WO2015182942A1 - Novel lipase signal sequence and method for lipase expression using same - Google Patents

Novel lipase signal sequence and method for lipase expression using same Download PDF

Info

Publication number
WO2015182942A1
WO2015182942A1 PCT/KR2015/005224 KR2015005224W WO2015182942A1 WO 2015182942 A1 WO2015182942 A1 WO 2015182942A1 KR 2015005224 W KR2015005224 W KR 2015005224W WO 2015182942 A1 WO2015182942 A1 WO 2015182942A1
Authority
WO
WIPO (PCT)
Prior art keywords
seq
lipase
signal sequence
protein
interest
Prior art date
Application number
PCT/KR2015/005224
Other languages
French (fr)
Korean (ko)
Other versions
WO2015182942A9 (en
Inventor
반재구
김의중
이동범
김은영
Original Assignee
주식회사 제노포커스
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 주식회사 제노포커스 filed Critical 주식회사 제노포커스
Publication of WO2015182942A1 publication Critical patent/WO2015182942A1/en
Publication of WO2015182942A9 publication Critical patent/WO2015182942A9/en

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/14—Fungi; Culture media therefor
    • C12N1/145—Fungal isolates
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P21/00—Preparation of peptides or proteins
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
    • C12R2001/00—Microorganisms ; Processes using microorganisms
    • C12R2001/645—Fungi ; Processes using fungi
    • C12R2001/66—Aspergillus
    • C12R2001/685—Aspergillus niger
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y10—TECHNICAL SUBJECTS COVERED BY FORMER USPC
    • Y10S—TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y10S435/00—Chemistry: molecular biology and microbiology
    • Y10S435/8215—Microorganisms
    • Y10S435/911—Microorganisms using fungi
    • Y10S435/913—Aspergillus
    • Y10S435/917—Aspergillus niger

Definitions

  • the present invention relates to a novel signal sequence for mass expression of lipase, and its use, and more particularly to a novel lipase signal sequence;
  • An expression vector comprising the signal sequence and a lipase gene;
  • it relates to a method for producing a large amount of lipase by culturing the recombinant microorganism.
  • the secretory signal sequence currently used to secrete the target protein in Aspergillus-Niger has been the self-signal sequence of the gene to be expressed and the Aspergillus-Niger glucoamylase signal sequence, and the strong promoter is glucoamylase ( glaA) promoter is used.
  • Aspergillus Niger can produce glucoamylase in high yields of 30 g / L or more through industrial process development.
  • the present inventors have tried to develop a method for mass production of lipase using genetic engineering method to overcome the limitation of the expression, and discover a new signal sequence for lipase expression, when using the signal sequence
  • the present invention was completed by confirming that lipase is expressed in large quantities.
  • An object of the present invention is a novel lipase signal sequence for expressing a large amount of lipase;
  • An expression vector comprising the signal sequence and a lipase gene; And to provide a recombinant microorganism into which the expression vector is introduced.
  • Another object of the present invention to provide a method for mass production of lipase by culturing the recombinant microorganism.
  • the present invention An03g06560 (SEQ ID NO: 1), An14g00860 (SEQ ID NO: 2), An07g00440 (SEQ ID NO: 3), An02g09690 (SEQ ID NO: 4), An16g08870 (SEQ ID NO: 5), An06g00350 (SEQ ID NO: 6 ), An16g01880 (SEQ ID NO: 7), An12g06560 (SEQ ID NO: 8), An09g02270 (SEQ ID NO: 9), An15g02210 (SEQ ID NO: 10), An13g02820 (SEQ ID NO: 11), and Anllg00100 (SEQ ID NO: 12) Lipase signal sequence; And An03g06560 (SEQ ID NO: 13), An14g00860 (SEQ ID NO: 14), An07g00440 (SEQ ID NO: 15), An02g09690 (SEQ ID NO: 16), An16g08870 (SEQ ID NO: 17), An06
  • the present invention also provides an expression vector comprising a nucleic acid encoding the signal sequence and a gene of the protein of interest, and a recombinant microorganism into which the expression vector is introduced.
  • the present invention also comprises the steps of (a) culturing the recombinant microorganism to produce the protein of interest; And (b) provides a method for producing a protein of interest comprising the step of recovering the produced protein of interest.
  • FIG. 1 is a schematic diagram of the expression vector of the present invention, using the glaA promoter and the pdcA terminator, and after the lipase signal sequence, the TLL gene can be cloned into Nae I / Not I.
  • FIG. 2 is an image showing the pASP504 vector of Example 1, wherein the pASP504 vector includes a glaA promoter and a pdcA terminator, includes a hygromycin resistance gene and a hygromycin B phosphotransferase, and each lipase signal It is a vector that can clone a sequence.
  • Example 3 is an image showing the pASP600s vector of Example 1, which is representative of the vectors cloned from each lipase signal sequence.
  • lipase signal sequence capable of expressing a large amount of a specific lipase and other target proteins
  • An expression vector comprising the signal sequence and a gene of the protein of interest; And a recombinant microorganism into which the expression vector is introduced.
  • a novel lipase signal sequence of the present invention when using a novel lipase signal sequence of the present invention using a lipase (TLL) gene derived from Thermomyces lanuginosus as a nucleic acid encoding a protein of interest, a large amount of lipase is produced. It was confirmed. However, this is only one example, and it will be apparent to those skilled in the art that the present invention can be applied not only to a specific lipase but also to other proteins of interest.
  • TLL lipase
  • An03g06560 (SEQ ID NO: 1), An14g00860 (SEQ ID NO: 2), An07g00440 (SEQ ID NO: 3), An02g09690 (SEQ ID NO: 4), An16g08870 (SEQ ID NO: 5), An06g00350 (SEQ ID NO: 6)
  • Lipase selected from the group consisting of, An16g01880 (SEQ ID NO: 7), An12g06560 (SEQ ID NO: 8), An09g02270 (SEQ ID NO: 9), An15g02210 (SEQ ID NO: 10), An13g02820 (SEQ ID NO: 11), and Anllg00100 (SEQ ID NO: 12) It is about signal sequence.
  • the signal sequence may be derived from Aspergillus niger , but is not limited thereto.
  • an03g06560 (SEQ ID NO: 13), An14g00860 (SEQ ID NO: 14), An07g00440 (SEQ ID NO: 15), An02g09690 (SEQ ID NO: 16), An16g08870 (SEQ ID NO: 17), An06g00350 (SEQ ID NO: 18), An16g01880 (SEQ ID NO: 19), An12g06560 (SEQ ID NO: 20), An09g02270 (SEQ ID NO: 21), An15g02210 (SEQ ID NO: 22), An13g02820 (SEQ ID NO: 23), and Anllg00100 (SEQ ID NO: 24), the lipase It relates to a nucleic acid encoding a signal sequence.
  • the present invention relates to an expression vector comprising a nucleic acid encoding the lipase signal sequence and a gene of the protein of interest.
  • vector means a DNA preparation containing a DNA sequence operably linked to a suitable regulatory sequence capable of expressing DNA in a suitable host.
  • Vectors can be plasmids, phage particles or simply potential genomic inserts. Once transformed into the appropriate host, the vector can replicate and function independently of the host genome, or in some cases can be integrated into the genome itself. Since plasmids are currently the most commonly used form of vectors, “plasmid” and “vector” are sometimes used interchangeably in the context of the present invention.
  • plasmid vectors For the purposes of the present invention, it is preferred to use plasmid vectors.
  • Typical plasmid vectors that can be used for this purpose include (a) a replication initiation point that allows for efficient replication to include hundreds of plasmid vectors per host cell, and (b) host cells transformed with the plasmid vector. It has a structure comprising an antibiotic resistance gene and a restriction enzyme cleavage site (c) allows foreign DNA fragments to be inserted. Although no suitable restriction enzyme cleavage site is present, the use of synthetic oligonucleotide adapters or linkers according to conventional methods can facilitate ligation of the vector and foreign DNA.
  • genes are "operably linked” when placed in a functional relationship with other nucleic acid sequences.
  • This may be genes and regulatory sequence (s) linked in such a way as to enable gene expression when appropriate molecules (eg, transcriptional activating proteins) are bound to regulatory sequence (s).
  • DNA for a pre-sequence or secretory leader is operably linked to DNA for a polypeptide when expressed as a shear protein that participates in the secretion of the polypeptide;
  • a promoter or enhancer is operably linked to a coding sequence when it affects the transcription of the sequence;
  • the ribosomal binding site is operably linked to a coding sequence when it affects the transcription of the sequence;
  • the ribosomal binding site is operably linked to a coding sequence when positioned to facilitate translation.
  • operably linked means that the linked DNA sequences are in contact, and in the case of a secretory leader, are in contact and present within the reading frame. However, enhancers do not need to touch. Linking of these sequences is performed by ligation (linking) at convenient restriction enzyme sites. If such sites do not exist, synthetic oligonucleotide adapters or linkers according to conventional methods are used.
  • the target protein may be characterized in that the lipase, the lipase may be characterized in that the lipase derived from Thermomyces lanuginosus (TLL), but is not limited thereto.
  • TLL Thermomyces lanuginosus
  • the expression vector may be characterized in that it further comprises a glucoamylase promoter
  • the glucoamylase promoter may be characterized in that the Aspergillus Niger glucoamylase (glaA) promoter, but is not limited thereto. It doesn't happen.
  • the expression vector is pASP601TLL, pASP602TLL, pASP603TLL, pASP604TLL, pASP605TLL, pASP606TLL, pASP607TLL, pASP608TLL, pASP609TLL, pASP610TLL, pASP611TLL, and pASP611TLL, pASP611TLL, but may be selected from the group consisting of limited to, no.
  • the present invention provides a recombinant microorganism into which a nucleic acid encoding the lipase signal sequence and a gene of a protein of interest are introduced; Or it relates to a recombinant microorganism into which the expression vector is introduced.
  • the recombinant microorganism may be characterized in that the Aspergillus niger ( Aspergillus niger ), but is not limited thereto.
  • microorganism As the recombinant microorganism, host cells having high DNA introduction efficiency and high expression efficiency of introduced DNA are commonly used. As all microorganisms including prokaryotic and eukaryotic cells, bacteria, yeasts, molds, and the like are available, and the present invention. Aspergillus Niger was used in the embodiment of the present invention, but not limited thereto, and any kind of microorganism may be used as long as the lipase can be sufficiently expressed.
  • vectors function equally to express the DNA sequences of the present invention
  • hosts function equally for the same expression system.
  • one of ordinary skill in the art may, without departing from the scope of the present invention without undue experimental burden, select appropriately among other vectors, expression control sequences and hosts.
  • the host in selecting a vector, the host must be considered, since the vector must be replicated therein, and the number of copies of the vector, the ability to control the number of copies, and other proteins encoded by the vector, e.g. For example, the expression of antibiotic markers should also be considered.
  • the transformed recombinant microorganism may be prepared according to any transformation method.
  • transformation refers to a phenomenon in which DNA is introduced into a host so that DNA can be reproduced as a factor of a chromosome or by completion of chromosome integration, thereby causing an artificial genetic change by introducing external DNA into a cell. Means.
  • a commonly known gene manipulation method may be used as a method of inserting the gene on the chromosome of the host cell.
  • a commonly known gene manipulation method may be used.
  • a retroviral vector an adenovirus vector, an adeno-associated virus vector, and herpes simplex.
  • a method of directly inserting on a chromosome of a host cell in addition to the method using an expression vector, a method of directly inserting on a chromosome of a host cell may be used.
  • nucleic acid conjugates nucleic acid conjugates, naked DNA, artificial virons, chemically promoted DNA influx, calcium phosphate (CaPO 4 ) Precipitation, calcium chloride (CaCl 2 ) precipitation, microinjection, lithium acetate-DMSO method and the like can be used.
  • Sonoporation for example methods using the Sonitron 2000 system (Rich-Mar), can also be used for the delivery of nucleic acids.
  • Other representative nucleic acid delivery systems are Amaxa Biosystems (Cologne, Germany), Maxcyte, Inc. (Rockville, Maryland). And BTX Molesular Syetem (Holliston, Mass.).
  • Lipofection methods are specified in US Pat. No. 5,049,386, US Pat. No. 4,946,787 and US Pat. No. 4,897,355 and lipofection reagents are commercially available, for example TRANSFECTAM TM and LIPOFECTIN TM.
  • Suitable cations or neutral lipids for effective receptor-recognition lipofection of polynucleotides include lipids from Felgner (WO91 / 17424 and WO91 / 16024) and can be delivered to cells via in vitro introduction and to target tissues via in vivo introduction. have.
  • nucleic acid complexes including target liposomes such as immunolipid complexes
  • Methods of preparing lipid: nucleic acid complexes, including target liposomes such as immunolipid complexes are well known in the art (Crystal, Science., 270: 404-410, 1995; Blaese et al., Cancer Gene Ther., 2: 291 -297, 1995; Behr et al., Bioconjugate Chem., 5: 382389, 1994; Remy et al., Bioconjugate Chem ., 5: 647-654, 1994; Gao et al., Gene Therapy.
  • the present invention comprises the steps of (a) culturing the recombinant microorganism to produce the protein of interest; And (b) relates to a method for producing a protein of interest comprising the step of separating the produced protein of interest.
  • a signal sequence of SEQ ID NOs. 13 to 24 (Table 2), encoding the amino acid sequence of SEQ ID NOs. 1 to 12 (Table 1), was chemically synthesized.
  • Single-chain oligonucleotides were chemically synthesized to have restriction sites of restriction enzymes ClaI and NaeI at both ends of the signal sequence, and double-chain oligonucleotides from the single-chain oligonucleotides.
  • annealing annealing
  • the recovered fragments were cut and cloned into pASP503 vector with restriction enzymes Cla I and Nae I and designated as pASP601, pASP602, pASP603, pASP604, pASP60pASP605, pASP606, pASP607, pASP608, pASP609, pASP610, pASP611, and pASP612, respectively.
  • the pASP504 vector contains a glaA promoter and a pdcA terminating factor and includes a hygromycin resistance gene, hygromycin B phosphotransferase (FIGS. 1 and 2). Hydromycin B is inserted into peptidyl-tRNA in ribosomes to interfere with the translation of peptidyl-tRNA. Hygromycin B phosphotransferase enzyme inactivates hygromycin B and thus can select for recombinant microorganisms.
  • TLL encodes 291 amino acids and includes a signal sequence of 17 amino acids and a free sequence of 5 amino acids.
  • the mature TLL consists of 269 amino acids and has a molecular weight of 29.3 kD.
  • TLL DNA without a signal sequence has a primer of SEQ ID NO: 25 (TLLF: atgaggagctcccttgtgctg) having no restriction enzyme recognition site at the 5 'end of the sequence and a sequence number having a single restriction enzyme NotI recognition site at the 3' end of the sequence.
  • Twenty-six primers (TLLNotR: gcggccgcctaaagacatgtcccaattaac) were chemically synthesized, and polymerase chain reaction (PCR) was performed using the two primers to obtain 2145 bp fragments.
  • the obtained fragments were cloned by cutting the pASP600s vector into NaeI and NotI, and pASP601TLL, pASP602TLL, pASP603TLL, pASP604TLL, pASP605TLL, pASP606TLL, pASP607TLL, pASP608TLL, pASP609TLL, pASP612, pASP612.
  • Example 2 The expression vector of Example 2 was transformed by introduction into Aspergillus niger (Tilburn et al., Gene. , 26: 205-221, 1983). For transformation, the liquid cultured mycelium was treated with cell wall lyase to make a protoplast, and pASP600s DNA was inserted into the genome. In addition, for selection of recombinant microorganisms, it was selected and passaged in agar medium to which hygromashin was added.
  • recombinant microorganisms resistant to hygromycin B are inoculated on the same agar medium and subjected to primary passage. After 4 days, evenly disperse the recombinant microorganism spores in agar complete medium, and incubate for 5-6 days at 30 ° C. until the spores are evenly formed.
  • Aspirate spores were harvested at 1 ⁇ 10 6 cells / ml with 0.1% Tween 80 from the culture dish incubated for 5 days, and the dilutions were inoculated into 1 ml liquid medium. Incubate at 28 °C, 200rpm, 4 days in a shaker. The culture medium was centrifuged at 10,000 g for 10 minutes to remove the cells and confirmed the activity in the recovered culture supernatant. Aspergillus niger microorganism flask culture of each recombinant vector was carried out 20 each.
  • 1 U is the amount of enzyme that releases 1 mole of butyric acid per minute.
  • the solution was prepared at pH 10 by adding 13.5 ml of Tributyrin, 2% calcium chloride, and 1.0 ml of 1M sodium chloride (NaCl) to a 1% dry acacia solution. 21 ml of the solution and 1 ml of the fermentation broth were added to the pH STAT and reacted at 30 ° C. for 15 minutes. Titration curves are prepared per minute for the consumption ml of 0.05 M NaOH solution added during the reaction.
  • the molecular weight of TLL was 29.3 kD but was glycosylated to determine the actual size of 31 kD.
  • the recombinant gene is secreted to the outside of Aspergillus Niger by the Aspergillus Niger lipase signal sequences of the present invention.
  • an expression vector comprising the novel signal sequence according to the present invention, it is possible to induce mass expression and secretion of a specific lipase as well as other target proteins, which is very useful for stable mass production of specific lipases and other target proteins.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • General Health & Medical Sciences (AREA)
  • Molecular Biology (AREA)
  • Medicinal Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Virology (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Mycology (AREA)
  • Botany (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Enzymes And Modification Thereof (AREA)

Abstract

The present invention relates to a novel signal sequence for mass-expression of lipase and a use thereof and, more specifically, to a novel lipase signal sequence; an expression vector comprising the signal sequence and a lipase gene; a recombinant microorganism into which the expression vector is introduced; and a method for mass-producing lipase by culturing the recombinant microorganism. The use of the expression vector comprising the novel signal sequence, according to the present invention, can induce mass expression and secretion of particular lipase and other target proteins, and thus the expression vector is very useful in the stable mass production of the particular lipase and other target proteins.

Description

신규 리파제 신호서열 및 이를 이용한 리파제 발현방법Novel lipase signal sequence and lipase expression method using the same
본 발명은 리파제를 대량 발현시키기 위한 신규 신호서열, 및 그 용도에 관한 것으로, 보다 구체적으로는 신규 리파제 신호서열; 상기 신호서열 및 리파제 유전자를 포함하는 발현벡터; 상기 발현벡터가 도입되어 있는 재조합미생물; 및 상기 재조합미생물을 배양하여 리파제를 대량으로 생산하는 방법에 관한 것이다.The present invention relates to a novel signal sequence for mass expression of lipase, and its use, and more particularly to a novel lipase signal sequence; An expression vector comprising the signal sequence and a lipase gene; A recombinant microorganism into which the expression vector is introduced; And it relates to a method for producing a large amount of lipase by culturing the recombinant microorganism.
산업용으로 사용되는 여러 종류의 단백질은 안정성이 널리 알려져 있는 사카로마이세스(Saccharomyces), 아스퍼질러스 나이거, 아스퍼질러스 오리제(Aspergillus orryzae), 트리코더마 리제이(Trichoderma reesei)를 사용하여 생산하여 왔고 목적 단백질을 발현 및 분비시키기 위하여 전사 촉진서열인 프로모터(promoter), 분비 신호 서열을 코딩하는 DNA, 목적 단백질의 구조 유전자 및 전사 종결자(transcription terminator)로 구성된 발현 분비 플라스미드 벡터를 사용하여왔다.Several proteins for industrial use have been produced using Saccharomyces , Aspergillus niger , Aspergillus orryzae and Trichoderma reesei , which are known for their stability. In order to express and secrete a target protein, an expression secretion plasmid vector composed of a promoter, a transcriptional promoter, DNA encoding a secretory signal sequence, a structural gene of the target protein, and a transcription terminator have been used.
아스퍼질러스 나이거에서 목적 단백질을 분비시키기 위해 현재 사용되고 있는 분비 신호 서열로는 발현하고자하는 유전자의 자체 신호서열과 아스퍼질러스 나이거 글루코아밀라제 신호서열이 사용되어 왔고, 강력한 프로모터로는 글루코아밀라제 (glaA)프로모터가 사용되고 있다. The secretory signal sequence currently used to secrete the target protein in Aspergillus-Niger has been the self-signal sequence of the gene to be expressed and the Aspergillus-Niger glucoamylase signal sequence, and the strong promoter is glucoamylase ( glaA) promoter is used.
그러나 지금까지 알려진 신호 서열만으로는 원하는 단백질을 대량 발현 할 수 없는 실정이다. However, only the signal sequence known to date is unable to express a large amount of the desired protein.
아스퍼질러스 나이거는 글루코아밀라제의 경우 산업적 공정 개발을 통해 30 g/L 이상의 고수율로 생산이 가능하다. 또한 아스퍼질러스 나이거에서 유래된 상업적으로 판매 되는 리파제들이 많으며, 이는 전통적인 돌연변이 유발법과 유도 물질로 리파제를 유도하여 아스퍼질러스 나이거에서 리파제를 효율적으로 생산할 수 있게 한다. 따라서, 아스퍼질러스 나이거 유전체상에서 세포 밖으로의 리파제 단백질의 분비촉진을 할 수 있는 방법이 요구되고 있는 실정이다. 즉, 상업적으로 중요한 효소인 단백질을 보다 효율적으로 대량 생산할 수 있는 신호서열 탐색이 중요하며, 재조합 미생물 재조합미생물의 개발이 요구되고 있는 실정이다. Aspergillus Niger can produce glucoamylase in high yields of 30 g / L or more through industrial process development. There are also a number of commercially available lipases derived from Aspergillus Niger, which allow efficient production of lipase in Aspergillus Niger by inducing lipases with traditional mutagenesis and inducers. Therefore, there is a need for a method capable of promoting the secretion of lipase proteins out of cells on the Aspergillus Niger genome. In other words, it is important to search for a signal sequence capable of mass-producing a commercially important protein more efficiently and to develop a recombinant microorganism.
이에, 본 발명자들은 상기 발현의 한계를 극복하기 위하여 유전공학적 방법을 이용하여 리파제를 대량생산하는 방법을 개발하고자 노력한 결과, 리파제를 발현하기 위한 신규한 신호서열을 발굴하고, 상기 신호서열을 이용할 경우 리파제가 대량으로 발현되는 것을 확인함으로써 본 발명을 완성하게 되었다.Therefore, the present inventors have tried to develop a method for mass production of lipase using genetic engineering method to overcome the limitation of the expression, and discover a new signal sequence for lipase expression, when using the signal sequence The present invention was completed by confirming that lipase is expressed in large quantities.
발명의 요약Summary of the Invention
본 발명의 목적은 리파제를 대량으로 발현시키기 위한 신규 리파제 신호서열; 상기 신호서열 및 리파제 유전자를 포함하는 발현벡터; 및 상기 발현벡터가 도입되어 있는 재조합미생물을 제공하는데 있다.An object of the present invention is a novel lipase signal sequence for expressing a large amount of lipase; An expression vector comprising the signal sequence and a lipase gene; And to provide a recombinant microorganism into which the expression vector is introduced.
본 발명의 다른 목적은 상기 재조합미생물을 배양하여 리파제를 대량 생산하는 방법을 제공하는데 있다.Another object of the present invention to provide a method for mass production of lipase by culturing the recombinant microorganism.
상기 목적을 달성하기 위하여, 본 발명은 An03g06560(서열번호 1), An14g00860(서열번호 2), An07g00440(서열번호 3), An02g09690(서열번호 4), An16g08870(서열번호 5), An06g00350(서열번호 6), An16g01880(서열번호 7), An12g06560(서열번호 8), An09g02270(서열번호 9), An15g02210(서열번호 10), An13g02820(서열번호 11), 및 Anllg00100(서열번호 12)로 구성된 군에서 선택되는리파제 신호서열; 및 An03g06560(서열번호 13), An14g00860(서열번호 14), An07g00440(서열번호 15), An02g09690(서열번호 16), An16g08870(서열번호 17), An06g00350(서열번호 18), An16g01880(서열번호 19), An12g06560(서열번호 20), An09g02270(서열번호 21), An15g02210(서열번호 22), An13g02820(서열번호 23), 및 Anllg00100(서열번호 24)로 구성된 군에서 선택되는, 상기 리파제 신호서열을 코딩하는 핵산을 제공한다.In order to achieve the above object, the present invention An03g06560 (SEQ ID NO: 1), An14g00860 (SEQ ID NO: 2), An07g00440 (SEQ ID NO: 3), An02g09690 (SEQ ID NO: 4), An16g08870 (SEQ ID NO: 5), An06g00350 (SEQ ID NO: 6 ), An16g01880 (SEQ ID NO: 7), An12g06560 (SEQ ID NO: 8), An09g02270 (SEQ ID NO: 9), An15g02210 (SEQ ID NO: 10), An13g02820 (SEQ ID NO: 11), and Anllg00100 (SEQ ID NO: 12) Lipase signal sequence; And An03g06560 (SEQ ID NO: 13), An14g00860 (SEQ ID NO: 14), An07g00440 (SEQ ID NO: 15), An02g09690 (SEQ ID NO: 16), An16g08870 (SEQ ID NO: 17), An06g00350 (SEQ ID NO: 18), An16g01880 (SEQ ID NO: 19), A nucleic acid encoding the lipase signal sequence selected from the group consisting of An12g06560 (SEQ ID NO: 20), An09g02270 (SEQ ID NO: 21), An15g02210 (SEQ ID NO: 22), An13g02820 (SEQ ID NO: 23), and Anllg00100 (SEQ ID NO: 24) To provide.
본 발명은 또한, 상기 신호서열을 코딩하는 핵산과 목적단백질의 유전자를 포함하는 발현벡터, 및 상기 발현벡터가 도입되어 있는 재조합미생물을 제공한다.The present invention also provides an expression vector comprising a nucleic acid encoding the signal sequence and a gene of the protein of interest, and a recombinant microorganism into which the expression vector is introduced.
본 발명은 또한, (a) 상기 재조합미생물을 배양하여 목적단백질을 생성하는 단계; 및 (b) 상기 생성된 목적단백질을 회수하는 단계를 포함하는 것을 특징으로 하는 목적단백질의 생산방법을 제공한다.The present invention also comprises the steps of (a) culturing the recombinant microorganism to produce the protein of interest; And (b) provides a method for producing a protein of interest comprising the step of recovering the produced protein of interest.
도 1은 본 발명의 발현벡터의 모식도로써, glaA 프로모터와 pdcA 종결인자를 사용하고, 리파제 신호서열 다음에, TLL 유전자를, Nae I/ Not I에 클로닝할 수 있음을 나타낸다.1 is a schematic diagram of the expression vector of the present invention, using the glaA promoter and the pdcA terminator, and after the lipase signal sequence, the TLL gene can be cloned into Nae I / Not I.
도 2는 실시예 1의 pASP504 벡터를 나타낸 이미지로, pASP504 벡터는 glaA 프로모터와 pdcA 종결인자를 포함하고, 하이그로마이신 내성 유전자와 하이그로마이신 B 포스포트랜스퍼라제를 포함하고 있으며, 각각의 리파제 신호서열을 클로닝 할 수 있는 벡터이다.FIG. 2 is an image showing the pASP504 vector of Example 1, wherein the pASP504 vector includes a glaA promoter and a pdcA terminator, includes a hygromycin resistance gene and a hygromycin B phosphotransferase, and each lipase signal It is a vector that can clone a sequence.
도 3은 실시예 1의 pASP600s 벡터를 나타낸 이미지로, 각각의 리파제 신호서열을 클로닝한 벡터 중 대표적인 것이다.3 is an image showing the pASP600s vector of Example 1, which is representative of the vectors cloned from each lipase signal sequence.
발명의 상세한 설명 및 바람직한 구현예Detailed Description of the Invention and Preferred Embodiments
다른 식으로 정의되지 않는 한, 본 명세서에서 사용된 모든 기술적 및 과학적 용어들은 본 발명이 속하는 기술 분야에서 숙련된 전문가에 의해서 통상적으로 이해되는 것과 동일한 의미를 가진다. 일반적으로, 본 명세서에서 사용된 명명법은 본 기술 분야에서 잘 알려져 있고 통상적으로 사용되는 것이다.Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. In general, the nomenclature used herein is well known and commonly used in the art.
본 발명에서는, 특정 리파제 및 다른 목적단백질을 다량 발현시킬 수 있는 리파제 신호서열; 상기 신호서열과 목적단백질의 유전자를 포함하는 발현벡터; 및 상기 발현벡터가 도입되어 있는 재조합미생물을 제조하였다. 그 결과, 제조된 재조합미생물을 배양시켜 리파제를 다량으로 생산할 수 있음을 확인하였다. In the present invention, lipase signal sequence capable of expressing a large amount of a specific lipase and other target proteins; An expression vector comprising the signal sequence and a gene of the protein of interest; And a recombinant microorganism into which the expression vector is introduced. As a result, it was confirmed that a large amount of lipase can be produced by culturing the prepared recombinant microorganism.
본 발명의 일 실시예에서는, 목적단백질을 코딩하는 핵산으로 썸모마이세스 렌기노수스(Thermomyces lanuginosus) 유래 리파제 (TLL) 유전자를 이용하여, 본 발명의 신규 리파제 신호서열을 이용하는 경우 리파제가 다량으로 생산됨을 확인하였다. 그러나, 이는 하나의 예시에 불과한바, 특정 리파제 뿐만 아니라 다른 목적단백질에도 본 발명을 적용할 수 있음은 당업자에게 있어서 자명한 것이다.In one embodiment of the present invention, when using a novel lipase signal sequence of the present invention using a lipase (TLL) gene derived from Thermomyces lanuginosus as a nucleic acid encoding a protein of interest, a large amount of lipase is produced. It was confirmed. However, this is only one example, and it will be apparent to those skilled in the art that the present invention can be applied not only to a specific lipase but also to other proteins of interest.
따라서, 본 발명은 일 관점에서, An03g06560(서열번호 1), An14g00860(서열번호 2), An07g00440(서열번호 3), An02g09690(서열번호 4), An16g08870(서열번호 5), An06g00350(서열번호 6), An16g01880(서열번호 7), An12g06560(서열번호 8), An09g02270(서열번호 9), An15g02210(서열번호 10), An13g02820(서열번호 11), 및 Anllg00100(서열번호 12)로 구성된 군에서 선택되는 리파제 신호서열에 관한 것이다.Therefore, in one aspect of the present invention, An03g06560 (SEQ ID NO: 1), An14g00860 (SEQ ID NO: 2), An07g00440 (SEQ ID NO: 3), An02g09690 (SEQ ID NO: 4), An16g08870 (SEQ ID NO: 5), An06g00350 (SEQ ID NO: 6) Lipase selected from the group consisting of, An16g01880 (SEQ ID NO: 7), An12g06560 (SEQ ID NO: 8), An09g02270 (SEQ ID NO: 9), An15g02210 (SEQ ID NO: 10), An13g02820 (SEQ ID NO: 11), and Anllg00100 (SEQ ID NO: 12) It is about signal sequence.
본 발명에 있어서,상기 신호서열은 아스퍼질러스 나이거(Aspergillus niger) 유래인 것을 특징으로할 수 있으나, 이에 한정되는 것은 아니다.In the present invention, the signal sequence may be derived from Aspergillus niger , but is not limited thereto.
본 발명은 다른 관점에서, An03g06560(서열번호 13), An14g00860(서열번호 14), An07g00440(서열번호 15), An02g09690(서열번호 16), An16g08870(서열번호 17), An06g00350(서열번호 18), An16g01880(서열번호 19), An12g06560(서열번호 20), An09g02270(서열번호 21), An15g02210(서열번호 22), An13g02820(서열번호 23), 및 Anllg00100(서열번호 24)로 구성된 군에서 선택되는, 상기 리파제 신호서열을 코딩하는 핵산에 관한 것이다.In another aspect of the present invention, An03g06560 (SEQ ID NO: 13), An14g00860 (SEQ ID NO: 14), An07g00440 (SEQ ID NO: 15), An02g09690 (SEQ ID NO: 16), An16g08870 (SEQ ID NO: 17), An06g00350 (SEQ ID NO: 18), An16g01880 (SEQ ID NO: 19), An12g06560 (SEQ ID NO: 20), An09g02270 (SEQ ID NO: 21), An15g02210 (SEQ ID NO: 22), An13g02820 (SEQ ID NO: 23), and Anllg00100 (SEQ ID NO: 24), the lipase It relates to a nucleic acid encoding a signal sequence.
본 발명은 또 다른 관점에서, 상기 리파제 신호서열을 코딩하는 핵산 및 목적단백질의 유전자를 포함하는 발현벡터에 관한 것이다.In another aspect, the present invention relates to an expression vector comprising a nucleic acid encoding the lipase signal sequence and a gene of the protein of interest.
본 발명에서, "벡터 (vector)"는 적합한 숙주 내에서 DNA를 발현 시킬 수 있는 적합한 조절 서열에 작동가능하게 연결된 DNA 서열을 함유하는 DNA 제조물을 의미한다. 벡터는 플라스미드, 파지 입자 또는 간단하게 잠재적 게놈 삽입물 일 수 있다. 적당한 숙주로 형질전환되면, 벡터는 숙주게놈과 무관하게 복제하고 기능할 수 있거나, 또는 일부경우에 게놈 그 자체에 통합될 수 있다. 플라스미드가 현재 벡터의 가장 통상적으로 사용되는 형태이므로, 본 발명의 명세서에서 "플라스미드(plasmid)" 및 "벡터(vector)"는 때로 상호교환적으로 사용된다.In the present invention, "vector" means a DNA preparation containing a DNA sequence operably linked to a suitable regulatory sequence capable of expressing DNA in a suitable host. Vectors can be plasmids, phage particles or simply potential genomic inserts. Once transformed into the appropriate host, the vector can replicate and function independently of the host genome, or in some cases can be integrated into the genome itself. Since plasmids are currently the most commonly used form of vectors, "plasmid" and "vector" are sometimes used interchangeably in the context of the present invention.
본 발명의 목적상, 플라스미드 벡터를 이용하는 것이 바람직하다. 이러한 목적에 사용될 수 있는 전형적인 플라스미드 벡터는 (a) 숙주세포당 수백개의 플라스미드벡터를 포함하도록 복제가 효율적으로 이루어지도록하는 복제 개시점, (b) 플라스미드 벡터로 형질전환된 숙주세포가 선발될 수 있도록 하는 항생제 내성 유전자 및 (c) 외래 DNA 절편이 삽입될 수 있도록 하는 제한효소 절단부위를 포함하는 구조를 지니고 있다. 적절한 제한효소 절단부위가 존재하지 않을지라도, 통상의 방법에 따른 합성 올리고뉴클레오타이드어댑터(oligonucleotide adaptor) 또는 링커(linker)를 사용하면 벡터와 외래 DNA를 용이하게 라이게이션(ligation) 할 수 있다.For the purposes of the present invention, it is preferred to use plasmid vectors. Typical plasmid vectors that can be used for this purpose include (a) a replication initiation point that allows for efficient replication to include hundreds of plasmid vectors per host cell, and (b) host cells transformed with the plasmid vector. It has a structure comprising an antibiotic resistance gene and a restriction enzyme cleavage site (c) allows foreign DNA fragments to be inserted. Although no suitable restriction enzyme cleavage site is present, the use of synthetic oligonucleotide adapters or linkers according to conventional methods can facilitate ligation of the vector and foreign DNA.
아울러, 상기 유전자는 다른 핵산 서열과 기능적 관계로 배치될 때 "작동가능하게 연결(operably linked)"된다. 이것은 적절한 분자(예를 들면, 전사 활성화 단백질)가 조절 서열(들)에 결합될 때 유전자 발현을 가능하게 하는 방식으로 연결된 유전자 및 조절 서열(들) 일 수 있다. 예를 들면, 전서열(pre-sequence) 또는 분비리더(leader)에 대한 DNA는 폴리펩타이드의 분비에 참여하는 전단백질로서 발현되는 경우 폴리펩타이드에 대한 DNA에 작동가능하게 연결되고; 프로모터 또는 인핸서는 서열의 전사에 영향을 끼치는 경우 코딩서열에 작동가능하게 연결되거나; 또는 리보좀 결합 부위는 서열의 전사에 영향을 끼치는 경우 코딩 서열에 작동가능하게 연결되거나; 또는 리보좀 결합 부위는 번역을 용이하게 하도록 배치되는 경우 코딩 서열에 작동가능하게 연결된다.In addition, the genes are "operably linked" when placed in a functional relationship with other nucleic acid sequences. This may be genes and regulatory sequence (s) linked in such a way as to enable gene expression when appropriate molecules (eg, transcriptional activating proteins) are bound to regulatory sequence (s). For example, DNA for a pre-sequence or secretory leader is operably linked to DNA for a polypeptide when expressed as a shear protein that participates in the secretion of the polypeptide; A promoter or enhancer is operably linked to a coding sequence when it affects the transcription of the sequence; Or the ribosomal binding site is operably linked to a coding sequence when it affects the transcription of the sequence; Or the ribosomal binding site is operably linked to a coding sequence when positioned to facilitate translation.
일반적으로 "작동가능하게 연결된"은 연결된 DNA 서열이 접촉하고, 또한 분비 리더의 경우 접촉하고 리딩 프레임 내에 존재하는 것을 의미한다. 그러나, 인핸서(enhancer)는 접촉할 필요가 없다. 이들 서열의 연결은 편리한 제한 효소 부위에서 라이게이션 (연결)에 의해 수행된다. 그러한 부위가 존재하지 않는 경우, 통상의 방법에 따른 합성 올리고뉴클레오티드 어댑터(oligonucleotide adaptor) 또는 링커(linker)를 사용한다.In general, "operably linked" means that the linked DNA sequences are in contact, and in the case of a secretory leader, are in contact and present within the reading frame. However, enhancers do not need to touch. Linking of these sequences is performed by ligation (linking) at convenient restriction enzyme sites. If such sites do not exist, synthetic oligonucleotide adapters or linkers according to conventional methods are used.
본 발명에 있어서, 상기 목적단백질은 리파제인 것을 특징으로 할 수 있으며, 상기 리파제는 썸모마이세스 렌기노수스(Thermomyces lanuginosus) 유래 리파제 (TLL)인 것을 특징으로 할 수 있으나, 이에 한정되는 것은 아니다.In the present invention, the target protein may be characterized in that the lipase, the lipase may be characterized in that the lipase derived from Thermomyces lanuginosus (TLL), but is not limited thereto.
본 발명에 있어서, 상기 발현벡터는 글루코아밀라아제 프로모터를 추가로 포함하는 것을 특징으로 할 수 있고, 상기 글루코아밀라아제 프로모터는 아스퍼질러스 나이거 글루코아밀라아제(glaA) 프로모터인 것을 특징으로 할 수 있으나, 이에 한정되는 것은 아니다.In the present invention, the expression vector may be characterized in that it further comprises a glucoamylase promoter, the glucoamylase promoter may be characterized in that the Aspergillus Niger glucoamylase (glaA) promoter, but is not limited thereto. It doesn't happen.
본 발명에 있어서, 상기 발현벡터는 pASP601TLL, pASP602TLL, pASP603TLL, pASP604TLL, pASP605TLL, pASP606TLL, pASP607TLL, pASP608TLL, pASP609TLL, pASP610TLL, pASP611TLL, 및 pASP612TLL로 구성된 군에서 선택되는 것을 특징으로 할 수 있으나, 이에 한정되는 것은 아니다.In the present invention, the expression vector is pASP601TLL, pASP602TLL, pASP603TLL, pASP604TLL, pASP605TLL, pASP606TLL, pASP607TLL, pASP608TLL, pASP609TLL, pASP610TLL, pASP611TLL, and pASP611TLL, pASP611TLL, but may be selected from the group consisting of limited to, no.
본 발명은 다른 관점에서, 상기 리파제 신호서열을 코딩하는 핵산과 목적단백질의 유전자가 도입되어 있는 재조합 미생물; 또는 상기 발현벡터가 도입되어 있는 재조합미생물에 관한 것이다.In another aspect, the present invention provides a recombinant microorganism into which a nucleic acid encoding the lipase signal sequence and a gene of a protein of interest are introduced; Or it relates to a recombinant microorganism into which the expression vector is introduced.
본 발명에 있어서, 상기 재조합미생물은 아스퍼질러스 나이거(Aspergillus niger)인 것을 특징으로 할 수 있으나, 이에 한정되는 것은 아니다.In the present invention, the recombinant microorganism may be characterized in that the Aspergillus niger ( Aspergillus niger ), but is not limited thereto.
상기 재조합미생물은 DNA의 도입효율이 높고, 도입된 DNA의 발현 효율이 높은 숙주세포가 통상 사용되며, 원핵 및 진핵 세포를 포함하는 모든 미생물로서, 박테리아, 효모, 곰팡이 등이 이용가능하고, 본 발명의 실시예에서는 아스퍼질러스 나이거를 사용하였으나, 이에 한정되지 않고, 상기 리파제가 충분히 발현될 수 있는 것이라면 어떠한 종류의 미생물이라도 무방하다.As the recombinant microorganism, host cells having high DNA introduction efficiency and high expression efficiency of introduced DNA are commonly used. As all microorganisms including prokaryotic and eukaryotic cells, bacteria, yeasts, molds, and the like are available, and the present invention. Aspergillus Niger was used in the embodiment of the present invention, but not limited thereto, and any kind of microorganism may be used as long as the lipase can be sufficiently expressed.
물론 모든 벡터가 본 발명의 DNA 서열을 발현하는데 모두 동등하게 기능을 발휘하지는 않고, 마찬가지로 모든 숙주가 동일한 발현 시스템에 대해 동일하게 기능을 발휘하지는 않는다. 그러나, 당업자라면 과도한 실험적 부담없이 본 발명의 범위를 벗어나지 않는 상태에서, 다른 여러 벡터, 발현 조절 서열 및 숙주 중에서 적절한 선택하여 적용할 수 있다. 예를 들어, 벡터를 선택함에 있어서는 숙주를 고려하여야 하는데, 이는 벡터가 그 안에 서 복제되어야만 하기 때문이고, 벡터의 복제 수, 복제 수를 조절할 수 있는 능력 및 당해 벡터에 의해 코딩되는 다른 단백질, 예를 들어 항생제 마커의 발현도 또한 고려되어야만 한다.Of course, not all vectors function equally to express the DNA sequences of the present invention, and likewise not all hosts function equally for the same expression system. However, one of ordinary skill in the art may, without departing from the scope of the present invention without undue experimental burden, select appropriately among other vectors, expression control sequences and hosts. For example, in selecting a vector, the host must be considered, since the vector must be replicated therein, and the number of copies of the vector, the ability to control the number of copies, and other proteins encoded by the vector, e.g. For example, the expression of antibiotic markers should also be considered.
상기 형질전환된 재조합 미생물은 임의의 형질전환 방법에 따라 제조할 수 있다. 본 발명의 "형질전환(transformation)"은 DNA를 숙주로 도입하여 DNA가 염색체의 인자로서 또는 염색체 통합완성에 의해 복제 가능하게 되는 것으로 외부의 DNA를 세포 내로 도입하여 인위적으로 유전적인 변화를 일으키는 현상을 의미한다. The transformed recombinant microorganism may be prepared according to any transformation method. In the present invention, "transformation" refers to a phenomenon in which DNA is introduced into a host so that DNA can be reproduced as a factor of a chromosome or by completion of chromosome integration, thereby causing an artificial genetic change by introducing external DNA into a cell. Means.
또한, 본 발명에서 상기 유전자를 숙주세포의 염색체상에 삽입하는 방법으로는 통상적으로 알려진 유전자조작방법을 사용할 수 있으며, 일 예로는 레트로바이러스 벡터, 아데노바이러스 벡터, 아데노-연관 바이러스 벡터, 헤르페스 심플렉스 바이러스 벡터, 폭스바이러스 벡터, 렌티바이러스 벡터 또는 비바이러스성 벡터를 이용하는 방법을 들 수 있다.In addition, in the present invention, as a method of inserting the gene on the chromosome of the host cell, a commonly known gene manipulation method may be used. For example, a retroviral vector, an adenovirus vector, an adeno-associated virus vector, and herpes simplex. And viral viral vectors, poxvirus vectors, lentiviral vectors or non-viral vectors.
또한, 형질전환방법에는 발현벡터를 이용한 방법 외에도, 숙주세포의 염색체상에 직접 삽입하는 방법도 이용될 수 있다.In addition, in the transformation method, in addition to the method using an expression vector, a method of directly inserting on a chromosome of a host cell may be used.
일반적으로 전기천공법(electroporation), 리포펙션, 탄도법, 비로솜, 리포솜, 면역리포솜, 다가양이온 또는 지질:핵산 접합체, 네이키드 DNA, 인공 바이론, 화학물질 촉진 DNA 유입, 인산칼슘(CaPO4) 침전, 염화칼슘(CaCl2)침전, 미세주입법(microinjection), 초산 리튬-DMSO법 등이 이용될 수 있다.Typically electroporation, lipofection, ballistic methods, virosomes, liposomes, immunoliposomes, polycations or lipids: nucleic acid conjugates, naked DNA, artificial virons, chemically promoted DNA influx, calcium phosphate (CaPO 4 ) Precipitation, calcium chloride (CaCl 2 ) precipitation, microinjection, lithium acetate-DMSO method and the like can be used.
소소노포레이션, 예를 들어 Sonitron 2000 시스템(Rich-Mar)을 이용한 방법도 핵산의 전달에 사용할 수 있으며, 다른 대표적인 핵산 전달 시스템은 Amaxa Biosystems(Cologne, Germany), Maxcyte, Inc.(Rockville, Maryland) 및 BTX Molesular Syetem(Holliston, MA)의 방법을 포함한다. 리포펙션 방법은 미국특허 제5,049,386호, 미국특허 제4,946,787호 및 미국특허 제4,897,355호에 명시되어 있으며 리포펙션 시약은 상업적으로 시판되고 있으며, 예를 들어, TRANSFECTAM™ 및 LIPOFECTIN™ 이 있다. 폴리뉴클레오티드의 효과적인 리셉터-인식 리포펙션에 적당한 양이온 또는 중성 지질은 Felgner의 지질을 포함하며 (WO91/17424 및 WO91/16024), 생체 외 도입을 통해 세포로, 생체 내 도입을 통해 표적 조직으로 전달할 수 있다. 면역지질 복합체 등 표적 리포솜을 포함하는 지질:핵산 복합체의 제조 방법은 당해 업계에 잘 알려져 있다 (Crystal, Science., 270:404-410, 1995; Blaese et al., Cancer Gene Ther., 2:291-297, 1995; Behr et al., Bioconjugate Chem., 5:382389, 1994; Remy et al., Bioconjugate Chem., 5:647-654, 1994; Gao et al., Gene Therapy., 2:710-722, 1995; Ahmad et al., Cancer Res., 52:4817-4820, 1992; 미국특허 제4,186,183호; 미국특허 제4,217,344호; 미국특허 제4,235,871호; 미국특허 제4,261,975호; 미국특허 제4,485,054호; 미국특허 제4,501,728호; 미국특허 제4,774,085호; 미국특허 제4,837,028호; 미국특허 제4,946,787호).Sonoporation, for example methods using the Sonitron 2000 system (Rich-Mar), can also be used for the delivery of nucleic acids. Other representative nucleic acid delivery systems are Amaxa Biosystems (Cologne, Germany), Maxcyte, Inc. (Rockville, Maryland). And BTX Molesular Syetem (Holliston, Mass.). Lipofection methods are specified in US Pat. No. 5,049,386, US Pat. No. 4,946,787 and US Pat. No. 4,897,355 and lipofection reagents are commercially available, for example TRANSFECTAM ™ and LIPOFECTIN ™. Suitable cations or neutral lipids for effective receptor-recognition lipofection of polynucleotides include lipids from Felgner (WO91 / 17424 and WO91 / 16024) and can be delivered to cells via in vitro introduction and to target tissues via in vivo introduction. have. Methods of preparing lipid: nucleic acid complexes, including target liposomes such as immunolipid complexes, are well known in the art (Crystal, Science., 270: 404-410, 1995; Blaese et al., Cancer Gene Ther., 2: 291 -297, 1995; Behr et al., Bioconjugate Chem., 5: 382389, 1994; Remy et al., Bioconjugate Chem ., 5: 647-654, 1994; Gao et al., Gene Therapy. , 2: 710- 722, 1995; Ahmad et al., Cancer Res ., 52: 4817-4820, 1992; US Patent 4,186,183; US Patent 4,217,344; US Patent 4,235,871; US Patent 4,261,975; US Patent 4,485,054 US Patent 4,501,728 US Patent 4,774,085 US Patent 4,837,028 US Patent 4,946,787.
본 발명은 다른 관점에서, (a) 상기 재조합미생물을 배양하여 목적단백질을 생성하는 단계; 및 (b) 상기 생성된 목적단백질을 분리하는 단계를 포함하는 것을 특징으로 하는 목적단백질의 생산방법에 관한 것이다.In another aspect, the present invention comprises the steps of (a) culturing the recombinant microorganism to produce the protein of interest; And (b) relates to a method for producing a protein of interest comprising the step of separating the produced protein of interest.
실시예Example
이하, 실시예를 통하여 본 발명을 더욱 상세히 설명하고자 한다. 이들 실시예는 오로지 본 발명을 예시하기 위한 것으로, 본 발명의 범위가 이들 실시예에 의해 제한되는 것으로 해석되지 않는 것은 당업계에서 통상의 지식을 가진 자에게 있어서 자명할 것이다. 따라서 본 발명의 실질적인 범위는 첨부된 청구항들과 그것들의 등가물에 의하여 정의된다고 할 것이다.Hereinafter, the present invention will be described in more detail with reference to Examples. These examples are only for illustrating the present invention, and it will be apparent to those skilled in the art that the scope of the present invention is not to be construed as being limited by these examples. Thus, the substantial scope of the present invention will be defined by the appended claims and their equivalents.
실시예 1 발현벡터 pASP600s의 제조Example 1 Preparation of Expression Vector pASP600s
TLL를 아스퍼질러스 나이거 외부로 분비하기 위하여 하기 서열번호 1 내지 12의 아미노산 서열(표 1)을 코딩하는, 서열번호 13 내지 24의 신호서열(표 2)을 화학합성하였다. 신호서열 염기서열의 양 말단에 제한효소 ClaI과 NaeI의 인식부위를 갖도록 각각 단일 사슬의 올리고뉴클리오티드(oligonucleotide)들을 화학합성하였고, 상기 단일사슬의 올리고뉴클리오티드로부터 이중사슬의 올리고뉴클리오티드를 제조하기 위하여 어닐링(annealing) 반응을 실시하였다. 각각 신호서열 DNA 절편을 회수하였다. In order to secrete TLL outside Aspergillus nager, a signal sequence of SEQ ID NOs. 13 to 24 (Table 2), encoding the amino acid sequence of SEQ ID NOs. 1 to 12 (Table 1), was chemically synthesized. Single-chain oligonucleotides were chemically synthesized to have restriction sites of restriction enzymes ClaI and NaeI at both ends of the signal sequence, and double-chain oligonucleotides from the single-chain oligonucleotides. In order to prepare an annealing (annealing) reaction was carried out. Each of the signal sequence DNA fragments was recovered.
회수된 절편을 pASP503 벡터에 제한효소 Cla I와 Nae I으로 커팅하고 클로닝하여 각각 순서 번호로 pASP601, pASP602, pASP603, pASP604, pASP60pASP605, pASP606, pASP607, pASP608, pASP609, pASP610, pASP611, pASP612라 명하였다.The recovered fragments were cut and cloned into pASP503 vector with restriction enzymes Cla I and Nae I and designated as pASP601, pASP602, pASP603, pASP604, pASP60pASP605, pASP606, pASP607, pASP608, pASP609, pASP610, pASP611, and pASP612, respectively.
pASP504 벡터는 glaA 프로모터와 pdcA 종결 인자를 포함하고 있으며, 하이그로마이신 내성 유전자, 하이그로마이신 B 포스포트랜스퍼라제를 포함한다(도 1 및 도 2). 하이드로마이신 B는 리보좀내의 펩티딜-tRNA에 삽입되어 펩티딜-tRNA의 번역(translation)을 방해한다. 하이그로마이신 B 포스포트랜스퍼라제 효소는 하이그로마이신 B를 불활성화시키므로 재조합미생물을 선별할 수 있다.The pASP504 vector contains a glaA promoter and a pdcA terminating factor and includes a hygromycin resistance gene, hygromycin B phosphotransferase (FIGS. 1 and 2). Hydromycin B is inserted into peptidyl-tRNA in ribosomes to interfere with the translation of peptidyl-tRNA. Hygromycin B phosphotransferase enzyme inactivates hygromycin B and thus can select for recombinant microorganisms.
표 1 리파제 신호서열
Gene ID 효소 신호서열(SS) 아미노산(AA) SS No. N-region H-region C-region
An03g06560 triacylglycerol lipase maimkallwlslslavwa(서열번호 1) 562 18 1-5 6-15 15-18
An14g00860 triacylglycerol lipase masallwlsllggstla(서열번호 2) 582 17 1 2-12 13-17
An07g00440 triacylglycerol lipase myipsvlllaaslfhgata(서열번호 3) 418 19 1-2 3-14 15-19
An02g09690 triacylglycerol lipase mlklavalfsllavgna(서열번호 4) 561 17 1-3 4-12 13-17
An16g08870 triacylglycerol lipase miffhlapffflfglvvs(서열번호 5) 538 19 1-5 6-14 15-19
An06g00350 triacylglycerol lipase mvalltsfawagltalalg(서열번호 6) 529 19 1-2 3-14 15-19
An16g01880 triacylglycerol lipase mfsgrfgvlltalaalsaa(서열번호 7) 298 19 1-5 6-14 15-19
An12g06560 triacylglycerol lipase mfvsslallaliaplia(서열번호 8) 580 17 1 2-12 13-17
An09g02270 triacylglycerol lipase mlnarsialaslpvllllfaqqlas(서열번호 9) 592 25 1-7 8-19 20-25
An15g02210 triacylglycerol lipase mkgmlptlswlalgmaslatc(서열번호 10) 564 21 1-4 5-13 14-21
An13g02820 triacylglycerol lipase mrlsslalassailpalg(서열번호 11) 277 18 1-2 3-14 15-18
An11g00100 triacylglycerol lipase mgvmrktadqalgltatalalvsaaqa(서열번호 12) 581 27 1-10 11-22 23-27
Table 1 Lipase Signal Sequence
Gene ID enzyme Signal Sequence (SS) Amino acid (AA) SS No. N-region H-region C-region
An03g06560 triacylglycerol lipase maimkallwlslslavwa (SEQ ID NO: 1) 562 18 1-5 6-15 15-18
An14g00860 triacylglycerol lipase masallwlsllggstla (SEQ ID NO: 2) 582 17 One 2-12 13-17
An07g00440 triacylglycerol lipase myipsvlllaaslfhgata (SEQ ID NO: 3) 418 19 1-2 3-14 15-19
An02g09690 triacylglycerol lipase mlklavalfsllavgna (SEQ ID NO: 4) 561 17 1-3 4-12 13-17
An16g08870 triacylglycerol lipase miffhlapffflfglvvs (SEQ ID NO: 5) 538 19 1-5 6-14 15-19
An06g00350 triacylglycerol lipase mvalltsfawagltalalg (SEQ ID NO: 6) 529 19 1-2 3-14 15-19
An16g01880 triacylglycerol lipase mfsgrfgvlltalaalsaa (SEQ ID NO: 7) 298 19 1-5 6-14 15-19
An12g06560 triacylglycerol lipase mfvsslallaliaplia (SEQ ID NO: 8) 580 17 One 2-12 13-17
An09g02270 triacylglycerol lipase mlnarsialaslpvllllfaqqlas (SEQ ID NO: 9) 592 25 1-7 8-19 20-25
An15g02210 triacylglycerol lipase mkgmlptlswlalgmaslatc (SEQ ID NO: 10) 564 21 1-4 5-13 14-21
An13g02820 triacylglycerol lipase mrlsslalassailpalg (SEQ ID NO: 11) 277 18 1-2 3-14 15-18
An11g00100 triacylglycerol lipase mgvmrktadqalgltatalalvsaaqa (SEQ ID NO: 12) 581 27 1-10 11-22 23-27
표 2 리파제 신호서열 염기서열
Gene ID 신호서열(SS) 염기서열
An03g06560 atgtggaacgccgcggtattctgcaggatgaactcatatgtcccgttgcggaaa (서열번호 13)
An14g00860 atggcgagcgcactcctctggctctccctgctgggtggcagcaccctagcc (서열번호 14)
An07g00440 atgtatatcccctcggtgctgcttctggccgcgagcctgttccatggcgcaacg (서열번호 15)
An02g09690 atgctaaagctcgctgttgctcttttttcgttacttgccgtgggcaatgca (서열번호 16)
An16g08870 atgattttctttcatctggcaccgttcttctttctctttggtctagtagtatcttcta (서열번호 17)
An06g00350 atggtggccttgctcacttcatttgcctgggcagggcttactgct (서열번호 18)
An16g01880 atgttctctggacggtttggagtgcttttgacggcgctcgctgcgctgagtgctgcg (서열번호 19)
An12g06560 atgtttgtttcctcgcttgctctattagcacttattgctcctttgatcgca (서열번호 20)
An09g02270 atgctgaatgcacgctccattgctctggcctcgttgccagttcttctcctactattcgcccagcaacttgcctct (서열번호 21)
An15g02210 atgaagggaatgctcccgacgcttagttggttggcactgggcatggccagcctggcaacctgc (서열번호 22)
An13g02820 tcacctgccgggagatcccagcgagcagacgaactcacgcttcggcgtagagtc (서열번호 23)
An11g00100 atgggcgtgatgcgcaagactgctgaccaggccttgggcctgaccgccaccgccctggctctggtcagtg ccgcccaggcc (서열번호 24)
TABLE 2 Lipase Signal Sequence
Gene ID Signal Sequence (SS) Sequence
An03g06560 atgtggaacgccgcggtattctgcaggatgaactcatatgtcccgttgcggaaa (SEQ ID NO: 13)
An14g00860 atggcgagcgcactcctctggctctccctgctgggtggcagcaccctagcc (SEQ ID NO: 14)
An07g00440 atgtatatcccctcggtgctgcttctggccgcgagcctgttccatggcgcaacg (SEQ ID NO: 15)
An02g09690 atgctaaagctcgctgttgctcttttttcgttacttgccgtgggcaatgca (SEQ ID NO: 16)
An16g08870 atgattttctttcatctggcaccgttcttctttctctttggtctagtagtatcttcta (SEQ ID NO: 17)
An06g00350 atggtggccttgctcacttcatttgcctgggcagggcttactgct (SEQ ID NO: 18)
An16g01880 atgttctctggacggtttggagtgcttttgacggcgctcgctgcgctgagtgctgcg (SEQ ID NO: 19)
An12g06560 atgtttgtttcctcgcttgctctattagcacttattgctcctttgatcgca (SEQ ID NO: 20)
An09g02270 atgctgaatgcacgctccattgctctggcctcgttgccagttcttctcctactattcgcccagcaacttgcctct (SEQ ID NO: 21)
An15g02210 atgaagggaatgctcccgacgcttagttggttggcactgggcatggccagcctggcaacctgc (SEQ ID NO: 22)
An13g02820 tcacctgccgggagatcccagcgagcagacgaactcacgcttcggcgtagagtc (SEQ ID NO: 23)
An11g00100 atgggcgtgatgcgcaagactgctgaccaggccttgggcctgaccgccaccgccctggctctggtcagtg ccgcccaggcc (SEQ ID NO: 24)
실시예 2 TLL 발현벡터의 제조Example 2 Preparation of TLL Expression Vectors
TLL은 291개의 아미노산을 암호화하고 있으며, 17개의 아미노산으로 이루어진 신호서열과 5개의 아미노산으로 이루어진 프리서열을 포함한다. 성숙한 TLL은 269개의 아미노산으로 이루어져 있으며, 분자량은 29.3kD이다. TLL encodes 291 amino acids and includes a signal sequence of 17 amino acids and a free sequence of 5 amino acids. The mature TLL consists of 269 amino acids and has a molecular weight of 29.3 kD.
신호서열을 포함하지 않은 TLL DNA는 서열의 5' 말단에 제한효소 인식부위를 갖지 않는 서열번호 25의 프라이머(TLLF: atgaggagctcccttgtgctg)와 서열의 3' 말단에 단일한 제한효소 NotI 인식부위를 갖는 서열번호 26의 프라이머(TLLNotR: gcggccgcctaaagacatgtcccaattaac)를 화학합성하였으며, 두 프라이머를 이용하여 중합효소 연쇄반응(PCR)을 실시하여 2145 bp 절편을 확보하였다. 확보된 절편은 pASP600s벡터를 NaeI과 NotI으로 절단하여 클로닝하였으며, 각각 순서 번호로 pASP601TLL, pASP602TLL, pASP603TLL, pASP604TLL, pASP605TLL, pASP606TLL, pASP607TLL, pASP608TLL, pASP609TLL, pASP610TLL, pASP611TLL, pASP612TLL이라고 명명하였다.TLL DNA without a signal sequence has a primer of SEQ ID NO: 25 (TLLF: atgaggagctcccttgtgctg) having no restriction enzyme recognition site at the 5 'end of the sequence and a sequence number having a single restriction enzyme NotI recognition site at the 3' end of the sequence. Twenty-six primers (TLLNotR: gcggccgcctaaagacatgtcccaattaac) were chemically synthesized, and polymerase chain reaction (PCR) was performed using the two primers to obtain 2145 bp fragments. The obtained fragments were cloned by cutting the pASP600s vector into NaeI and NotI, and pASP601TLL, pASP602TLL, pASP603TLL, pASP604TLL, pASP605TLL, pASP606TLL, pASP607TLL, pASP608TLL, pASP609TLL, pASP612, pASP612.
실시예 3 발현벡터를 도입한 재조합미생물의 제조 및 재조합미생물의 선별방법Example 3 Preparation of Recombinant Microorganisms and Expression of Recombinant Microorganisms Incorporating Expression Vectors
실시예 2의 발현벡터를 아스퍼질러스 나이거에 도입하여 형질전환하였다(Tilburn et al., Gene., 26:205-221, 1983). 형질전환을 위하여, 액상 배양한 균사체에 세포벽 분해 효소를 처리하여 프로토플라스트를 만든 후 pASP600s DNA를 유전체에 삽입하였다. 또한, 재조합미생물 선별을 위하여, 하이그로마시신이 첨가된 아가 배지에서 선별하여 계대배양하였다.The expression vector of Example 2 was transformed by introduction into Aspergillus niger (Tilburn et al., Gene. , 26: 205-221, 1983). For transformation, the liquid cultured mycelium was treated with cell wall lyase to make a protoplast, and pASP600s DNA was inserted into the genome. In addition, for selection of recombinant microorganisms, it was selected and passaged in agar medium to which hygromashin was added.
실시예 4 재조합미생물의 플라스크 배양Example 4 Flask Culture of Recombinant Microorganisms
실시예 3의 재조합미생물 중에서 하이그로마이신 B에 내성을 가지는 재조합미생물들을 동일한 아가배지에 점 접종하여 1차 계대를 한다. 4일 후 아가완전 배지에 재조합미생물 포자를 골고루 분산시킨 후 30℃에서 포자가 골고루 형성될때까지 5-6일간 배양한다. Among the recombinant microorganisms of Example 3, recombinant microorganisms resistant to hygromycin B are inoculated on the same agar medium and subjected to primary passage. After 4 days, evenly disperse the recombinant microorganism spores in agar complete medium, and incubate for 5-6 days at 30 ° C. until the spores are evenly formed.
5일간 배양한 배양접시로부터 0.1% Tween 80으로 무성포자를 1×106 cells/ml로 수확하여 이 희석액을 1ml 액상 완전배지에 접종한다. 진탕배양기에서 28℃, 200rpm, 4일 동안 배양한다. 배양액을 10,000 g에서 10분간 원심분리하여 균체를 제거하고 회수한 배양상등액에서 활성을 확인하였다. 각각의 재조합벡터의 아스퍼질러스 나이거재조합미생물 플라스크 배양은 각각 20개씩 수행하였다. Aspirate spores were harvested at 1 × 10 6 cells / ml with 0.1% Tween 80 from the culture dish incubated for 5 days, and the dilutions were inoculated into 1 ml liquid medium. Incubate at 28 ℃, 200rpm, 4 days in a shaker. The culture medium was centrifuged at 10,000 g for 10 minutes to remove the cells and confirmed the activity in the recovered culture supernatant. Aspergillus niger microorganism flask culture of each recombinant vector was carried out 20 each.
실시예 5 TLL 효소의 활성 측정Example 5 Determination of Activity of TLL Enzymes
1U는 분당 1 mole의 butyric acid 유리시키는 효소의 양이다. 1% 건 아카시아 용액에 트리부틸린(Tributyrin) 13.5ml, 2% 칼슘클로라이드(calcium chloride), 1M 소듐크로라이드(NaCl) 1.0ml을 첨가하여 pH10으로 용액을 만든다. pH 스텟(STAT)에 상기용액에 21ml과 발효액 1ml를 첨가하여 30℃에서 15분간 반응시킨다. 반응 과정에서 투입된 0.05M NaOH 용액의 소비 ml에 대한 분당 적정 곡선을 작성한다. 1 U is the amount of enzyme that releases 1 mole of butyric acid per minute. The solution was prepared at pH 10 by adding 13.5 ml of Tributyrin, 2% calcium chloride, and 1.0 ml of 1M sodium chloride (NaCl) to a 1% dry acacia solution. 21 ml of the solution and 1 ml of the fermentation broth were added to the pH STAT and reacted at 30 ° C. for 15 minutes. Titration curves are prepared per minute for the consumption ml of 0.05 M NaOH solution added during the reaction.
U/ml=(Slope determined by titration in ml/min*DF＊0.05/WU / ml = (Slope determined by titration in ml / min * DF * 0.05 / W
DF: 희석 배수, 0.05-NaOH 용액의 규정농도(M)DF: dilution drainage, defined concentration of 0.05-NaOH solution (M)
W: 시료용액 1ml에 함유된 시료의 양(g)W: amount of sample contained in 1 ml of sample solution (g)
TLL 자체서열보다 An03g06560, An13g02820, An14g00860, An07g00440, An02g09690, An06g00350 An16g01880, An12g06560, An15g02210 리파제 신호서열에서 최대 7배 높은 활성을 나타내었다(표 3). It showed up to 7 times higher activity in the An03g06560, An13g02820, An14g00860, An07g00440, An02g09690, An06g00350 An16g01880, An12g06560, An15g02210 lipase signal sequences than the TLL self-sequence (Table 3).
표 3 발현벡터의 활성확인
발현벡터 신호서열(SS) 활성 U/ml
pASP43TLL TLL SS 850
pASP601TLL An03g06560 2.130
pASP602TLL An14g00860 5.029
pASP603TLL An07g00440 6.012
pASP604TLL An02g09690 1.020
pASP605TLL An16g08870 310
pASP606TLL An06g00350 5.050
pASP607TLL An16g01880 1.009
pASP608TLL An12g06560 3.251
pASP609TLL An09g02270 10
pASP610TLL An15g02210 2.669
pASP611TLL An13g02820 532
pASP612TLL An11g00100 9
숙주세포 ― 11
TABLE 3 Confirmation of activity of expression vector
Expression vector Signal Sequence (SS) Active U / ml
pASP43TLL TLL SS 850
pASP601TLL An03g06560 2.130
pASP602TLL An14g00860 5.029
pASP603TLL An07g00440 6.012
pASP604TLL An02g09690 1.020
pASP605TLL An16g08870 310
pASP606TLL An06g00350 5.050
pASP607TLL An16g01880 1.009
pASP608TLL An12g06560 3.251
pASP609TLL An09g02270 10
pASP610TLL An15g02210 2.669
pASP611TLL An13g02820 532
pASP612TLL An11g00100 9
Host cell ― 11
SDS PAGE 분석 결과 TLL 분자량은 29.3 kD 크기이나 글라이코실레이션(Glycosylation) 되어 실제 크기는 31 kD임을 확인하였다. 이로써 본 발명의 아스퍼질러스 나이거 리파제 신호서열들에 의해 재조합 유전자가 아스퍼질러스 나이거 외부로 분비됨을 확인할 수 있었다.As a result of SDS PAGE analysis, the molecular weight of TLL was 29.3 kD but was glycosylated to determine the actual size of 31 kD. As a result, it was confirmed that the recombinant gene is secreted to the outside of Aspergillus Niger by the Aspergillus Niger lipase signal sequences of the present invention.
이상으로 본 발명 내용의 특정한 부분을 상세히 기술하였는바, 당업계의 통상의 지식을 가진 자에게 있어서 이러한 구체적 기술은 단지 바람직한 실시태양일 뿐이며, 이에 의해 본 발명의 범위가 제한되는 것이 아닌 점은 명백할 것이다. 따라서, 본 발명의 실질적인 범위는 첨부된 청구항들과 그것들의 등가물에 의하여 정의된다고 할 것이다.The specific parts of the present invention have been described in detail above, and it is apparent to those skilled in the art that such specific descriptions are merely preferred embodiments, and thus the scope of the present invention is not limited thereto. something to do. Thus, the substantial scope of the present invention will be defined by the appended claims and their equivalents.
본 발명에 따른 신규 신호서열을 포함하는 발현벡터를 이용하면 특정 리파제뿐만 아니라 다른 목적단백질의 대량 발현 및 분비를 유도할 수 있어, 특정 리파제 및 다른 목적단백질의 안정적인 대량 생산에 있어 매우 유용하다.By using an expression vector comprising the novel signal sequence according to the present invention, it is possible to induce mass expression and secretion of a specific lipase as well as other target proteins, which is very useful for stable mass production of specific lipases and other target proteins.
전자파일 첨부하였음.Electronic file attached.

Claims (14)

  1. 서열번호 1, 서열번호 2, 서열번호 3, 서열번호 4, 서열번호 5, 서열번호 6, 서열번호 7, 서열번호 8, 서열번호 9, 서열번호 10, 서열번호 11, 및 서열번호 12로 구성된 군에서 선택되는 리파제 신호서열.Consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, and SEQ ID NO: 12 Lipase signal sequence selected from the group.
  2. 제1항에 있어서, 아스퍼질러스 나이거(Aspergillus niger) 유래인 것을 특징으로 하는 리파제 신호서열.The lipase signal sequence of claim 1, wherein the lipase signal is derived from Aspergillus niger .
  3. 서열번호 13, 서열번호 14, 서열번호 15, 서열번호 16, 서열번호 17, 서열번호 18, 서열번호 19, 서열번호 20, 서열번호 21, 서열번호 22, 서열번호 23, 및 서열번호 24로 구성된 군에서 선택되는, 제1항의 리파제 신호서열을 코딩하는 핵산.Consisting of SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, and SEQ ID NO: 24 A nucleic acid encoding the lipase signal sequence of claim 1 selected from the group.
  4. 제1항의 리파제 신호서열을 코딩하는 핵산 및 목적단백질의 유전자를 포함하는 발현벡터.An expression vector comprising a nucleic acid encoding the lipase signal sequence of claim 1 and a gene of the protein of interest.
  5. 제4항에 있어서, 상기 목적단백질은 리파제인 것을 특징으로 하는 발현벡터.The expression vector according to claim 4, wherein the protein of interest is a lipase.
  6. 제5항에 있어서, 상기 리파제는 썸모마이세스 렌기노수스(Thermomyces lanuginosus) 유래 리파제 (TLL)인 것을 특징으로 하는 발현벡터.6. The expression vector of claim 5, wherein the lipase is Thermomyces lanuginosus- derived lipase (TLL).
  7. 제4항에 있어서, 글루코아밀라아제 프로모터를 추가로 포함하는 것을 특징으로 하는 발현벡터.The expression vector according to claim 4, further comprising a glucoamylase promoter.
  8. 제7항에 있어서, 상기 글루코아밀라아제 프로모터는 아스퍼질러스 나이거 글루코아밀라아제(glaA) 프로모터인 것을 특징으로 하는 발현벡터.8. The expression vector of claim 7, wherein the glucoamylase promoter is an Aspergillus niger glucoamylase (glaA) promoter.
  9. 제4항에 있어서, pASP601TLL, pASP602TLL, pASP603TLL, pASP604TLL, pASP605TLL, pASP606TLL, pASP607TLL, pASP608TLL, pASP609TLL, pASP610TLL, pASP611TLL, 및 pASP612TLL로 구성된 군에서 선택되는 것을 특징으로 하는 발현벡터.The vector of claim 4 selected from the group consisting of pASP601TLL, pASP602TLL, pASP603TLL, pASP604TLL, pASP605TLL, pASP606TLL, pASP607TLL, pASP608TLL, pASP609TLL, pASP610TLL, pASP611TLL, and pASP612TLL.
  10. 제4항 내지 제9항 중 어느 한 항의 발현벡터가 도입되어 있는 재조합미생물.A recombinant microorganism into which the expression vector of any one of claims 4 to 9 is introduced.
  11. 제10항에 있어서, 아스퍼질러스 나이거(Aspergillus niger)인 것을 특징으로 하는 재조합미생물. The recombinant microorganism according to claim 10, which is Aspergillus niger .
  12. 제1항의 리파제 신호서열을 코딩하는 핵산과 목적단백질의 유전자가 도입되어 있는 재조합 미생물.A recombinant microorganism into which a nucleic acid encoding the lipase signal sequence of claim 1 and a gene of a protein of interest are introduced.
  13. 다음 단계를 포함하는 것을 특징으로 하는 목적단백질의 생산방법:A method for producing a protein of interest comprising the following steps:
    (a) 제10항의 재조합미생물을 배양하여 목적단백질을 생성하는 단계; 및(a) culturing the recombinant microorganism of claim 10 to produce the protein of interest; And
    (b) 상기 생성된 목적단백질을 분리하는 단계.(b) separating the resultant protein of interest.
  14. 다음 단계를 포함하는 것을 특징으로 하는 목적단백질의 생산방법:A method for producing a protein of interest comprising the following steps:
    (a) 제12항의 재조합미생물을 배양하여 목적단백질을 생성하는 단계; 및(a) culturing the recombinant microorganism of claim 12 to produce the protein of interest; And
    (b) 상기 생성된 목적단백질을 분리하는 단계.(b) separating the resultant protein of interest.
PCT/KR2015/005224 2014-05-27 2015-05-26 Novel lipase signal sequence and method for lipase expression using same WO2015182942A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR1020140063979A KR101803013B1 (en) 2014-05-27 2014-05-27 New Lipase Signal Sequences and Expression Method Using The Same
KR10-2014-0063979 2014-05-27

Publications (2)

Publication Number Publication Date
WO2015182942A1 true WO2015182942A1 (en) 2015-12-03
WO2015182942A9 WO2015182942A9 (en) 2016-04-21

Family

ID=54699216

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2015/005224 WO2015182942A1 (en) 2014-05-27 2015-05-26 Novel lipase signal sequence and method for lipase expression using same

Country Status (2)

Country Link
KR (1) KR101803013B1 (en)
WO (1) WO2015182942A1 (en)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR102181315B1 (en) * 2018-11-01 2020-11-20 한국생명공학연구원 Mutant lipases of Rhizomucor miehei having enhanced transesterification activity and a method of producing the lipase

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JPH05284973A (en) * 1992-04-13 1993-11-02 Kurita Water Ind Ltd Recombinant plasmid and process for secreting and producing foreign protein using the plasmid as vector
US20120231520A1 (en) * 2009-09-10 2012-09-13 Biocon Limited Novel fusion proteins and method of expression thereof
KR20140041159A (en) * 2012-09-27 2014-04-04 한국과학기술원 Deletion mutant of pseudomonas fluorescens and method for the production of protein using the same

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JPH05284973A (en) * 1992-04-13 1993-11-02 Kurita Water Ind Ltd Recombinant plasmid and process for secreting and producing foreign protein using the plasmid as vector
US20120231520A1 (en) * 2009-09-10 2012-09-13 Biocon Limited Novel fusion proteins and method of expression thereof
KR20140041159A (en) * 2012-09-27 2014-04-04 한국과학기술원 Deletion mutant of pseudomonas fluorescens and method for the production of protein using the same

Non-Patent Citations (14)

* Cited by examiner, † Cited by third party
Title
DATABASE NCBI [O] 12 October 2011 (2011-10-12), "Carboxyesterase [Aspergillus niger ATCC 1015", XP055241698, Database accession no. EHA23255 *
DATABASE NCBI [O] 12 October 2011 (2011-10-12), "Carboxylest erase [Aspergillus niger 1015", XP055241259, Database accession no. EHA25387 *
DATABASE NCBI [O] 12 October 2011 (2011-10-12), "lipase [Aspergillus niger ATCC 1015", XP055240941, Database accession no. EHA23686.1 *
DATABASE NCBI [O] 12 October 2011 (2011-10-12), "Lipase [Aspergillus niger ATCC 1015", XP055240941, Database accession no. EHA27430 *
DATABASE NCBI [O] 2 February 2011 (2011-02-02), "Carboxylest erase [Aspergillus niger CBS 513.88", XP055241702, Database accession no. XP_001394014 *
DATABASE NCBI [O] 3 March 2011 (2011-03-03), "Carboxylesterase family protein [Aspergillus niger CBS 513.88", XP055241259, Database accession no. XP_001400715 *
DATABASE NCBI [O] 3 March 2011 (2011-03-03), "Cholinesterase [Aspergillus niger CBS 513.88", XP055241255, Database accession no. XP_001390531 *
DATABASE NCBI [O] 3 March 2011 (2011-03-03), "Extracellular lipase [Aspergillus niger CBS 513.88", XP055240941, Database accession no. XP_001393541 *
DATABASE NCBI [O] 3 March 2011 (2011-03-03), "Hypothetical protein ANI_1_ 372054 [Aspergillus niger CBS 513.88", XP002684292, Database accession no. XP_001390863 *
DATABASE NCBI [O] 3 March 2011 (2011-03-03), "Lipase [Aspergillus niger CBS 513.88", XP055240941, Database accession no. XP_001397501 *
DATABASE NCBI [O] 3 March 2011 (2011-03-03), "Lipase 1 precursor [Aspergillus niger CBS 513.88", XP055240941, Database accession no. XP_001391137 *
DATABASE NCBI 3 March 2011 (2011-03-03), "Carboxylesterase, type B [Aspergillus niger CBS 513.88", Database accession no. XP_001396760 *
DATABASE NCBI 3 March 2011 (2011-03-03), "Triacylglycerol lipase [Aspergillus niger CBS 513.88", Database accession no. XP_001398185 *
VADHANA, A. K. P. ET AL.: "Improved secretion of Candida antarctica lipase B with its native signal peptide in Pichia pastoris", ENZYME AND MICROBIAL TECHNOLOGY, vol. 52, no. 3, 5 March 2013 (2013-03-05), pages 177 - 183, XP028976800 *

Also Published As

Publication number Publication date
KR101803013B1 (en) 2017-12-04
KR20150136730A (en) 2015-12-08
WO2015182942A9 (en) 2016-04-21

Similar Documents

Publication Publication Date Title
WO2016082135A1 (en) Method for porcine h11 site-specific insertion by using site-specific cleavage system
WO2016080795A1 (en) Method for regulating gene expression using cas9 protein expressed from two vectors
WO2023045682A1 (en) Method for increasing soluble expression quantity of polypeptide
WO2021178934A1 (en) Class ii, type v crispr systems
CN109486814A (en) A kind of gRNA for repairing HBB1 point mutation, gene editing system, expression vector and gene editing kit
US20240084285A1 (en) Method for producing target dna sequence and cloning vector
CN109929788A (en) A kind of bacterial strain and its construction method for bearing sieve effect with ccdB
WO2017181920A1 (en) Method for preparing recombinant human granulocyte colony-stimulating factor
WO2015182942A1 (en) Novel lipase signal sequence and method for lipase expression using same
WO2015182941A1 (en) Novel catalase signal sequence and method for catalase expression using same
WO2023028348A1 (en) Enzymes with ruvc domains
CN109536494A (en) A kind of gRNA for repairing HBB1 point mutation, gene editing system, expression vector and gene editing kit
CN107287226B (en) Cpf 1-based DNA construct and DNA in-vitro splicing method
EP0073436A2 (en) Hybrid plasmid and preparation thereof
KR101781328B1 (en) New Lipase Signal Sequences and Expression Method Using The Same
KR101781327B1 (en) New Lipase Signal Sequences and Expression Method Using The Same
KR20050093757A (en) Plasmid-free clone of e. coli strain dsm 6601
CN114891791B (en) sgRNA of specific targeting canine Rosa26 gene and application thereof
CN114891786B (en) Dog Rosa26 gene and application thereof
WO2023224327A1 (en) System and method for increasing gene editing efficiency of microalgae by using autolysin
US20220002692A1 (en) DNA cutting means based on Cas9 protein from biotechnologically significant bacterium Clostridium cellulolyticum
CN118086353A (en) E.coli-saccharomycete shuttle plasmid vector, recombinant plasmid and application thereof
Tu et al. Red/ET recombineering enhances extracellular lipase production by Burkholderia glumae
CN116987694A (en) Bidirectional promoter of medaka and application thereof
CN117660511A (en) Rhodobacter sphaeroides gene editing method based on RecET recombination system and application thereof

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 15799926

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 15799926

Country of ref document: EP

Kind code of ref document: A1