjects with ATTR. It is for use. In some embodiments, the LNP associated with the gRNA disclosed herein is for use in the preparation of a medicament for reducing serum TTR levels. In some embodiments, the LNP associated with the gRNA disclosed herein is intended for use in the treatment of ATTR in a subject, eg, a mammal, eg, a primate animal such as a human. In some embodiments, the LNP associated with the gRNA disclosed herein is the accumulation and aggregation of TTR in amyloid or amyloid fibrils in subjects with ATTR, such as mammals, such as primates such as humans. It is intended for use in mitigation or prevention. In some embodiments, the LNP associated with the gRNA disclosed herein is for use in reducing serum TTR levels in a subject, such as a mammal, eg, a primatology animal such as a human.

Electroporation is also a well-known means for delivery of cargo, and any electroporation methodology may be used for delivery of any one of the gRNAs disclosed herein. In some embodiments, electroporation is used to deliver any one of the gRNAs disclosed herein and an mRNA encoding an RNA-guided DNA nuclease such as Cas9 or an RNA-guided DNA nuclease such as Cas9. May be used.

In some embodiments, the invention is a method of delivering any one of the gRNAs disclosed herein to ex vivo cells, wherein the gRNA is associated with an LNP or is associated with an LNP. Does not include methods. In some embodiments, the gRNA / LNP or gRNA is also associated with an mRNA encoding an RNA-guided DNA nuclease such as Cas9 or an RNA-guided DNA nuclease such as Cas9.

In certain embodiments, the invention comprises a DNA or RNA vector encoding any of the guide RNAs comprising any one or more of the guide sequences described herein. In some embodiments, in addition to the guide RNA sequence, the vector further comprises a nucleic acid that does not encode a guide RNA. Nucleic acids that do not encode a guide RNA include, but are not limited to, nucleic acids that encode an RNA-guided DNA nuclease that can be a promoter, enhancer, regulatory sequence, and a nuclease such as Cas9. In some embodiments, the vector comprises crRNA, trRNA, or one or more nucleotide sequences encoding crRNA and trRNA. In some embodiments, the vector comprises one or more nucleotide sequences encoding an sgRNA and an mRNA encoding an RNA-guided DNA nuclease, where the RNA-guided DNA nuclease can be a Casnuclease such as Cas9 or Cpf1. In some embodiments, the vector comprises crRNA, one or more nucleotide sequences encoding trRNA and mRNA encoding an RNA-guided DNA nuclease, which can be a Cas protein such as Cas9. In one embodiment, Cas9 is from Streptococcus pyogenes (ie, Spy Cas9). In some embodiments, the nucleotide sequences encoding crRNA, trRNA, or crRNA and trRNA (which may be sgRNA) are flanked by all or part of the repetitive sequences from the naturally occurring CRISPR / Cas system. Contains or consists of guide sequences. A nucleic acid comprising or consisting of crRNA, trRNA, or crRNA and trRNA may further comprise a vector sequence comprising or consisting of crRNA, trRNA, or a nucleic acid not found naturally with crRNA and trRNA.

In some embodiments, crRNA and trRNA are encoded by discontinuous nucleic acids within a single vector. In other embodiments, the crRNA and trRNA may be encoded by contiguous nucleic acids. In some embodiments, crRNA and trRNA are encoded by opposite strands of a single nucleic acid. In other embodiments, the crRNA and trRNA are encoded by the same strand of a single nucleic acid.

In some embodiments, the vector may be cyclic. In other embodiments, the vector may be linear. In some embodiments, the vector may be confined in lipid nanoparticles, liposomes, non-lipid nanoparticles, or viral capsids. Non-limiting exemplary vectors include plasmids, phagemids, cosmids, artificial chromosomes, minichromosomes, transposons, viral vectors, and expression vectors.

In some embodiments, the vector may be a viral vector. In some embodiments, the viral vector may be genetically modified from its wild-type counterpart. For example, a viral vector may contain insertions, deletions, or substitutions of one or more nucleotides, which facilitate cloning or alter one or more properties of the vector. Good. Such properties include packaging ability, transduction efficiency, immunogenicity, genomic integration, replication, transcription, and translation. In some embodiments, parts of the viral genome may be deleted so that the virus can package exogenous sequences of larger size. In some embodiments, the viral vector may have an enhanced transduction efficiency. In some embodiments, the immune response induced by the virus in the host may be reduced. In some embodiments, a viral gene that promotes integration of the viral sequence into the host genome (eg, integrase, etc.) may be mutated so that the virus is non-integrated. In some embodiments, the viral vector may be replication defective. In some embodiments, the viral vector may include an extrinsic transcriptional or translational control sequence to facilitate expression of the coding sequence on the vector. In some embodiments, the virus may be helper dependent. For example, the virus may require one or more helper viruses to supply the viral components (eg, viral proteins, etc.) needed to amplify the vector and package it into viral particles. In such cases, one or more helper components, such as one or more vectors encoding the viral component, may be introduced into the host cell along with the vector system described herein. In other embodiments, the virus may be helper-free. For example, the virus may be one that can amplify and package the vector without any helper virus. In some embodiments, the vector system described herein may also encode the viral components required for viral amplification and packaging.

Non-limiting exemplary viral vectors include adeno-associated virus (AAV) vectors, lentivirus vectors, adenovirus vectors, helper-dependent adenovirus vectors (HDAd), herpes simplex virus (HSV-1) vectors, and bacteriophage. Included are T4, baculovirus vectors, and retroviral vectors. In some embodiments, the viral vector may be an AAV vector. In some embodiments, the viral vectors are AAV2, AAV3, AAV3B, AAV5, AAV6, AAV6.2, AAV7, AAVrh. 64R1, AAVhu. 37, AAVrh. 8. AAVrh. 32.33, AAV8, AAV9, AAVrh10, or AAVLK03. In other embodiments, the viral vector may be a lentiviral vector.

In some embodiments, the lentivirus may be non-embedded. In some embodiments, the viral vector may be an adenovirus vector. In some embodiments, the adenovirus may be a high cloning ability or "gutless" adenovirus, in which 5'and 3'reverse end repeats (ITRs) and packaging signals ("I"". All coding virus regions except) have been deleted from the virus, increasing packaging capacity. In yet another embodiment, the viral vector may be an HSV-1 vector. In some embodiments, the HSV-1-based vector is helper-dependent, and in other embodiments, it is helper-independent. For example, an amplicon vector that retains only the packaging sequence requires a helper virus with structural components for packaging, whereas a 30 kb-deficient HSV-1 vector that eliminates non-essential viral function requires a helper virus. Do not. In additional embodiments, the viral vector may be bacteriophage T4. In some embodiments, the bacteriophage T4 may be capable of packaging any linear or circular DNA or RNA molecule when the virus head is empty. In a further embodiment, the viral vector may be a baculovirus vector. In a further further embodiment, the viral vector may be a retroviral vector. In embodiments that use AAV or lentiviral vectors with smaller cloning capabilities, it is necessary to use more than one vector to deliver all components of the vector system as disclosed herein. There is something. For example, one AAV vector may contain a sequence encoding an RNA-guided DNA nuclease such as Cas nuclease, and the second AAV vector may contain one or more guide sequences.

In some embodiments, the vector may be capable of promoting expression of one or more coding sequences in the cell. In some embodiments, the cell may be a prokaryotic cell, such as a bacterial cell. In some embodiments, the cell may be a eukaryotic cell, such as a yeast, plant, insect, or mammalian cell. In some embodiments, the eukaryotic cell may be a mammalian cell. In some embodiments, the eukaryotic cell may be a rodent cell. In some embodiments, the eukaryotic cell may be a human cell. Suitable promoters for promoting expression in different types of cells are known in the art. In some embodiments, the promoter may be wild-type. In other embodiments, the promoter may be modified for more efficient or effective expression. In yet other embodiments, the promoter may be cleaved but still retain its function. For example, the promoter may have a normal size, or a reduced size suitable for proper packaging of the vector into the virus.

In some embodiments, the vector may comprise a nucleotide sequence encoding an RNA-guided DNA nuclease, such as the nucleases described herein. In some embodiments, the nuclease encoded by the vector may be a Cas protein. In some embodiments, the vector system may include one copy of the nucleotide sequence encoding the nuclease. In other embodiments, the vector system may contain more than one copy of the nucleotide sequence encoding the nuclease. In some embodiments, the nucleotide sequence encoding the nuclease may be operably linked to at least one transcriptional or translational control sequence. In some embodiments, the nucleotide sequence encoding the nuclease may be operably linked to at least one promoter.

In some embodiments, the promoter may be constitutive, inducible, or tissue-specific. In some embodiments, the promoter may be a constitutive promoter. Non-limiting exemplary constitutive promoters include the cytomegalovirus earliest promoter (CMV), Simianvirus (SV40) promoter, adenovirus major late (MLP) promoter, Laus sarcoma virus (RSV) promoter, mouse mammary tumor Viral (MMTV) promoter, phosphoglycerate kinase (PGK) promoter, elongation factor-alpha (EF1a) promoter, ubiquitin promoter, actin promoter, tubulin promoter, immunoglobulin promoter, functional fragments thereof, or any of the above. Combinations can be mentioned. In some embodiments, the promoter may be a CMV promoter. In some embodiments, the promoter may be a cleaved CMV promoter. In other embodiments, the promoter may be the EF1a promoter. In some embodiments, the promoter may be an inducible promoter. Non-limiting exemplary inducible promoters include those which can be induced by heat shock, light, chemicals, peptides, metals, steroids, antibiotics, or alcohols. In some embodiments, the inducible promoter may be one with low basal (non-inducible) expression levels, such as the Tet-On® promoter (Clontech).

In some embodiments, the promoter may be a tissue-specific promoter, eg, a promoter specific for expression in the liver.

The vector may further comprise a nucleotide sequence encoding a guide RNA described herein. In some embodiments, the vector comprises one copy of the guide RNA. In other embodiments, the vector contains more than one copy of the guide RNA. In embodiments with more than one guide RNA, the guide RNAs may be non-identical to target different target sequences, or they may be identical to target the same target sequence. Good. In some embodiments where the vector comprises more than one guide RNA, each guide RNA has other different properties, eg, activity or stability within the complex with an RNA-guided DNA nuclease such as the Cas RNP complex. May have. In some embodiments, the nucleotide sequence encoding the guide RNA may be operably linked to at least one transcriptional or translational control sequence, such as a promoter, 3'UTR, or 5'UTR. In one embodiment, the promoter may be a tRNA promoter, eg, tRNA ^Lys3 , or a tRNA chimera. Mefferd et al. , RNA. 2015 21: 1683-9; Scherer et al. , Nucleic Acids Res. See 2007 35: 2620-2628. In some embodiments, the promoter may be recognized by RNA polymerase III (Pol III). Non-limiting examples of the Pol III promoter include the U6 and H1 promoters. In some embodiments, the nucleotide sequence encoding the guide RNA may be operably linked to the mouse or human U6 promoter. In other embodiments, the nucleotide sequence encoding the guide RNA may be operably linked to the mouse or human H1 promoter. In embodiments with more than one guide RNA, the promoters used to promote expression may be the same or different. In some embodiments, the nucleotide encoding the guide RNA crRNA and the nucleotide encoding the guide RNA trRNA may be provided on the same vector. In some embodiments, the nucleotides encoding crRNA and the nucleotides encoding trRNA may be driven by the same promoter. In some embodiments, the crRNA and trRNA may be transcribed into a single transcript. For example, crRNA and trRNA may be processed from a single transcript to form a dual molecule guide RNA. Alternatively, crRNA and trRNA may be transcribed into a single molecule guide RNA (sgRNA). In other embodiments, crRNA and trRNA may be promoted by their corresponding promoters on the same vector. In yet other embodiments, the crRNA and trRNA may be encoded by different vectors.

In some embodiments, the nucleotide sequence encoding the guide RNA may be located on the same vector containing the nucleotide sequence encoding the RNA guide DNA nuclease, such as Cas nuclease. In some embodiments, expression of RNA-guided DNA nucleases, such as guide RNAs and Cas proteins, may be facilitated by their own corresponding promoters. In some embodiments, the expression of the guide RNA may be driven by the same promoter that promotes the expression of an RNA-guided DNA nuclease, such as Cas protein. In some embodiments, RNA-guided DNA nuclease transcripts such as guide RNA and Cas protein may be contained within a single transcript. For example, the guide RNA may be in the untranslated region (UTR) of an RNA-guided DNA nuclease transcript such as Cas protein. In some embodiments, the guide RNA may be in the 5'UTR of the transcript. In other embodiments, the guide RNA may be in the 3'UTR of the transcript. In some embodiments, the intracellular half-life of the transcript may be reduced by containing a guide RNA within the 3'UTR, thereby shortening the length of the 3'UTR. In additional embodiments, the guide RNA may be in the intron of the transcript. In some embodiments, suitable splice sites may be added in the intron where the guide RNA is located so that the guide RNA is properly spliced from the transcript. In some embodiments, expression of RNA-guided DNA nucleases and guide RNAs, such as Cas proteins, from the same vector in close proximity in time may promote more efficient formation of the CRISPR RNP complex.

In some embodiments, the composition comprises a vector system. In some embodiments, the vector system may include one single vector. In other embodiments, the vector system may include two vectors. In additional embodiments, the vector system may include three vectors. If different guide RNAs are used for multiplexing, or if multiple copies of the guide RNA are used, the vector system may contain more than three vectors.

In some embodiments, the vector system may include an inducible promoter for initiation of expression only after delivery to the target cell. Non-limiting exemplary inducible promoters include those which can be induced by heat shock, light, chemicals, peptides, metals, steroids, antibiotics, or alcohols. In some embodiments, the inducible promoter may be one with low basal (non-inducible) expression levels, such as the Tet-On® promoter (Clontech).

In additional embodiments, the vector system may include a tissue-specific promoter for initiation of expression only after delivery to a particular tissue.

The vector may be delivered by liposomes, nanoparticles, exosomes, or microvesicles. The vector may also be delivered by lipid nanoparticles (LNP). For example, the U.S.A. named "LICID NANOPARTICLE FORMURATIONS FOR CRISPR / CAS COMPONENTS" filed on December 12, 2016. S. S. N. 62 / 433,228, the contents of which are incorporated herein by reference in their entirety. Any LNP and LNP formulation described herein are suitable for the delivery of guides alone or in combination with Cas nuclease or mRNA encoding Cas nuclease. In some embodiments, an LNP composition comprising an RNA component and a lipid component is included, the lipid component comprising amine lipids, triglycerides, helper lipids, and stealth lipids, with an N / P ratio of about 1. It is 10.

In some cases, the lipid component comprises Lipid A or its acetal analogs, cholesterol, DSPC, and PEG-DMG, with an N / P ratio of about 1-10. In some embodiments, the lipid component comprises about 40-60 mol% amine lipids, about 5-15 mol% neutral lipids, and about 1.5-10 mol% PEG lipids of the lipid component. The rest is helper lipids and the N / P ratio of the LNP composition is about 3-10. In some embodiments, the lipid component comprises from about 50-60 mol% amine lipids, from about 8-10 mol% neutral lipids, and from about 2.5-4 mol% PEG lipids to the lipid component. The rest is helper lipids and the N / P ratio of the LNP composition is about 3-8. In some cases, the lipid component comprises about 50-60 mol% amine lipid, about 5-15 mol% DSPC, and about 2.5-4 mol% PEG lipid, the rest of the lipid component. Is cholesterol, and the N / P ratio of the LNP composition is about 3-8. In some cases, the lipid component contains 48-53 mol% Lipid A, about 8-10 mol% DSPC, and 1.5-10 mol% PEG lipid, with the rest of the lipid component being cholesterol. And the N / P ratio of the LNP composition is 3 to 8 ± 0.2.

In some embodiments, the vector may be delivered systemically. In some embodiments, the vector may be delivered to the hepatic circulation.

This description and exemplary embodiments should not be construed as limiting. For the purposes of the specification and the appended claims, all numbers representing the amounts, percentages, or proportions used in the specification and claims, unless otherwise indicated. And other numbers should be understood as being modified by the term "about" in all cases, if not already so modified. Therefore, unless otherwise indicated, the numerical parameters described in the following specification and the appended claims are approximate and may be modified depending on the desired properties to be obtained. is there. At the very least, and without attempting to limit the application of the doctrine of equivalents to the claims, each numerical parameter should apply, at least in light of the number of significant figures reported, and the usual rounding techniques. Should be interpreted by.

As used herein and in the appended claims, the use of the singular forms "a", "an", and "the", as well as any singular form of any word, is specified in one referent. It should be noted that it includes multiple referents unless specifically and specifically limited. As used herein, the term "contains" and its grammatical variants are intended to be non-limiting, and listing of items in the list replaces or adds to the listed items. Do not exclude other similar items that can be.

The following examples are provided to illustrate certain disclosed embodiments with examples and should not be construed as limiting the scope of this disclosure in any way.

Example 1. Materials and Methods In vitro transcription of nuclease mRNA (“IVT”)
In vitro transcription using a linearized plasmid DNA template and T7 RNA polymerase produced cap-added and polyadenylated Streptococcus pyogenes (“Spy”) Cas9 mRNA containing N1-methylpseudo U. A plasmid DNA containing the T7 promoter, a sequence for transcription by SEQ ID NO: 1 or 2, and a 100 nt poly (A / T) region is provided under the following conditions: 200 ng / μL plasmid, 2 U / μL XbaI (NEB). , And linearized by incubating with XbaI at 37 ° C. for 2 hours with 1x reaction buffer. XbaI was inactivated by heating the reaction solution at 65 ° C. for 20 minutes. Linearization plasmids were purified from enzymes and buffer salts using a silica maxi spin column (Epoch Life Sciences) and analyzed on an agarose gel to confirm linearization. The IVT reaction solution for producing Cas9-modified mRNA was prepared under the following conditions: 50 ng / μL linear plasmid; 2 mM GTP, ATP, CTP, and N1-methylpseudo UTP (Trilink); 10 mM ARCA (Trilink). ); 5 U / μL T7 RNA polymerase (NEB); 1 U / μ L mouse ribonuclease inhibitor (NEB); 0.004 U / μ L inorganic E. coli. Incubated at 37 ° C. for 4 hours in coli pyrophosphatase (NEB); and 1x reaction buffer. After a 4-hour incubation, TURBO DNase (Thermo Fisher) was added to a final concentration of 0.01 U / μL and the reaction was incubated for an additional 30 minutes to remove the DNA template. Cas9 mRNA was purified from enzymes and nucleotides using the MegaClear Transcription Clean-up kit according to the manufacturer's protocol (Thermo Fisher). Alternatively, mRNA was purified through a precipitation protocol and, in some cases, HPLC-based purification followed. Briefly, after digestion with deoxyribonuclease, mRNA was precipitated by adding and mixing a 0.21 x volume of 7.5 M LiCl solution, and the precipitated mRNA was pelleted by centrifugation. After removing the supernatant, the mRNA was reconstituted in water. The mRNA was reprecipitated using ammonium acetate and ethanol. 5M ammonium acetate was added to the mRNA solution with 2x volumes of 100% EtOH up to a final concentration of 2M. The solutions were mixed and incubated at −20 ° C. for 15 minutes. The precipitated mRNA was pelleted again by centrifugation, the supernatant was removed, and the mRNA was reconstituted in water. As a final step, mRNA was precipitated using sodium acetate and ethanol. 1/10 volume of 3M sodium acetate (pH 5.5) was added to the solution with 2x volume of 100% EtOH. The solutions were mixed and incubated at −20 ° C. for 15 minutes. The precipitated mRNA was pelleted again by centrifugation, the supernatant was removed, the pellet was washed with 70% cold ethanol and air dried. The mRNA was reconstituted in water. For HPLC purified mRNA, after LiCl precipitation and rearrangement, the mRNA was purified by RP-IP HPLC (see, eg, Kariko, et al. Nucleic Acids Research, 2011, Vol. 39, No. 21 e142). The fractions selected for the pool were combined and desalted by sodium acetate / ethanol precipitation as described above. The transcript concentration was determined by measuring the absorbance at 260 nm (Nanodrop) and the transcript was analyzed by capillary electrophoresis on a Bioanlayer (Agilent).

When referring to SEQ ID NOs: 1 and 2 below for RNA, it is understood that T should be replaced with U (N1-methylpseudouridine as described above). The Cas9 mRNA used in the examples contains, for example, up to 100 nt of 5'caps and 3'poly A tails and is identified by SEQ ID NO:.

SEQ ID NO: 1: Cas9 sequence for transcription 1
GGGTCCCGCAGTCGGCGTCCAGCGGCTCTGCTTGTTCGTGTGTGTGTCGTTGCAGGCCTTATTCGGATCCGCCACCATGGACAAGAAGTACAGCATCGGACTGGACATCGGAACAAACAGCGTCGGATGGGCAGTCATCACAGACGAATACAAGGTCCCGAGCAAGAAGTTCAAGGTCCTGGGAAACACAGACAGACACAGCATCAAGAAGAACCTGATCGGAGCACTGCTGTTCGACAGCGGAGAAACAGCAGAAGCAACAAGACTGAAGAGAACAGCAAGAAGAAGATACACAAGAAGAAAGAACAGAATCTGCTACCTGCAGGAAATCTTCAGCAACGAAATGGCAAAGGTCGACGACAGCTTCTTCCACAGACTGGAAGAAAGCTTCCTGGTCGAAGAAGACAAGAAGCACGAAAGACACCCGATCTTCGGAAACATCGTCGACGAAGTCGCATACCACGAAAAGTACCCGACAATCTACCACCTGAGAAAGAAGCTGGTCGACAGCACAGACAAGGCAGACCTGAGACTGATCTACCTGGCACTGGCACACATGATCAAGTTCAGAGGACACTTCCTGATCGAAGGAGACCTGAACCCGGACAACAGCGACGTCGACAAGCTGTTCATCCAGCTGGTCCAGACATACAACCAGCTGTTCGAAGAAAACCCGATCAACGCAAGCGGAGTCGACGCAAAGGCAATCCTGAGCGCAAGACTGAGCAAGAGCAGAAGACTGGAAAACCTGATCGCACAGCTGCCGGGAGAAAAGAAGAACGGACTGTTCGGAAACCTGATCGCACTGAGCCTGGGACTGACACCGAACTTCAAGAGCAACTTCGACCTGGCAGAAGACGCAAAGCTGCAGCTGAGCAAGGACACATACGACGACGACCTGGACAACCTGCTGGCACAGATCGGAGACCAGTACGCAGACCTGTTCCTGGCAGCAAAGAACCTGAGCGACGCAATCCTGCTGAGCGACATCCTGAGAGTC AACACAGAAATCACAAAGGCACCGCTGAGCGCAAGCATGATCAAGAGATACGACGAACACCACCAGGACCTGACACTGCTGAAGGCACTGGTCAGACAGCAGCTGCCGGAAAAGTACAAGGAAATCTTCTTCGACCAGAGCAAGAACGGATACGCAGGATACATCGACGGAGGAGCAAGCCAGGAAGAATTCTACAAGTTCATCAAGCCGATCCTGGAAAAGATGGACGGAACAGAAGAACTGCTGGTCAAGCTGAACAGAGAAGACCTGCTGAGAAAGCAGAGAACATTCGACAACGGAAGCATCCCGCACCAGATCCACCTGGGAGAACTGCACGCAATCCTGAGAAGACAGGAAGACTTCTACCCGTTCCTGAAGGACAACAGAGAAAAGATCGAAAAGATCCTGACATTCAGAATCCCGTACTACGTCGGACCGCTGGCAAGAGGAAACAGCAGATTCGCATGGATGACAAGAAAGAGCGAAGAAACAATCACACCGTGGAACTTCGAAGAAGTCGTCGACAAGGGAGCAAGCGCACAGAGCTTCATCGAAAGAATGACAAACTTCGACAAGAACCTGCCGAACGAAAAGGTCCTGCCGAAGCACAGCCTGCTGTACGAATACTTCACAGTCTACAACGAACTGACAAAGGTCAAGTACGTCACAGAAGGAATGAGAAAGCCGGCATTCCTGAGCGGAGAACAGAAGAAGGCAATCGTCGACCTGCTGTTCAAGACAAACAGAAAGGTCACAGTCAAGCAGCTGAAGGAAGACTACTTCAAGAAGATCGAATGCTTCGACAGCGTCGAAATCAGCGGAGTCGAAGACAGATTCAACGCAAGCCTGGGAACATACCACGACCTGCTGAAGATCATCAAGGACAAGGACTTCCTGGACAACGAAGAAAACGAAGACATCCTGGAAGACATCGTCCTGACACTGACACTGTTCGAAGACAGAGAAATGATCGAAGAAAGACTGAAGACATACGCACACC TGTTCGACGACAAGGTCATGAAGCAGCTGAAGAGAAGAAGATACACAGGATGGGGAAGACTGAGCAGAAAGCTGATCAACGGAATCAGAGACAAGCAGAGCGGAAAGACAATCCTGGACTTCCTGAAGAGCGACGGATTCGCAAACAGAAACTTCATGCAGCTGATCCACGACGACAGCCTGACATTCAAGGAAGACATCCAGAAGGCACAGGTCAGCGGACAGGGAGACAGCCTGCACGAACACATCGCAAACCTGGCAGGAAGCCCGGCAATCAAGAAGGGAATCCTGCAGACAGTCAAGGTCGTCGACGAACTGGTCAAGGTCATGGGAAGACACAAGCCGGAAAACATCGTCATCGAAATGGCAAGAGAAAACCAGACAACACAGAAGGGACAGAAGAACAGCAGAGAAAGAATGAAGAGAATCGAAGAAGGAATCAAGGAACTGGGAAGCCAGATCCTGAAGGAACACCCGGTCGAAAACACACAGCTGCAGAACGAAAAGCTGTACCTGTACTACCTGCAGAACGGAAGAGACATGTACGTCGACCAGGAACTGGACATCAACAGACTGAGCGACTACGACGTCGACCACATCGTCCCGCAGAGCTTCCTGAAGGACGACAGCATCGACAACAAGGTCCTGACAAGAAGCGACAAGAACAGAGGAAAGAGCGACAACGTCCCGAGCGAAGAAGTCGTCAAGAAGATGAAGAACTACTGGAGACAGCTGCTGAACGCAAAGCTGATCACACAGAGAAAGTTCGACAACCTGACAAAGGCAGAGAGAGGAGGACTGAGCGAACTGGACAAGGCAGGATTCATCAAGAGACAGCTGGTCGAAACAAGACAGATCACAAAGCACGTCGCACAGATCCTGGACAGCAGAATGAACACAAAGTACGACGAAAACGACAAGCTGATCAGAGAAGTCAAGGTCATCACACTGAAGAGCAAGCTGGTCAGCGACTTCAGAAAGGACTTCCAGTTCTACAAGGT CAGAGAAATCAACAACTACCACCACGCACACGACGCATACCTGAACGCAGTCGTCGGAACAGCACTGATCAAGAAGTACCCGAAGCTGGAAAGCGAATTCGTCTACGGAGACTACAAGGTCTACGACGTCAGAAAGATGATCGCAAAGAGCGAACAGGAAATCGGAAAGGCAACAGCAAAGTACTTCTTCTACAGCAACATCATGAACTTCTTCAAGACAGAAATCACACTGGCAAACGGAGAAATCAGAAAGAGACCGCTGATCGAAACAAACGGAGAAACAGGAGAAATCGTCTGGGACAAGGGAAGAGACTTCGCAACAGTCAGAAAGGTCCTGAGCATGCCGCAGGTCAACATCGTCAAGAAGACAGAAGTCCAGACAGGAGGATTCAGCAAGGAAAGCATCCTGCCGAAGAGAAACAGCGACAAGCTGATCGCAAGAAAGAAGGACTGGGACCCGAAGAAGTACGGAGGATTCGACAGCCCGACAGTCGCATACAGCGTCCTGGTCGTCGCAAAGGTCGAAAAGGGAAAGAGCAAGAAGCTGAAGAGCGTCAAGGAACTGCTGGGAATCACAATCATGGAAAGAAGCAGCTTCGAAAAGAACCCGATCGACTTCCTGGAAGCAAAGGGATACAAGGAAGTCAAGAAGGACCTGATCATCAAGCTGCCGAAGTACAGCCTGTTCGAACTGGAAAACGGAAGAAAGAGAATGCTGGCAAGCGCAGGAGAACTGCAGAAGGGAAACGAACTGGCACTGCCGAGCAAGTACGTCAACTTCCTGTACCTGGCAAGCCACTACGAAAAGCTGAAGGGAAGCCCGGAAGACAACGAACAGAAGCAGCTGTTCGTCGAACAGCACAAGCACTACCTGGACGAAATCATCGAACAGATCAGCGAATTCAGCAAGAGAGTCATCCTGGCAGACGCAAACCTGGACAAGGTCCTGAGCGCATACAACAAGCACAGAGACAAGCCGATCAGAGAACAGGCAGAAAAC ATCATCCACCTGTTCACACTGACAAACCTGGGAGCACCGGCAGCATTCAAGTACTTCGACACAACAATCGACAGAAAGAGATACACAAGCACAAAGGAAGTCCTGGACGCAACACTGATCCACCAGAGCATCACAGGACTGTACGAAACAAGAATCGACCTGAGCCAGCTGGGAGGAGACGGAGGAGGAAGCCCGAAGAAGAAGAGAAAGGTCTAGCTAGCCATCACATTTAAAAGCATCTCAGCCTACCATGAGAATAAGAGAAAGAAAATGAAGATCAATAGCTTATTCATCTCTTTTTCTTTTTCGTTGGTGTAAAGCCAACACCCTGTCTAAAAAACATAAATTTCTTTAATCATTTTGCCTCTTTTCTCTGTGCTTCAATTAATAAAAAATGGAAAGAACCTCGAG

SEQ ID NO: 2: Cas9 sequence for transcription 2
GGGTCCCGCAGTCGGCGTCCAGCGGCTCTGCTTGTTCGTGTGTGTGTCGTTGCAGGCCTTATTCGGATCCATGGATAAGAAGTACTCAATCGGGCTGGATATCGGAACTAATTCCGTGGGTTGGGCAGTGATCACGGATGAATACAAAGTGCCGTCCAAGAAGTTCAAGGTCCTGGGGAACACCGATAGACACAGCATCAAGAAAAATCTCATCGGAGCCCTGCTGTTTGACTCCGGCGAAACCGCAGAAGCGACCCGGCTCAAACGTACCGCGAGGCGACGCTACACCCGGCGGAAGAATCGCATCTGCTATCTGCAAGAGATCTTTTCGAACGAAATGGCAAAGGTCGACGACAGCTTCTTCCACCGCCTGGAAGAATCTTTCCTGGTGGAGGAGGACAAGAAGCATGAACGGCATCCTATCTTTGGAAACATCGTCGACGAAGTGGCGTACCACGAAAAGTACCCGACCATCTACCATCTGCGGAAGAAGTTGGTTGACTCAACTGACAAGGCCGACCTCAGATTGATCTACTTGGCCCTCGCCCATATGATCAAATTCCGCGGACACTTCCTGATCGAAGGCGATCTGAACCCTGATAACTCCGACGTGGATAAGCTTTTCATTCAACTGGTGCAGACCTACAACCAACTGTTCGAAGAAAACCCAATCAATGCTAGCGGCGTCGATGCCAAGGCCATCCTGTCCGCCCGGCTGTCGAAGTCGCGGCGCCTCGAAAACCTGATCGCACAGCTGCCGGGAGAGAAAAAGAACGGACTTTTCGGCAACTTGATCGCTCTCTCACTGGGACTCACTCCCAATTTCAAGTCCAATTTTGACCTGGCCGAGGACGCGAAGCTGCAACTCTCAAAGGACACCTACGACGACGACTTGGACAATTTGCTGGCACAAATTGGCGATCAGTACGCGGATCTGTTCCTTGCCGCTAAGAACCTTTCGGACGCAATCTTGCTGTCCGATATCCTGCGCGTGAACACC GAAATAACCAAAGCGCCGCTTAGCGCCTCGATGATTAAGCGGTACGACGAGCATCACCAGGATCTCACGCTGCTCAAAGCGCTCGTGAGACAGCAACTGCCTGAAAAGTACAAGGAGATCTTCTTCGACCAGTCCAAGAATGGGTACGCAGGGTACATCGATGGAGGCGCTAGCCAGGAAGAGTTCTATAAGTTCATCAAGCCAATCCTGGAAAAGATGGACGGAACCGAAGAACTGCTGGTCAAGCTGAACAGGGAGGATCTGCTCCGGAAACAGAGAACCTTTGACAACGGATCCATTCCCCACCAGATCCATCTGGGTGAGCTGCACGCCATCTTGCGGCGCCAGGAGGACTTTTACCCATTCCTCAAGGACAACCGGGAAAAGATCGAGAAAATTCTGACGTTCCGCATCCCGTATTACGTGGGCCCACTGGCGCGCGGCAATTCGCGCTTCGCGTGGATGACTAGAAAATCAGAGGAAACCATCACTCCTTGGAATTTCGAGGAAGTTGTGGATAAGGGAGCTTCGGCACAAAGCTTCATCGAACGAATGACCAACTTCGACAAGAATCTCCCAAACGAGAAGGTGCTTCCTAAGCACAGCCTCCTTTACGAATACTTCACTGTCTACAACGAACTGACTAAAGTGAAATACGTTACTGAAGGAATGAGGAAGCCGGCCTTTCTGTCCGGAGAACAGAAGAAAGCAATTGTCGATCTGCTGTTCAAGACCAACCGCAAGGTGACCGTCAAGCAGCTTAAAGAGGACTACTTCAAGAAGATCGAGTGTTTCGACTCAGTGGAAATCAGCGGGGTGGAGGACAGATTCAACGCTTCGCTGGGAACCTATCATGATCTCCTGAAGATCATCAAGGACAAGGACTTCCTTGACAACGAGGAGAACGAGGACATCCTGGAAGATATCGTCCTGACCTTGACCCTTTTCGAGGATCGCGAGATGATCGAGGAGAGGCTTAAGACCTACGCTCATCTCTTCG ACGATAAGGTCATGAAACAACTCAAGCGCCGCCGGTACACTGGTTGGGGCCGCCTCTCCCGCAAGCTGATCAACGGTATTCGCGATAAACAGAGCGGTAAAACTATCCTGGATTTCCTCAAATCGGATGGCTTCGCTAATCGTAACTTCATGCAATTGATCCACGACGACAGCCTGACCTTTAAGGAGGACATCCAAAAAGCACAAGTGTCCGGACAGGGAGACTCACTCCATGAACACATCGCGAATCTGGCCGGTTCGCCGGCGATTAAGAAGGGAATTCTGCAAACTGTGAAGGTGGTCGACGAGCTGGTGAAGGTCATGGGACGGCACAAACCGGAGAATATCGTGATTGAAATGGCCCGAGAAAACCAGACTACCCAGAAGGGCCAGAAAAACTCCCGCGAAAGGATGAAGCGGATCGAAGAAGGAATCAAGGAGCTGGGCAGCCAGATCCTGAAAGAGCACCCGGTGGAAAACACGCAGCTGCAGAACGAGAAGCTCTACCTGTACTATTTGCAAAATGGACGGGACATGTACGTGGACCAAGAGCTGGACATCAATCGGTTGTCTGATTACGACGTGGACCACATCGTTCCACAGTCCTTTCTGAAGGATGACTCGATCGATAACAAGGTGTTGACTCGCAGCGACAAGAACAGAGGGAAGTCAGATAATGTGCCATCGGAGGAGGTCGTGAAGAAGATGAAGAATTACTGGCGGCAGCTCCTGAATGCGAAGCTGATTACCCAGAGAAAGTTTGACAATCTCACTAAAGCCGAGCGCGGCGGACTCTCAGAGCTGGATAAGGCTGGATTCATCAAACGGCAGCTGGTCGAGACTCGGCAGATTACCAAGCACGTGGCGCAGATCTTGGACTCCCGCATGAACACTAAATACGACGAGAACGATAAGCTCATCCGGGAAGTGAAGGTGATTACCCTGAAAAGCAAACTTGTGTCGGACTTTCGGAAGGACTTTCAGTTTTACAAAGTGAGAGA AATCAACAACTACCATCACGCGCATGACGCATACCTCAACGCTGTGGTCGGTACCGCCCTGATCAAAAAGTACCCTAAACTTGAATCGGAGTTTGTGTACGGAGACTACAAGGTCTACGACGTGAGGAAGATGATAGCCAAGTCCGAACAGGAAATCGGGAAAGCAACTGCGAAATACTTCTTTTACTCAAACATCATGAACTTTTTCAAGACTGAAATTACGCTGGCCAATGGAGAAATCAGGAAGAGGCCACTGATCGAAACTAACGGAGAAACGGGCGAAATCGTGTGGGACAAGGGCAGGGACTTCGCAACTGTTCGCAAAGTGCTCTCTATGCCGCAAGTCAATATTGTGAAGAAAACCGAAGTGCAAACCGGCGGATTTTCAAAGGAATCGATCCTCCCAAAGAGAAATAGCGACAAGCTCATTGCACGCAAGAAAGACTGGGACCCGAAGAAGTACGGAGGATTCGATTCGCCGACTGTCGCATACTCCGTCCTCGTGGTGGCCAAGGTGGAGAAGGGAAAGAGCAAAAAGCTCAAATCCGTCAAAGAGCTGCTGGGGATTACCATCATGGAACGATCCTCGTTCGAGAAGAACCCGATTGATTTCCTCGAGGCGAAGGGTTACAAGGAGGTGAAGAAGGATCTGATCATCAAACTCCCCAAGTACTCACTGTTCGAACTGGAAAATGGTCGGAAGCGCATGCTGGCTTCGGCCGGAGAACTCCAAAAAGGAAATGAGCTGGCCTTGCCTAGCAAGTACGTCAACTTCCTCTATCTTGCTTCGCACTACGAAAAACTCAAAGGGTCACCGGAAGATAACGAACAGAAGCAGCTTTTCGTGGAGCAGCACAAGCATTATCTGGATGAAATCATCGAACAAATCTCCGAGTTTTCAAAGCGCGTGATCCTCGCCGACGCCAACCTCGACAAAGTCCTGTCGGCCTACAATAAGCATAGAGATAAGCCGATCAGAGAACAGGCCGAGAACATTATC CACTTGTTCACCCTGACTAACCTGGGAGCCCCAGCCGCCTTCAAGTACTTCGATACTACTATCGATCGCAAAAGATACACGTCCACCAAGGAAGTTCTGGACGCGACCCTGATCCACCAAAGCATCACTGGACTCTACGAAACTAGGATCGATCTGTCGCAGCTGGGTGGCGATGGCGGTGGATCTCCGAAAAAGAAGAGAAAGGTGTAATGAGCTAGCCATCACATTTAAAAGCATCTCAGCCTACCATGAGAATAAGAGAAAGAAAATGAAGATCAATAGCTTATTCATCTCTTTTTCTTTTTCGTTGGTGTAAAGCCAACACCCTGTCTAAAAAACATAAATTTCTTTAATCATTTTGCCTCTTTTCTCTGTGCTTCAATTAATAAAAAATGGAAAGAACCTCGAG

Human TTR guide design and human TTR along with cynomolgus monkey homology guide design
Initial guide selections were made in silico to identify PAMs in the region of interest using a human reference genome (eg, hg38) and a user-defined genomic region of interest (eg, TTR protein coding exons). .. Each identified PAM will be analyzed and statistics will be reported. GRNA molecules were further selected and ranked based on a number of criteria (eg, GC content, expected on-target activity, and potential off-target activity).
A total of 68 guide RNAs for TTR (ENSG000000118271) were designed by targeting the protein coding regions within exons 1, 2, 3 and 4. Of the total of 68 guides, 33 were 100% homologous in cynomolgus monkeys (“cyno”). In addition, for 10 human TTR guides that are not completely homologous in cynomolgus monkeys, "surrogate" guides were designed and generated in parallel to perfectly match the corresponding cynomolgus monkey target sequences. These "surrogate" or "tool" guides can be screened in cynomolgus monkeys, for example, to approximate the activity and function of homologous human guide sequences. Guide sequences and corresponding genomic coordinates are provided (Table 1). All guide RNAs were made as dual guide RNAs and a subset of guide sequences were made as modified single guide RNAs (Table 2). In addition to dual guide RNA (dgRNA) IDs, modified single guide RNA (sgRNA) IDs, and the number of mismatches to the cynomolgus monkey genome, we provide guide ID alignment across exactly matching IDs in cynomolgus monkeys (Table 3). When dgRNA was used in the experiments detailed throughout the Examples, SEQ ID NO: 270 was used.

Delivery of Cas9 mRNA and guide RNA in vitro HEK293_Cas9 cell line. The human fetal kidney adenocarcinoma cell line HEK293 (“HEK293_Cas9”) constitutively expressing Spy Cas9 was cultured in DMEM medium supplemented with 10% fetal bovine serum and 500 μg / ml G418. Cells were plated on 96-well plates at a density of 10,000 cells / well 24 hours prior to transfection. Cells were transfected with Lipofectamine RNAiMAX (Thermo Fisher, Cat. 13778150) according to the manufacturer's protocol. Cells were transfected with lipoplex containing individual crRNA (25 nM), trRNA (25 nM), Lipofectamine RNAiMAX (0.3 μL / well) and OptiMem.

HUH7 cell line. Human hepatocellular carcinoma cell line HUH7 (Japanese Collection of Research Bioresurces Cell Bank, Cat. JCRB0403) was cultured in DMEM medium supplemented with 10% fetal bovine serum. Cells were plated on 96-well plates at a density of 15,000 cells / well 20 hours prior to transfection. Cells were transfected with Lipofectamine Messenger MAX (Thermo Fisher, Cat. LMRNA003) according to the manufacturer's protocol. Lipoplex containing Spy Cas9 mRNA (100 ng), MessengerMAX (0.3 μL / well) and OptiMem in cells, followed by individual crRNA (25 nM), tracer RNA (25 nM), MessengerMAX (0.3 μL / well) and OptiMem. Separate lipoplexes containing were sequentially transfected.

HepG2 cell line. The human hepatocellular carcinoma cell line HepG2 (American Type Culture Collection, Cat. HB-8065) was cultured in DMEM medium supplemented with 10% bovine fetal serum. Cells were counted and plated on 96-well plates (Thermo Fisher, Cat. 877272) coated with Bio-coat collagen I at a density of 10,000 cells / well on 96-well plates 24 hours prior to transfection. Cells were transfected with Lipofectamine 2000 (Thermo Fisher, Cat. 11668019) according to the manufacturer's protocol. Lipoplex containing Spy Cas9 mRNA (100 ng), Lipofectamine 2000 (0.2 μL / well) and OptiMem in cells, followed by individual crRNA (25 nM), tracer RNA (25 nM), Lipofectamine 2000 (0.2 μL / well). Separate lipoplexes containing and OptiMem were sequentially transfected.

Primary liver hepatocytes. Primary human liver hepatocytes (PHH) and primary cynomolgus monkey liver hepatocytes (PCH) (Gibco) were cultured according to the manufacturer's protocol (Invitrogen, protocol 11.28.2012). Briefly, cells were thawed, resuspended in hepatocyte thawing medium with additives (Gibco, Cat. CM7000) and then centrifuged at 100 g for 10 minutes for humans and 80 g for cynomolgus monkeys for 4 minutes. The supernatant was discarded and the pelleted cells were resuspended in hepatocyte plating medium + additive pack (Invitrogen, Cat. A12176001 and CM3000). Cells are counted and a density of 33,000 cells / well for humans or 60,000 cells / well for cynomolgus monkeys (or 65,000 cells / well when assaying for effects on TTR protein, as further described below). Plated on 96-well plates (ThermoFisher, Cat. 877272) coated with Bio-coat collagen I. Plated cells were allowed to adhere in a tissue culture incubator at 37 ° C. and 5% CO ₂ atmosphere for 6 or 24 hours. After incubation, cells were confirmed for monolayer formation and the medium was replaced with hepatocellular culture medium containing serum-free additive packs (Invitrogen, Cat. A12176001 and CM4000).

Lipofectamine RNAiMax (Thermo Fisher, Cat. 13778150) -based transfection was performed according to the manufacturer's protocol. Lipoplex containing Spy Cas9 mRNA (100 ng), Lipofectamine RNAiMax (0.4 μL / well) and OptiMem in cells, followed by crRNA (25 nM) and tracer RNA (25 nM) or sgRNA (25 nM), Lipofectamine RNAiMax (0.4 μL / well). Separate lipoplexes containing / well) and OptiMem were sequentially transfected.

After ribonucleotide formation, cells were electroporated or transfected with a Spy Cas9 protein (RNP) carrying a guide RNA. For dual guides (dgRNA), individual crRNA and trRNA were pre-annealed by mixing equal amounts of reagents, incubating at 95 ° C. for 2 minutes and cooling to room temperature. The single guide (sgRNA) was boiled at 95 ° C. for 2 minutes and cooled to room temperature. Boiled dgRNA or sgRNA was incubated with Spy Cas9 protein in Optimem at room temperature for 10 minutes to form a ribonucleoprotein (RNP) complex.

For electroporation of RNP to primary human and cynomolgus monkey hepatocytes, the cells were thawed and concentrated in Lonza electroporation Primary Cell P3 buffer at 2500 cells / μL for human hepatocytes and 3500 cells / μL for cynomolgus monkey hepatocytes. Resuspend in. Mix 20 μL volumes of resuspended cells and 5 μL RNP per guide. Place 20 μL of the mixture in a Lonza electroporation plate. Cells were electroporated using a Lonza nucleofector using a preset protocol EX-147. After electroporation, cells are transferred to a Biocoat plate containing preheated maintenance medium and placed in a tissue culture incubator at 37 ° C. and 5% CO ₂ .

For transfection of RNP lipoplex, cells were transfected with Lipofectamine RNAiMAX (Thermo Fisher, Cat. 13778150) according to the manufacturer's protocol. Cells were transfected with RNP containing Spy Cas9 (10 nM), individual guides (10 nM), tracer RNA (10 nM), Lipofectamine RNAiMAX (1.0 μL / well) and OptiMem. The formation of RNP was carried out as described above.

LNPs were formed by microfluidic mixing of lipid and RNA solutions using Precision Nanosystems NanoAssemblr ™ Benchtop Instrument according to the manufacturer's protocol, or by cross-flow mixing.

LNP formulation-NanoAssemblr
In general, lipid nanoparticle components were dissolved in 100% ethanol with lipid components of various molar ratios. RNA cargo was dissolved in 25 mM citrate, 100 mM NaCl (pH 5.0) to give a concentration of RNA cargo of about 0.45 mg / mL as a result. LNPs were blended in a molar ratio of about 4.5 or about 6 lipid amines to RNA phosphates (N: P) and a weight ratio of 1: 1 mRNA to gRNA.

LNPs were formed by microfluidic mixing of lipid and RNA solutions using Precision Nanosystems NanoAssemblr ™ Benchtop Instrument according to the manufacturer's protocol. The difference in flow rates was used to maintain a 2: 1 ratio of aqueous solvent to organic solvent during mixing. After mixing, LNP was recovered, diluted in water (about 1: 1 v / v), kept at room temperature for 1 hour, further diluted with water (about 1: 1 v / v), and then the final buffer exchange was performed. .. Final buffer exchange to 50 mM Tris, 45 mM NaCl, 5% (w / v) sucrose, pH 7.5 (TSS) was completed using a PD-10 desalting column (GE). If necessary, the formulation was concentrated by centrifugation using an Amicon 100 kDa centrifugal filter (Millipore). The resulting mixture was then filtered using a 0.2 μm sterile filter. The final LNP was stored at −80 ° C. until further use.

LNP Formulation-Cross Flow For LNPs prepared using the cross flow technique, LNPs were formed by collision jet mixing of lipids in ethanol with 2 volumes of RNA solution and 1 volume of water. The lipid in ethanol is mixed with 2 volumes of RNA solution through a mixing cloth. A fourth stream of water is mixed with the outlet stream of the cloth through an in-line tee (see Figure 2 of WO2016010840). LNP was kept at room temperature for 1 hour and further diluted with water (about 1: 1 v / v). After concentrating the diluted LNP using tangential flow filtration on a flat sheet cartridge (Sartorius, 100 kD MWCO), the buffer was diafiltrated with 50 mM Tris, 45 mM NaCl, 5% (w / v). Was replaced with sucrose, pH 7.5 (TSS). Alternatively, the final buffer exchange to TSS was completed using a PD-10 desalting column (GE). If necessary, the formulation was concentrated by centrifugation using an Amicon 100 kDa centrifugal filter (Millipore). The resulting mixture was then filtered using a 0.2 μm sterile filter. The final LNP was stored at 4 ° C or -80 ° C until further use.

Analysis of Formulations Dynamic light scattering (“DLS”) is used to characterize the multidispersity index (“pdi”) and size of the LNPs disclosed herein. DLS measures the light scattering that results from feeding a sample to a light source. The PDI determined from the DLS measurement represents the distribution of particle size within the population (around the average particle size), with a perfectly uniform population having a PDI of 0. Average particle size and polydispersity are measured by dynamic light scattering (DLS) using a Malvern Zethasizer DLS instrument. LNP samples were diluted to 30X in PBS prior to measurement by DLS. The Z average diameter, which is an intensity-based measurement of average particle size, is reported along with the number average diameter and pdi. A Malvern Zetasizer device is also used to measure the Zeta potential of the LNP. Prior to measurement, the sample is diluted 1:17 (50 uL to 800 uL) with 0.1 X PBS, pH 7.4.

Fluorescence-based assays (Ribogren®, Thermo Fisher Scientific) are used to determine total RNA concentration and free RNA. Encapsulation efficiency is calculated as (total RNA-free RNA) / total RNA. LNP samples are appropriately diluted with 1x TE buffer containing 0.2% Triton-X 100 to determine total RNA, or diluted with 1x TE buffer to determine free RNA. A standard curve is made by utilizing the starting RNA solution used to make the formulation and diluted with 1x TE buffer +/- 0.2% Triton-X 100. Diluted RiboGreen® dye (according to the manufacturer's instructions) is then added to each of the standard and sample and incubated in the absence of light for about 10 minutes at room temperature. Samples are read using a SpectraMax M5 Microplate Reader (Molecular Devices) and the excitation, automatic cutoff and emission wavelengths are set to 488 nm, 515 nm and 525 nm, respectively. Determine total RNA and free RNA from the appropriate standard curve.

Encapsulation efficiency is calculated as (total RNA-free RNA) / total RNA. The same procedure may be used to determine the encapsulation efficiency of DNA-based cargo components. The Orange Dye may be used for single-stranded DNA, and the Picogreen Dye may be used for double-stranded DNA.

Typically, when LNP was prepared, encapsulation was> 80%, particle size was <120 nm, and pdi was <0.2.

Delivery of LNP in vivo Unless otherwise stated, 6-10 week old CD-1 female mice were used in each experiment. Animals were weighed and grouped according to body weight to prepare dosing solutions based on group average body weight. LNP was administered via the temporal vein in a volume of 0.2 mL per animal (approximately 10 mL per kilogram of body weight). Animals were observed for adverse effects approximately 6 hours after dosing. Body weight was measured 24 hours after dosing and animals were euthanized at various time points by blood loss through cardiac puncture under isoflurane anesthesia. Blood was collected in serum separation tubes or tubes containing buffered sodium citrate for plasma as described herein. For experiments involving in vivo editing, liver tissue was harvested from the middle lobe of each animal or three independent lobes (eg, right middle lobe, left middle lobe, and lateral left lobe) for DNA extraction and analysis.

Transthyretin (TTR) ELISA analysis used in animal experiments Blood was collected and serum was isolated as indicated. All mouse TTR serum levels were determined using a Mouse Prealbumin (Transthyretin) ELISA Kit (Aviva Systems Biology, Cat. OKIA00111) and rat TTR serum levels were determined using a rat-specific ELISA kit (Aviva System) using a rat-specific ELISA kit (Aviva Systems Catalog). Human TTR serum levels were measured using a human-specific ELISA kit (Aviva Systems Biology, Catalog No. OKIA00081), each performed according to the manufacturer's protocol. Briefly, serum was serially diluted 10,000-fold with the kit's sample diluent, or 5,000-fold when measuring human TTR in mouse serum. 100 ul of prepared standard curve or diluted serum sample was added to an ELISA plate, incubated for 30 minutes at room temperature, and then washed 3 times with the provided wash buffer. Next, 100 uL of the detection antibody was added to each well, incubated at room temperature for 20 minutes, and then washed 3 times. After adding 100 uL of substrate, the mixture was incubated at room temperature for 10 minutes, and then 100 uL of stop solution was added. Absorbance of the contents was measured with a Spectramax M5 plate reader and analyzed using Softmax Pro version 7.0 software. Serum TTR levels were quantified from the standard curve using a 4-parameter logistic fit and expressed as a percentage of ug / mL serum or knockdown relative control (vehicle treated) animals.

Isolation of Genomic DNA Transfected cells were harvested 24, 48, or 72 hours after transfection. Genomic DNA was extracted from each well of a 96-well plate using a 50 μL / well Blockal Amp DNA Extraction solution (Epicenter, Cat. QE09050) according to the manufacturer's protocol. All DNA samples were subjected to PCR and subsequent NGS analysis as described herein.

Next Generation Sequencing (“NGS”) Analysis Sequencing was used to identify the presence of insertions and deletions introduced by gene editing to quantitatively determine the efficiency of editing at target locations in the genome.

Primers were designed around the target site within the gene of interest (eg, TTR) to amplify the genomic compartment of interest.

Additional PCR was performed according to the manufacturer's protocol (Illumina) to add the chemicals for sequencing. The amplicons were sequenced on an Illumina MiSeq instrument. Align the read to the reference genome (eg, human reference genome (hg38), cynomolgus monkey reference genome (mf5), rat reference genome (rn6), or mouse reference genome (mm10)) after removing those with a low quality score. did. The resulting file containing reads is mapped to the reference genome (BAM file), the reads that overlap the target region of interest are selected, and the wild type for the number of reads containing inserts, substitutions, or deletions. The number of leads was calculated.

The edit percentage (eg, "edit efficiency" or "edit percentage" or "indel frequency") is the total number of sequence reads with insertions / deletions ("indels") or substitutions across the total number of sequence reads, including wild types. Defined.

Analysis of secreted transthyretin (“TTR”) protein by Western blot The level of TTR protein secretion in the medium was determined using Western blotting. HepG2 cells were transfected with the selection guide from Table 1 as previously described. Medium changes were made every 3 days after transfection. The medium was removed 6 days after transfection and the cells were washed once with fetal bovine serum (FBS) -free medium. Serum-free medium was added to the cells and incubated at 37 ° C. After 4 hours, the medium was removed, centrifuged to pellet any debris, and cell numbers were estimated for each well based on the values obtained from the CTG assay for residual cells and comparison with plate averages. After centrifugation, the medium was transferred to a new plate and stored at −20 ° C. Acetone precipitation of the medium was performed to precipitate any protein secreted into the medium. Four volumes of ice-cooled acetone were added to one volume of medium. The solution was mixed well and kept at -20 ° C for 90 minutes. Acetone: medium mixture was centrifuged at 15,000 xg and 4 ° C. for 15 minutes. The supernatant was discarded and the retained pellet was air dried to remove any residual acetone. Pellets were resuspended in 15 μL RIPA buffer (Boston Bio Products, Cat. BP-115) freshly added with a protease inhibitor mixture consisting of a complete protease inhibitor cocktail (Sigma, Cat. 116979489001) and 1 mM DTT. .. The lysate was mixed with Laemmli buffer and denatured at 95 ° C. for 10 minutes. Wet transfer to 0.45 μm nitrocellulose membrane (Bio-Rad, Cat. 162015) after performing Western blots using the NuPage system (Thermo Fisher) on 12% Bis-Tris gel according to the manufacturer's protocol. Was done. Blots were blocked using 5% milk powder in TBS for 30 minutes at room temperature on a lab rocker. The blots were rinsed with TBST and probed with a rabbit α-TTR monoclonal antibody (Abcam, Cat. Ab75815) at 1: 1000 during TBST. Alpha-1 antitrypsin was used as a loading control (Sigma, Cat. HPA001292) at 1: 1000 in TBST and incubated simultaneously with the TTR primary antibody. The blot was sealed in a bag and kept overnight at 4 ° C. on a laboratory locker. After incubation, the blots were rinsed 3 times in TBST for 5 minutes each and probed with a secondary antibody against rabbits (Thermo Fisher, Cat. PISA535571) at 1: 25,000 in TBST for 30 minutes at room temperature. After incubation, the blots were rinsed 3 times in TBST, 5 minutes each, and 2 times with PBS. Blots were visualized and analyzed using the Licor Odyssey system.

Analysis of Intracellular TTR by Western Blot Hepatocellular Carcinoma Cell Line HUH7 was transfected with a selection guide from Table 1 as previously described. The medium was removed 6 days after transfection and the protease inhibitor mixture consisted of a complete protease inhibitor cocktail (Sigma, Cat. 116979489001), 1 mM DTT, and 250 U / ml Benzonase (EMD Millipore, Cat. 71206-3). Cells were lysed with a freshly added 50 μL / well RIPA buffer (Boston Bio Products, Cat. BP-115). The cells were kept on ice for 30 minutes, at which time NaCl (final concentration of 1M) was added. The cell lysate was thoroughly mixed and held on ice for 30 minutes. Whole cell extracts (“WCE”) were transferred to PCR plates and centrifuged to pellet debris. The protein content of the lysate was evaluated using the Bradford assay (Bio-Rad, Cat. 500-0001). The procedure for the Bladeford assay was performed according to the manufacturer's protocol. The extract was stored at −20 ° C. before use. Western blotting was performed to evaluate intracellular TTR protein levels. The lysate was mixed with Laemmli buffer and denatured at 95 ° C. for 10 minutes. Wet transfer to 0.45 μm nitrocellulose membrane (Bio-Rad, Cat. 162015) after performing Western blots using the NuPage system (Thermo Fisher) on 12% Bis-Tris gel according to the manufacturer's protocol. Was done. The transfer membrane was thoroughly rinsed with water and stained with Ponceau S solution (Boston Bio Products, Cat. ST-180) to confirm complete and uniform transfer. Blots were blocked using 5% milk powder in TBS for 30 minutes at room temperature on a laboratory locker. The blots were rinsed with TBST and probed with a rabbit α-TTR monoclonal antibody (Abcam, Cat. Ab75815) at 1: 1000 during TBST. β-actin was used as a loading control (Thermo Fisher, Cat. AM4302) at 1: 2500 in TBST and incubated with the TTR primary antibody. The blot was sealed in a bag and kept overnight at 4 ° C. on a laboratory locker. After incubation, blots are rinsed 3 times in TBST for 5 minutes each and probing with secondary antibodies against mice and rabbits (Thermo Fisher, Cat. PI35518 and PISA535571) at 1: 25,000 each in TBST for 30 minutes at room temperature. went. After incubation, the blots were rinsed 3 times in TBST, 5 minutes each, and 2 times with PBS. Blots were visualized and analyzed using the Licor Odyssey system.

Example 2. Screening of dgRNA sequences Cross-screening of TTR dgRNAs in multiple cell types A guide in the form of dgRNA targeting matched sequences of human TTR and cynomolgus monkeys, other than HEK293_Cas9, HUH7 and HepG2 cell lines as described in Example 1. Was delivered to primary human hepatocytes and primary cynomolgus monkey hepatocytes. Editing percentages were determined for crRNA containing each guide sequence across each cell type, and then the guide sequences were ranked based on the highest editing percentage. Screening data for the guide sequences in Table 1 for all five cell lines are listed below (Tables 4-11).

Table 4 shows the mean and standard deviations of the edited%, insertion% (Ins), and deletion% (Del) for TTR crRNA in the human kidney adenocarcinoma cell line HEK293_Cas9, which constitutively overexpresses the Spy Cas9 protein.

Table 5 shows the edited%, insertion% (Ins), and deletion% (Del) of the tested TTR crRNA co-transfected with Spy Cas9 mRNA (SEQ ID NO: 2) in the human hepatocellular carcinoma cell line HUH7. Shows mean and standard deviation.

Table 6 shows% edited,% inserted (Ins), and% deleted (Del) for the tested TTR and control crRNA co-transfected with Spy Cas9 mRNA (SEQ ID NO: 2) in the human hepatocellular carcinoma cell line HepG2. ) Means and standard deviations.

Table 7 shows the mean and standard deviations of the edited%, insertion% (Ins), and deletion% (Del) for the tested TTR degRNA electroporated with the Spy Cas9 protein (RNP) in primary human hepatocytes.

Table 8 shows the mean and standard deviations of the edited%, insertion% (Ins), and deletion% (Del) for the tested TTR and control dgRNA transfected with the Spy Cas9 protein (RNP) in primary human hepatocytes. Shown.

Table 9 shows the average edited%, insertion% (Ins), and deletion% (Del) of the tested TTR and control dgRNA co-transfected with Spy Cas9 mRNA (SEQ ID NO: 2) in primary human hepatocytes. And the standard deviation.

Table 10 shows the mean and standard deviations of the edited%, insertion% (Ins), and deletion% (Del) for the tested TTR degRNA electroporated with the Spy Cas9 protein (RNP) in primary cynomolgus monkey hepatocytes.

Table 11 shows the mean and standard deviations of the edited%, insertion% (Ins), and deletion% (Del) for the tested cynomolgus monkey-specific TTR degRNA electroporated with the Spy Cas9 protein (RNP) in primary cynomolgus hepatocytes. Is shown.

Example 3. Screening of sgRNA sequences Cross-screening of TTR sgRNA in multiple cell types Delivery of modified sgRNA-form guides targeting human and / or cynomolgus monkey TTR to primary human and cynomolgus monkey hepatocytes as described in Example 1. did. Editing percentages were determined for crRNA containing each guide sequence across each cell type, and then the guide sequences were ranked based on the highest editing percentage. Screening data for the guide sequences in Table 2 in both cell lines are listed below (Tables 12-15).

Table 12 shows the mean and standard deviations of the edited%, insertion% (Ins), and deletion% (Del) for TTR sgRNAs transfected with the Spy Cas9 protein (RNP) in primary human hepatocytes.

Table 13 shows 12.5 nM of edited%, insertion% (Ins), and deletion% (Del) of the tested TTR sgRNA co-transfected with Spy Cas9 mRNA (SEQ ID NO: 2) in primary human hepatocytes. The mean and standard deviation in.

Table 14 shows the mean and standard deviations of% edited%,% inserted (Ins), and% deleted (Del) for the tested TTR sgRNA electroporated with the Spy Cas9 protein (RNP) in primary cynomolgus monkey hepatocytes. It should be noted that the guides G000480 and G000488 have one mismatch with cynomolgus monkeys and can degrade editing efficiency in cynomolgus monkey cells.

Table 15 shows the mean and standard deviations of the edited%, insertion% (Ins), and deletion% (Del) for the tested cynomolgus monkey-specific TTR sgRNA electroporated with the Spy Cas9 protein (RNP) in primary cynomolgus hepatocytes. Is shown.

Example 4. Screening of Lipid Nanoparticles (LNP) Formulations Containing Spy Cas9 mRNA and sgRNA Cross Screening of LNP Formulated TTR sgRNA with Spy Cas9 mRNA in Primary Human Hepatocytes and Primary Crab Hepatocytes

Lipid nanoparticle formulations of modified sgRNAs targeting human TTR and matching sgRNA sequences of cynomolgus monkeys were tested on primary human hepatocytes and cynomolgus monkey hepatocytes on dose response curves. Primary human and cynomolgus monkey hepatocytes were plated as described in Example 1. Both cell lines were incubated at 37 ° C. and 5% CO ₂ for 24 hours prior to treatment with LNP. The LNPs used in the experiments detailed in Tables 16-19 were prepared using the procedure of Nanoassemblr ™, each containing a particular sgRNA and Cas9 mRNA (SEQ ID NO: 2), each containing. It had lipids. LNP contained lipid A, cholesterol, DSPC, and PEG2k-DMG in a molar ratio of 45:44: 9: 2, respectively, and had an N: P ratio of 4.5. LNP was incubated in hepatocyte maintenance medium containing 6% cynomolgus monkey serum at 37 ° C. for 5 minutes. After incubation, LNP was added to primary human or cynomolgus monkey hepatocytes with a double dose response curve of 8 points starting with 100 ng mRNA. Cells were lysed 72 hours after treatment for NGS analysis as described in Example 1. Editing percentages were determined for crRNA containing each guide sequence across each cell type, and then the guide sequences were ranked based on the highest editing% at 12.5 ng mRNA input and 3.9 nM guide concentration. Dose response curves for guide sequences in both cell lines are shown in Figures 4-7. Edited% at 12.5 ng mRNA input and 3.9 nM guide concentration are listed below (Tables 16-18).

Table 16 shows 12. The mean and standard deviation in 5 ng of cas9 mRNA is shown. G000570 exhibits an uncharacteristic dose response curve compared to other sgRNAs and may be an experimental artifact. The data is shown graphically in FIG.

Table 17 shows 12. The mean and standard deviation at a guide concentration of 5 ng mNRA and 3.9 nM are shown. The data is shown graphically in FIG.

Table 18 shows the edited%,% insertion (Ins), and% deletion (Del) of the tested cypress monkey-specific TTR sgRNA formulated in lipid nanoparticles with Spy Cas9 mRNA in primary cypress hepatocytes as a dose response curve. Shows the mean and standard deviation at a guide concentration of 12.5 ng mRNA and 3.9 nM. The data is shown graphically in FIG.

Cross-screening of TTR sgRNA compounded in LNP with Spy Cas9 mRNA in primary human hepatocytes and primary crab hepatocytes Primary human hepatocytes with modified sgRNA targeting human TTR and lipid nanoparticles of crab monkey matching sgRNA sequences And primary crab hepatocytes were tested on the dose response curve. Primary human and cynomolgus monkey hepatocytes were plated as described in Example 1. Both cell lines were incubated at 37 ° C. and 5% CO ₂ for 24 hours prior to treatment with LNP. The LNPs used in the experiments detailed in Tables 20-22 were prepared using the cross-flow procedure described above, but were purified using a PD-10 column (GE Healthcare Life Sciences) and an Amicon centrifuge filter unit (Millipore). Concentrated using Sigma), each containing a particular sgRNA and Cas9 mRNA (SEQ ID NO: 1). LNP contained lipid A, cholesterol, DSPC, and PEG2k-DMG in a molar ratio of 50:38: 9: 3, respectively, and had an N: P ratio of 6.0. LNP was incubated in hepatocyte maintenance medium containing 6% cynomolgus monkey serum at 37 ° C. and 5% CO ₂ for 5 minutes. After incubation, LNP was added to primary human or cynomolgus monkey hepatocytes with a 3-fold dose response curve of 8 points starting with 300 ng mRNA. Cells were lysed 72 hours after treatment for NGS analysis as described in Example 1. Editing percentages were determined for crRNAs containing each guide sequence across each cell type, and then the guide sequences were ranked based on EC50 values and maximum editing percentages. Dose response curve data for guide sequences in both cell lines are shown in Figures 4-7. The EC50 values and maximum edit percentages are listed below (Tables 19-22).

Table 19 shows the EC50 and maximal edits of the tested human-specific TTR sgRNA formulated in lipid nanoparticles with U-depleted Spy Cas9 mRNA in primary human hepatocytes as a dose response curve. The data is shown graphically in FIG.

Table 20 shows the EC50 and maximal edits of the tested human-specific TTR sgRNA formulated in lipid nanoparticles with U-depleted Spy Cas9 mRNA in primary cynomolgus monkey hepatocytes as a dose response curve. The data is shown graphically in FIG.

Table 21 shows the EC50 and maximal edits of matched TTR sgRNAs of cynomolgus monkeys tested blended into lipid nanoparticles with U-depleted Spy Cas9 mRNA in primary human hepatocytes as dose response curves. The data is shown graphically in FIG.

Table 22 shows the EC50 and maximal edits of matched TTR sgRNAs of tested cynomolgus monkeys blended into lipid nanoparticles with U-depleted Spy Cas9 mRNA in primary cynomolgus monkey hepatocytes as dose response curves. The data is shown graphically in FIG.

Example 5. Off-target analysis of TTR dgRNA and sgRNA Cas9 targeting TTR using TTR-guided off-target analysis oligo-insertion-based assays (see, eg, Tsai et al., Nature Biotechnology 33, 187-197; 2015). Potential off-target genomic sites to be cleaved by The 45 dgRNAs in Table 1 (and two control guides with known off-target profiles) were screened in HEK293_Cas9 cells. The human fetal kidney adenocarcinoma cell line HEK293 (“HEK293_Cas9”) constitutively expressing Spy Cas9 was cultured in DMEM medium supplemented with 10% fetal bovine serum and 500 μg / ml G418. Cells were plated on 96-well plates at a density of 30,000 cells / well 24 hours prior to transfection. Cells were transfected with Lipofectamine RNAiMAX (Thermo Fisher, Cat. 13778150) according to the manufacturer's protocol. Cells were transfected with lipoplex containing individual crRNA (15 nM), trRNA (15 nM), and donor oligos along with (10 nM) Lipofectamine RNAiMAX (0.3 μL / well) and OptiMem. Cells were lysed 24 hours after transfection and genomic DNA was extracted using Zymo's Quick gDNA 96 Execution kit (Catalog # D3012) according to the manufacturer's recommended protocol. GDNA was quantified using a Qubit High Sensitivity dsDNA kit (Life Technologies). The library was prepared according to the method previously described in Tsai et al, 2015 with minor modifications. Sequencing was performed with Illumina MiSeq and HiSeq 2500. The assay identified potential off-target sites for some of the crRNAs, which are plotted in FIG.

Table 23 shows the number of off-target integration sites detected in HekCas9 cells transfected with TTR degRNA along with the double-stranded DNA oligodonner sequence.

In addition, a subset of guides were evaluated for off-target potential as modified sgRNAs in Hek_Cas9 cells via the oligo-based insertion method described above. The off-target results are plotted in FIG.

Table 24 shows the number of off-target integration sites detected in HekCas9 cells transfected with TTR sgRNA with double-stranded DNA oligodonner sequences.

Example 6. Targeted Sequencing to Validate Potential Off-Target Sites The HEK293_Cas9 cells used in Example 5 to detect potential off-target sites constitutively overexpress Cas9 and in various cell types. It results in a higher number of potential off-target "hits" compared to the transient delivery paradigm. Moreover, when delivering sgRNAs (as opposed to ggRNAs), the number of potential off-target hits can be further increased because sgRNA molecules are more stable than DGRNAs (especially when chemically modified). Therefore, potential off-target sites identified by oligo-insertion methods such as those used in Example 5 can be verified using targeted sequencing of the identified potential off-target sites.

One approach treats primary hepatocytes with LNPs containing Cas9 mRNA and the sgRNA of interest (eg, sgRNA with a potential off-target site for evaluation). Primary hepatocytes are then lysed and primers adjacent to potential off-target sites (s) are used to generate amplicon for NGS analysis. Identification of indels at a particular level can demonstrate potential off-target sites, while the lack of indels found at potential off-target sites can point to false positives in the HEK293_Cas9 cell assay.

Example 7. Phenotypic analysis Western blot analysis of secreted TTR Hepatocellular carcinoma cell line HepG2 was transfected with a selection guide from Table 1 in triplets as described in Example 1. Two days after transfection, one replica was recovered for analysis by NGS sequencing for genomic DNA and editing efficiency. Five days after transfection, serum-free medium was replaced with one replica. After 4 hours, medium was collected for analysis of secreted TTR by WB as previously described. Data for edit% and reduction of extracellular TTR for each guide are provided in FIG.

Western Blot Analysis of Intracellular TTR Hepatocellular Carcinoma Cell Line HUH7 was transfected with crRNA containing the guides in Table 1 as described in Example 1. The transfected pool of cells was retained in tissue culture and passaged for further analysis. Cells were harvested 7 days after transfection and whole cell extracts (WCE) were prepared and subjected to Western blot analysis as previously described.

WCE was analyzed by Western blot for reduction of TTR protein. The full length TTR protein has a predicted molecular weight of about 16 kD. A band of this molecular weight was observed in the control lane of the Western blot.

The percentage reduction of TTR protein was calculated using the Licor Odyssey Image Studio Ver5.2 software. GAPDH was used as a loading control and probed at the same time as TTR. Ratios were calculated for densitometry values for GAPDH in each sample compared to the entire region containing the TTR band. After normalizing the ratio to the control lane, the percentage reduction of TTR protein was determined. The results are shown in FIG.

Example 8. Delivery of LNP to Humanized TTR Mice and Mice with wt (Mouse) TTR Humanized mice for the TTR gene were administered LNP formulations 701-704 containing the guides indicated in Table 25 (5 mice / formulation). Stuff). In these humanized TTR mice, the region of the endogenous mouse TTR locus has been deleted and replaced with the orthologous human TTR sequence so that the locus is engineered to encode the human TTR protein. It was. For comparison, 6 mice with mouse TTRs were administered LNP700 containing a guide to target mouse TTRs (G000282). The LNPs of Formulation Nos. 1-5 in Table 25 were prepared using the Nanoassemblr ™ procedure as described above, and the LNPs of Formulation Nos. 6-16 used the cross-flow procedure described above. However, it was purified using a PD-10 column (GE Healthcare Life Sciences) and concentrated using an Amicon centrifugal filter unit (Millipore Sigma). As a negative control, mice of the corresponding genotype were administered vehicle alone (Tris-saline-sucrose buffer (TSS)). The background of humanized TTR mice treated with LNPs of Formulation Numbers 2-5 in Table 25 was 50% 129S6 / SvEvTac, 50% C57BL / 6NTac, and Formulation No. 6 in Table 25. In addition to LNP-treated humanized TTR mice having ~ 16, the background of mice with mouse TTR (LNP700, administered formulation number 1) was 75% C57BL / 6NTac and 25% 129S6 / SvEvTac. Met.

LNPs with Formulations 1-5 contain Cas9 mRNA with SEQ ID NO: 2, and LNPs with Formulations 6-16 contain Cas9 mRNA with SEQ ID NO: 1, all 1: 1 relative to the guide. Was the weight ratio of. LNP contained Lipid A, Cholesterol, DSPC, and PEG2k-DMG in molar ratios listed in Table 25, respectively. Administration with LNPs with formulations numbers 1-5 is 2 mg / kg (total RNA content) and administration with LNPs with formulations numbers 6-16 is 1 mg / kg (total RNA content). there were. The results of liver editing were determined using primers designed to amplify the region of interest for NGS analysis. The results of liver editing for formulations numbers 1-5 are shown in FIG. 9, which used each of the four guides tested to edit human TTR sequences at a level of> 35% editing (mean). Pointed out, G000494 and G000499 provide values close to 60%. The results of liver editing for formulation numbers 6-8, 10-13, and 15-16 are shown in FIGS. 13 and 26, which efficiently edit the human TTR sequence with each formulation tested. Shown. Edits above 38% were found for all formulations, and some formulations provided edit values above 60%. Formulations 9 and 14 are not shown due to the design of the PCR amplicon and the small number of sequencing reads obtained as a result.

Levels of human TTR in serum were measured in mice provided with Formulations 6-8, 10-13, and 15-16. See FIG. 14B. FIG. 14A is a repeat of FIG. 13 provided for comparative purposes. Knockdown of serum human TTR was detected for each formulation tested, which correlated with the amount of edits detected in the liver (see Figure 14A vs. Figure 14B, Table 26).

In another set of experiments, humanized TTR mice were administered an LNP formulation over a dose range containing guides G000480, G000488, G000489 and G000502. The formulation contained Cas9 mRNA (SEQ ID NO: 1) in a weight ratio of 1: 1 to the guide. LNP contained lipid A, cholesterol, DSPC, and PEG2k-DMG in a molar ratio of 50:38: 9: 3, respectively, and had an N: P ratio of 6. Administration was 1, 0.3, 0.1, or 0.03 mg / kg (n = 5 / group). LNPs were prepared using the cross-flow procedure described above and purified and concentrated using a PD-10 column and an Amicon centrifugal filter unit, respectively. The results of liver editing were determined using primers designed to amplify the region of interest for NGS analysis and serum human TTR levels were measured as described above. Results for liver editing are shown in FIGS. 26A and results for serum human TTR levels are shown in FIGS. 26B-C. Dose responses for both edited and serum TTR levels were clear.

In another set of experiments, humanized TTR mice were administered an LNP formulation over a dose range containing guides G000481, G000482, G000486 and G000499. The formulation contained Cas9 mRNA (SEQ ID NO: 1) in a weight ratio of 1: 1 to the guide. LNP contained lipid A, cholesterol, DSPC, and PEG2k-DMG in a molar ratio of 50:38: 9: 3, respectively, and had an N: P ratio of 6. Administration was 1, 0.3, or 0.1 mg / kg (n = 5 / group). LNPs were prepared using the cross-flow procedure described above and purified and concentrated using a PD-10 column and an Amicon centrifugal filter unit, respectively. The results of liver editing were determined using primers designed to amplify the region of interest for NGS analysis and serum human TTR levels were measured as described above. Results for liver editing are shown in FIGS. 27A and results for serum human TTR levels are shown in FIGS. 27B-C. Dose responses for both edited and serum TTR levels were clear.

In another set of experiments, humanized TTR mice were administered an LNP formulation over a dose range containing guides G000480, G000481, G000486, G000499 and G000502. The formulation contained Cas9 mRNA (SEQ ID NO: 1) in a weight ratio of 1: 2 to the guide. LNP contained lipid A, cholesterol, DSPC, and PEG2k-DMG in a molar ratio of 50:38: 9: 3, respectively, and had an N: P ratio of 6. Administration was 1, 0.3, or 0.1 mg / kg (n = 5 / group). LNPs were prepared using the cross-flow procedure described above and purified and concentrated using a PD-10 column and an Amicon centrifugal filter unit, respectively. The results of liver editing were determined using primers designed to amplify the region of interest for NGS analysis and serum human TTR levels were measured as described above. Results for liver editing are shown in FIGS. 28A and results for serum human TTR levels are shown in FIGS. 28B-C. Dose responses for both edited and serum TTR levels were clear.

In separate experiments using wild-type CD-1 mice, LNP formulations containing Guide G000502, which are reciprocal between mice and cynomolgus monkeys, were tested in dose response tests. The formulation contained Cas9 mRNA (SEQ ID NO: 1) in a weight ratio of 1: 1 to the guide. LNP contained lipid A, cholesterol, DSPC, and PEG2k-DMG in a molar ratio of 45:44: 9: 2, respectively, and had an N: P ratio of 6. Administration was 1, 0.3, 0.1, 0.03, or 0.01 mg / kg (n = 5 / group). The results of liver editing were determined using primers designed to amplify the region of interest for NGS analysis. Results for liver editing are shown in FIG. 15A and results for serum mouse TTR levels are shown in FIG. 15B. Dose responses for both edited and serum TTR levels were clear.

Example 9. Delivery of LNP to mice at multiple doses G000282 (“G282”) and Cas9 mRNA (SEQ ID NO: 2) in a 1: 1 weight ratio to mice (female from Charles River Laboratory, about 6-7 weeks old) ), And a total RNA concentration of 0.5 mg / ml, LNP formulation LNP705 prepared using the crossflow and TFF procedures as described above was administered. LNP had an N: P ratio of 4.5 and contained lipid A, cholesterol, DSPC, and PEG2k-DMG in a molar ratio of 45:44: 9: 2, respectively. The group was administered once a week for up to 1, 2, 3 or 4 weeks (QWx1-4) or once a month for up to 2 or 3 months (QMx2-3). The dose was 0.5 mg / kg or 1 mg / kg (total RNA content). Control groups were given a single dose of 0.5, 1, or 2 mg / kg on day 1. Each group contained 5 mice. Serum TTR was analyzed by ELISA and liver, spleen and muscle were collected for NGS editorial analysis at autopsy, respectively. The groups are shown in Table 27. X = slaughter and autopsy. MPK = mg / kg.

Table 28 and FIGS. 10A-11B show the results of serum TTR levels (KD% = knockdown%). Table 29 and FIGS. 12A-C show the results of liver editing.

The results show that cumulative doses and effects can be constructed with multiple doses over time, such as weekly or monthly intervals, to achieve an increase in TTR editing levels and KD%.

Example 10. RNA Cargo: Ratios of Different mRNAs and GRNAs In this study, the in vivo efficacy of different ratios of gRNA vs. mRNA was evaluated in mice. CleanCap ™ capped Cas9 mRNA with the ORF of SEQ ID NO: 4, HSD 5'UTR, human albumin 3'UTR, Kozak sequence, and poly A tail, N1-methylpseudouridine 3 instead of uridine triphosphate. It was prepared by IVT synthesis using phosphoric acid as indicated in Example 1.

The LNP formulation prepared from the mRNA and G282 (SEQ ID NO: 124) described as described in Example 1 was prepared in a molar ratio of 50:38: 9: 3 with lipid A, cholesterol, DSPC, and PEG2k-. It contained DMG and had an N: P ratio of 6. The weight ratio of gRNA: Cas9 mRNA in the formulation was as shown in FIGS. 19A and 19B.

For in vivo characterization, LNP was administered to mice at 0.1 mg total RNA (mg guide RNA + mg mRNA) / kg (n = 5 / group). Animals were sacrificed 7-9 days after dosing, blood and liver were collected and serum TTR and liver editing were measured as described in Example 1. The results of serum TTR and liver editing are shown in FIGS. 19A and 19B. Negative control mice were treated with TSS vehicle.
In addition, the above LNP was administered to mice at a constant mRNA dose of 0.05 mg mRNA / kg (n = 5 / group), with gRNA doses varying from 0.06 mg / kg to 0.4 mg / kg. Animals were sacrificed 7-9 days after dosing, blood and liver were collected and serum TTR and liver edits were measured. The results of serum TTR and liver editing are shown in FIGS. 19C and 19D. Negative control mice were treated with TSS vehicle.

Example 11. Off-target analysis of TTR sgRNA in primary human hepatocytes (Hepatocytes) Off-target analysis of TTR-targeting sgRNA was performed in primary human hepatocytes (PHH) as described in Example 5 with the following modifications. PHH was plated on a collagen-coated 96-well plate as described in Example 1 at a density of 33,000 cells / well. Twenty-four hours after plating, cells were washed with medium and transfected with Lipofectamine RNAiMAX (Thermo Fisher, Cat. 13778150) as described in Example 1. Cells were transfected with a lipoplex containing 100 ng Cas9 mRNA and immediately followed by another lipoplex (0.3 μL / well) containing 25 nM sgRNA and 12.5 nM donor oligo. Cells were lysed 48 hours after transfection, gDNA was extracted and analyzed as further described in Example 5. The data is shown graphically in FIG.

Table 30 shows the number of off-target integration sites detected in PHH and is compared to the number of sites detected in the HekCas9 cells used in Example 5. Fewer sites were detected in PHH for all guides tested compared to the HekCas9 cell line, and no specific sites were detected in PHH alone.

After identifying potential off-target sites in PHH via oligo-insertion assay, certain potential sites were further evaluated by targeted amplicon sequencing, eg, as described in Example 6. .. In addition to the potential off-target sites identified by the oligo insertion strategy, additional potential off-target sites identified by in silico prediction were included in the analysis.

For this purpose, PHH was treated with an LNP containing 100 ng of Cas9 mRNA (SEQ ID NO: 1) and the gRNA of interest at 14.68 nM (1: 1 weight ratio) as described in Example 4. .. LNPs were prepared using the cross-flow procedure described above and purified and concentrated using a PD-10 column and an Amicon centrifugal filter unit, respectively. LNP was formulated to have an N: P ratio of 6.0, which contained Lipid A, cholesterol, DSPC, and PEG2k-DMG in a molar ratio of 50:38: 9: 2, respectively. After treatment with LNP, the isolated genomic DNA is analyzed by NGS (eg, as described in Examples 1 and 6) to see if the indel can be detected at a potential off-target site (which is Cas9). (Indel of mediated amputation events) was determined. Tables 31 and 32 show potential off-target sites evaluated for gRNA G000480 and G000486, respectively.

As shown in FIGS. 21A-B and 22A-B and Table 33 below, indels are low for only two potential off-target sites identified by oligoinsertion assay for G000480 and only one for G000486. Detected at level. No indels were detected in any of the in silico prediction sites for any of the guides. In addition, indels were only detected at these sites using near-saturated doses of LNP, and the indel rates observed at the on-target sites for G000480 and G000486 were about 97% and about 91%, respectively (Table 33). See). Genomic coordinates of these sites are also reported in Tables 31 and 32, each corresponding to a sequence that does not encode any protein.

A dose response assay was then performed to determine the maximum dose of LNP for which no off-target was detected. PHH was treated with an LNP containing either G000480 or G000486 as described in Example 4. Dose spanned 11 points with respect to gRNA concentration (0.001 nM, 0.002 nM, 0.007 nM, 0.02 nM, 0.06 nM, 0.19 nM, 0.57 nM, 1.72 nM, 5.17 nM, 15. 51 nM, and 46.55 nM). As represented by the dashed lines above and below in FIGS. 21A-B and 22A-B, the highest concentrations (in terms of gRNA concentration) for G000480 and G000486 where potential off-target sites are no longer detected are 0.57 nM and 15. It was 51 nM, resulting in on-target indel rates of 84.60% and 89.50%, respectively.

Example 12. Delivery of LNP to a Humanized Mouse Model of ATTR A well-established humanized transgenic mouse model of hereditary ATTR amyloidosis expressing the human TTR protein in the V30M pathogenic mutant form was used in this example. This mouse model reproduces the TTR deposition phenotype in tissues observed in ATTR patients, such as in the peripheral nervous system and gastrointestinal (GI) tracts (Santos et al., Neurobiol Aging. 2010 Feb; 31 (2): 280. See -9).

Mice (approximately 4-5 months old) were administered an LNP formulation prepared using the crossflow and TFF procedures as described in Example 1. LNP was formulated to have an N: P ratio of 6.0 and contained lipid A, cholesterol, DSPC, and PEG2k-DMG in a molar ratio of 50:38: 9: 2, respectively. LNP is a 1: 1 gRNA: mRNA weight ratio of either Cas9 mRNA (SEQ ID NO: 1) and G000481 (“G481”) or non-targeted control guide G000395 (“G395”; SEQ ID NO: 273). Contained.

Mice were injected with a single dose of 1 mg / kg (of total RNA content) of LNP via the lateral tail vein as described in Example 1 (n = 10 / group). Eight weeks after the procedure, mice were euthanized for sample collection. Butler et al. , Amyloid. Human TTR protein levels in serum and cerebrospinal fluid (CSF) were measured by ELISA as previously described by 2016 Jun; 23 (2): 109-18. Liver tissue was assayed for edit levels as described in Example 1. Other tissues (stomach, colon, sciatic nerve, dorsal root ganglion (DRG)) were collected and Goncalves et al. , Amyloid. 2014 Sep; 21 (3): Processed for semi-quantitative immunohistochemistry as previously described by 175-184. Statistical analysis of immunohistochemical data was performed using the Mann-Whitney test with a p-value <0.0001.

As shown in FIGS. 23A-B, robust editing of TTR (49.4%) was observed in the liver of humanized mice after a single dose of LNP containing G481, and no editing was detected in the control group. Analysis of the editing events demonstrated that 96.8% of the events were insertions and the rest were deletions.

As shown in FIGS. 24A-B, TTR protein levels were reduced in treated mouse plasma, but not in CSF, and knockdowns above 99% of TTR plasma levels were observed (p <0. 001).

Nearly complete knockdown of TTR observed in treated animal plasma correlated with clearance of TTR protein amyloid deposits in the assayed tissue. As shown in FIG. 25, control mice exhibited amyloid staining in tissues similar to the pathophysiology observed in human subjects with ATTR. The reduction of circulating TTR by editing the HuTTR V30M locus resulted in a dramatic reduction in amyloid deposits in tissues. Approximately 85% or better reduction in TTR staining was observed over the treated tissue 8 weeks after treatment (FIG. 25).

Example 13. Knockdown of TTR mRNA in primary human hepatocytes (PHH) In one experiment, PHH was cultured and treated with LNP containing Cas9 mRNA (SEQ ID NO: 1) and gRNA of interest as described in Example 4. (See FIG. 29, Table 34). LNPs were prepared using the cross-flow procedure described above and purified and concentrated using a PD-10 column and an Amicon centrifugal filter unit, respectively. LNP was formulated to have an N: P ratio of 6.0 and contained lipid A, cholesterol, DSPC, and PEG2k-DMG in a molar ratio of 50:38: 9: 2, respectively. The LNP contained a 1: 2 gRNA: mRNA ratio and the cells were treated at a dose of 300 ng (in terms of the amount of mRNA cargo delivered).

After 96 hours of LNP treatment (using a biological triplet for each condition), mRNA was purified from PHH cells using the Dynabeads mRNA DIRECT Kit (Thermo Fisher Scientific) according to the manufacturer's protocol. Reverse transcription (RT) was performed using Maxima Reverse Transcriptase (Thermo Fisher Scientific) and poly-dT primers. The resulting cDNA was purified using Aple XP Beads (Agencourt). For quantitative PCR, 2% purified cDNA was added to Taqman Fast Advanced Mastermix and three Taqman probe sets, TTR (assay ID: Hs00174914_m1), GAPDH (assay ID: Hs0276624_g1), and PPIB (assay ID: Hs00168719m). Amplified using. The assay was performed by the Quant Studio 7 Flex Real Time PCR System according to the manufacturer's instructions (Life Technologies). Relative expression of TTR mRNA was calculated and then averaged by individual normalization to endogenous controls (GAPDH and PPIB).

As shown in FIG. 29 and reproducing the numbers in Table 34 below, each LNP formulation tested resulted in knockdown of TTR mRNA as compared to a negative (untreated) control. The groups in FIGS. 29 and 34 are identified by the gRNA ID used in each LNP preparation. The relative expression of TTR mRNA is plotted in FIG. 29, while the knockdown percentage of TTR mRNA is provided in Table 34.

In separate experiments, TTR mRNA knockdown was evaluated after treatment with LNPs containing G000480, G000486, and G000502. LNP was compounded, PHH was cultured, and LNP was used as described in each of the above experiments in this example, except that the cells were treated at a dose of 100 ng (with respect to the amount of mRNA cargo delivered). Processed.

After 96 hours of LNP treatment (single treatment for each condition), mRNA was purified from PHH cells using the Dynabeads mRNA DIRECT Kit (Thermo Fisher Scientific) according to the manufacturer's protocol. Reverse transcription (RT) was performed using the High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) according to the manufacturer's instructions. For quantitative PCR, 2% cDNA was used with Taqman Fast Advanced Mastermix and three Taqman probe sets, TTR (assay ID: Hs00174914_m1), GAPDH (assay ID: Hs0276624_g1), and PPIB (assay ID: Hs00168719_m1). did. The assay was performed by the Quant Studio 7 Flex Real Time PCR System according to the manufacturer's instructions (Life Technologies). Relative expression of TTR mRNA was calculated and then averaged by individual normalization to endogenous controls (GAPDH and PPIB).

As shown in FIG. 30 and reproducing the numbers in Table 35 below, each LNP formulation tested resulted in knockdown of TTR mRNA as compared to a negative (untreated) control. The groups in FIGS. 30 and 35 are identified by the gRNA ID used in each LNP preparation. The relative expression of TTR mRNA is plotted in FIG. 30, while the knockdown percent of TTR mRNA is provided in Table 35.

Sequence Listing The following sequence listing provides a list of sequences disclosed herein. It is understood that when a DNA sequence (including T) is referenced with respect to RNA, T should be replaced with U (which may be modified or unmodified depending on the circumstances) and vice versa. To.

Claims (209)

A method of inducing double-strand breaks (DSBs) within the TTR gene, comprising delivering the composition to cells, said composition.
a. SEQ ID NO: Guide RNA containing a guide sequence selected from 5-82;
b. SEQ ID NO:: A guide RNA containing at least 17, 18, 19, or 20 contiguous nucleotides of a sequence selected from 5 to 82; or c. SEQ ID NO: Guide containing a guide sequence that is at least 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, or 90% identical to the sequence selected from 5-82. RNA
including,
Method. A method of modifying the TTR gene, which comprises delivering the composition to a cell, wherein the composition encodes (i) an RNA-guided DNA-binding agent or an RNA-guided DNA-binding agent and (ii) a guide RNA. The guide RNA contains
a. SEQ ID NO: Guide sequence selected from 5 to 82;
b. SEQ ID NO:: At least 17, 18, 19, or 20 contiguous nucleotides of the sequence selected from 5-82; or c. SEQ ID NO:: Contains a guide sequence that is at least 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, or 90% identical to the sequence selected from 5-82.
Method. A method of treating amyloidosis (ATTR) associated with TTR, comprising administering the composition to a subject in need thereof thereby treating ATTR, wherein the composition is (i) RNA-guided. DNA binding agent or RNA guide A nucleic acid encoding a DNA binding agent and (ii) a guide RNA are contained, and the guide RNA comprises
a. SEQ ID NO: Guide sequence selected from 5 to 82;
b. SEQ ID NO:: At least 17, 18, 19, or 20 contiguous nucleotides of the sequence selected from 5-82; or c. SEQ ID NO:: Contains a guide sequence that is at least 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, or 90% identical to the sequence selected from 5-82.
Method. A method of reducing the serum concentration of TTR, comprising administering the composition to a subject in need thereof, thereby reducing the serum concentration of TTR, wherein the composition is (i) RNA-guided DNA. Binding Agent or RNA Guide RNA comprising a nucleic acid encoding a binding agent and (ii) a guide RNA, said guide RNA
a. SEQ ID NO: Guide sequence selected from 5 to 82;
b. SEQ ID NO:: At least 17, 18, 19, or 20 contiguous nucleotides of the sequence selected from 5-82; or c. SEQ ID NO:: Contains a guide sequence that is at least 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, or 90% identical to the sequence selected from 5-82.
Method. A method of reducing or preventing the accumulation of TTR-containing amyloid or amyloid fibrils in a subject by administering the composition to a subject in need thereof, thereby reducing the accumulation of amyloid or amyloid fibrils. The composition comprises (i) a nucleic acid encoding an RNA-guided DNA-binding agent or an RNA-guided DNA-binding agent and (ii) a guide RNA, wherein the guide RNA comprises.
a. SEQ ID NO: Guide sequence selected from 5 to 82;
b. SEQ ID NO:: At least 17, 18, 19, or 20 contiguous nucleotides of the sequence selected from 5-82; or c. SEQ ID NO:: Contains a guide sequence that is at least 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, or 90% identical to the sequence selected from 5-82.
Method. A composition containing a guide RNA, wherein the guide RNA is
a. SEQ ID NO: Guide sequence selected from 5 to 82;
b. SEQ ID NO:: At least 17, 18, 19, or 20 contiguous nucleotides of the sequence selected from 5-82; or c. SEQ ID NO:: Contains a guide sequence that is at least 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, or 90% identical to the sequence selected from 5-82.
Composition. A composition comprising a vector encoding a guide RNA, wherein the guide RNA
a. SEQ ID NO: Guide sequence selected from 5 to 82;
b. SEQ ID NO:: At least 17, 18, 19, or 20 contiguous nucleotides of the sequence selected from 5-82; or c. SEQ ID NO:: Contains a guide sequence that is at least 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, or 90% identical to the sequence selected from 5-82.
Composition. The composition according to claim 6 or 7, for use in inducing double-strand breaks (DSBs) within the TTR gene in cells or subjects. The composition according to claim 6 or 7, for use in modifying the TTR gene in a cell or subject. The composition according to claim 6 or 7, for use in the treatment of amyloidosis (ATTR) associated with TTR in a subject. The composition according to claim 6 or 7, for use in reducing the serum concentration of TTR in a subject. The composition according to claim 6 or 7, for use in reducing or preventing the accumulation of amyloid or amyloid fibrils in a subject. The method according to any one of claims 1 to 5 or the composition for use according to any one of claims 8 to 12, wherein the composition reduces serum TTR levels. The composition for the method or use according to claim 13, wherein the serum TTR level is reduced by at least 50% compared to the serum TTR level prior to administration of the composition. The serum TTR level is 50-60%, 60-70%, 70-80%, 80-90%, 90-95%, 95-98%, as compared to the serum TTR level before administration of the composition. The composition for the method or use according to claim 13, which is reduced by 98-99%, or 99-100%. The composition for the method or use according to any one of claims 1-5 or 8-15, wherein the composition results in the editing of the TTR gene. The composition for the method or use of claim 16, wherein the edit is calculated as a percentage of the population being edited (editing percentage). The composition for the method or use according to claim 17, wherein the editing percentage is 30-99% of the population. The editing percentages are 30-35%, 35-40%, 40-45%, 45-50%, 50-55%, 55-60%, 60-65%, 65-70%, 70- The composition for the method or use according to claim 17, which is 75%, 75-80%, 80-85%, 85-90%, 90-95%, or 95-99%. The method according to any one of claims 1 to 5 or the composition for use according to any one of claims 8 to 19, wherein the composition reduces amyloid deposition in at least one tissue. The composition for the method or use of claim 20, wherein the at least one tissue comprises one or more of the stomach, colon, sciatic nerve, or dorsal root ganglion. The composition for the method or use according to claim 20 or 21, wherein the amyloid deposits are measured 8 weeks after administration of the composition. The composition for the method or use according to any one of claims 20-22, wherein the amyloid deposits are compared to a negative control or a level measured prior to administration of the composition. The composition for the method or use according to any one of claims 20-23, wherein the amyloid deposits are measured in a biopsy sample and / or by immunostaining. Amyloid deposits are 30-35%, 35-40%, 40-45%, 45-50%, 50-55%, 55-60%, 60-65%, 65-70 of amyloid deposits seen in negative controls. %, 70-75%, 75-80%, 80-85%, 85-90%, 90-95%, or 95-99% reduction, according to any one of claims 20-24. Composition for method or use. Amyloid deposits are 30-35%, 35-40%, 40-45%, 45-50%, 50-55%, 55-60%, 60-65 of amyloid deposits seen prior to administration of the composition. %, 65-70%, 70-75%, 75-80%, 80-85%, 85-90%, 90-95%, or 95-99% reduction, any of claims 20-25. The composition for the method or use according to paragraph 1. The composition for the method or use according to any one of claims 1-5 or 8-26, wherein the composition is administered or delivered at least twice. The composition for the method or use of claim 27, wherein the composition is administered or delivered at least three times. The composition for the method or use of claim 27, wherein the composition is administered or delivered at least 4 times. The composition for the method or use of claim 27, wherein the composition is administered or delivered up to 5, 6, 7, 8, 9, or 10 times. Any of claims 27-30, wherein the administration or delivery is performed at intervals of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 days. The composition for the method or use according to claim 1. Any of claims 27-30, wherein the administration or delivery takes place at intervals of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 weeks. The composition for the method or use according to claim 1. 27-30, wherein the administration or delivery is performed at intervals of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 months. The composition according to any one of the methods or uses. The method or composition according to any one of claims 1-3, wherein the guide sequence is selected from SEQ ID NOs: 5-82. The method or composition according to any one of claims 1 to 34, wherein the guide RNA is at least partially complementary to the target sequence present in the human TTR gene. 35. The method or composition of claim 35, wherein the target sequence is in exons 1, 2, 3, or 4 of the human TTR gene. 35. The method or composition of claim 35, wherein the target sequence is in exon 1 of the human TTR gene. 35. The method or composition of claim 35, wherein the target sequence is in exon 2 of the human TTR gene. 35. The method or composition of claim 35, wherein the target sequence is in exon 3 of the human TTR gene. 35. The method or composition of claim 35, wherein the target sequence is in exon 4 of the human TTR gene. The method or composition according to any one of claims 1 to 40, wherein the guide sequence is complementary to the target sequence in the normal chain of TTR. The method or composition according to any one of claims 1 to 40, wherein the guide sequence is complementary to the target sequence in the negative chain of TTR. A second guide sequence is complementary to the first target sequence in the positive strand of the TTR gene, and the composition is complementary to the second target sequence in the negative strand of the TTR gene. The method or composition according to any one of claims 1 to 40, further comprising a guide sequence. Claims 1-43, wherein the guide RNA comprises a crRNA comprising the guide sequence and further comprising a nucleotide sequence of SEQ ID NO: 126, wherein the nucleotide of SEQ ID NO: 126 follows the guide sequence at its 3'end. The method or composition according to any one of the above. The method or composition according to any one of claims 1-44, wherein the guide RNA is a dual guide (DGRNA). 45. The dual guide RNA comprises crRNA and trRNA, the crRNA comprises a nucleotide sequence of SEQ ID NO: 126, and the nucleotide of SEQ ID NO: 126 follows the guide sequence at its 3'end. The method or composition described. The method or composition according to any one of claims 1-43, wherein the guide RNA is a single guide (sgRNA). 47. The method or composition of claim 47, wherein the sgRNA comprises a guide sequence having the pattern of SEQ ID NO: 3. 47. The method or composition of claim 47, wherein the sgRNA comprises the sequence of SEQ ID NO: 3. 48 or 49, wherein each N in SEQ ID NO: 3 is any natural or unnatural nucleotide, said N forms the guide sequence, and the guide sequence targets Cas9 to the TTR gene. Method or composition. The method or composition of any one of claims 47-50, wherein the sgRNA comprises any one of the guide sequences of SEQ ID NO: 5-82 and the nucleotide of SEQ ID NO: 126. A guide in which the sgRNA is at least 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, or 90% identical to the sequence selected from SEQ ID NOs: 87-124. The method or composition according to any one of claims 47-51, comprising a sequence. 47. The method or composition of claim 47, wherein the sgRNA comprises a sequence selected from SEQ ID NOs: 87-124. The method or composition according to any one of claims 1 to 53, wherein the guide RNA comprises at least one modification. The method or composition of claim 54, wherein the at least one modification comprises a 2'-O-methyl (2'-O-Me) modified nucleotide. The method or composition of claim 54 or 55, wherein the at least one modification comprises a phosphorothioate (PS) bond between nucleotides. The method or composition according to any one of claims 54 to 56, wherein the at least one modification comprises a 2'-fluoro (2'-F) modified nucleotide. The method or composition of any one of claims 54-57, wherein the at least one modification comprises a modification at one or more of the first five nucleotides at the 5'end. The method or composition of any one of claims 54-58, wherein the at least one modification comprises a modification in one or more of the last five nucleotides at the 3'end. The method or composition according to any one of claims 54 to 59, wherein the at least one modification comprises a PS bond between the first four nucleotides. The method or composition according to any one of claims 54 to 60, wherein the at least one modification comprises a PS bond between the last four nucleotides. The method or composition of any one of claims 54-61, wherein the at least one modification comprises a 2'-O-Me modified nucleotide in the first three nucleotides at the 5'end. The method or composition of any one of claims 54-62, wherein the at least one modification comprises a 2'-O-Me modified nucleotide in the last three nucleotides at the 3'end. The method or composition according to any one of claims 54 to 63, wherein the guide RNA comprises a modified nucleotide of SEQ ID NO: 3. The method or composition according to any one of claims 1 to 64, wherein the composition further comprises a pharmaceutically acceptable excipient. The method or composition according to any one of claims 1 to 65, wherein the guide RNA is associated with lipid nanoparticles (LNP). The method or composition of claim 66, wherein the LNP comprises a CCD lipid. The method or composition according to claim 67, wherein the CCD lipid is Lipid A or Lipid B. The method or composition of claims 66-68, wherein the LNP comprises triglycerides. The method or composition of claim 69, wherein the triglyceride is DSPC. The method or composition according to any one of claims 66 to 70, wherein the LNP comprises a helper lipid. The method or composition of claim 71, wherein the helper lipid is cholesterol. The method or composition according to any one of claims 66 to 72, wherein the LNP comprises a stealth lipid. The method or composition of claim 73, wherein the stealth lipid is PEG2k-DMG. The method or composition according to any one of claims 1 to 74, wherein the composition further comprises an RNA-guided DNA binder. The method or composition according to any one of claims 1 to 75, wherein the composition further comprises mRNA encoding an RNA-guided DNA binder. The method or composition of claim 75 or 76, wherein the RNA-guided DNA binder is Cas Crybase. The method or composition of claim 77, wherein the RNA-guided DNA binder is Cas9. The method or composition according to any one of claims 75 to 78, wherein the RNA-guided DNA binder is modified. The method or composition according to any one of claims 75 to 79, wherein the RNA-guided DNA binder is nickase. The method or composition of claim 79 or 80, wherein the modified RNA-guided DNA binder comprises a nuclear localization signal (NLS). The method or composition according to any one of claims 75-81, wherein the RNA-guided DNA binder is Cas from a Type II CRISPR / Cas system. The method or composition according to any one of claims 1 to 82, wherein the composition is a pharmaceutical formulation and further comprises a pharmaceutically acceptable carrier. The composition for the method or use according to any one of claims 1-5 or 8-83, wherein the composition reduces or prevents amyloid or amyloid fibrils, including TTR. The composition for the method or use of claim 84, wherein the amyloid or amyloid fibril is in the nerve, heart, or gastrointestinal tract. The composition for the method or use according to any one of claims 1-5 or 8-83, wherein the non-homologous end binding (NHEJ) results in a mutation during the repair of the DSB in the TTR gene. The composition for the method or use of claim 86, wherein the NHEJ results in the deletion or insertion of nucleotides during the repair of DSB in the TTR gene. The composition for the method or use of claim 87, wherein the deletion or insertion of the nucleotide induces a frameshift or nonsense mutation in the TTR gene. The composition for the method or use according to claim 87, wherein a frameshift or nonsense mutation is induced in the TTR gene of at least 50% of hepatocytes. Frameshift or nonsense mutations of 50% -60%, 60% -70%, 70% or 80%, 80% -90%, 90-95%, 95% -99%, or 99% -100% The composition for the method or use according to claim 89, which is induced in the TTR gene of hepatocytes. The composition for the method or use according to any one of claims 87-90, wherein the deletion or insertion of nucleotides occurs in the TTR gene at least 50-fold or more than at the off-target site. The deletion or insertion of nucleotides is 50 to 150 times, 150 to 500 times, 500 to 1500 times, 1500 to 5000 times, 5000 to 15000 times, 15000 to 30000 times that at the off-target site. , Or a composition for use according to claim 91, which occurs 30,000 to 60,000 times more in the TTR gene. The deletion or insertion of nucleotides occurs in primary human hepatocytes at off-target sites less than 3, 2, 1, or 0 or equal to 3, 2, 1, or 0, and optionally the off-target sites. The composition for the method or use according to any one of claims 87-92, which does not occur in the protein coding region of the primary human hepatocyte genome. The deletion or insertion of nucleotides occurs in fewer off-target sites in primary human hepatocytes than the number of off-target sites in which nucleotide deletion or insertion occurs in Cas9 overexpressing cells, and optionally the off-target. The composition for the method or use according to claim 93, wherein the site does not occur in the protein coding region of the primary human hepatocyte genome. The composition for the method or use according to claim 94, wherein the Cas9 overexpressing cells are HEK293 cells that stably express Cas9. The number of off-target sites in primary human hepatocytes was determined by analyzing genomic DNA from primary human hepatocytes transfected with Cas9 mRNA and the guide RNA in vitro and optionally said off. The composition for the method or use according to any one of claims 93-95, wherein the target site does not occur in the protein coding region of the primary human hepatocyte genome. An oligonucleotide insertion assay comprising analyzing genomic DNA from primary human hepatocytes transfected with Cas9 mRNA, said guide RNA, and donor oligonucleotides in vitro to the number of off-target sites in primary human hepatocytes. 93. The composition for use according to any one of claims 93-95, wherein the off-target site does not occur in the protein coding region of the genome of the primary human hepatocyte, as determined by. Stuff. The sequence of the guide RNA
a) SEQ ID NO: 92 or 104;
b) SEQ ID NO: 87, 89, 96, or 113;
c) SEQ ID NO: 100, 102, 106, 111, or 112; or d) SEQ ID NO: 88, 90, 91, 93, 94, 95, 97, 101, 103, 108, or 109
The guide RNA is, optionally, any one of claims 1-43 or 47-97, wherein the guide RNA does not produce indels at off-target sites that occur in the protein coding region of the genome of primary human hepatocytes. Method or composition. The composition for the method or use according to any one of claims 1-5 or 8-98, wherein administering the composition reduces the level of TTR in the subject. The composition for the method or use according to claim 99, wherein said level of TTR is reduced by at least 50%. Said levels of TTR are reduced by 50% -60%, 60% -70%, 70% or 80%, 80% -90%, 90-95%, 95% -99%, or 99% -100%. , The composition for use according to claim 100. The composition for the method or use according to claim 100 or 101, wherein said level of TTR is measured in serum, plasma, blood, cerebrospinal fluid, or sputum. The composition for the method or use according to claim 100 or 101, wherein said levels of TTR are measured in the liver, choroid plexus, and / or retina. The composition for the method or use according to any one of claims 99-103, wherein said level of TTR is measured via an enzyme-linked immunosorbent assay (ELISA). The composition for the method or use according to any one of claims 1-5 or 8-104, wherein the subject has an ATTR. The composition for the method or use according to any one of claims 1-5 or 8-105, wherein the subject is a human. The composition for the method or use according to claim 105 or 106, wherein the subject has ATTRwt. The composition for the method or use of claim 105 or 106, wherein the subject has a hereditary ATTR. The composition for the method or use according to any one of claims 1-5, 8-106, or 108, wherein the subject has a family history of ATTR. The composition for the method or use according to any one of claims 1-5, 8-106, or 108-109, wherein the subject has familial amyloid multiple neuropathy. The composition for the method or use according to any one of claims 1-5 or 8-110, wherein the subject has only ATTR neurological symptoms or predominantly ATTR neurological symptoms. The composition for the method or use according to any one of claims 1-5 or 8-110, wherein the subject has familial amyloid cardiomyopathy. The composition for the method or use according to any one of claims 1-5, 8-109, or 112, wherein the subject has only ATTR cardiac symptoms or predominantly ATTR cardiac symptoms. Stuff. The composition for the method or use according to any one of claims 1-5 or 8-113, wherein the subject expresses a TTR carrying a V30 mutation. The composition for the method or use according to claim 114, wherein the V30 mutation is V30A, V30G, V30L, or V30M. The composition for the method or use of claim according to any one of claims 1-5 or 8-113, wherein the subject expresses a TTR carrying a T60 mutation. The composition for the method or use according to claim 116, wherein the T60 mutation is T60A. The composition for the method or use of claim according to any one of claims 1-5 or 8-113, wherein the subject expresses a TTR carrying a V122 mutation. The composition for the method or use of claim 118, wherein the V122 mutation is V122A, V122I, or V122 (−). The composition for the method or use according to any one of claims 1-5 or 8-119, wherein the subject expresses wild-type TTR. The composition for the method or use according to any one of claims 1-5, 8-107, or 120, wherein the subject does not express a TTR with a V30, T60, or V122 mutation. The composition for the method or use according to any one of claims 1-5, 8-107, or 120-121, wherein the subject does not express a TTR with a pathological mutation. The composition for the method or use of claim 121, wherein the subject is homozygous for a wild-type TTR. The composition for the method or use according to any one of claims 1-5 or 8-123, wherein after administration the subject has amelioration, stabilization, or slowing of change in the symptoms of sensorimotor neuropathy. Stuff. The composition for the method or use of claim 124, wherein the improvement, stabilization, or slowing of changes in sensory neuropathy is measured using electromyography, nerve conduction studies, or patient-reported outcomes. Stuff. The composition for the method or use of any one of claims 1-5 or 8-125, wherein the subject has amelioration, stabilization, or slowing of change in the symptoms of congestive heart failure. 12. The method of claim 126, wherein the improvement, stabilization, or slowing of changes in congestive heart failure is measured using a cardiac biomarker test, pulmonary function test, chest x-ray, or electrocardiography. Composition for use. The composition for the method or use according to any one of claims 1-5 or 8-127, wherein the composition or pharmaceutical formulation is administered via a viral vector. The composition for the method or use according to any one of claims 1-5 or 8-127, wherein the composition or pharmaceutical formulation is administered via lipid nanoparticles. The method or use according to any one of claims 1-5 or 8-129, wherein the subject is tested for a particular mutation in the TTR gene prior to administration of the composition or formulation. Composition. The method or composition according to any one of claims 1 to 130, wherein the sequence selected from SEQ ID NO: 5 to 82 is SEQ ID NO: 5. The method or composition according to any one of claims 1 to 130, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 6. The method or composition according to any one of claims 1 to 130, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 7. The method or composition according to any one of claims 1 to 130, wherein the sequence selected from SEQ ID NO: 5 to 82 is SEQ ID NO: 8. The method or composition according to any one of claims 1 to 130, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 9. The method or composition according to any one of claims 1 to 130, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 10. The method or composition according to any one of claims 1 to 130, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 11. The method or composition according to any one of claims 1 to 130, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 12. The method or composition according to any one of claims 1 to 130, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 13. The method or composition according to any one of claims 1 to 130, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 14. The method or composition according to any one of claims 1 to 130, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 15. The method or composition according to any one of claims 1 to 130, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 16. The method or composition according to any one of claims 1 to 130, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 17. The method or composition according to any one of claims 1 to 130, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 18. The method or composition according to any one of claims 1 to 130, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 19. The method or composition according to any one of claims 1 to 130, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 20. The method or composition according to any one of claims 1 to 130, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 21. The method or composition according to any one of claims 1 to 130, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 22. The method or composition according to any one of claims 1 to 130, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 23. The method or composition according to any one of claims 1 to 130, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 24. The method or composition according to any one of claims 1 to 130, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 25. The method or composition according to any one of claims 1 to 130, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 26. The method or composition according to any one of claims 1 to 130, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 27. The method or composition according to any one of claims 1 to 130, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 28. The method or composition according to any one of claims 1 to 130, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 29. The method or composition according to any one of claims 1 to 130, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 30. The method or composition according to any one of claims 1 to 130, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 31. The method or composition according to any one of claims 1 to 130, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 32. The method or composition according to any one of claims 1 to 130, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 33. The method or composition according to any one of claims 1 to 130, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 34. The method or composition according to any one of claims 1 to 130, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 35. The method or composition according to any one of claims 1 to 130, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 36. The method or composition according to any one of claims 1 to 130, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 37. The method or composition according to any one of claims 1 to 130, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 38. The method or composition according to any one of claims 1 to 130, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 39. The method or composition according to any one of claims 1 to 130, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 40. The method or composition according to any one of claims 1 to 130, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 41. The method or composition according to any one of claims 1 to 130, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 42. The method or composition according to any one of claims 1 to 130, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 43. The method or composition according to any one of claims 1 to 130, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 44. The method or composition according to any one of claims 1 to 130, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 45. The method or composition according to any one of claims 1 to 130, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 46. The method or composition according to any one of claims 1 to 130, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 47. The method or composition according to any one of claims 1 to 130, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 48. The method or composition according to any one of claims 1 to 130, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 49. The method or composition according to any one of claims 1 to 130, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 50. The method or composition according to any one of claims 1 to 130, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 51. The method or composition according to any one of claims 1 to 130, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 52. The method or composition according to any one of claims 1 to 130, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 53. The method or composition according to any one of claims 1 to 130, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 54. The method or composition according to any one of claims 1 to 130, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 55. The method or composition according to any one of claims 1 to 130, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 56. The method or composition according to any one of claims 1 to 130, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 57. The method or composition according to any one of claims 1 to 130, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 58. The method or composition according to any one of claims 1 to 130, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 59. The method or composition according to any one of claims 1 to 130, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 60. The method or composition according to any one of claims 1 to 130, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 61. The method or composition according to any one of claims 1 to 130, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 62. The method or composition according to any one of claims 1 to 130, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 63. The method or composition according to any one of claims 1 to 130, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 64. The method or composition according to any one of claims 1 to 130, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 65. The method or composition according to any one of claims 1 to 130, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 66. The method or composition according to any one of claims 1 to 130, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 67. The method or composition according to any one of claims 1 to 130, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 68. The method or composition according to any one of claims 1 to 130, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 69. The method or composition according to any one of claims 1 to 130, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 70. The method or composition according to any one of claims 1 to 130, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 71. The method or composition according to any one of claims 1 to 130, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 72. The method or composition according to any one of claims 1 to 130, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 73. The method or composition according to any one of claims 1 to 130, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 74. The method or composition according to any one of claims 1 to 130, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 75. The method or composition according to any one of claims 1 to 130, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 76. The method or composition according to any one of claims 1 to 130, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 77. The method or composition according to any one of claims 1 to 130, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 78. The method or composition according to any one of claims 1 to 130, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 79. The method or composition according to any one of claims 1 to 130, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 80. The method or composition according to any one of claims 1 to 130, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 81. The method or composition according to any one of claims 1 to 130, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 82. Use of the composition or formulation according to any of claims 6-208 for the preparation of a medicament for treating a human subject having an ATTR.