WO2016006846A1 - 목적 유전자의 발현 억제 특이성이 증가된 siRNA 분자 - Google Patents
목적 유전자의 발현 억제 특이성이 증가된 siRNA 분자 Download PDFInfo
- Publication number
- WO2016006846A1 WO2016006846A1 PCT/KR2015/006418 KR2015006418W WO2016006846A1 WO 2016006846 A1 WO2016006846 A1 WO 2016006846A1 KR 2015006418 W KR2015006418 W KR 2015006418W WO 2016006846 A1 WO2016006846 A1 WO 2016006846A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- sirna
- rna
- target
- overhang
- sirna molecule
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07H—SUGARS; DERIVATIVES THEREOF; NUCLEOSIDES; NUCLEOTIDES; NUCLEIC ACIDS
- C07H21/00—Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
- C12N15/1135—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against oncogenes or tumor suppressor genes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/11—Antisense
Definitions
- the present invention relates to siRNA molecules with increased expression inhibition specificity of the target gene, and more particularly, siRNA molecules with increased expression inhibition specificity of the target gene and reduced off-target effect, wherein the siRNA molecules are sense and antisense strands.
- one of the two strands has a 3'-overhang consisting of 1 to 3 nucleotides of DNA, and the other strand has a 3'-overhang consisting of 1 to 3 nucleotides of RNA.
- SiRNA molecule having an asymmetric structure of 3'-overhang a method for producing an siRNA molecule having an asymmetric structure of 3'-overhang, a composition and kit for inhibiting gene expression containing the siRNA molecule, the siRNA molecule
- the method of inhibiting the expression of a target gene in a cell comprising the step of introducing into a cell other than the human body and the cell siRNA Is brought into contact with the chair according to the in vitro method, the target-specific RNA-mediated interference in a cell comprising the step of mediating the object-specific RNA interference caused by siRNA.
- RNA interference is an evolutionarily conserved mechanism of gene silencing after transcription that promotes mRNA degradation in a sequence specific manner. RNAi technology is widely used by researchers for basic research and development of new disease therapies.
- the circular siRNA duplex was originally described by Elbashir and his colleagues ( Nature , 2001, 411: 494-498), reminiscent of being processed by an RNase III type enzyme such as Dicer.
- the two strands of the siRNA duplex are first assembled into double stranded RNA into the Argonaute protein (pre-RISC complex) and one strand is discarded by unwinding or cleavage to form a mature RISC complex.
- This discarded strand is called the passenger strand (or sense strand), while the other strand that is finally retained within the mature RISC is called the guide strand (or antisense strand).
- siRNA is expected to be able to greatly alleviate the problem of gene delivery efficiency, which is a drawback of the existing gene therapy methods, because it can be delivered intracellularly with much higher efficiency than the nucleic acid used in conventional gene therapy.
- siRNA specificity refers to the ability of a particular siRNA to silence the desired target gene without affecting the expression of other genes.
- the off-target effect is a phenomenon of unintended cleavage of the target gene by incomplete pairing of the antisense strand and target mRNA of a conventional 19 + 2 structure siRNA or incorporation of a sense strand in the RISC complex. Since off-target effects can lead to undesirable phenotypes, novel methods and compositions for minimizing, altering or eliminating the off-target effects are considered indispensable for siRNA to be an effective research and therapeutic tool. . Many studies have proposed various methods of modifying siRNA primarily to reduce sense strand mediated nonspecific expression inhibition (Elmen et al., 2005, Nucleic Acids Res .
- asymmetric siRNA (asiRNA, asymmetric siRNA) having RNA overhang has superior gene silencing effect than asymmetric siRNA having dTdT overhang (Hong et al., 2014, Biochem). J. ), it was confirmed that asiRNA with RNA overhang is more efficiently assembled into the AGO2-RISC complex than asiRNA with dTdT overhang. Therefore, in the present invention, a method of increasing the specificity for the target gene and reducing the off-target effect through structural modification of the 3'-overhang of siRNA was studied.
- Korean Patent No. 0872437 discloses a 'small RNA molecule that mediates RNA interference'
- Korean Patent No. 1237036 discloses a novel siRNA structure that minimizes off-target effects by antisense strands and uses thereof. 'Is disclosed, but there is no description of siRNA molecules with increased expression specificity of the gene of interest of the present invention.
- the present invention is derived from the above requirements, and the present inventors prepared an siRNA molecule having an asymmetric 3'-overhang structure of RNA / dTdT, and treated the cell to confirm the inhibition efficiency of the target gene.
- the present invention was completed by confirming that the siRNA molecule of the novel structure according to the present invention had a high inhibitory efficiency with respect to the target gene and a reduced off-target effect.
- the present invention is an siRNA molecule with increased expression inhibition specificity of the target gene and reduced off-target effect, wherein the siRNA molecule is composed of sense and antisense strands, one of the two strands is The 3'-overhang has an asymmetric structure, characterized in that it has a 3'-overhang consisting of 1 to 3 nucleotides of DNA, and the other strand has a 3'-overhang consisting of 1 to 3 nucleotides of RNA.
- siRNA molecules is composed of sense and antisense strands, one of the two strands is The 3'-overhang has an asymmetric structure, characterized in that it has a 3'-overhang consisting of 1 to 3 nucleotides of DNA, and the other strand has a 3'-overhang consisting of 1 to 3 nucleotides of RNA.
- the present invention also provides a method for preparing siRNA molecules having a 3'-overhang asymmetric structure.
- the present invention provides a composition for inhibiting gene expression containing an siRNA molecule having the asymmetric structure of the 3'-overhang.
- the present invention also provides a kit for inhibiting gene expression containing an siRNA molecule having the asymmetric structure of the 3'-overhang.
- the present invention provides a method of inhibiting the expression of a target gene in a cell, comprising the step of introducing the siRNA molecule having the asymmetric structure of the 3'-overhang into cells except for the human body.
- the present invention comprises contacting a cell with an siRNA molecule having the asymmetric structure of the 3′-overhang to mediate object specific RNA interference caused by siRNA.
- contacting a cell with an siRNA molecule having the asymmetric structure of the 3′-overhang to mediate object specific RNA interference caused by siRNA.
- the present invention provides a siRNA molecule having a novel structure of which specificity is increased and an off-target effect is reduced by an asymmetric 3'-overhang structure of RNA / dTdT, and a method of inhibiting expression of a target gene using the same.
- the siRNA molecule having an asymmetric 3'-overhang according to the present invention is a novel siRNA structure with increased functionality in a simple manner without complicated chemical modifications, and is easy to manufacture, and is based on siRNA such as gene therapy by replacing conventional siRNA molecules. It is expected to be widely used in the technique of inhibiting gene expression.
- Figure 1 shows the effect of siRNA 3'-overhang on the RNAi activity of each strand
- (A) is a diagram showing the structure of the siRNA duplex having a symmetric or asymmetric 3'-overhang, underlined DNA Point to.
- (B) is a result confirming the reporter gene knockdown activity of siRNA duplex performed in A549 cells
- (C) and (D) is the purpose of Fwd (dT): Rev (R) and Fwd (R): Rev (dT) IC 50 was confirmed for gene knockdown activity.
- Fwd forward, Rev: reverse, dT: dTdT overhang, R: RNA overhang.
- Figure 2 shows the loading preference for each strand of the siRNA duplex with asymmetric RNA / dTdT overhang
- A is a diagram showing the siRNA duplex structure used in in vitro loading assay
- B is a result of reacting the lysate of HEK293T cells expressing FLAG-hAGO2 with the siRNA duplex of (A), followed by immunoprecipitation to isolate by native gel electrophoresis
- C gel shift assay The formation of mature- and pre-RISC complexes over time is confirmed by)
- (D) is the result of in vitro cleavage assay.
- FIG. 3 shows the effect of siRNA 3'-overhang on RNAi activity on endogenous sense and antisense transcription.
- A shows the structure of siRNA duplexes with symmetric or asymmetric 3'-overhang.
- R stands for RFXANK
- N stands for NR2C2AP
- underline represents DNA.
- B is the result of confirming the endogenous gene knockdown activity of the siRNA duplex performed in A549 cells
- C) and (D) is the purpose of R (dT): N (R) and R (R): N (dT) IC 50 was confirmed for gene knockdown activity.
- dT dTdT overhang
- R RNA overhang.
- Figure 4 shows a schematic diagram of the reporter structure
- (A) is a pMIR-report based reporter structure
- (B) is a schematic diagram showing the position of the gene specific primer (GSP) used for analysis with siRNA duplex.
- GSP gene specific primer
- FIG. 5 shows RNAi activity of other target genes of siRNA having an asymmetric 3'-overhang.
- A shows the structure of an siRNA duplex having a symmetric or asymmetric 3'-overhang. Indicates DNA.
- B is a result of confirming the reporter gene knockdown activity of the siRNA duplex in HeLa cells. Fwd: forward, Rev: reverse, dT: dTdT overhang, R: RNA overhang.
- the present invention is an siRNA molecule with increased expression inhibition specificity of the target gene and reduced off-target effect
- the siRNA molecule consists of sense and antisense strands, One strand of the two strands has a 3'-overhang consisting of 1 to 3 nucleotides of DNA, and the other strand has a 3'-overhang consisting of 1 to 3 nucleotides of RNA.
- 3'-overhang provides an siRNA molecule with an asymmetric structure.
- small interfering RNA refers to short double stranded RNA (dsRNA) that mediates sequence specific efficient gene silencing.
- antisense strand is a polynucleotide that is substantially or 100% complementary to a target nucleic acid of interest, for example mRNA (messenger RNA), non-mRNA RNA sequences (microRNA, piwiRNA, tRNA). , rRNA and hnRNA) or a coding or non-coding DNA sequence may be complementary in whole or in part.
- mRNA messenger RNA
- non-mRNA RNA sequences microRNA, piwiRNA, tRNA
- rRNA and hnRNA a coding or non-coding DNA sequence
- sense strand refers to a polynucleotide having the same nucleic acid sequence as the nucleic acid of interest, and which is identical in whole or in part to mRNA, non-mRNA RNA sequences or coding or non-coding DNA sequences.
- off-target effect is originally used to obtain the effect of siRNA to induce degradation of mRNA having a sequence complementary to the antisense strand and to inhibit gene expression of the mRNA.
- the unexpected degradation of other mRNAs caused by the sense strand or the inhibitory effect of expression of the corresponding gene and the antisense strand of siRNA are paired with the wrong target to degrade other mRNAs. It is to include all the inhibitory effect of the degradation of other mRNA by the anti-sense strand is generated.
- the sense and antisense strands of the siRNA molecule each have a length of 20 to 22 nucleotides, and the length of the 20 to 22 nucleotides. Means a length including a 3'-overhang.
- the length of the 3'-overhang may be 1 to 3 nucleotides in length, preferably 2 nucleotides in length, but is not limited thereto.
- the siRNA molecule having the asymmetric structure of the 3'-overhang of the present invention has one strand of either sense or antisense having two RNAs at the 3'-terminus of over 19 nucleotides in length, and the other one
- the strand may be a structure having two dTdTs overhang at the 3′-end and 19 nucleotides in length.
- the two RNA overhangs may consist of sequences corresponding to the mRNA of the gene of interest.
- step (b) combining the synthesized RNA strands of step (a) with each other capable of subject-specific RNA interference under conditions in which siRNA molecules are formed, wherein the 3'-overhang is asymmetrical
- steps (b) combining the synthesized RNA strands of step (a) with each other capable of subject-specific RNA interference under conditions in which siRNA molecules are formed, wherein the 3'-overhang is asymmetrical
- the method of synthesizing the RNA molecule may be a chemical synthesis method or an enzymatic method, preferably a chemical synthesis method, but is not limited thereto.
- Methods of chemical synthesis of RNA molecules are known in the art, and chemical synthesis methods as described in Verma and Eckstein (1998) may be specifically referenced.
- each of the RNA strand has a length of 20 to 22 nucleotides
- the length of the 20 to 22 nucleotides means a length including an overhang.
- the length of the 3'-overhang may be 1 to 3 nucleotides in length, preferably 2 nucleotides in length, but is not limited thereto.
- the siRNA molecule having the asymmetric structure of the 3'-overhang of the present invention has one strand having two RNAs at the 3'-terminus of 19 nucleotides in length, and the other strand has 19 It may be a structure having two dTdTs overhang at the 3'-end in the length of the nucleotide.
- the two RNA overhangs may consist of sequences corresponding to the mRNA of the gene of interest.
- the siRNA molecule having the asymmetric structure of the 3'-overhang according to the preparation method of the present invention is characterized in that the expression inhibition specificity of the target gene is increased and the off-target effect is reduced.
- the present invention provides a composition for inhibiting gene expression containing an siRNA molecule having a 3'-overhang asymmetric structure according to the present invention.
- the gene expression inhibition composition may be provided in the form of a gene expression inhibition kit (kit).
- Kits for inhibiting gene expression may take the form of bottles, tubs, sachets, envelopes, tubes, ampoules, etc., which may be partially or wholly plastic, glass, paper, foil, It may be formed from wax or the like.
- the container may be equipped with a fully or partially separable stopper, which may initially be part of the container or attached to the container by mechanical, adhesive, or other means.
- the container may also be equipped with a stopper, which may be accessible to the contents by a needle.
- the kit may include an external package, which may include instructions for use of the components.
- the present invention also provides a method of inhibiting the expression of a target gene in a cell, comprising the step of introducing a siRNA molecule having a 3'-overhang asymmetrical structure into a cell except the human body.
- the target gene may be an endogenous gene or a transgene.
- SiRNA molecules having a 3'-overhang asymmetrical structure according to the present invention do not require chemical modifications, such as 2'-OMe or LNA, which are known to have a conventional off-target reduction effect.
- the present invention relates to a method for inhibiting gene expression comprising expressing the siRNA molecule in a cell.
- step (b) mediating target specific RNA interference in a cell, comprising mediating target specific RNA interference caused by the siRNA with a target nucleic acid having a sequence portion corresponding to the siRNA molecule of step (a).
- a target nucleic acid having a sequence portion corresponding to the siRNA molecule of step (a).
- the siRNA is an siRNA molecule having a 3'-overhang asymmetric structure.
- the contacting step (a) comprises the step of contacting the double-stranded RNA molecule in a target cell, for example, in a cell of interest, an isolated target cell such as a single cell microorganism or a multicellular individual Introducing into cells or a plurality of cells of interest.
- the step of introducing comprises carrier-mediated delivery, for example delivery by liposome carrier or injection.
- RNAs were purchased from Bioneer (Korea) and used in combination according to the manufacturer's protocol.
- A549 (CCL-185) and HeLa (CCL-2) cell lines were purchased from ATCC (USA) and cultured at 37 ° C. in DMEM (Gibco) medium supplemented with 10% fetal bovine serum (FBS, Gibco, USA). It was. Cells were passaged periodically to maintain exponential growth. For siRNA transfection, cells were plated using complete medium to achieve 30-50% confluence in 12-well plates 24 hours prior to transfection. Lipofectamine RNAiMAX (Invitrogen, USA) was used for A549 cell and HeLa cell transfection.
- DNA oligonucleotides containing the target sequence corresponding to the siRNA duplex were cloned into the SpeI and HindIII sites of the pMIR-REPORT luciferase vector (Ambion, USA) (FIGS. 1 and 5).
- the sequence of each oligonucleotide is shown in Table 1 below.
- DMEM fetal bovine serum
- HEK293T cells CTL-112678 to prepare lysates of cells expressing FLAG-tagged human argonaute 2 (hAGO2) protein (Welgene, South Korea) Incubated at 37 ° C. with 5% CO 2 .
- Cultured HEK293T cells were transfected with 10 ⁇ g of pcDNA3.1-FLAG-hAGO2 using the calcium phosphate method. Cells were washed three times with cold PBS (pH 7.4) and then centrifuged at 4 ° C. at 6,000 rpm for 5 minutes to collect cells.
- RNA samples were then extracted with phenol, precipitated with ethanol and separated via 15% native polyacrylamide gel electrophoresis at 4 ° C. Phosphorescence was performed using a BAS-2500 image analyzer (Fujifilm, Japan), and signal intensity was quantified using MultiGauge (Fujifilm).
- CTGF-17 target mRNA was in vitro transcribed and 5'-cap by guanylytransferase using mScript mRNA production system (Epicentre, USA). Was radiolabeled and purified by polyacrylamide gel electrophoresis.
- Target RNA digestion analysis was performed according to the previously described method, briefly the reaction was carried out at 30 ° C. with 10 nM siRNA, 2.5 nM cap-radiated labeled target RNA, 1 mM ATP, 1 mM MgCl 2 , 0.1 ⁇ g / ⁇ l creatine kinase, 25 mM Incubated with creatine phosphate and 0.4 U / ⁇ l RNasin (Promega, USA).
- siRNA duplexes were preincubated with lysates of HEK293T cells at 30 ° C. for 20 minutes prior to cap-labeled target RNA addition.
- Phosphorescence imaging was performed using a BAS-2500 image analyzer, and signal strength was quantified using MultiGauge.
- RISC assembly assays were performed according to the previously described method; briefly, each reaction was performed with 5 ⁇ l of cell lysate, 3 ⁇ l of 40X reaction mixture (Haley B et al., 2003, Methods 30: 330-336 ), 1 ⁇ l of 100 nM 5′- 32 P-radiation labeled small RNA duplex and 1 ⁇ l of lysis buffer. At the indicated time points after incubation the reaction was stopped using 2 ⁇ l of heparin mixture (60 mM KCl, 3 mM MgCl 2 , 3% PEG 8000 , 8% glycerol and 4 mg / ml heparin). RISC complexes were separated by vertical native gel electrophoresis for 1.5 hours at 4 ° C. at 10 W. Phosphorescence imaging was performed using a BAS-2500 image analyzer, and signal strength was quantified using MultiGauge.
- two reporter vectors with firefly luciferases in both directions in the 3'-UTR (untranslated region) were designed (FIG.
- each siRNA duplex was transfected with each siRNA duplex, firefly luciferase structure, and Renilla luciferase as a transfection control.
- the activity of firefly luciferase vs. Renilla luciferase was analyzed 24 hours after transfection (FIG. 1B).
- siRNA duplexes such as Fwd (dT): Rev (dT) and Fwd (R): Rev (R) with symmetrical 3′-overhangs showed similar RNAi activity of both strands to the target. Regardless of the strand and target combination, 70-78% of the target gene knockdown was observed.
- Fwd (dT): Rev (R) and Fwd (R): Rev (dT) siRNA duplexes with asymmetric 3'-overhangs have been shown to have a clear preference for one of two target sequences. As shown in FIG.
- the Fwd (dT): Rev (R) siRNA duplex showed high inhibition rate (83% knockdown) against the reverse target sequence (pMIR-report-Rev), but the forward target sequence (pMIR- report-Fwd) showed moderate inhibition (64% knockdown).
- Fwd (R): Rev (dT) siRNA duplexes showed the opposite trend to Fwd (dT): Rev (R) siRNA duplexes for target sequence silencing (81% and for the forward and reverse target sequences, respectively). 61% knockdown).
- IC 50 analysis was performed on each strand of the siRNA duplex with asymmetric overhangs, showing that the strands with RNA overhangs were 3.8-fold and 1.8-fold higher RNAi activity, respectively, than the strands with dTdT overhangs (FIG. 1C and 1D).
- siRNA duplex variants R: R, dT: R, R: dT and dT: dT
- Cultivation of the target mRNA in the cytoplasmic extract present produced 5'-degradation products at the locations expected to be degraded by hAGO2-catalytic action (FIG.
- siRNA duplexes showed significantly higher efficiency of target degradation than siRNA duplexes (R: dT) corresponding to reverse strand targets, and reversed for forward strand targets. Correlation was observed (FIG. 2D).
- siRNA duplexes with specific dependence on 3'-overhangs and siRNA duplexes with asymmetric RNA / dTdT overhangs, efficiently assemble into mature RISC complexes, ultimately inducing selective target silencing of the desired strands. It was confirmed that.
- NAT natural antisense transcript
- RFXANK regulatory factor X-associated ankyrin-containing protein
- N2C2AP nuclear receptor 2C2-associated protein
- R (dT): N (R) duplexes composed of RFXANK target strand with dTdT overhang and NR2C2AP target strand with RNA overhang showed 34.2% and 76.9% knockdown for RFXANK and NR2C2AP, respectively (FIG. 3B).
- the R (R): N (dT) duplex showed the opposite trend of target gene silencing with 80.8% and 55.3% knockdown for RFXANK and NR2C2AP, respectively.
- IC 50 analysis confirmed the high gene silencing activity of strands with RNA overhangs in both asymmetric overhang duplexes (FIG. 3C).
- the R (dT): N (R) duplex showed a dramatic preference ( ⁇ 100-fold) for NR2C2AP compared to RFXANK, which allowed siRNA duplexes with asymmetric RNA / dTdT overhangs to silence specific NAT pairs. It could be confirmed that it has a high potential for.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Biomedical Technology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- General Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Physics & Mathematics (AREA)
- Microbiology (AREA)
- Biophysics (AREA)
- Plant Pathology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Oncology (AREA)
- Analytical Chemistry (AREA)
- Immunology (AREA)
Abstract
본 발명은 목적 유전자의 발현 억제 특이성이 증가되고 오프-타겟 효과가 감소된 siRNA 분자로서, 상기 siRNA 분자는 센스 및 안티센스 가닥으로 이루어져 있으며, 상기 두 가닥 중 하나의 가닥은 1 내지 3개의 뉴클레오티드의 DNA로 구성된 3'-오버행을 가지며, 나머지 하나의 가닥은 1 내지 3개의 뉴클레오티드의 RNA로 구성된 3'-오버행을 가지는 것을 특징으로 하는, 3'-오버행이 비대칭적인 구조를 갖는 siRNA 분자에 관한 것이다.
Description
본 발명은 목적 유전자의 발현 억제 특이성이 증가된 siRNA 분자에 관한 것으로, 더욱 상세하게는 목적 유전자의 발현 억제 특이성이 증가되고 오프-타겟 효과가 감소된 siRNA 분자로서, 상기 siRNA 분자는 센스 및 안티센스 가닥으로 이루어져 있으며, 상기 두 가닥 중 하나의 가닥은 1 내지 3개의 뉴클레오티드의 DNA로 구성된 3'-오버행을 가지며, 나머지 하나의 가닥은 1 내지 3개의 뉴클레오티드의 RNA로 구성된 3'-오버행을 가지는 것을 특징으로 하는, 3'-오버행이 비대칭적인 구조를 갖는 siRNA 분자, 상기 3'-오버행이 비대칭적인 구조를 갖는 siRNA 분자의 제조 방법, 상기 siRNA 분자를 함유하는 유전자 발현 억제용 조성물 및 키트, 상기 siRNA 분자를 인체를 제외한 세포 내 도입시키는 단계를 포함하는 세포 내 목적 유전자의 발현 억제 방법 및 세포를 상기 siRNA 분자와 접촉시켜 siRNA에 의하여 초래되는 목적 특이적 RNA 간섭을 매개하는 단계를 포함하는, 세포에서 목적 특이적 RNA 간섭을 매개하는 인 비트로 방법에 관한 것이다.
RNA 간섭 (RNAi, RNA interference)는 진화학적으로 보존된 전사 후 유전자 침묵의 기작으로 서열 특이적인 방법으로 mRNA 분해를 촉진한다. RNAi 기술은 기초 연구와 새로운 질병 치료제 개발을 위한 연구자들에게 많이 이용되어 지고 있다. 원형의 siRNA 듀플렉스(duplex)는 원래 Elbashir와 그의 동료들에 의해 기술되었는데(Nature, 2001, 411:494-498), 다이서(dicer)와 같은 RNase Ⅲ 타입의 효소에 의해 처리되는 것을 연상시키는 2개의 뉴클레오티드가 대칭인 3'-오버행(overhang)을 가진 19bp를 포함하는 21개의 뉴클레오티드로 된 두 가닥 RNA이다. siRNA 듀플렉스의 두 가닥들은 먼저 Argonaute 단백질 내로 이중 가닥의 RNA로 조립되고(pre-RISC 복합체), 성숙한 RISC 복합체 형성을 위해 한 개의 가닥이 풀림(unwinding) 또는 분해(cleavage)에 의해 버려지게 된다. 이 버려지는 가닥은 패신저(passenger) 가닥 (또는 센스 가닥)으로 불리며, 반면 최종적으로 성숙한 RISC 내에 보유되는 다른 가닥은 가이드(guide) 가닥 (또는 안티센스 가닥)으로 불린다.
2001년 처음으로 인간 체세포에서 siRNA가 성공적으로 표적 유전자를 녹다운(Knock-down)시키는 결과가 보고된 후, 현재까지 기능유전체 연구, 신약 타겟 도출 및 siRNA를 이용한 약물 개발 등에 응용되고 있다. siRNA는 기존 유전자 치료에 쓰이던 핵산보다 매우 우수한 효율로 세포내 전달이 가능하므로 기존 유전자 치료 방법의 결점인 유전자 전달 효율의 문제점을 크게 완화시킬 수 있을 것으로 기대를 모으고 있다.
하지만, 이러한 siRNA의 높은 전망에도 불구하고, 기능성(functiolality), 특이성(specificity), 운반 방법(delivery methods) 및 안정성(stability) 등의 주요 난제가 siRNA와 관련된 연구에서 해결되어야한 주요한 부분으로 남아있다. 이 중에서, siRNA의 특이성은 다른 유전자의 발현에는 영향을 미치지 아니하며 원하는 목적 유전자를 침묵시키는 특정 siRNA의 능력을 의미하는데, 최근의 연구는 비특이적 유도효과 즉, 오프-타겟 효과(off-target effect)가 초기에 예상했던 것보다 훨씬 더 광범위하게 일어남이 확인되었다(Jackson et al., 2003, Nat Biotechnol. 21:635-7).
오프-타겟 효과는 종래의 19+2 구조의 siRNA의 안티센스 가닥과 목표 mRNA의 불완전한 페어링(pairing) 또는 RISC 복합체에서 센스 가닥 도입(incorporation) 등에 의해 의도하지 않은 목표 유전자의 절단을 보이는 현상이다. 오프-타겟 효과는 바람직하지 못한 표현형을 유발할 수 있으므로, 상기 오프-타겟 효과를 최소화, 변경 또는 제거하는 신규한 방법 및 조성물은 siRNA가 효험있는 연구 및 치료적인 수단이 되는데 필요불가결한 것으로 간주되고 있다. 많은 연구에서, 주로 센스 가닥 매개 비특이적인 발현 억제를 감소시키기 위한 다양한 siRNA 변형 방법을 제안하여 왔다(Elmen et al., 2005, Nucleic Acids Res. 33:439; Sano et al., 2008, Nucleic Acids Res. 36:5812; Sun et al., 2008, Nat Biotechnol., 26:1379). 그러나 화학적 변형들을 통한 siRNA의 오프-타겟 효과의 감소 방법 중 일부는 온-타겟 억제효율도 감소시킬 수 있는 것으로 나타났다. 더욱이, 이러한 화학적 변형전략은 세포 내 발현되는 siRNA에는 확장할 수 없었다.
본 발명자들은 이전의 연구를 통해서, RNA 오버행을 가지는 비대칭 구조의 siRNA(asiRNA, asymmetric siRNA)가 dTdT 오버행을 가지는 비대칭 구조의 siRNA 보다 유전자 침묵 효과가 우수함을 보고하였고(Hong et al., 2014, Biochem J.), RNA 오버행을 가지는 asiRNA가 dTdT 오버행을 가지는 asiRNA 보다 AGO2-RISC 복합체 내로 보다 효율적으로 어셈블되는 것을 확인하였다. 이에 본 발명에서는 siRNA의 3'-오버행의 구조 변형을 통해 목적 유전자에 대한 특이성을 증가시키고, 오프-타겟 효과는 감소시키는 방법에 대해 연구하였다.
한편, 한국등록특허 제0872437호에는 'RNA 간섭을 매개하는 작은 RNA 분자'가 개시되어 있고, 한국등록특허 제1237036호에는 '안티센스 가닥에 의한 오프-타겟 효과를 최소화한 신규한 siRNA 구조 및 그 용도'가 개시되어 있으나, 본 발명의 목적 유전자의 발현 억제 특이성이 증가된 siRNA 분자에 대해서는 기재된 바가 없다.
본 발명은 상기와 같은 요구에 의해 도출된 것으로서, 본 발명자들은 RNA/dTdT의 비대칭적인 3'-오버행 구조를 가지는 siRNA 분자를 제작하고 세포에 처리하여 목적 유전자의 억제 효율을 확인한 결과, 본 발명에 따른 신규한 구조의 siRNA 분자가 목적 유전자에 대한 억제 효율이 높으면서도 오프-타겟 효과가 감소된 것을 확인함으로써, 본 발명을 완성하였다.
상기 과제를 해결하기 위해, 본 발명은 목적 유전자의 발현 억제 특이성이 증가되고 오프-타겟 효과가 감소된 siRNA 분자로서, 상기 siRNA 분자는 센스 및 안티센스 가닥으로 이루어져 있으며, 상기 두 가닥 중 하나의 가닥은 1 내지 3개의 뉴클레오티드의 DNA로 구성된 3'-오버행을 가지며, 나머지 하나의 가닥은 1 내지 3개의 뉴클레오티드의 RNA로 구성된 3'-오버행을 가지는 것을 특징으로 하는, 3'-오버행이 비대칭적인 구조를 갖는 siRNA 분자를 제공한다.
또한, 본 발명은 상기 3'-오버행이 비대칭적인 구조를 갖는 siRNA 분자의 제조 방법을 제공한다.
또한, 본 발명은 상기 3'-오버행이 비대칭적인 구조를 갖는 siRNA 분자를 함유하는 유전자 발현 억제용 조성물을 제공한다.
또한, 본 발명은 상기 3'-오버행이 비대칭적인 구조를 갖는 siRNA 분자를 함유하는 유전자 발현 억제용 키트를 제공한다.
또한, 본 발명은 상기 3'-오버행이 비대칭적인 구조를 갖는 siRNA 분자를 인체를 제외한 세포 내로 도입시키는 단계를 포함하는 세포 내 목적 유전자의 발현 억제 방법을 제공한다.
또한, 본 발명은 세포를 상기 3'-오버행이 비대칭적인 구조를 갖는 siRNA 분자와 접촉시켜 siRNA에 의하여 초래되는 목적 특이적 RNA 간섭을 매개하는 단계를 포함하는, 세포에서 목적 특이적 RNA 간섭을 매개하는 인 비트로 방법을 제공한다.
본 발명은 RNA/dTdT의 비대칭적인 3'-오버행 구조에 의해 특이성이 증가되고 오프-타겟 효과가 감소된 새로운 구조의 siRNA 분자 및 이를 이용한 목적 유전자의 발현 억제 방법을 제공하였다. 본 발명에 따른 비대칭의 3'-오버행을 가지는 siRNA 분자는 복잡한 화학적 변형 없이 간단한 방법으로 기능성이 증가된 새로운 siRNA 구조로 그 제조 방법이 용이하며, 종래의 siRNA 분자들을 대체하여 유전자 치료 등 siRNA를 기반으로 하는 유전자 발현 억제 기법에 널리 사용될 수 있을 것으로 기대된다.
도 1은 siRNA 3'-오버행이 각 가닥의 RNAi 활성에 미치는 영향을 알아본 결과로, (A)는 대칭의 또는 비대칭의 3'-오버행을 가지는 siRNA 듀플렉스의 구조를 나타낸 그림으로, 밑줄은 DNA를 가리킨다. (B)는 A549 세포에서 수행한 siRNA 듀플렉스의 리포터 유전자 녹다운 활성을 확인한 결과이고, (C)와 (D)는 Fwd(dT):Rev(R) 및 Fwd(R):Rev(dT)의 목적 유전자 녹다운 활성에 대해 IC50를 확인한 결과이다. Fwd: 정방향, Rev: 역방향, dT: dTdT 오버행, R: RNA 오버행.
도 2는 비대칭의 RNA/dTdT 오버행을 가지는 siRNA 듀플렉스의 각 가닥들에 대한 로딩 선호도를 확인한 결과로, (A)는 인 비트로(in vitro) 로딩 분석에 사용된 siRNA 듀플렉스 구조를 나타낸 그림이고, (B)는 FLAG-hAGO2를 발현하는 HEK293T 세포의 용해물과 (A)의 siRNA 듀플렉스를 반응시킨 후 면역침강하여 네이티브 겔 전기영동을 통해 분리한 결과이며, (C)는 겔 이동 분석(gel shift assay)을 통해 성숙한- 및 pre-RISC 복합체 형성을 시간 경과에 따라 확인한 결과이며, (D)는 인 비트로 분해 분석(in vitro cleavage assay)의 결과이다.
도 3은 내인적인 센스 및 안티센스 전사에 대해서 siRNA의 3'-오버행이 RNAi 활성에 미치는 영향을 확인한 결과로, (A)는 대칭의 또는 비대칭의 3'-오버행을 가지는 siRNA 듀플렉스의 구조를 나타낸 그림으로, R은 RFXANK를 N은 NR2C2AP를 의미하며, 밑줄은 DNA를 나타낸다. (B)는 A549 세포에서 수행한 siRNA 듀플렉스의 내인성 유전자 녹다운 활성을 확인한 결과이고, (C)와 (D)는 R(dT):N(R) 및 R(R):N(dT)의 목적 유전자 녹다운 활성에 대해 IC50를 확인한 결과이다. dT: dTdT 오버행, R: RNA 오버행.
도 4는 리포터 구조의 모식도를 나타낸 것으로, (A)는 pMIR-report 기반의 리포터 구조를, (B)는 siRNA 듀플렉스와 분석을 위해 사용한 유전자 특이적 프라이머(GSP)의 위치를 나타내는 도식이다.
도 5는 비대칭의 3'-오버행을 가지는 siRNA의 다른 목적 유전자에 대한 RNAi 활성을 확인한 결과로, (A)는 대칭의 또는 비대칭의 3'-오버행을 가지는 siRNA 듀플렉스의 구조를 나타낸 그림으로, 밑줄은 DNA를 가리킨다. (B)는 HeLa 세포에서 siRNA 듀플렉스의 리포터 유전자 녹다운 활성을 확인한 결과이다. Fwd: 정방향, Rev: 역방향, dT: dTdT 오버행, R: RNA 오버행.
본 발명의 목적을 달성하기 위하여, 본 발명은 목적 유전자의 발현 억제 특이성이 증가되고 오프-타겟 효과(off-target effect)가 감소된 siRNA 분자로서, 상기 siRNA 분자는 센스 및 안티센스 가닥으로 이루어져 있으며, 상기 두 가닥 중 하나의 가닥은 1 내지 3개의 뉴클레오티드의 DNA로 구성된 3'-오버행(overhang)을 가지며, 나머지 하나의 가닥은 1 내지 3개의 뉴클레오티드의 RNA로 구성된 3'-오버행을 가지는 것을 특징으로 하는, 3'-오버행이 비대칭적인 구조를 갖는 siRNA 분자를 제공한다.
용어 "siRNA(small interfering RNA)"는 서열 특이적으로 효율적인 유전자 발현 억제(gene silencing)를 매개하는 짧은 이중 가닥의 RNA(dsRNA)를 의미한다.
용어 "안티센스(antisense) 가닥"은 관심 있는 목적 핵산(target nucleic acid)에 실질적으로 또는 100% 상보적인 폴리뉴클레오티드로서, 예를 들어 mRNA (messenger RNA), mRNA가 아닌 RNA 서열(microRNA, piwiRNA, tRNA, rRNA 및 hnRNA) 또는 코딩 또는 비코딩 DNA 서열과 전체로서 또는 일부로서 상보적일 수 있다. 또한, "센스(sense) 가닥"이란 목적 핵산과 동일한 핵산 서열을 갖는 폴리뉴클레오티드로서, mRNA, mRNA가 아닌 RNA 서열 또는 코딩 또는 비코딩 DNA 서열과 전체로서 또는 일부로서 동일한 폴리뉴클레오티드를 말한다.
용어 "오프-타겟 효과(off-target effect)"란 본래 siRNA는 안티센스 가닥과 상보적인 서열을 갖는 mRNA의 분해를 유도하여 해당 mRNA의 유전자 발현을 억제하는 효과를 얻기 위하여 사용하는 것임에 불구하고, siRNA의 센스 가닥에 의해 타 mRNA의 분해가 발생하게 되는 경우 센스 가닥에 의해 발생하는 이러한 예상치 못한 타 mRNA의 분해 내지 해당 유전자의 발현 억제 효과 및 siRNA의 안티센스 가닥이 잘못된 타겟과 페어링하여 타 mRNA의 분해가 발생하는 안티센스 가닥에 의한 타 mRNA의 분해 내지 해당 유전자의 발현 억제효과를 모두 포함하는 것이다.
본 발명의 일 구현 예에 따른 3'-오버행이 비대칭적인 구조를 갖는 siRNA 분자에서, 상기 siRNA 분자의 센스 및 안티센스 가닥은 각각 20 내지 22개의 뉴클레오티드의 길이를 갖고, 상기 20 내지 22개의 뉴클레오티드의 길이는 3'-오버행을 포함하는 길이를 의미한다. 또한, 상기 3'-오버행의 길이는 1 내지 3개의 뉴클레오티드 길이일 수 있으며, 바람직하게는 2개의 뉴클레오티드 길이일 수 있으나, 이에 제한되지 않는다. 더욱 바람직하게는 본 발명의 상기 3'-오버행이 비대칭적인 구조를 갖는 siRNA 분자는 센스 또는 안티센스 중 하나의 가닥은 19개의 뉴클레오티드의 길이에 3'-말단에 2개의 RNA를 오버행으로 가지며, 나머지 한 가닥은 19개의 뉴클레오티드의 길이에 3'-말단에 2개의 dTdT를 오버행으로 가지는 구조일 수 있다. 상기 2개의 RNA 오버행은 목적 유전자의 mRNA에 대응되는 서열로 이루어질 수 있다.
또한, 본 발명은
(a) siRNA 분자를 형성할 수 있는, 미리 결정된 mRNA 목적 분자에 대해 85 내지 100%의 서열 동일성을 가지는 두 개의 RNA 가닥으로서, 상기 가닥 중 하나의 가닥은 1 내지 3개의 뉴클레오티드의 DNA로 구성된 3'-오버행을 가지며, 나머지 하나의 가닥은 1 내지 3개의 뉴클레오티드의 RNA로 구성된 3'-오버행을 갖는 것을 특징으로 하는 두 개의 RNA 가닥을 합성하는 단계; 및
(b) siRNA 분자가 형성되는 조건하에서, 목적 특이적 RNA 간섭을 할 수 있는 상기 (a) 단계의 합성된 RNA 가닥을 서로 조합하는 단계를 포함하는 것을 특징으로 하는, 3'-오버행이 비대칭적인 구조를 갖는 siRNA 분자의 제조 방법을 제공한다.
본 발명의 일 구현 예에 따른 제조 방법에 있어서, 상기 RNA 분자를 합성하는 방법은 화학적 합성 방법 또는 효소적 방법일 수 있으며, 바람직하게는 화학적 합성 방법일 수 있으나, 이에 제한되지 않는다. RNA 분자의 화학적 합성 방법은 당업계에 알려져 있으며, Verma 및 Eckstein(1998)에 기재된 바와 같은 화학적 합성 방법이 특히 참조될 수 있다.
본 발명의 일 구현 예에 따른 제조 방법에 있어서, 상기 RNA 가닥은 각각 20 내지 22개의 뉴클레오티드의 길이를 갖고, 상기 20 내지 22개의 뉴클레오티드의 길이는 오버행을 포함하는 길이를 의미한다. 또한, 상기 3'-오버행의 길이는 1 내지 3개의 뉴클레오티드 길이일 수 있으며, 바람직하게는 2개의 뉴클레오티드 길이일 수 있으나, 이에 제한되지 않는다. 더욱 바람직하게는 본 발명의 상기 3'-오버행이 비대칭적인 구조를 갖는 siRNA 분자는 하나의 가닥은 19개의 뉴클레오티드의 길이에 3'-말단에 2개의 RNA를 오버행으로 가지며, 나머지 한 가닥은 19개의 뉴클레오티드의 길이에 3'-말단에 2개의 dTdT를 오버행으로 가지는 구조일 수 있다. 상기 2개의 RNA 오버행은 목적 유전자의 mRNA에 대응되는 서열로 이루어질 수 있다.
본 발명의 제조 방법에 따른 상기 3'-오버행이 비대칭적인 구조를 갖는 siRNA 분자는 목적 유전자의 발현 억제 특이성이 증가되고 오프-타켓 효과가 감소된 것을 특징으로 한다.
또한, 본 발명은 본 발명에 따른 3'-오버행이 비대칭적인 구조를 갖는 siRNA 분자를 함유하는 유전자 발현 억제용 조성물을 제공한다.
상기 유전자 발현 억제용 조성물은 유전자 발현 억제용 키트(kit)의 형태로 제공될 수 있다. 유전자 발현 억제용 키트는 병, 통(tub), 작은 봉지(sachet), 봉투(envelope), 튜브, 앰플(ampoule) 등과 같은 형태를 취할 수 있으며 이들은 부분적으로 또는 전체적으로 플라스틱, 유리, 종이, 호일, 왁스 등으로부터 형성될 수 있다. 용기는, 처음에는 용기의 일부이거나 또는 기계적, 접착성, 또는 기타 수단에 의해 용기에 부착될 수 있는, 완전히 또는 부분적으로 분리가 가능한 마개를 장착할 수 있다. 용기는 또한 주사바늘에 의해 내용물에 접근할 수 있는, 스토퍼가 장착될 수 있다. 상기 키트는 외부 패키지를 포함할 수 있으며, 외부 패키지는 구성 요소들의 사용에 관한 사용설명서를 포함할 수 있다.
또한, 본 발명은 본 발명에 따른 3'-오버행이 비대칭적인 구조를 갖는 siRNA 분자를 인체를 제외한 세포 내로 도입시키는 단계를 포함하는 세포 내 목적 유전자의 발현 억제 방법을 제공한다.
본 발명에 있어서, 상기 목적 유전자는 내인성(endogeneous) 유전자이거나 삽입유전자(transgene)일 수 있다.
본 발명에 따른 3'-오버행이 비대칭적인 구조를 갖는 siRNA 분자는 기존의 오프-타겟 감소 효과를 가진다고 알려진 2'-OMe나 LNA 같은 화학적 변형을 필요로 하지 않는다. 따라서, 본 발명은 다른 관점에서, 상기 siRNA 분자를 세포 내에서 발현시키는 단계를 포함하는 유전자 발현 억제 방법에 관한 것이다.
또한, 본 발명은
(a) 세포를 목적 특이적 RNA 간섭이 일어날 수 있는 조건하에서 본 발명의 3'-오버행이 비대칭적인 구조를 갖는 siRNA 분자와 접촉시키는 단계; 및
(b) 상기 (a) 단계의 siRNA 분자에 대응되는 서열 부분을 갖는 목적 핵산에 대하여 상기 siRNA에 의하여 초래되는 목적 특이적 RNA 간섭을 매개하는 단계를 포함하는, 세포에서 목적 특이적 RNA 간섭을 매개하는 인 비트로 방법을 제공한다.
본 발명에 따른 상기 인 비트로 방법에 있어서, 상기 siRNA는 3'-오버행이 비대칭적인 구조를 갖는 siRNA 분자이다.
또한, 본 발명에 따른 상기 인 비트로 방법에 있어서, 상기 접촉시키는 단계 (a)는 상기 이중가닥 RNA 분자를 목적 세포, 예를 들면, 세포 배양, 단세포 미생물과 같은 분리된 목적 세포 또는 다세포 개체 내의 목적 세포 또는 복수의 목적 세포로 도입하는 단계를 포함할 수 있다. 바람직하게는, 상기 도입하는 단계는 담체-매개 전달, 예를 들면, 리포좀 담체 또는 주사(injection)에 의한 전달을 포함한다.
이하, 본 발명을 실시예에 의해 상세히 설명한다. 단, 하기 실시예는 본 발명을 예시하는 것일 뿐, 본 발명의 내용이 하기 실시예에 한정되는 것은 아니다.
재료 및 방법
siRNA
화학적으로 합성한 RNA들은 바이오니아(한국)으로부터 구매하였고, 제조사의 프로토콜에 따라 조합하여 사용하였다.
세포 배양 및 siRNA 트렌스펙션
A549(CCL-185) 및 HeLa(CCL-2) 세포주는 ATCC(미국)로부터 구매하였고, 10% 소태아혈청(FBS, Gibco, 미국)으로 보충한 DMEM(Gibco) 배지에서 37℃의 조건으로 배양하였다. 세포들은 지수기 생장을 유지하기 위해 주기적으로 계대배양하였다. siRNA 트렌스펙션을 위해서, 세포들을 트렌스펙션 수행 24시간 전에 12-웰 플레이트에 30~50%의 컨플루언스(confluence)가 되도록 완전 배지(complete medium)를 사용하여 플레이팅하였다. A549 세포 및 HeLa 세포 트렌스펙션을 위해 lipofectamine RNAiMAX(Invitrogen, 미국)을 사용하였다.
플라스미드
siRNA 듀플렉스에 상응하는 목적 서열을 포함하는 DNA 올리고뉴클레오티드는 pMIR-REPORT 루시퍼라제 벡터(Ambion, 미국)의 SpeI 및 HindⅢ 자리 내로 클로닝되었다(도 1 및 도 5). 각각의 올리고뉴클레오티드의 서열은 하기 표 1과 같다.
표 1
| 이름 | 서열정보 (5'→3') |
| 도 1 정방향 표적 | CTAGTAGTACAGCGATTCAAAGATGTCATTGTCTC (서열번호 1) |
| 도 1 정방향 표적 | AGCTGAGACAATGACATCTTTGAATCGCTGTACTA (서열번호 2) |
| 도 1 역방향 표적 | CTAGGAGACAATGACATCTTTGAATCGCTGTACTA (서열번호 3) |
| 도 1 역방향 표적 | AGCTTAGTACAGCGATTCAAAGATGTCATTGTCTC (서열번호 4) |
| 도 5 정방향 표적 | CTAGCTCATGGGTGGAATCATATTGGA (서열번호 5) |
| 도 5 정방향 표적 | AGCTTCCAATATGATTCCACCCATGAG (서열번호 6) |
| 도 5 역방향 표적 | CTAGTCCAATATGATTCCACCCATGAG (서열번호 7) |
| 도 5 역방향 표적 | AGCTCTCATGGGTGGAATCATATTGGA (서열번호 8) |
루시퍼라제 녹다운 검정
세포들을 24-웰 플레이트에 50% 컨플루언스가 되도록 완전 배지를 사용하여 플레이팅하였다. 24시간 후에, siRNA 목적 자리를 포함하고 있는 pMIR-report 기반 플라스미드, pRL-SV40(1ng, Promega, 미국) 및 siRNA를 lipofectamine 2000(Invitrogen, 미국) 시약을 사용하여 함께 트렌스펙션하였다. 24시간 후에, 루시퍼라제 활성을 Dual Liciferase Report Assay System(Promega)을 사용하여 분석하였다. 결과는 20/20n 루미노미터(Turner Biosystems, 미국)를 사용하여 정량화하였다.
정량적 실시간 중합효소연쇄반응
총 RNA는 Isol-RNA lysis 시약(5 Prime, 독일)을 사용하여 추출하였고, 500ng의 RNA를 고성능 cDNA 역전사 키트(Applied Biosystems, 미국)를 사용한 cDNA 합성에 주형으로 사용하였다. 각 cDNA 반응의 균등물(1/20)을 StepOne Real-time PCR System(Applied Biosystems) 장비를 사용하여 정량적 실시간 역전사 중합효소연쇄반응(quantitative real-time RT-PCR)으로 분석하였다. 유전자 특이적 프라이머를 SYBR Premix Ex Taq(Takara, 일본)과 섞어서 사용하였다. siRNA 목적 유전자의 녹다운 효율의 분석은, 목적 유전자와 내부 대조구 mRNA(TUBA1A) 수준을 상대적 표준 곡선 정량 방법을 사용하여 측정하였다. 본 발명에 사용된 프라이머의 정보는 하기 표 2와 같다.
표 2 정량적 실시간 중합효소연쇄반응을 위한 프라이머
| 이름 | 서열정보(5'→3') |
| RFXANK-정방향 | CGTGACGTGGACATCAACA (서열번호 9) |
| RFXANK-역방향 | CCTGTTGCACTTTCCGGTAT (서열번호 10) |
| NR2C2AP-정방향 | CAGCTGCAGATCCAGTTTCA (서열번호 11) |
| NR2C2AP-역방향 | CACTTCAGCAGCTGGTATGG (서열번호 12) |
| TUBA1A-정방향 | GACCAAGCGTACCATCCAGT (서열번호 13) |
| TUBA1A-역방향 | CACGTTTGGCATACATCAGG (서열번호 14) |
세포 용해물(lysate) 준비
FLAG-태깅된 hAGO2(human argonaute 2) 단백질을 발현하는 세포의 용해물을 준비하기 위해, HEK293T 세포(CRL-11268)를 10%(v/v) 소태아혈청으로 보충한 DMEM(Welgene, 한국)으로 5% CO2의 37℃ 조건에서 배양하였다. 배양된 HEK293T 세포에 10㎍의 pcDNA3.1-FLAG-hAGO2를 칼슘 포스페이트 방법을 사용하여 트렌스펙션하였다. 세포를 차가운 PBS(pH 7.4)로 3회 세척한 후, 4℃에서 6,000rpm의 속도로 5분간 원심분리하여 세포를 수집하였다. 세포 펠렛을 농축세포용적의 3배 부피의 저장성(hypotonic) 용해 버퍼(25 mM HEPES-NaOH (pH 7.4), 10 mM NaCl, 5 mM DTT, 0.1% Tween-20 및 1x EDTAfree 프로테아제 저해제 칵테일)으로 재부유시킨 후, 4℃에서 17,000rpm의 속도로 30분간 원심분리하여 정화시켰다. 상층액을 액체 질소에서 얼린 후, -80℃에 보관하였다.
인 비트로(
in vitro
) RNA 로딩 분석
방사선표지된 듀플렉스(5'-32P-방사선 표지된 RNA 가닥을 방사선 표지 되지 않은 대응 가닥과 어닐링한 듀플렉스) 10nmole을 인 비트로 RNAi 반응액 40㎕에 넣고 37℃에서 1시간 동안 반응시켰다. 반응의 10%를 투입 분획(input fraction)으로 사용하기 위해 덜어내고, 나머지 시료는 항-FLAG M2 친화성 겔(affinity gel, Sigma-Aldrich, 미국)과 2시간 동안 가벼운 흔들림과 함께 4℃에서 배양시켰다. 레진은 10배 비드 부피의 세척 버퍼(25mM HEPES-NaOH (pH 7.4), 300mM NaCl, 1.5mM MgCl2 및 1X 프로테아제 저해제 칵테일(Roche, 독일))로 4회 세척하였다. RNA 시료는 그 후 페놀로 추출하였고, 에탄올로 침전시켰으며, 4℃에서 15% 네이티브 폴리아크릴아마이드 겔 전기영동을 통해 분리하였다. 인광화상(phosphorimaging)은 BAS-2500 이미지 분석기(Fujifilm, 일본)를 사용하여 수행하였고, 신호 세기는 MultiGauge(Fujifilm)를 이용하여 정량화하였다.
인 비트로 목적(target) RNA 분해 분석
목적(target) RNA의 생성을 위해, CTGF-17 목적(target) mRNA를 인 비트로 전사시켰고, mScript mRNA 생산 시스템(Epicentre, 미국)을 사용하여 구아닐리트렌스퍼라제(guanylytransferase)에 의한 5'-캡에 방사선 표지를 하고, 폴리아크릴아마이드 겔 전기영동을 통해 정제하였다. 목적 RNA 분해 분석은 이전에 기술한 방법에 따라 수행되었는데, 간단하게 반응은 30℃에서 10nM siRNA, 2.5nM 캡-방사선 표지된 목적 RNA, 1mM ATP, 1mM MgCl2, 0.1㎍/㎕ 크레아틴 키나제, 25mM 크레아틴 포스페이트 및 0.4U/㎕ RNasin(Promega, 미국)을 사용하여 배양시켰다. siRNA 듀플렉스는 캡-표지된 목적 RNA 첨가 전에 30℃에서 20분 동안 HEK293T 세포의 용해물과 전배양시켰다. 인광화상은 BAS-2500 이미지 분석기를 사용하여 수행하였고, 신호 세기는 MultiGauge를 이용하여 정량화하였다.
인 비트로 RISC 어셈블 분석 (Gel-shift assay)
인 비트로 RISC 어셈블 분석은 이전에 기술한 방법을 따라 수행하였는데, 간단하게, 각 반응은 5㎕의 세포 용해물, 3㎕의 40X 반응 혼합물(Haley B et al., 2003, Methods 30:330-336), 1㎕의 100nM 5'-32P-방사선 표지 된 작은 RNA 듀플렉스 및 1㎕의 용해 버퍼로 구성되었다. 배양 후에 지시된 시간대에 상기 반응을 2㎕의 헤파린 혼합물(60 mM KCl, 3mM MgCl2, 3% PEG8000, 8% 글리세롤 및 4㎎/㎖ 헤파린)을 사용하여 중지시켰다. RISC 복합체는 4℃에서 10W로 1.5 시간 동안 수직의 네이티브 겔 전기영동을 통해 분리하였다. 인광화상은 BAS-2500 이미지 분석기를 사용하여 수행하였고, 신호 세기는 MultiGauge를 이용하여 정량화하였다.
실시예 1. RNAi 활성에 대한 siRNA 듀플렉스의 3'-오버행 구조의 영향
siRNA 오버행이 각 가닥의 RNAi 활성에 어떠한 영향을 미치는지 조사하기 위해서, 동일한 목적 서열을 가지지만 다른 종류의 오버행을 가지는 네 종류의 siRNA 듀플렉스를 고안하였다. Fwd(dT):Rev(dT) 및 Fwd(R):Rev(R) siRNA 듀플렉스는 양 가닥이 모두 각각 dTdT 및 RNA로 동일한 오버행을 가진다. 대조적으로, Fwd(dT):Rev(R) 및 Fwd(R):Rev(dT) siRNA 듀플렉스는 dTdT와 RNA의 다른 오버행을 가지는 가닥으로 구성되어 있다(도 1A). 본 발명에서는, 3'-UTR(untranslated region) 내에 양 방향으로 반딧불이(firefly) 루시퍼라제를 가지고 있는 두개의 리포터 벡터를 디자인하였다(도 4). 본 발명에서는 가이드(guide) 및 패신저(passenger) 가닥이 리포터 벡터 분석에서 매우 의존적일 것이기 때문에, 각 siRNA 듀플렉스의 정방향(forward, Fwd) 및 역방향(reverse, Rev) 가닥이라는 용어를 사용하였다. A549 세포를 각 siRNA 듀플렉스, 반딧불이 루시퍼라제 구조 그리고 트렌스펙션 대조구로서 레닐라(Renilla) 루시퍼라제와 함께 트렌스펙션하였다. 반딧불이 루시퍼라제 대 레닐라 루시퍼라제의 활성을 트렌스펙션 후 24시간 째에 분석하였다(도 1B).
그 결과, 대칭적인 3'-오버행을 가지는 Fwd(dT):Rev(dT) 및 Fwd(R):Rev(R)와 같은 siRNA 듀플렉스는 타겟에 대한 양 가닥의 RNAi 활성이 비슷하게 나타났다. 가닥과 타겟 조합에 상관없이, 70-78%의 목적 유전자 녹다운이 관찰되었다. 그러나, 비대칭적인 3'-오버행을 가지는 Fwd(dT):Rev(R) 및 Fwd(R):Rev(dT) siRNA 듀플렉스는 두 가지 목적 서열 중 하나에 대한 뚜렷한 선호도가 확인되었다. 도 1B에 보여지는 바와 같이, Fwd(dT):Rev(R) siRNA 듀플렉스는 역방향 목적 서열(pMIR-report-Rev)에 대해 높은 억제율(83% 녹다운)을 보여주었으나, 정방향 목적 서열(pMIR-report-Fwd)에 대해서는 중간 정도의 억제율(64% 녹다운)을 보여주었다. 그에 반해서, Fwd(R):Rev(dT) siRNA 듀플렉스는 목적 서열 침묵에 대해 Fwd(dT):Rev(R) siRNA 듀플렉스와 반대되는 경향을 보여주었다(정방향 및 역방향 목적 서열에 대해서 각각 81% 및 61%의 녹다운을 보여주었다). 추가로, 비대칭적인 오버행을 가지는 siRNA 듀플렉스의 각 가닥에 대한 IC50 분석을 수행하였는데, dTdT 오버행을 가지는 가닥보다 RNA 오버행을 가지는 가닥이 각각 3.8배 및 1.8배 높은 RNAi 활성도를 보여주었다(도 1C 및 1D).
본 발명자들은 다른 오버행 구성이 일반적으로 목적 유전자 침묵에 대해서 가닥 선택도(selectivity)에 영향을 미치는지 확인해보기 위해서 추가적인 siRNA 듀플렉스 세트 및 리포터 벡터를 디자인하였다(도 5). 예상대로, Fwd(dT):Rev(R) 듀플렉스는 정방향 목적 서열(70% 녹다운) 보다 역방향 목적 서열(79% 녹다운)에 대해 상대적으로 높은 RNAi 활성을 보여주었다. 그리고 Fwd(R):Rev(dT) siRNA 듀플렉스는 각 가닥의 RNAi 활성에 있어서 극적인 차이를 보여주었는데, Fwd(R) 가닥은 목적 서열에 대해 83%의 높은 억제율을 보인 반면, Rev(dT)는 단지 22%의 목적 서열 억제율을 보여주었다. 결과적으로, 상기의 결과들은 RNA 오버행을 가지는 가닥이 RNAi 경로 동안에 가이드 가닥으로 우선적으로 처리됨을 의미했다.
실시예 2. 비대칭 RNA/dTdT 오버행 구조를 가지는 siRNA 듀플렉스의 특이도 분석
리포터 실험에서 관찰된 비대칭 오버행 구조를 가지는 siRNA 듀플렉스의 우선적인 침묵을 이끄는 중요한 단계를 생화학적으로 관찰하기 위해서, 가닥 선택에 대한 다른 오버행 구조를 가지는 siRNA 듀플렉스의 개개의 기여도를 평가할 수 있는 최소한의 인 비트로 시스템을 수립하였다. 여덟 개의 각기 다른 작은 RNA 듀플렉스 기질들을 합성하고, 정방향 또는 역방향 가닥에 5'-32P-방사선 표지 된 가닥과 다른 가닥에는 방사선이 표지 되지 않은 5'-포스페이트를 가지는 각 작은 RNA 듀플렉스를 FLAG-태깅된 hAGO2를 발현하는 세포질 추출물과 반응시킨 후, 비즈가 컨쥬게이팅된 항-FLAG 항체를 사용하여 면역침강(immunoprecipitation)시켰다. 면역침강된 단백질들은 페놀 추출을 통해 제거하였고, 수거된 32P-방사선 표지 된 작은 RNA는 개개의 단일 가닥 RNA의 어느 정도가 미성숙 siRNA 듀플렉스로부터 성숙되었는지 확인하기 위해 네이티브 겔 전기영동을 통해서 분석하였다(도 2A). 비대칭 RNA/dTdT 오버행(dT:R 또는 R:dT)을 가지는 siRNA 듀플렉스는 대칭적인 오버행을 가지는 것보다, 2-3배 높은 선택 효율로 RNA 오버행을 가진 가닥이 선택되어졌다. 이상의 결과들을 통해 앞서 수행한 리포터 실험에서와 같이 선호도가 있는 목적 침묵의 결과를 확실하게 설명할 수 있었다.
실시예 3. RNA 오버행을 가지는 가닥의 성숙 RISC 복합체와의 어셈블 및 목적 분해 선택도 분석
면역침강 분석이 Argonaute와 기능적으로 성숙한 RISC 복합체에서 미성숙한 듀플렉스를 구별할 수 없기 때문에, 성숙한 가닥들이 인 비트로에서 성숙한 RISC 복합체 내로 실제로 결합되는지를 더 조사하기 위해서 겔 이동 분석(gel shift assay)을 수행하였다. 각기 다른 siRNA 듀플렉스의 시간 경과에 따른 어셈블리는 RNA 오버행을 가지는 가닥이 dTdT 오버행을 가지는 가닥보다 훨씬 높은 RISC 복합체 수준을 형성함을 보여주었다(도 2C). 비대칭의 RNA/dTdT 오버행을 가지는 siRNA 듀플렉스로부터 유래한 빠르게 이동하는 고-분자량 복합체의 축적은 대칭의 오버행을 가지는 siRNA와 비교하여, 기능적으로 성숙한 RISC 복합체 형성의 높은 수준을 진단하였다(도 2C).
본 발명자들은 이러한 기능적으로 성숙한 RISC 복합체들이 hAGO2-매개 목적 분해 작용의 높은 효율을 유도하는지 확인해보았다. 5'-32P-캡-방사선 표지 된 정방향 또는 역방향 가닥의 하나와 외인적으로 어셈블된 네 가지 다른 siRNA 듀플렉스 변이체들(R:R, dT:R, R:dT 및 dT:dT)을 포함하고 있는 세포질 추출물 내의 목적 mRNA의 배양은 hAGO2-촉매 작용에 의한 분해로 예상되는 위치에 5'-분해 산물들을 생산하였다(도 2D). 이는 다른 3'-오버행 구성이 분해 자리 위치에는 어떠한 영향도 미치지 않음을 제시하며, 이는 비대칭의 RNA/dTdT 오버행을 가지는 siRNA 듀플렉스가 표준이 되는(canonical) RNAi 경로로 들어감을 의미했다. 예상대로, siRNA 듀플렉스(dT:R)는 역방향 가닥 목적(target)에 대해 대응 관계에 있는 siRNA 듀플렉스(R:dT)보다 목적 분해의 상당히 높은 효율을 보여주었고, 정방향 가닥 목적(target)에 대해서는 역 상관관계가 관찰되었다(도 2D).
본 발명자들은 3'-오버행에 특이적인 의존도를 보이는 siRNA 듀플렉스, 그리고 비대칭의 RNA/dTdT 오버행을 가지는 siRNA 듀플렉스가 성숙한 RISC 복합체 내로 능률적으로 어셈블되고, 궁극적으로는 원하는 가닥의 선택적인 목적 침묵을 유도하는 것으로 확인되었다.
실시예 4. 비대칭적인 오버행을 가지는 siRNA 듀플렉스에 의한 내인성의 센스 또는 안티센스 전사체의 선택적인 억제 분석
상기의 실시예 결과들은 비대칭의 오버행을 가지는 siRNA 듀플렉스가 향상된 가닥-침묵 효능을 수여하는 것을 입증하였다. 이와 같은 발견을 자연적 안티센스 전사체(NAT, natural antisense transcript) 쌍 유전자들의 가닥-특이적인 녹다운에 직접적으로 적용하였다. NAT는 반대 DNA 가닥으로부터 다른 전사체(센스 전사체)까지 전사된 내인성인 RNA 분자이고, 센스 전사체와 부분적으로 겹쳐진다. 다른 연구 그룹에 의해 확인된 인간 NATs로부터, RFXANK(regulatory factor X-associated ankyrin-containing protein)와 NR2C2AP(nuclear receptor 2C2-associated protein)의 NAT 쌍을 선택하여 겹쳐지는 서열을 표적하는 상응하는 siRNA 듀플렉스를 디자인하고 실험하였다(도 3A 및 도 4). 예상대로, 비대칭 오버행 듀플렉스의 가닥-특이적 목적 유전자 침묵이 관찰되었다. dTdT 오버행을 가지는 RFXANK 목적 가닥과 RNA 오버행을 가지는 NR2C2AP 목적 가닥으로 구성된 R(dT):N(R) 듀플렉스는 RFXANK와 NR2C2AP에 대해서 각각 34.2%와 76.9%의 녹다운을 보여주었다(도 3B). 대조적으로, R(R):N(dT) 듀플렉스는 목적 유전자 침묵이 RFXANK와 NR2C2AP에 대해서 각각 80.8%와 55.3%의 녹다운으로 반대의 경향을 보여주었다. 추가의 IC50 분석 또한, 비대칭 오버행 듀플렉스 모두에서 RNA 오버행을 가지는 가닥의 높은 유전자 침묵 활성을 확인해주었다(도 3C). 특히, R(dT):N(R) 듀플렉스는 RFXANK와 비교하여 NR2C2AP에 대해 극적인 선호(~100배) 결과를 보여주었고, 이를 통해 비대칭의 RNA/dTdT 오버행을 가지는 siRNA 듀플렉스가 NAT 쌍의 특정한 침묵에 대해서 높은 잠재력을 가지고 있음을 확인할 수 있었다.
Claims (12)
- 목적 유전자(target gene)의 발현 억제 특이성이 증가되고 오프-타겟 효과가 감소된 siRNA 분자로서, 상기 siRNA 분자는 센스 및 안티센스 가닥으로 이루어져 있으며, 상기 두 가닥 중 하나의 가닥은 1 내지 3개의 뉴클레오티드의 DNA로 구성된 3'-오버행을 가지며, 나머지 하나의 가닥은 1 내지 3개의 뉴클레오티드의 RNA로 구성된 3'-오버행을 가지는 것을 특징으로 하는, 3'-오버행이 비대칭적인 구조를 갖는 siRNA 분자.
- 제1항에 있어서, 상기 센스 및 안티센스 가닥은 각각 20 내지 22개의 뉴클레오티드의 길이를 갖는 것을 특징으로 하는 siRNA 분자.
- 제1항에 있어서, 상기 3'-오버행은 2개의 뉴클레오티드의 DNA 또는 RNA로 구성된 것을 특징으로 하는 siRNA 분자.
- (a) siRNA 분자를 형성할 수 있는, 미리 결정된 mRNA 목적(target) 분자에 대해 85 내지 100%의 서열 동일성을 가지는 두 개의 RNA 가닥으로서, 상기 가닥 중 하나의 가닥은 1 내지 3개의 뉴클레오티드의 DNA로 구성된 3'-오버행을 가지며, 나머지 하나의 가닥은 1 내지 3개의 뉴클레오티드의 RNA로 구성된 3'-오버행을 갖는 것을 특징으로 하는 두 개의 RNA 가닥을 합성하는 단계; 및(b) siRNA 분자가 형성되는 조건하에서, 목적(target) 특이적 RNA 간섭을 할 수 있는 상기 (a) 단계의 합성된 RNA 가닥을 서로 조합하는 단계를 포함하는 것을 특징으로 하는, 3'-오버행이 비대칭적인 구조를 갖는 siRNA 분자의 제조 방법.
- 제4항에 있어서, 상기 RNA 가닥은 각각 20 내지 22개의 뉴클레오티드의 길이를 갖는 것을 특징으로 하는 siRNA 분자의 제조 방법.
- 제4항에 있어서, 상기 3'-오버행은 2개의 뉴클레오티드의 DNA 또는 RNA로 구성된 것을 특징으로 하는 siRNA 분자의 제조 방법.
- 제4항에 있어서, 상기 RNA 가닥은 화학적으로 합성되는 것을 특징으로 하는 siRNA 분자의 제조 방법.
- 제4항에 있어서, 상기 siRNA 분자는 목적 유전자의 발현 억제 특이성이 증가되고 오프-타켓 효과가 감소된 것을 특징으로 하는 siRNA 분자의 제조 방법.
- 제1항 내지 제3항 중 어느 한 항의 siRNA 분자를 함유하는 유전자 발현 억제용 조성물.
- 제1항 내지 제3항 중 어느 한 항의 siRNA 분자를 함유하는 유전자 발현 억제용 키트.
- 제1항 내지 제3항 중 어느 한 항의 siRNA 분자를 인체를 제외한 세포 내로 도입시키는 단계를 포함하는 세포 내 목적 유전자의 발현 억제 방법.
- (a) 세포를 목적(target) 특이적 RNA 간섭이 일어날 수 있는 조건하에서 제1항 내지 제3항 중 어느 한 항의 siRNA 분자와 접촉시키는 단계; 및(b) 상기 (a) 단계의 siRNA 분자에 대응되는 서열 부분을 갖는 목적(target) 핵산에 대하여 상기 siRNA에 의하여 초래되는 목적(target) 특이적 RNA 간섭을 매개하는 단계를 포함하는, 세포에서 목적 특이적 RNA 간섭을 매개하는 인 비트로 방법.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| KR1020140086224A KR101670254B1 (ko) | 2014-07-09 | 2014-07-09 | 목적 유전자의 발현 억제 특이성이 증가된 siRNA 분자 |
| KR10-2014-0086224 | 2014-07-09 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2016006846A1 true WO2016006846A1 (ko) | 2016-01-14 |
Family
ID=55064421
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/KR2015/006418 Ceased WO2016006846A1 (ko) | 2014-07-09 | 2015-06-24 | 목적 유전자의 발현 억제 특이성이 증가된 siRNA 분자 |
Country Status (2)
| Country | Link |
|---|---|
| KR (1) | KR101670254B1 (ko) |
| WO (1) | WO2016006846A1 (ko) |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR20110110776A (ko) * | 2008-12-18 | 2011-10-07 | 다이서나 파마수이티컬, 인크. | 유전자 발현의 특이적 억제를 위한 연장된 다이서 기질 제제 및 방법 |
Family Cites Families (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP1633890B2 (en) * | 2003-06-02 | 2020-11-18 | University of Massachusetts | METHODS AND COMPOSITIONS FOR ENHANCING THE EFFICACY AND SPECIFICITY OF FNAi |
| CA2559955C (en) | 2004-03-15 | 2016-02-16 | City Of Hope | Methods and compositions for the specific inhibition of gene expression by double-stranded rna |
| KR100949791B1 (ko) * | 2007-12-18 | 2010-03-30 | 이동기 | 오프-타겟 효과를 최소화하고 RNAi 기구를 포화시키지않는 신규한 siRNA 구조 및 그 용도 |
| CN103555722B (zh) | 2009-04-03 | 2016-08-31 | 戴瑟纳制药公司 | 利用不对称双链rna特异性抑制kras的方法和组合物 |
-
2014
- 2014-07-09 KR KR1020140086224A patent/KR101670254B1/ko not_active Expired - Fee Related
-
2015
- 2015-06-24 WO PCT/KR2015/006418 patent/WO2016006846A1/ko not_active Ceased
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR20110110776A (ko) * | 2008-12-18 | 2011-10-07 | 다이서나 파마수이티컬, 인크. | 유전자 발현의 특이적 억제를 위한 연장된 다이서 기질 제제 및 방법 |
Non-Patent Citations (2)
| Title |
|---|
| JIEHUA ZHOUL ET AL.: "Deep Sequencing Analyses of DsiRNAs Reveal the Influence of 3' Terminal Overhangs on Dicing Polarity, Strand Selectivity, and RNA Editing of siRNAs", MOLECULAR THERAPY-NUCLEIC ACIDS, vol. 1, 2012, pages e17 * |
| PAOLA POSOCCO ET AL.: "Impact of siRNA Overhangs for Dendrimer-Mediated siRNA Delivery and Gene Silencing", MOL. PHARMACEUTICS, vol. 10, 2013, pages 3262 - 3273 * |
Also Published As
| Publication number | Publication date |
|---|---|
| KR101670254B1 (ko) | 2016-10-28 |
| KR20160006522A (ko) | 2016-01-19 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Bramsen et al. | A large-scale chemical modification screen identifies design rules to generate siRNAs with high activity, high stability and low toxicity | |
| CN1318586C (zh) | 短的双链RNAs的体外合成方法 | |
| EP3358014A2 (en) | Method for stabilizing functional nucleic acids | |
| KR20110049733A (ko) | 안티센스 가닥에 의한 오프-타겟 효과를 최소화한 신규한 siRNA 구조 및 그 용도 | |
| Vo et al. | Building of neomycin–nucleobase–amino acid conjugates for the inhibition of oncogenic miRNAs biogenesis | |
| JP2024109655A (ja) | プログラム可能なsiRNA及びその使用 | |
| JP2015211680A (ja) | 遺伝子発現の阻害のためのショートヘアピンrna | |
| US20170137859A1 (en) | Dna templates for small rna production in mammalian cells | |
| WO2005014810A1 (ja) | ダンベル型dnaの効率的な製造方法 | |
| Durso et al. | Chemical modifications in the seed region of miRNAs 221/222 increase the silencing performances in gastrointestinal stromal tumor cells | |
| JP2025023131A (ja) | 治療的使用のための、ヒト遺伝子JAK1又はJAK3の発現を標的とするSiRNA配列 | |
| Gamper et al. | Synthesis of long RNA with a site-specific modification by enzymatic splint ligation | |
| EP2240582B1 (en) | Positive controls for expression modulating experiments | |
| Luo et al. | Synthesis of oligonucleotides with glucosamine at the 3′-position and evaluation of their biological activity | |
| Hefner et al. | Increased potency and longevity of gene silencing using validated Dicer substrates | |
| US11767529B2 (en) | Short hairpin RNA compositions, methods of making and applications thereof | |
| KR20120029002A (ko) | 신규한 형태의 간섭 rna 분자 | |
| WO2016006846A1 (ko) | 목적 유전자의 발현 억제 특이성이 증가된 siRNA 분자 | |
| US11242553B2 (en) | MiRNA targets | |
| Chen et al. | Using a lentivirus-based inducible RNAi vector to silence a gene | |
| CN120464698B (zh) | 一种具有基因敲低功能的环状shRNA的合成方法及应用 | |
| Stoltz | Interactions of the alternative splicing factor RBFOX with non-coding RNAs | |
| Masuda et al. | Synthesis, gene-silencing activity and nuclease resistance of 3′–3′-linked double short hairpin RNA | |
| Ai | Characterization of CRISPR/CAS13 Systems and Analysis of TIMP2 Alternative Polyadenylation in Ras Signaling | |
| Berk | Alternative scaffolds for systemic delivery of small interfering RNAs |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 15818869 Country of ref document: EP Kind code of ref document: A1 |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 15818869 Country of ref document: EP Kind code of ref document: A1 |