WO2015152437A1 - 신규한 히스톤 메틸 트랜스퍼라아제 억제제 및 그 용도 - Google Patents

신규한 히스톤 메틸 트랜스퍼라아제 억제제 및 그 용도 Download PDF

Info

Publication number
WO2015152437A1
WO2015152437A1 PCT/KR2014/002796 KR2014002796W WO2015152437A1 WO 2015152437 A1 WO2015152437 A1 WO 2015152437A1 KR 2014002796 W KR2014002796 W KR 2014002796W WO 2015152437 A1 WO2015152437 A1 WO 2015152437A1
Authority
WO
WIPO (PCT)
Prior art keywords
cancer
group
nsd2
histone
compound
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/KR2014/002796
Other languages
English (en)
French (fr)
Inventor
루시오에릭 디
모리시타마사요
이태호
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Industry Academic Cooperation Foundation of KNU
Original Assignee
Industry Academic Cooperation Foundation of KNU
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Industry Academic Cooperation Foundation of KNU filed Critical Industry Academic Cooperation Foundation of KNU
Priority to KR1020167027278A priority Critical patent/KR102285119B1/ko
Priority to PCT/KR2014/002796 priority patent/WO2015152437A1/ko
Publication of WO2015152437A1 publication Critical patent/WO2015152437A1/ko
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D405/00Heterocyclic compounds containing both one or more hetero rings having oxygen atoms as the only ring hetero atoms, and one or more rings having nitrogen as the only ring hetero atom
    • C07D405/14Heterocyclic compounds containing both one or more hetero rings having oxygen atoms as the only ring hetero atoms, and one or more rings having nitrogen as the only ring hetero atom containing three or more hetero rings
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D495/00Heterocyclic compounds containing in the condensed system at least one hetero ring having sulfur atoms as the only ring hetero atoms
    • C07D495/02Heterocyclic compounds containing in the condensed system at least one hetero ring having sulfur atoms as the only ring hetero atoms in which the condensed system contains two hetero rings
    • C07D495/04Ortho-condensed systems
    • AHUMAN NECESSITIES
    • A23FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23LFOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES, NOT OTHERWISE PROVIDED FOR; PREPARATION OR TREATMENT THEREOF
    • A23L33/00Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof
    • A23L33/10Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof using additives
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/495Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
    • A61K31/505Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim
    • A61K31/506Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim not condensed and containing further heterocyclic rings
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/495Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
    • A61K31/505Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim
    • A61K31/519Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim ortho- or peri-condensed with heterocyclic rings
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D403/00Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, not provided for by group C07D401/00
    • C07D403/14Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, not provided for by group C07D401/00 containing three or more hetero rings
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D471/00Heterocyclic compounds containing nitrogen atoms as the only ring hetero atoms in the condensed system, at least one ring being a six-membered ring with one nitrogen atom, not provided for by groups C07D451/00 - C07D463/00
    • C07D471/02Heterocyclic compounds containing nitrogen atoms as the only ring hetero atoms in the condensed system, at least one ring being a six-membered ring with one nitrogen atom, not provided for by groups C07D451/00 - C07D463/00 in which the condensed system contains two hetero rings
    • C07D471/04Ortho-condensed systems
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D487/00Heterocyclic compounds containing nitrogen atoms as the only ring hetero atoms in the condensed system, not provided for by groups C07D451/00 - C07D477/00
    • C07D487/02Heterocyclic compounds containing nitrogen atoms as the only ring hetero atoms in the condensed system, not provided for by groups C07D451/00 - C07D477/00 in which the condensed system contains two hetero rings
    • C07D487/04Ortho-condensed systems
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D491/00Heterocyclic compounds containing in the condensed ring system both one or more rings having oxygen atoms as the only ring hetero atoms and one or more rings having nitrogen atoms as the only ring hetero atoms, not provided for by groups C07D451/00 - C07D459/00, C07D463/00, C07D477/00 or C07D489/00
    • C07D491/02Heterocyclic compounds containing in the condensed ring system both one or more rings having oxygen atoms as the only ring hetero atoms and one or more rings having nitrogen atoms as the only ring hetero atoms, not provided for by groups C07D451/00 - C07D459/00, C07D463/00, C07D477/00 or C07D489/00 in which the condensed system contains two hetero rings
    • C07D491/04Ortho-condensed systems
    • C07D491/044Ortho-condensed systems with only one oxygen atom as ring hetero atom in the oxygen-containing ring
    • C07D491/048Ortho-condensed systems with only one oxygen atom as ring hetero atom in the oxygen-containing ring the oxygen-containing ring being five-membered
    • AHUMAN NECESSITIES
    • A23FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23VINDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
    • A23V2002/00Food compositions, function of food ingredients or processes for food or foodstuffs
    • AHUMAN NECESSITIES
    • A23FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23VINDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
    • A23V2200/00Function of food ingredients
    • A23V2200/30Foods, ingredients or supplements having a functional effect on health
    • A23V2200/308Foods, ingredients or supplements having a functional effect on health having an effect on cancer prevention

Definitions

  • the present invention relates to novel histone methyl transferase inhibitors.
  • the present invention also relates to a pharmaceutical composition or a food composition comprising the novel histone methyl transferase inhibitor.
  • the present invention also relates to methods of treating cancer using the novel histone methyl transferase inhibitors.
  • NSD1, NSD2 / MMSET / WHSC1 and NSD3 / WHSC1L1 form a nuclear receptor binding SET domain (NSD) family and are classified into the histone methyltransferase (HMTase) KMT3 family.
  • NSD is a histone modifier involved in the maintenance of chromatin. NSD methylates most of histone H3 lysine 36 (H3K36) and histone H4 lysine 20 (H4K20) of chromatin, and in vivo NSD1, NSD2, and NSD3 act in different mechanisms.
  • NSD2 and NSD3 do not contribute substantially to the overgrowth phenotype, whereas NSD1 genetic modification is observed.
  • NSD family configurations can replace each other.
  • NSDs, especially NSD2 play an important role in the development and progression of various cancers and are considered to be very important drug targets.
  • Amplification of NSD1 has been observed in multiple myeloma, lung cancer, neuroblastoma, glioblastoma.
  • Amplification of NSD1 and NSD2 triggers cellular transformation into cancer cells.
  • NSD3 plays a role in lung cancer and has been shown to be amplified in breast cancer cell lines and primary breast carcinomas.
  • NSD2 / MMSET Multiple myeloma SET
  • NSD2 is overexpressed in solid tumors, especially breast cancer, myeloma and gliomas, resulting in abnormal increases in the global level of H3K36me2.
  • Overexpression of NSD2 in prostate cancer leads to epigenetic aberration, leading to metastatic phenotype.
  • NSD2 / MMSET is an important focus in therapeutic intervention for multiple myeloma, especially t (4; 14) myeloma, which has the worst prognosis compared to other species.
  • Multiple myeloma is the second most common hematologic cancer after non-Hodgkin's lymphoma. There is no treatment or effective treatment for multiple myeloma yet.
  • Chromatin remodeling inhibitors which target DNA methyltransferases (DNMTs), histone methyltransferases, and histone deacetylases (HDAC), are being pursued in both anticancer chemotherapy and cancer prevention chemotherapy.
  • DNMTs DNA methyltransferases
  • HDAC histone deacetylases
  • Several DNA-methylation and histone deacetylase inhibitors have recently entered clinical trials.
  • HMTase is a novel sample target and HMTase inhibitors are still lacking and very small amounts of compound have been reported.
  • Epizyme Inc. has made significant progress by discovering HMTase DOT1L and EZH2 potential inhibitors.
  • DOT1L does not contain a canonical SET domain and is distinct from other HMTases.
  • HMTase inhibitors BIX-01294 and BIX-01338, have effects on G9a with 3 and 5 IC 50 , respectively. Chaetocin also inhibits Su (var) 3-9 with an IC 50 of 0.8.
  • Liu et al. Completed the formation of several G9a inhibitors, such as UNC0224 of IC 50 at 15 nM. Epizyme Inc. And researchers of G9a and EZH2 by GlaxoSmithKline Inc. reported HMTase inhibitors of IC50 at nanomolar levels. However, only one NSD2 inhibitor (MCTP39) was found to have an IC50 of ⁇ 3 and was recently patented.
  • the catalytic mechanism of lysine-HMTase is carried out through a linear SN2 nucleophilic attack between cofactor SAM (SAdenosylmethionine) and Lysine-NH3 substrate.
  • SAM binds into small cavities adjacent to histone-tailed large binding grooves in which lysine substrates extend deep into channels located at the interface between both binding sites.
  • the inventors of the prior art have identified that the SET domain of NSD1 accepts 7-amino acid peptides similar to that identified in SET8.
  • This control-loop acts like a seatbelt of lysine-gas to participate in both substrate recognition and catalytic mechanisms.
  • This control-loop is located on top of the lysine-substrate which strongly anchors the histone-tail to the SET domain. Histone tail binding sites are associated with portions of both SET and postSET subdomains.
  • NSDs are distanced from other known HMTases systematically (FIG. 2). Inhibition of HMTases is achieved by targeting SAM binding pockets or histone-tail binding clefts.
  • EZH2 inhibitor GSK343 has inhibitory activity against EZH1 as a SAM competitor and also has inhibitory effects of SET7 and PRMT3.
  • EZH1 and EZH2 have very close SET domain sequences for NSDs, which may be important for the selection of EZH2 inhibitors for NSDs, in particular NSD2.
  • MCTP39 is a SAM competitor to NSD2, recently patented.
  • the SAM binding pocket is partially buried within the crystal structure of the SET domain in NSD1, and the major residues that stabilize SAM are highly conserved between NSDs.
  • the larger, more accessible histone-tail binding sites have greater sequence heterogeneity compared to SAM binding pockets.
  • the residues involved in stabilizing the binding of histone substrates, unlike the SAM binding site are not conserved between NSDs. This could be observed in the crystal structure of HMTase G9a-like protein and BIX-01294, a histone-tailed mimic inhibitor targeting histone tail binding domains.
  • the involvement of specific fluid regulatory loops in the binding of histone-tailed NSDs SET domains suggests that histone-tailed binding gaps can be developed to achieve specific and selective inhibition in NSD2.
  • One aspect of the present invention is to provide novel histone methyl transferase inhibitors.
  • one aspect of the present invention is to provide a pharmaceutical composition or a food composition comprising the novel histone methyl transferase inhibitor.
  • the present invention also provides a method for treating cancer using the novel histone methyl transferase inhibitor.
  • One aspect of the present invention provides a compound or a pharmaceutically acceptable salt thereof, consisting of:
  • the A group is selected from the group consisting of
  • the B group is selected from the group consisting of
  • the C group is selected from the group consisting of:
  • R 1 is selected from the group consisting of methyl, ethyl, di-methyl and i-Pr,
  • R 2 and R 3 are independently selected from the group consisting of hydrogen, a substituted or unsubstituted alkyl group, a substituted or unsubstituted cycloalkyl group, and a substituted or unsubstituted heterocycloalkyl group having O, N, S or P as a hetero element. ,
  • R 4 is selected from the group consisting of fluorine, chlorine, methyl, and OMe,
  • R 5 is selected from the group consisting of methyl, ethyl, tert-butyl, substituted or unsubstituted phenyl, and substituted or unsubstituted phenyl group having O, N, S or P as a hetero element.
  • the compound may be an inhibitor of histone lysine-methyl transferase, the histone methyl transferase is preferably a family of nuclear receptor binding SET domains (NSD), more preferably NSD2 / MMSET.
  • NSD nuclear receptor binding SET domains
  • the inhibitor of the histone lysine-methyl transferase may be a compound, most preferably consisting of the following formula.
  • one aspect of the present invention provides a pharmaceutical composition for preventing or treating cancer, comprising the compound as an active ingredient.
  • the cancer includes lymphoma, acute lymphoblastic leukemia (ALL), chronic lymphocytic leukemia (CLL), myeloma, skin cancer, primary melanomas, yolk sac Yolk sac tumour, breast cancer, lung cancer, colon cancer, pancreatic cancer, ovarian cancer, bladder cancer, prostate cancer, kidney cancer, brain cancer, cervical cancer, leukemia, granulomatosis, and cellular transformation transformation), most preferably multiple myeloma.
  • ALL acute lymphoblastic leukemia
  • CLL chronic lymphocytic leukemia
  • one aspect of the present invention provides a food composition for preventing or improving cancer, comprising the compound as an active ingredient.
  • Another aspect of the invention also provides a method of treating cancer comprising administering to a subject a pharmaceutically effective amount of said compound.
  • novel compounds according to the invention can effectively inhibit histone lysine-methyl transferase inhibitors and thus can be used as therapeutic agents in various tumors involving histone lysine-methyl transferase.
  • NSD members all comprise two PWWP domains, four PHD zinc finger domains, and a catalytic domain.
  • Catalytic domains have HMTase activity and include pre-SET, SET, and post-SET domains. The regulatory loop covering the histone-binding portion is shown in red.
  • Figure 2 shows the HMTase activity of NSD1-CTD, NSD2-CTD, and NSD3-CTD on H3 and H4 substrates in vitro.
  • the structure of the catalytic domain consists of one group of three groups of normal form -sheets arranged in a triangular fashion and one group of two -sheets very adjacent to the conserved -helix, for the binding of lysine-histone ligands.
  • the Qualifier AdoMet combines the appropriate configuration for the CD through the channel.
  • the fluid control loop is shown in red. The movement of the control loop is indicated by the curved inverse arrow.
  • H3K36 Model of NSD-CDs bound to H3-peptide (a.a. 32-38) after MD simulations.
  • H3K36 is indicated.
  • the electrostatic surface is colored as follows: Blue: positive charge; Red color; Negative charge. Unit + 5 / -5 kb.T.ec -1.
  • FIG. 4 is a diagram showing the molecular determinant of H3K4, H3K9 and H3K27 bonds.
  • H3K4 (a.a.1-7), H3K9 (a.a. 5-11), and H3K27 (a.a. 23-29) are aligned vertically and the atomic details of the residues are shown in purple. Interactions of amino acids from CDs of NSD are shown in brown and numbered. Green dotted line represents hydrogen bond. Hydrophobic interactions are omitted. This figure was constructed using the program Ligplot.
  • H3K36 (a.a. 32-38), H3K79 (a.a. 75-81), and H4K20 (a.a.16-22).
  • FIG. 6 is a diagram showing a structure of NSD2 / MMSET and a model of an open SET domain including LEM-14.
  • NSD2 Primary structure of NSD2: PWWP domain; PHD zinc finger domains; SET HMTase (histone methyl transferase) including preSET and postSET. The control loop closing the histone-binding portion is marked in red.
  • Figure 7 shows sequence relationships between HMTases and between SET domains of NSD.
  • Figure 8 is a diagram showing the concentration response curve of the inhibitor for NSD2-SET H3K36 mono-methylation activity. NSD2-SET H3K36 mono-methylation activity was indicated at various concentrations of candidate inhibitors. Concentration response curves and IC50 of LEM-06, LEM-14, and BIX-01294 were expressed using GraphPad Prism 6.0.
  • FIG. 10 shows molecular details of the binding of inhibitors in histone-tail binding grooves of NSD2.
  • A LEM-14,
  • B LEM-06,
  • C BIX-01294. Yellow dashed lines indicate hydrogen bonds.
  • FIG. 11 shows binding of BIX-01294 and LEM-06 docked to NSD2 histone-tail binding grooves.
  • One aspect of the present invention provides a compound or a pharmaceutically acceptable salt thereof, consisting of:
  • the A group is selected from the group consisting of
  • the B group is selected from the group consisting of
  • the C group is selected from the group consisting of:
  • R 1 is selected from the group consisting of methyl, ethyl, di-methyl and i-Pr,
  • R 2 and R 3 are independently selected from the group consisting of hydrogen, a substituted or unsubstituted alkyl group, a substituted or unsubstituted cycloalkyl group, and a substituted or unsubstituted heterocycloalkyl group having O, N, S or P as a hetero element. ,
  • R 4 is selected from the group consisting of fluorine, chlorine, methyl, and OMe,
  • R 5 is selected from the group consisting of methyl, ethyl, tert-butyl, substituted or unsubstituted phenyl, and substituted or unsubstituted phenyl group having O, N, S or P as a hetero element.
  • the compound may be an inhibitor of histone lysine-methyl transferase, the histone lysine-methyl transferase is preferably a nuclear receptor binding SET domain (NSD), more preferably NSD2.
  • NSD nuclear receptor binding SET domain
  • the inhibitor of the histone lysine-methyl transferase may be a compound, most preferably consisting of the following formula.
  • the present invention includes the optical isomers, enantiomers, diastereomers and geometric isomers of the compounds.
  • the present invention also encompasses all tautomeric forms of the compounds.
  • Another aspect of the invention provides N-oxides, hydrates, solvates, pharmaceutically acceptable salts, complexes and prodrugs of the compounds.
  • salts that are within the scope of this invention. References to such compounds of the invention are understood to include references to salts thereof unless stated otherwise.
  • salt (s) refers to acidic and / or basic salts formed with inorganic and / or organic acids and bases.
  • salts when the compounds of the present invention contain both basic moieties such as but not limited to pyridine or imidazole and acid moieties such as but not limited to zwitterion (“internal salts”) ) May be formed and included within the term "salt (s)" as used herein.
  • Other salts are also useful, such as in separation or purification steps that can be applied during preparation, but pharmaceutically acceptable (ie non-toxic (with minimal or no undesired toxic effects)) salts are preferred.
  • Salts of the compounds of the invention can be formed, for example, by reacting a compound of the invention with a predetermined amount of acid or base, such as an equivalent, in a medium, such as a medium in which the salt precipitates or in an aqueous medium, and freeze drying.
  • a predetermined amount of acid or base such as an equivalent
  • a medium such as a medium in which the salt precipitates or in an aqueous medium
  • more than one equivalent of acid (base) could be used to provide, for example, di- or tri-salts.
  • exemplary acid addition salts include acetates (such as those formed with acetic acid or trihaloacetic acid, for example trifluoroacetic acid), adipate, alginate, ascorbate, aspartate, benzoate, benzenesulfonate , Bisulfate, borate, butyrate, citrate, camphorrate, camphorsulfonate, cyclopentanepropionate, digluconate, dodecyl sulfate, ethanesulfonate, fumarate, glucoheptanoate, glycerophosphate, hemi Sulfate, heptanoate, hexanoate, hydrochloride, hydrobromide, hydroiodide, hydroxyethanesulfonate (e.g.
  • 2-hydroxyethanesulfonate lactate, maleate, methanesulfonate, naphthalenesulfo Nates (eg 2-naphthalenesulfonate), nicotinate, nitrate, oxalate, peck Nates, persulfates, phenylpropionates (eg 3-phenylpropionate), phosphates, picrates, pivalates, propionates, salicylates, succinates, sulfates (eg, those formed with sulfuric acid), sulfo Nates, tartrates, thiocyanates, toluenesulfonates such as tosylate, undecanoate and the like.
  • naphthalenesulfo Nates eg 2-naphthalenesulfonate
  • nicotinate nitrate
  • oxalate peck Nates
  • persulfates eg 2-naphthalenesulf
  • Compounds of the invention that contain an acidic moiety can form salts with various organic and inorganic bases.
  • Exemplary basic salts include ammonium salts, alkali metal salts such as sodium, lithium and potassium salts, alkaline earth metal salts such as calcium and magnesium salts, salts with organic bases (eg organic amines) such as benzadine, dish Clohexylamine, hydravamin (formed with N, N-bis (dehydroabiethyl) ethylenediamine), N-methyl-D-glucamine, N-methyl-D-glycarmide, t-butyl amine and arginine, Salts with amino acids such as lysine.
  • organic bases eg organic amines
  • hydravamin formed with N, N-bis (dehydroabiethyl) ethylenediamine
  • N-methyl-D-glucamine N-methyl-D-glycarmide
  • Basic nitrogen-containing groups include lower alkyl halides (eg, methyl, ethyl, propyl and butyl chlorides, bromide and iodide), dialkyl sulfates (eg, dimethyl, diethyl, dibutyl and diamyl sulfates), long chain halides (eg , Decyl, lauryl, myristyl and stearyl chloride, bromide and iodide), aralkyl halides (eg benzyl and phenethyl bromide) and the like.
  • lower alkyl halides eg, methyl, ethyl, propyl and butyl chlorides, bromide and iodide
  • dialkyl sulfates eg, dimethyl, diethyl, dibutyl and diamyl sulfates
  • long chain halides eg , Decyl, lauryl, myristyl
  • salts refers to salts that retain the required biological activity of the aforementioned compounds and exhibit minimal or no toxic effects.
  • examples of such salts include, but are not limited to, acid addition salts formed with inorganic acids (eg hydrochloric acid, hydrobromic acid, sulfuric acid, phosphoric acid and nitric acid) and organic acids such as acetic acid, oxalic acid, tartaric acid, succinic acid, malic acid, ascorbic acid, Salts formed with benzoic acid, carbonic acid, pamoic acid, alginic acid, polyglutamic acid, naphthalenesulfonic acid, naphthalenedisulfonic acid, and polygalacturonic acid.
  • inorganic acids eg hydrochloric acid, hydrobromic acid, sulfuric acid, phosphoric acid and nitric acid
  • organic acids such as acetic acid, oxalic acid, tartaric acid, succinic acid, malic acid, ascorbic acid
  • Compounds may be administered as a quaternary acceptable salt by a known pharmaceutical to those skilled in the art, these are in particular the formula (-NR) + + Z - (here, R is hydrogen, alkyl, or benzyl, Z is chloride, bromide, Iodide, -O-alkyl, toluenesulfonate, methylsulfonate, sulfonate, phosphate or carboxylate (e.g. benzoate, succinate, acetate, glycolate, maleate, maleate, citrate, tartrate Quaternary ammonium salts), ascorbate, benzoate, cinnamoate, mandelloate, benzylate or diphenylacetate).
  • R is hydrogen, alkyl, or benzyl
  • Z is chloride, bromide, Iodide, -O-alkyl, toluenesulfonate, methylsulfonate, sulfonate, phosphat
  • the invention also includes prodrugs of the compounds of the invention.
  • prodrug is intended to refer to a compound covalently bound to a carrier, and when the prodrug is administered to a mammalian subject, the prodrug may release the active ingredient of the prodrug. Release of the active ingredient occurs in vivo.
  • Prodrugs can be prepared by techniques known to those skilled in the art. Such techniques generally modify suitable functional groups of a given compound. However, this modified functional group regenerates the original functional group by routine manipulation or in vivo.
  • Prodrugs of the compounds of the present invention include compounds with modified hydroxy, amino, carboxyl or similar groups.
  • prodrugs include, but are not limited to, esters (eg, acetate, formate and benzoate derivatives), carbamate of hydroxy or amino functional groups in the compounds of the invention (eg, N, N-dimethylaminocarbonyl) , Amides (eg, trifluoroacetylamino, acetylamino, and the like).
  • esters eg, acetate, formate and benzoate derivatives
  • carbamate of hydroxy or amino functional groups in the compounds of the invention eg, N, N-dimethylaminocarbonyl
  • Amides eg, trifluoroacetylamino, acetylamino, and the like.
  • histone methyl transferase and "HMTase” are enzymes that promote the transfer of one, two or three methyl to the lysine of the histone, is a histone-modifying enzyme.
  • histone is meant to refer to any histone protein, including H1, H2A, H2B, H3, H4, and H5 from any species.
  • histone methyl transferase inhibitor means that it can interact with histone methyl transferase and inhibit its enzymatic activity.
  • the expression “inhibits the enzymatic activity of histone methyl transferase” means reducing the ability to transfer methyl groups in histones.
  • inhibition of histone methyl transferase activity may be at least about 10%.
  • such a decrease in histone methyl transferase activity is at least about 50%, more preferably at least about 75%, more preferably at least about 90%.
  • histone histone methyl transferase activity is reduced by at least 95%, more preferably by at least 99%.
  • IC 50 value is the concentration of histone deacetylase inhibitor that reduces the activity of histone histone methyl transferase by 50%.
  • inhibitor effective amount is intended to denote a dosage sufficient to cause inhibition of histone methyl transferase activity.
  • Histone methyl transferases may be present in cells, in other words in multicellular organisms.
  • Multicellular organisms can be, for example, plants, fungi or animals, preferably mammals and more preferably humans. Fungi can infect plants or mammals, preferably humans, so that they can be present in and / or on plants or mammals.
  • the method according to this aspect of the invention comprises administering to the organism a compound or composition according to the invention. Administration can be carried out by any route including, without limitation, parenteral, oral, sublingual, transdermal, topical, nasal, intratracheal or rectal.
  • the compounds of the present invention are administered intravenously in a hospital setting. In certain other preferred embodiments, administration may preferably be by oral route.
  • one aspect of the present invention provides a pharmaceutical composition for preventing or treating cancer, comprising the compound as an active ingredient.
  • the cancer includes lymphoma, acute lymphoblastic leukemia (ALL), chronic lymphocytic leukemia (CLL), myeloma, skin cancer, primary melanomas, yolk sac Yolk sac tumour, breast cancer, lung cancer, colon cancer, pancreatic cancer, ovarian cancer, bladder cancer, prostate cancer, kidney cancer, brain cancer, cervical cancer, leukemia, granulomatosis, or cellular transformation transformation, most preferably multiple myeloma.
  • ALL acute lymphoblastic leukemia
  • CLL chronic lymphocytic leukemia
  • one aspect of the present invention provides a food composition for preventing or improving cancer, comprising the compound as an active ingredient.
  • Another aspect of the invention also provides a method of treating cancer comprising administering to a subject a pharmaceutically effective amount of said compound.
  • the pharmaceutical compositions of the present invention may be formulated by any method well known in the art and by any route including, without limitation, parenteral, oral, sublingual, transdermal, topical, intranasal, intratracheal or rectal. It may be prepared for administration. In certain preferred embodiments, the pharmaceutical compositions of the present invention are administered intravenously in a hospital setting. In certain other preferred embodiments, the administration may preferably be by the oral route.
  • the pharmaceutical composition may be in any form including but not limited to a solution or suspension.
  • the formulations may be in the form of tablets or capsules.
  • the pharmaceutical compositions may be in the form of powders, nasal drops or aerosols.
  • the pharmaceutical composition can be administered locally or systemically.
  • compositions according to the invention may contain, in addition to inhibitors, diluents, fillers, salts, buffers, stabilizers, solubilizers and other substances known in the art.
  • inhibitors diluents
  • fillers salts, buffers, stabilizers, solubilizers and other substances known in the art.
  • additional therapeutic agents that could normally be administered to treat the disease or condition may also be present in the compositions of the present invention.
  • administration of such agents may be carried out continuously or simultaneously with the administration of the composition according to the invention.
  • the compounds of the present invention may be administered alone or in combination with one or more additional therapeutic (pharmaceutical) agents in which the combination does not cause any unacceptable side effects. This may be particularly suitable for the treatment of hyperproliferative diseases such as cancer.
  • the compounds of the present invention may be combined with known anticancer agent (s) as well as mixtures and combinations thereof.
  • additional therapeutic agents generally administered to treat a particular disease or condition are known as "suitable for the disease or condition to be treated.”
  • additional therapeutic agent includes, for example, chemotherapeutic agents and other anti-proliferative agents.
  • the composition comprises one or more compound (s) according to the invention.
  • the composition comprises one or more compound (s) according to the invention and / or another HMTase inhibitor known or to be found by those skilled in the art.
  • the active ingredients of such compositions preferably act synergistically to produce a therapeutic effect.
  • NSDs-CTDs include pre-SET, SET, post-SET, and PHD4 domains within the catalytic core and histone-recognition module.
  • CTD carboxyl terminal domain
  • NSD1, NSD2, and NSD3 belonging to the NSDs family of HMTase are shown in FIG. 1A.
  • NSD members all comprise two PWWP domains, four PHD zinc finger domains, and a catalytic domain.
  • Catalytic domains have HMTase activity and include pre-SET, SET, and post-SET domains. The regulatory loop covering the histone-binding portion is shown in red.
  • CTD carboxyl terminal domain
  • NSD1-CTD 1338 bp, 5325-6663 nt; encoding 446 aa, 1775-2221 aa), NSD2-CTD (1287 bp, 2808-4095 nt; encoding 429 aa, 936-1365 aa), and NSD3-CTD (1344 bp, 2967-4311 nt; encoding 484 aa, 989-1437 aa) were amplified by PCR using a human liver cDNA library (TAKARA, Japan) as a template.
  • TAKARA human liver cDNA library
  • the forward and reverse primers used are as follows.
  • Protein expression intein-tagged with amplified NSD1-CTD and NSD3-CTD strands (including Sal I and Not I restriction enzyme sites) and NSD2-CTD strands (including Nde I and Xho I restriction enzyme sites) The vector, pTYB2 or pTYB12 (New England Biolabs, USA) was inserted into the restriction site of the polyclonal site.
  • Escherichia coli expression strains (ER2566 or BL21) were transformed with pTYB2 or pTYB12 plasmids including NSD1-CTD , NSD2-CTD , and NSD3-CTD ( NSD-CTDs ).
  • Transformed cell lines were cultured in LB medium containing 100 g / mL ampicillin and expression of recombinant NSD-CTDs was induced at 250 M IPTG (isopropyl 1-thio-D-galactopyranoside) for 15 to 4 hours.
  • E. coli cells were recovered and lysed by the freeze-and-thaw method and buffer A [20 mM Tris (pH 8.0), containing 0.1% Triton X-100 and 1 mM PMSF (phenylmethanesulfonylfluoride), 500 mM NaCl, and 0.1 mM EDTA], and then sonicated 20 times on ice.
  • buffer A 20 mM Tris (pH 8.0), containing 0.1% Triton X-100 and 1 mM PMSF (phenylmethanesulfonylfluoride), 500 mM NaCl, and 0.1 mM EDTA
  • NSD-CTD-Intein-CBD chitin-binding domain
  • NSD-CTD protein was cut from chitin beads by incubation for 4 to 48 hours in Buffer A with 50 mM 2-mercaptoethanol. After eluting with Buffer A, it was concentrated using Amicon Ultra centrifugal filter and used for methyltransferase assay. Some of the purified NSD-CTDs were analyzed by SDSPAGE.
  • NSD2-CTD Soluble, pure NSD-CTDs of expected molecular weights of 50.8 kDa (NSD1-CTD), 48.9 KDa (NSD2-CTD) and 51.1 KDa (NSD3-CTD) were identified on Coomassie stained gels (FIG. 1B). Recombinant NSD2-SET retained stable and catalytic activity after storage at 80.
  • Histone methyltransferase activity of NSD-CTDs at H3K4, K9, K27, K36, K79, and H4K20 was measured in colorimetric quantification kit (Epigentek, USA) according to the manufacturer's protocol.
  • Epigentek, USA purified recombinant NSD-CTDs (0.2 g and 2.0 g) were incubated with recombinant histone H3 or H4 (Epigentek, USA) and methyl donor in strip wells coated with specific antibodies (Adomet) and incubated at room temperature for 60-90 minutes. Specific antibodies bound to the bottom of the strip wells captured the methylated substrate.
  • biotinylated histone substrates were used in place of antibody coated strip wells and stably captured on strip wells at 37 for 60 minutes.
  • the captured pihotinylated histone substrate was then incubated with high-affinity antibody for 60 minutes at room temperature with stirring at 100 rpm.
  • Excess purified NSD-CTDs, histones, Adomet, and antibodies are washed away to remove and antibody bound or biotinylated H3 / H4me bound strip wells are labeled with detection antibody labeled 100 in the dark at 100 for 24 minutes. Incubation was carried out at vortex conditions of rpm.
  • NSD2-CD (aa 971-1202) shares 75.9% identity and 90.1% similarity with NSD1-CD (PDB: 3OO1)
  • NSD3-CD (aa 1044-1283) with NSD1-CD 72.9% identity and 85% similarity.
  • Histone tail peptides were identified as H3K4 (aa 1-7), H3K9 (aa 5-11), H3K27 (aa 23-29), H3K36 (aa 32-38), H3K79 (aa 75-81), and H4K20 (aa 16- Residues of 22), which were manually constructed in the COOT.
  • NSD1-CD NSD1-CD
  • PDB histone H4 peptides
  • NSD1-CD-H3K4 (1-7), 42,121 atoms; NSD1-CD-H3K9 (5-11), 42,104 atoms; NSD1-CD-H3K27 (23-27), 42,095 atoms; NSD1-CD-H3K36 (32-38), 42,106 atoms; NSD1- CD-H3K79 (75-81), 42,120 atoms; NSD1-CDH4K20 (32-38), 42,130 atoms; NSD2-CDH 3 K 4 (1-7), 44,848 atoms; NSD2-CD-H3K9 (5- 11), 44,840 atoms; NSD2-CD-H3K27 (23-27), 44,828 atoms; NSD2-CD-H
  • EM and MD were performed with NAMD v2.8 using the CHARMM force field. Constant temperature was maintained using Langevin damping at 300K, and pressure was kept constant at 1 pressure using Langevin piston. The electrostatic force was considered to be 10 cut-off distances using PME (particle mesh Ewald) method.
  • the solvated complex, histone peptide-NSD-CD was first introduced with five iterations of 5,000 (5 ns) conjugate gradient EM, followed by 20,000 (20 ns) molecular dynamics and 5,000 (5 ns) EM. Equilibrated. The last step was 5ns of EM.
  • Binding energy was calculated as follows using the total energy calculation of NAMD 54.
  • binding complex (peptide + NSD).
  • the model of the final MD step was separated from the solvent molecules and used to calculate the binding energy of the complex. Binding complexes, peptides, and models of NSD-CD apo were all subjected to the same EM procedure followed by binding energy calculations.
  • the model was energy minimized to 4,000 steps (4 ns) conjugate gradient EM, followed by 2,000 steps (2 ns) MD, and 6,000 steps (6 ns) EM (NAMD v2.8).
  • the EM step was long enough to reach a local minimum of ⁇ 1 kJ / mol. Constant temperature was maintained using Langevin damping at 300K, and pressure was kept constant at 1 pressure using Langevin piston.
  • FIG. Figure 2 shows the HMTase activity of NSD1-CTD, NSD2-CTD, and NSD3-CTD on H3 and H4 substrates in vitro.
  • NSD1-CTD, NSD2-CTD, and NSD3-CTD show similar substrate recognition and methylation properties, but confirmed reduced methylation activity in NSD3-CTD (FIG. 2). More H3K4me3 and H3K27me3 species were detected in NSD1-CTD and NSD2-CTD than me1 and me2 species. However, H3K9-me1 & -me2 and H3K79-me1 & -me2 species were preferred over me3 species. Compared with NSD1-CTD and NSD2-CTD, NSD3-CTD showed significant methylation activity ( ⁇ 1.5 fold) except for the slight activity on H3K4 and H3K9. For specific substrates, the methylation activity of NSD3-CTD to H3K9, H3K27, and H3K79 was nearly identical to that of NSD1-CTD and NSD2-CTD.
  • H4K20 methylation varied between NSD-CTDs. Nevertheless, significant mono- / tri-methylation activity of NSD1-CTD, di- / tri-methylation activity of NSD2-CTD, and di- / tri-methylation activity of NSD3-CTD were identified in H4K20, indicating that H4K20 is in In vitro , it is a target of all NSD-CTDs. H3K36 was methylated by both NSD-CTDs and was the preferred substrate of NSD1-CTD.
  • the structure of the catalytic domain consists of one group of three groups of normal form -sheets arranged in a triangular fashion and one group of two -sheets very adjacent to the conserved -helix, for the binding of lysine-histone ligands.
  • the Qualifier AdoMet combines the appropriate configuration for the CD through the channel.
  • the fluid control loop is shown in red. The movement of the control loop is indicated by the curved inverse arrow.
  • H3K36 Model of NSD-CDs bound to H3-peptide (a.a. 32-38) after MD simulations.
  • H3K36 is indicated.
  • the electrostatic surface is colored as follows: Blue: positive charge; Red color; Negative charge. Unit + 5 / -5 kb.T.ec -1.
  • the crystal structure of NSD1-CD (PDB: 3OOI) is devoid of peptide substrates and the histone-lysine binding moiety is blocked by a regulatory loop at the interface of the SET and post-SET moieties.
  • the molecular determinant of this regulatory loop extends to the histone binding moiety and stericly interferes with the binding of other substrates.
  • the H3K4 HMTase MLL1 shares similar characteristics with the fluid post-SET that causes the open- and closed structure of the lysine-chambered binding moiety.
  • To construct CDs of NSD2 and NSD3 we used the crystal structure of NSD1-CD (PDB: 3OOI-aa 1850-2080), which was performed through homology modeling with similar structure by sharing more than 40% sequence identity. It was.
  • NSD2-CD (aa 971-1202) shares 75.9% identity and 90.1% similarity with NSD1-CD (PDB: 3OO1).
  • NSD3-CD (aa 1044-1283) showed 72.9% identity and 85% similarity with NSD1-CD.
  • NSD1-CD, NSD2-CD, and NSD3-CD share very high base homology, indicating that they share very similar structures (FIG. 1).
  • FIG. 4 is a diagram showing the molecular determinant of H3K4, H3K9 and H3K27 bonds.
  • H3K4 (a.a.1-7), H3K9 (a.a. 5-11), and H3K27 (a.a. 23-29) are aligned vertically and the atomic details of the residues are shown in purple. Interactions of amino acids from CDs of NSD are shown in brown and numbered. Green dotted line represents hydrogen bond. Hydrophobic interactions are omitted. This figure was constructed using the program Ligplot.
  • H3K36 (a.a. 32-38), H3K79 (a.a. 75-81), and H4K20 (a.a.16-22).
  • CDs of NSD members share similar functional domains, and share common structural characteristics as well (FIG. 1A).
  • the histone tail-defect portion is rotated and shifted in the control loop of the interface between the SET and post-SET portions, exposing the negatively charged surface portion to be suitable for docking the positively charged H3 and H4 peptide tails. Only accessible ( Figure 3).
  • Table 1 shows the binding energy of peptides when including lysine-histone substrates on the catalytic domains of NSD1, NSD2, and NSD3.
  • Peptides are as follows: H3K4 (a.a. 1-7); H3K9 (a.a. 5-11); H3K27 (a.a. 23-29); H3K36 (a.a. 32-38); H3K79 (a.a. 75-81); H4K20 (a.a. 16-22).
  • PolyE was used as a control experiment in the docking test.
  • polyE is a 6-mer poly-glutamic acid peptide.
  • control loop acts like a seatbelt to anchor a single histone tail to the binding domain, allowing the lysine substrate to extend to the cofactor-binding moiety to trigger a catalytic reaction (FIG. 3).
  • the peptide-binding moiety is large enough to accommodate a 7-amino acid peptide.
  • results can be equivalently compatible with histone peptides whose histone-binding pockets of NSD members are tested, which provides steric and electrostatic matches for the stability of H3 and / or H4 histone tails.
  • PCR using human liver cDNA library (TAKARA, Japan) as a template was performed to amplify the human NSD2 gene (NSD2-SET , 873 bp, 2844-3717 nt; 291 aa, 948-1239 aa).
  • the forward and reverse primers were PK162, 5-GGCAGCCATATG ( Nde I) CAGGGGGTCAGAGGGATCGGAAGAG-3 and PK163, 5-GAAGCACTCGAG ( Xho I) CTCTGACTGCCTCTTCCCTTCCCC-3, respectively.
  • PCR amplified NSD2-SET DNA manipulations were digested with Nde I and Xho I and inserted into multiple cloning sites of the protein expression Intein-tagged vector, pTYB2 (New England Biolabs, USA). The sequence was confirmed by sequencing.
  • NSD2-SET Escherichia coli expression strain, BL21, transformed with pTYB2 plasmid was incubated in LB medium containing 100 g / mL ampicillin. Expression of recombinant NSD2-SET was induced for 15 4 hours with 250 M IPTG (isopropyl 1-thio-D-galactopyranoside).
  • coli cells were harvested and lysed by the freeze-and-thaw method, buffer A [20 mM Tris (pH 8.0), containing 0.1% Triton X-100 and 10 mM PMSF (phenylmethanesulfonylfluoride), 500 mM NaCl, and 0.1 mM EDTA] and then sonicated 20 times on ice.
  • Cell extracts comprising the NSD2-SET-intein-chitin-binding domain fusion protein were loaded on an affinity column of chitin beads and washed with 100-column volume of Buffer A containing 0.1% Triton X-100, Wash with 20-column volume of Buffer A without Triton X-100.
  • the recombinant NSD2-SET-bound chitin beads were washed with 10-bead volume of Buffer A containing 10 mM ATP (adenosine triphosphate) and 2.5 mM MgCl 2 . Incubate for 4 to 48 hours in buffer A containing 50 mM 2-mercaptoethanol to cut NSD2-SET protein from chitin beads, elute with buffer A, and concentrate using Amicon Ultra centrifugal filter Then, it was used for the methyltransferase assay. A portion of purified NSD2-SET was analyzed by SDSPAGE. Soluble, pure NSD2-SET was identified of the expected molecular weight of 33.2 KDa on Coomassie stained gel (FIG. 6B). Recombinant NSD2-SET retained stable and catalytic activity after storage at 80.
  • Buffer A containing 10 mM ATP (adenosine triphosphate) and 2.5 mM MgCl 2 .
  • buffer A containing 50 m
  • the compound was purchased from MolPort (http://www.molport.com/) (Table 2) and prepared in> 99.9% purity in dimethyl sulfoxide (DMSO) (D8418 Sigma).
  • Histone methyltransferase activity of NSD2-SET on H3K36 was measured according to the manufacturer's protocol using a colorimetric quantification kit (Epigentek, USA). Purified recombinant NSD2-SET (4.0 g, final 2.42 M) was preincubated with recombinant human histone H3.1 (5 M) (New- England Biolabs NEB, USA) and in C2 buffer of the assay kit. The concentration of inhibitor / DMSO or DMSO alone (0 mM inhibitor) in was measured. The recombinant histones used in this assay did not undergo any potential modifications in production in E. coli and were confirmed using ESI-TOF mass spectrometry according to the manufacturer's (NEB) instructions.
  • NEB manufacturer's
  • Methyl group donor 50 M was added to the preculture mixture and immediately transferred to strip wells and incubated in the dark at room temperature for 120 minutes.
  • Mono-methylated H3K36 (H3K36me1) was captured using anti-mono-H3K36 antibody attached to the bottom of the strip wells.
  • Excess purified NSD2-SET, histone H3, inhibitors, and Adomet were removed by washing, and antibody-H3K36me1 with labeled detection antibody followed by color development reagent was detected.
  • Strip wells were analyzed at 450 nm with ELISA plate reader. The level of H3K36me1 is proportional to the intensity of absorbance. Assays were performed three times independently. Results were normalized to a control without enzymes.
  • the crystal structure of the SET domain of NSD1 (PDB: 3OOI-a.a. 1850-2080) was used as a template for constructing the SET domain of NSD2 (a.a. 971-1202).
  • the sequence of NSD2-SET (a.a. 971-1202) shares 75.9% identity and 90.1% similarity with template NSD1-SET (PDB: 3OO1).
  • 100 models were prepared using Modeler V9.5. According to the intrinsic modeler function, residue-positioning was performed on the optimal model using the SCWRL4 program. Stereochemistry was confirmed using PROCHECK. The model was manually checked using a COOT.
  • the model of NSD2-SET had an H-factor of 18.1%.
  • the quality and accuracy of the model set was evaluated with the H-factor. This is a new quality metric in homology modeling. Due to the high sequence conservation of the SET domain between NSD1 and NSD2, modeling of NSD2-SET represents an ideal case.
  • Histone tail H3K36 (a.a. 32-38) peptides were constructed manually in the COOT.
  • the structural overlay between the crystal structure of SET8 bound to NSD1-SET (PDB: 3OOI) and histone H4 peptide (PDB: 3F9Y) was obtained by placing the H3K36 (aa 32-38) peptide within the histone binding position of the closed structural model of NSD2. It was used to manually position and fit.
  • Structural overlay was performed using the SSM algorithm in the COOT.
  • Peptide-NSD2-SET complexes were completely solvated in a water bath (140 ⁇ 100 ⁇ 110) using VMD 1.9.
  • AutoDock Vina was used to perform docking with Clean Drug-Like compounds downloaded from ZINC docking database version 11 42. Missing hydrogen atoms on open NSD2-SET were added using the PDB2PQR program and the CHARMM force field. Ligands were prepared with AutoDock tools (ADT) v1.5.4 r29. Docking grid size and position were manually set using ADT. The lattice size (22x20x20) was large enough to cover the open NSD2-SET and was the center of the enzymatic channels identified in NSD1-SET.
  • NSD2 / MMSET is a major therapeutic target for multiple myeloma. Multiple myeloma is a very low survival rate and malignancy without treatment. HMTase inhibitors are very rare and only one NSD2 inhibitor, MCTP39, SAM competitor, has been identified to date. In the present invention, using a structure-based discovery approach, we identified small molecules that inhibit H3K36 HMTase activity of NSD2 in vitro .
  • NSD2 The structure of NSD2 is not yet known, and the closest crystal structure identified is the apoSET domain of NSD1.
  • FIG. 6 is a diagram showing a structure of NSD2 / MMSET and a model of an open SET domain including LEM-14.
  • NSD2 Primary structure of NSD2: PWWP domain; PHD zinc finger domains; SET HMTase (histone methyl transferase) including preSET and postSET. The control loop closing the histone-binding portion is marked in red.
  • NSD2-SET of open structure was modeled using long-term MD simulation.
  • H3 peptide a.a. 32-38
  • the NSD2-SET-H3K36 (a.a. 32-38) complex was intentionally made into a stereoscopically labile structure.
  • Energy minimization and long-term MD simulations relaxed steric constraints and allowed the SET domain to accommodate substrates (FIGS. 6C and D). MD simulations allowed the complex to stabilize with a stable structure.
  • NSD2-SET experienced significant displacement with ⁇ 45 rotations and ⁇ 6 translations at the ends, which were very largely negatively coupled joint grooves suitable for docking of H3 or H4 tails.
  • FIG. 6D To open (FIG. 6D).
  • Both NSD1-SET and NSD2-SET have a recognition sequence comprising at least 7 amino acids in a portion of H4K20 HMTase SET8.
  • BIX-01294 is a histone-tail mimetic that targets the SET domain of the G9a-like protein HMTase.
  • HMTase inhibitors BIX-01294, BIX-01338, and ketocin have molecular weights of 492 Da, 535 Da, and 696 Da, respectively (FIG. 9).
  • BIX-01294, BIX-01338, and ketosine have a positive electrostatic field with steric hindrance that matches the binding groove of histone tails.
  • Figure 8 is a diagram showing the concentration response curve of the inhibitor for NSD2-SET H3K36 mono-methylation activity. NSD2-SET H3K36 mono-methylation activity was indicated at various concentrations of candidate inhibitors. Concentration response curves and IC50 of LEM-06, LEM-14, and BIX-01294 were expressed using GraphPad Prism 6.0.
  • LEM-06 which is weaker than LEM-14 and BIX-01294, results in weak stabilization due to LEM-15 and BIX-01294 having five hydrogen bonds in the SET domain, while LEM-06 has three hydrogen bonds. This is illustrated by (Fig. 9). It is not clear why other LEMs do not show significant H3K36me1 HMTase inhibitory effects in vitro . However, a possible explanation is in the molecular refraction of the tested molecules that effectively compete with binding to histone H3.1. LEM-14 and BIX-01294 both have the strongest positive electrostatic fields compared to other LEMs, which may be related to the intensity of interaction with the negatively charged surface of histone-tail binding domains (FIGS. 6D and 11). ).
  • BIX-01294 binds to histone-binding grooves of HMTase G9a and inhibits activity with IC 50 of 3M.
  • derivatives of BIX-01294 can inhibit the family of H3K9 Jumonji demethylase with an IC 50 of 0.05-75M.
  • LEM-14 and BIX-01294 bind with docking energies of -9.2 Kcal / mol and -7.6 Kcal / mol, respectively. This is in stark contrast to LEM-14 and BIX-01294 making a more preferred binding to histone-tail pockets with docking energies of -10.7 Kcal / mol and 9.7 Kcal / mol, respectively (Table 2).
  • both LEM-14 and BIX-01294 are bulkier than MCTP39 or AdoMet, and sterically constrained binding into SAM-binding bags of electrons' NSDs consumes more energy and reduces the likelihood of occurrence.
  • derivatives of LEM-14 can be used as specific NSD2 / MMSET inhibitors suitable for a variety of tumors, including multiple myeloma.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Public Health (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Medicinal Chemistry (AREA)
  • Animal Behavior & Ethology (AREA)
  • Veterinary Medicine (AREA)
  • Epidemiology (AREA)
  • Mycology (AREA)
  • Nutrition Science (AREA)
  • Engineering & Computer Science (AREA)
  • Food Science & Technology (AREA)
  • Polymers & Plastics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

본 발명은 신규한 히스톤 메틸 트랜스퍼라아제 억제제에 관한 것이다. 또한, 본 발명은 상기 신규한 히스톤 메틸 트랜스퍼라아제 억제제를 포함하는 약학적 조성물 또는 식품 조성물에 관한 것이다. 또한, 본 발명은 상기 신규한 히스톤 메틸 트랜스퍼라아제 억제제를 이용하여 암을 치료하는 방법에 관한 것이다.

Description

신규한 히스톤 메틸 트랜스퍼라아제 억제제 및 그 용도
본 발명은 신규한 히스톤 메틸 트랜스퍼라아제 억제제에 관한 것이다.
또한, 본 발명은 상기 신규한 히스톤 메틸 트랜스퍼라아제 억제제를 포함하는 약학적 조성물 또는 식품 조성물에 관한 것이다.
또한, 본 발명은 상기 신규한 히스톤 메틸 트랜스퍼라아제 억제제를 이용하여 암을 치료하는 방법에 관한 것이다.
다양한 암 발생에 있어서, 후생성 (epigenetic) 탈조절 (deregulation)이 매우 중요한 요소로 조명되고 있다. NSD1, NSD2/MMSET/WHSC1 및 NSD3/WHSC1L1은 핵 수용체 결합 SET 도메인 (nuclear receptor binding SET domain, NSD) 패밀리를 이루며 히스톤메틸 트랜스퍼라아제 (histone methyltransferase, HMTase) KMT3 패밀리로 분류된다. NSD는 크로마틴의 유지에 관련되는 히스톤 변형제이다. NSD는 대부분 크로마틴의 히스톤 H3 라이신 36 (H3K36) 및 히스톤 H4 리신 20 (H4K20)을 메틸화하며, in vivo NSD1, NSD2, 및 NSD3는 각기 상이한 기작으로 작용한다. 구체적으로 NSD2 및 NSD3의 경우 과성장 표현형에 실질적으로 기여하지 않는 반면, NSD1 유전자 변형에서는 관찰된다. 다만, NSD 패밀리 구성들이 서로를 대체할 수 있는지 여부에 대해서는 아직 밝혀진바 없다. NSDs, 특히 NSD2는 다양한 암의 발생 및 진행에 중요한 역할을 하고 있으며, 매우 중요한 약물 타겟으로 판단되고 있다. NSD1의 증폭은 다발성 골수종 (multiple myeloma), 폐암, 신경아세포종 (neuroblastoma), 교아종 (glioblastoma)에서 관찰되고 있다. NSD1 및 NSD2의 증폭은 암세포로의 세포 변형을 촉발한다. NSD3은 폐암에서 역할을 수행하며 유방암 세포주 및 일차 유방암종에서 증폭된 것으로 확인된다. NSD2/MMSET (multiple myeloma SET)은 전립선암, 다발성 골수종을 포함하는 대부분의 암 유형에서 종양의 공격력 및 예후에 관련된다. NSD2은 고형 종양, 특히 유방암, 골수종 및 교아종에서 과발현하여, H3K36me2의 전체 수준 (global level)의 비정상적인 증가를 야기한다. 전립선암에서의 NSD2의 과발현은 후생적 이상 (epigenetic aberration)을 유발하여 전이성 표현형 (metastatic phenotype)을 유도한다. NSD2/MMSET은 다발성 골수종 특히, 다른 종류와 비교하여 가장 좋지 않은 예후를 나타내는 t(4;14) 골수종에 대한 치료학적 개입 (therapeutic intervention)에 있어서 중요한 초점이다. 다발성 골수종은 비호지킨림프종에 이어서 두번째로 흔한 혈액암이다. 아직까지 다발성 골수종에 대한 치료 및 효과적인 치료방법이 존재하지 않는다.
DNA 메틸트랜스퍼라아제 (DNMTs), 히스톤 메틸트랜스퍼라아제 및 히스톤 데아세틸라아제 (HDAC)를 표적하는, 크로마틴 리모델링 억제제는 항암화학요법 및 암예방화학요법 모두에서 추구되고 있다. 몇몇의 DNA-메틸화 및 히스톤 데아세틸라아제 억제제가 최근 임상 시험 단계에 와있다. HMTase는 신규한 시료 표적이며, HMTase 억제제는 아직 부족하고 매우 적은 양의 화합물이 보고되어 있다. 특히, GlaxoSmithKline Inc. 및 Epizyme Inc.가 HMTase DOT1L 및 EZH2 잠재적 억제제를 발견하여 큰 진보를 이루었다. DOT1L은 정규적인 SET 도메인을 포함하고 있지 않은바, 다른 HMTase와 구별된다. HMTase inhibitor인, BIX-01294 및 BIX-01338는 각각 3 및 5 IC50으로 G9a에 효과를 나타낸다. 또한, Chaetocin은 0.8 의 IC50으로 Su(var)3-9를 억제한다. 중요하게, Liu et al.는 15 nM의 IC50의 UNC0224과 같은, 몇몇의 G9a 억제제의 형성을 완료하였다. Epizyme Inc. 및 GlaxoSmithKline Inc 의 G9a 및 EZH2에 대한 연구자들은 나노몰 수준의 IC50의 HMTase 억제제를 보고하였다. 다만, 단 하나의 NSD2 억제제 (MCTP39) 만이 IC50 이 ~3 인 것으로 확인하고 최근 특허등록되었다.
리신-HMTase의 촉매적 메커니즘은 공인자 (cofactor) SAM (SAdenosylmethionine)과 Lysine-NH3 기질간의 선형 SN2 친핵 공격을 통하여 수행된다. SAM은 양 결합부위 사이의 인터페이스에 위치한 채널 내로 리신 기질이 깊게 확장 되는 히스톤-꼬리 큰 결합 그루브에 인접하는 작은 구멍 (cavity) 내로 결합한다.
종래 본 발명자는 SET8에서 확인된 것과 유사하게 NSD1의 SET 도메인이 7-아미노산 펩티드를 수용한다는 것을 확인하였다. 또한 본 발명자는 SET 및 postSET 서브도메인 간의 인터페이스에서의 작은 루프의 회전을 통한 NSD1 의 SET 도메인의 개시 메커니즘을 입증하였다. 이 조절-루프는 리신-기실의 안전벨트와 같이 작용하여 기질 인식 및 촉매적 메커니즘에 모두 참여한다. 이 조절-루프는 SET 도메인에 히스톤-꼬리를 강력하게 고정시키는 리신-기질의 상부에 위치한다. 히스톤 꼬리 결합 부위는 SET 및 postSET 서브도메인 모두의 일부분과 관련된다. SET 도메인의 시퀀스는 NSDs 간에 매우 보존되어 있으며, 따라서 NSD1에서 기술된 것과 동일한 메커니즘이 NSD2 및 NSD3에서도 수행된다고 예상된다. 특히, NSDs는 계통학적으로 다른 알려진 HMTases와 거리가 있다 (도 2). HMTases의 억제는 SAM 결합 주머니 또는 히스톤-꼬리 결합 틈 (cleft)을 표적함으로써 이루어진다. EZH2에서, 억제제 GSK343는 SAM 경쟁자로서 EZH1에 대한 억제활성을 가지며, SET7 및 PRMT3의 억제 효과 역시 갖는다. 흥미롭게도, EZH1 및 EZH2은 NSDs 에 대하여 매우 가까운 SET 도메인 시퀀스를 가지며, 이는 NSDs 특히, NSD2에 대한 EZH2 억제제의 선별에 중요할 수 있다. MCTP39는 NSD2에 대한 SAM 경쟁자로서, 최근 특허등록되었다. SAM 결합 주머니는 NSD1 내의 SET 도메인의 결정 구조 내에 부분적으로 묻혀있으며, SAM을 안정화 시키는 주요 잔기는 NSDs간에 높게 보존되어 있다. 대조적으로, 더 크고 더 접근이 용이한 히스톤-꼬리 결합 부위의 경우, SAM 결합 주머니와 비교하여, 더 큰 시퀀스 이질성 (heterogeneity)을 가진다. 히스톤 기질의 결합을 안정화하는데 관여하는 잔기는 SAM 결합 부위와는 다르게 NSDs 간에 보전되어 있지 않다. 이는 HMTase G9a-유사 단백질과 히스톤 꼬리 결합 도메인을 표적하는 히스톤-꼬리 모방 억제제인, BIX-01294와의 결정 구조에서 관찰할 수 있었다. 또한, 히스톤-꼬리의 NSDs SET 도메인과의 결합에서 특이적 유동적인 조절 루프의 관여는, 히스톤-꼬리 결합 틈이 NSD2에서 특이적이고 선택적인 억제를 달성하기 위하여 개발될 수 있음을 암시한다.
따라서 본 발명에서, 본 발명자는 히스톤-꼬리 결합 그루브에 대한 신규한 NSD2 억제제를 확인하였으며, 이는 NSD2-SET의 히스톤-꼬리 결합 도메인의 오픈된 형태의 분자 모델에 대한 가상 리간드 스크리닝을 이용하여 수행하였다. 또한, 본 발명자들은 상기 신규한 NSD2 억제제의 유도체를 개발하기에 이르렀다.
본 발명의 일 양상은 신규한 히스톤 메틸 트랜스퍼라아제 억제제을 제공하는 것이다.
또한, 본 발명의 일 양상은 상기 신규한 히스톤 메틸 트랜스퍼라아제 억제제를 포함하는 약학적 조성물 또는 식품 조성물을 제공하는 것이다.
또한, 본 발명은 상기 신규한 히스톤 메틸 트랜스퍼라아제 억제제를 이용하여 암을 치료하는 방법에 을 제공하는 것이다.
본 발명의 일 양상은 하기의 식으로 이루어진 화합물 또는 이의 약제학적으로 허용되는 염을 제공한다:
Figure PCTKR2014002796-appb-I000001
여기서,
상기 A 기는 하기의 기로 이루어진 군으로부터 선택된 것이고,
Figure PCTKR2014002796-appb-I000002
상기 B 기는 하기의 기로 이루어진 군으로부터 선택된 것이며,
Figure PCTKR2014002796-appb-I000003
상기 C 기는 하기의 기로 이루어진 군으로부터 선택된 것으로서;
Figure PCTKR2014002796-appb-I000004
상기 R1은 메틸, 에틸, 다이-메틸 및 i-Pr로 이루어진 군으로부터 선택된 것이고,
R2 및 R3는 독립적으로, 수소, 치환 또는 비치환된 알킬기, 치환 또는 비치환된 시클로알킬기, 및 이종원소로 O, N, S 또는 P를 갖는 치환 또는 비치환된 헤테로시클로알킬기로 이루어진 군으로부터 선택된 것이며,
R4는 플루오르, 염소, 메틸, 및 OMe으로 이루어진 군으로부터 선택된 것이고,
R5는 메틸, 에틸, tert-부틸, 치환 또는 비치환된 페닐, 및 이종원소로 O, N, S 또는 P를 갖는 치환 또는 비환치된 페닐기로부터 이루어진 군으로부터 선택된다.
상기 화합물은 히스톤 라이신-메틸 트랜스퍼라아제의 억제제일 수 있으며, 상기 히스톤 메틸 트랜스퍼라아제는 바람직하게는 NSD (nuclear receptor binding SET domain) 패밀리이며, 더욱 바람직하게는 NSD2/MMSET일 수 있다.
상기 히스톤 라이신-메틸 트랜스퍼라아제의 억제제는 가장 바람직하게는 하기의 화학식으로 이루어진 것인, 화합물일 수 있다.
Figure PCTKR2014002796-appb-I000005
또한, 본 발명의 일 양상은 상기 화합물을 유효성분으로 포함하는, 암의 예방 또는 치료용 약학적 조성물을 제공한다. 상기 암은 림프종 (lymphoid malignancies), 급성 림프구성 백혈병 (Acute lymphoblastic leukemia, ALL), 만성 림프구성 백혈병 (Chronic lymphocytic leukemia, CLL), 골수종 (myeloma), 피부암, 원발성 흑색종 (primary melanomas), 난황주머니 종양 (Yolk sac tumour), 유방암, 폐암, 대장암, 췌장암, 난소암, 방광암, 전립선암, 신장암, 뇌종양(brain cancer), 자궁경부암, 백혈병, 육아종증(granulomatosis), 및 세포 형질 변환 (cellular transformation)일 수 있으며, 가장 바람직하게는 다발성 골수종일 수 있다.
또한, 본 발명의 일 양상은 상기 화합물을 유효성분으로 포함하는, 암의 예방 또는 개선용 식품 조성물을 제공한다.
또한, 본 발명의 다른 양상은 상기 화합물의 약학적으로 효과적인 양을 개체에게 투여하는 단계를 포함하는, 암을 치료하는 방법을 제공한다.
본 발명에 따른 신규한 화합물은 히스톤 라이신-메틸 트랜스퍼라아제 억제제를 효과적으로 억제할 수 있으므로 히스톤 라이신-메틸 트랜스퍼라아제가 관여하는 다양한 종양에서 치료제로 사용할 수 있다.
도1는 NSD1, NSD2, 및 NSD3의 일차 구조의 모식도이다: NSD 구성원 모두는 2개의 PWWP 도메인, 4개의 PHD 아연 핑거 (zinc finger) 도메인 및 촉매 도메인 (catalytic domain)을 포함한다. 촉매도메인은 HMTase 활성을 가지며, pre-SET, SET, 및 post-SET 도메인을 포함한다. 히스톤-결합 부분을 덮는 조절 루프 (regulatory loop)를 붉은 색으로 표시하였다.
도 2는 in vitro 에서 H3 및 H4 기질에 대한 NSD1-CTD, NSD2-CTD, 및 NSD3-CTD의 HMTase 활성을 나타낸 도이다.
도 3은 촉매 도메인의 열린 및 닫힌 구조 및 분자 모델링을 확인한 도이다.
좌측 패널: 촉매 도메인의 구조는 삼각형 방식 (triangular fashion)으로 정렬된 3개 군의 정규형 -시트 및 보존된 -헬릭스와 매우 인접한 두 -시트의 1개 군으로 이루어져, 리신-히스톤 리간드의 결합을 위한 틈을 형성한다. 공인자 AdoMet는 채널을 통하여 CD에 적합한 구성으로 결합한다. 유동적 조절 루프를 적색으로 표시하였다. 조절 루프의 이동을 굽은 역화살로 표시하였다.
우측패널: MD 시뮬레이션 후 H3-펩티드 (a.a. 32-38)에 결합된 NSD-CDs의 모델. H3K36를 표시하였다. 정전기적 표면을 하기와 같이 색으로 표시하였다: 푸른색: 양전하; 붉은색; 음전하. 단위 +5/-5 kb.T.ec -1.
도 4는 H3K4, H3K9 및 H3K27 결합의 분자 행렬식 (Molecular determinant)을 나타내는 도이다.
펩티드 H3K4 (a.a.1-7), H3K9 (a.a. 5-11), 및 H3K27 (a.a. 23-29)을 수직으로 맞추고 잔기의 원자 디테일을 보라색으로 나타내어다. NSD의 CDs로부터의 아미노산의 상호작용을 갈색으로 표시하고 숫자를 부여하였다. 녹색 점선을 수소결합을 나타낸다. 소수성 상호작용은 생략하였다. 이 도면은 프로그램 Ligplot를 이용하여 구성하였다.
도 5는 H3K36, H3K79 및 H4K20 결합의 행렬식은 나타내는 도이다. 펩티드 H3K36 (a.a. 32-38), H3K79 (a.a. 75-81), 및 H4K20 (a.a.16-22)을 나타내었다.
도 6은 NSD2/MMSET의 구조 및 LEM-14을 포함하는 열린 SET 도메인의 모델을 나타낸 도이다.
(A) NSD2의 일차구조: PWWP 도메인; PHD zinc 핑거 도메인; preSET 및 postSET를 포함하는 SET HMTase (histone methyl transferase). 히스톤-결합 부분을 닫는 조절 루프를 붉은 색으로 표시하였다.
(B) 정제후의 재조합 NSD2-SET 를 SDS-PAGE 겔 상에서 쿠마시 염색한 결과이다.
(C) 가상 리간드 스크리닝을 통하여 LEM-14와 가장 선호되는 구조로 결합되어 있는 열린 NSD2-SET 모델이다. 조절 루프는 붉은 색으로 표시하였다.
(D) LEM-14와 결합한 NSD2-SET의 분자 표면을 나타낸 도이다. 정전기적 표면을 아래와 같이 색으로 표시하였다:
푸른색: 양전하; 붉은색: 음전하, 단위 +5/-5 kb.T.ec -1.
도 7은 HMTases 간의 및 NSD의 SET 도메인 간의 서열 관련성을 나타낸 도이다.
(A) 인간 및 효모 HMTases 의 SET 도메인의 단백질 서열에 대한 비뿌리형의 계통수 (Unrooted phylogenic tree). NSD 패밀리는 알려진 다른 HMTases (붉은색)과는 거리가 멀다. 이 계통수는 CLUSTAL 2.1을 이용한 다중 서열 정렬 후 NJ (neighbor-joining) 방법을 이용하여 설계하였다. Hs: Homo sapiens; Sc: Saccharomyces cerevisiae; Sp: Saccharomyces pombe
(B) NSD1, NSD2 및 NSD3의 preSET, SET 및 postSET 서브도메인의 서열 정렬 결과. 파란색 박스 안의 서열이 히스톤-꼬리 결합에 관여하는 부분. 붉은색 박스의 서열이 S-Adenosylmethionine에 반응성인 부분. 다중서열정렬은 CLUSTAL 2.1으로 수행하였다.
도 8은 NSD2-SET H3K36 모노-메틸화 활성에 대한 억제제의 농도반응 곡선을 나타낸 도이다. NSD2-SET H3K36 모노-메틸화 활성을 후보 억제제의 다양한 농도에서 표시하였다. LEM-06, LEM-14, 및 BIX-01294의 농도반응곡선 및 IC50을 GraphPad Prism 6.0를 이용하여 표시하였다.
도 9는 LEM-06, LEM-14 및 BIX-01294의 화학 구조이다.
도 10은 NSD2의 히스톤-꼬리 결합 그루브에서 억제제의 결합에 대한 분자적 디테일을 나타난 도이다. (A) LEM-14, (B) LEM-06, (C) BIX-01294. 노란색 점선은 수소결합을 나타낸다.
도 11은 NSD2 히스톤-꼬리 결합 그루브에 도킹된 BIX-01294 및 LEM-06의 결합을 나타낸 도이다. BIX-01294 (A) 및 LEM-06 (B)와 결합된 NSD2-SET의 열린 구조의 분자 표면 모델. 푸른색: 양전하; 붉은색: 음전하, 단위 +5/-5 kb.T.ec -1.
본 발명의 일 양상은 하기의 식으로 이루어진 화합물 또는 이의 약제학적으로 허용되는 염을 제공한다:
Figure PCTKR2014002796-appb-I000006
여기서,
상기 A 기는 하기의 기로 이루어진 군으로부터 선택된 것이고,
Figure PCTKR2014002796-appb-I000007
상기 B 기는 하기의 기로 이루어진 군으로부터 선택된 것이며,
Figure PCTKR2014002796-appb-I000008
상기 C 기는 하기의 기로 이루어진 군으로부터 선택된 것으로서;
Figure PCTKR2014002796-appb-I000009
상기 R1은 메틸, 에틸, 다이-메틸 및 i-Pr로 이루어진 군으로부터 선택된 것이고,
R2 및 R3는 독립적으로, 수소, 치환 또는 비치환된 알킬기, 치환 또는 비치환된 시클로알킬기, 및 이종원소로 O, N, S 또는 P를 갖는 치환 또는 비치환된 헤테로시클로알킬기로 이루어진 군으로부터 선택된 것이며,
R4는 플루오르, 염소, 메틸, 및 OMe으로 이루어진 군으로부터 선택된 것이고,
R5는 메틸, 에틸, tert-부틸, 치환 또는 비치환된 페닐, 및 이종원소로 O, N, S 또는 P를 갖는 치환 또는 비환치된 페닐기로부터 이루어진 군으로부터 선택된다.
상기 화합물은 히스톤 라이신-메틸 트랜스퍼라아제의 억제제일 수 있으며, 상기 히스톤 라이신-메틸 트랜스퍼라아제는 바람직하게는 NSD (nuclear receptor binding SET domain)이며, 더욱 바람직하게는 NSD2일 수 있다.
상기 히스톤 라이신-메틸 트랜스퍼라아제의 억제제는 가장 바람직하게는 하기의 화학식으로 이루어진 것인, 화합물일 수 있다.
Figure PCTKR2014002796-appb-I000010
본 발명은 상기 화합물의 광학 이성질체, 거울상이성질체, 부분입체이성질체 및 기하 이성질체를 포함한다.. 본 발명은 또한 화합물의 모든 호변이성질체 형태를 포함한다.
본 발명의 또 다른 양상는 상기 화합물의 N-옥사이드, 수화물, 용매화물, 약제학적으로 허용되는 염, 복합체 및 프로드럭을 제공한다.
본 발명의 화합물은 또한 본 발명의 범위 내에 있는 염을 형성한다. 본 발명의 상기 화합물에 대한 언급은 달리 언급되지 않는 한 이의 염에 대한 언급을 포함하는 것으로 이해된다. 본원에서 사용된 용어 "염(들)"은 무기 및/또는 유기 산 및 염기로 형성된 산성 및/또는 염기성 염을 나타낸다.
또한, 본 발명의 화합물이 이로 제한되는 것은 아니나 피리딘 또는 이미다졸과 같은 염기성 부분 및 이로 제한되는 것은 아니나 카르복실산과 같은 산성 부분 둘 모두를 함유하는 경우, 쯔비터이온 (zwitterion)("내부염")이 형성될 수 있고 이것은 본원에서 사용된 용어 "염(들)" 내에 포함된다. 다른 염도, 예컨대 제조 동안 적용될 수 있는 분리 또는 정제 단계에서 유용하나, 약제학적으로 허용되는 (즉, 무독성 (요망되지 않는 독물 효과가 최소이거나 없다)) 염이 바람직하다. 본 발명의 화합물의 염은, 예를 들어 본 발명의 화합물을 당량과 같은 산 또는 염기의 소정량과 배지, 예컨대 염이 침전되는 배지 또는 수성 배지에서 반응시키고 냉동 건조시킴에 의해 형성될 수 있다. 특정 경우에, 1을 초과하는 당량의 산 (염기)이 사용되어, 예를 들어 디- 또는 트리- 염을 제공할 수 있었다.
이로 제한되는 것은 아니나 아민 또는 피리딘 또는 이미다졸 고리와 같은 염기성 부분을 함유하는 본 발명의 화합물은 다양한 유기 및 무기 산과 염을 형성할 수 있다. 예시적인 산 부가염으로는 아세테이트 (예컨대, 아세트산 또는 트리할로아세트산, 예를 들어 트리플루오로아세트산으로 형성된 것들), 아디페이트, 알기네이트, 아스코르베이트, 아스파르테이트, 벤조에이트, 벤젠설포네이트, 바이설페이트, 보레이트, 부티레이트, 시트레이트, 캄포레이트, 캄포르설포네이트, 시클로펜탄프로피오네이트, 디글루코네이트, 도데실설페이트, 에탄설포네이트, 푸마레이트, 글루코헵타노에이트, 글리세로포스페이트, 헤미설페이트, 헵타노에이트, 헥사노에이트, 히드로클로라이드, 히드로브로마이드, 히드로요오다이드, 히드록시에탄설포네이트 (예컨대, 2-히드록시에탄설포네이트), 락테이트, 말레에이트, 메탄설포네이트, 나프탈렌설포네이트 (예컨대, 2-나프탈렌설포네이트), 니코티네이트, 니트레이트, 옥살레이트, 펙티네이트, 퍼설페이트, 페닐프로피오네이트 (예컨대, 3-페닐프로피오네이트), 포스페이트, 피크레이트, 피발레이트, 프로피오네이트, 살리실레이트, 숙시네이트, 설페이트 (예컨대, 황산으로 형성된 것들), 설포네이트, 타르트레이트, 티오시아네이트, 톨루엔설포네이트, 예컨대 토실레이트, 운데카노에이트 등이 있다.
이로 제한되는 것은 아니나 카르복실산과 같은 산성 부분을 함유하는 본 발명의 화합물은 다양한 유기 및 무기 염기와 염을 형성할 수 있다. 예시적인 염기성 염으로는 암모늄 염, 알칼리 금속염, 예컨대 나트륨, 리튬 및 칼륨 염, 알칼리성 토류 금속 염, 예컨대 칼슘 및 마그네슘 염, 유기 염기와의 염 (예를 들어, 유기 아민), 예컨대 벤자딘, 디시클로헥실아민, 히드라바민 (N,N-비스(데히드로아비에틸)에틸렌디아민으로 형성됨), N-메틸-D-글루카민, N-메틸-D-글리카미드, t-부틸 아민 및 아르기닌, 라이신과 같은 아미노산과의 염 등이 있다. 염기성 질소-함유 기는 저급 알킬 할라이드 (예컨대, 메틸, 에틸, 프로필 및 부틸 클로라이드, 브로마이드 및 요오다이드), 디알킬 설페이트 (예컨대, 디메틸, 디에틸, 디부틸 및 디아밀 설페이트), 장쇄 할라이드 (예컨대, 데실, 라우릴, 미리스틸 및 스테아릴 클로라이드, 브로마이드 및 요오다이드), 아르알킬 할라이드 (예컨대, 벤질 및 페네틸 브로마이드) 등과 같은 제제로 4차화될 수 있다.
본원에서 사용된 용어 "약제학적으로 허용되는 염"이란 상기 언급된 화합물의 요구되는 생물학적 활성을 보유하고 독물 효과를 최소로 나타내거나 전혀 나타내지 않는 염을 언급한다. 이러한 염의 예로는 이로 제한되는 것은 아니나 무기 산으로 형성된 산 부가염 (예를 들어, 염산, 브롬화수소산, 황산, 인산 및 질산) 및 유기 산, 예컨대 아세트산, 옥살산, 타르타르산, 숙신산, 말산, 아스코르브산, 벤조산, 탄산, 파모산, 알긴산, 폴리글루탐산, 나프탈렌설폰산, 나프탈렌디설폰산, 및 폴리갈락투론산으로 형성된 염이 있다. 화합물은 당업자에게 공지된 약제학적으로 허용되는 4차 염으로서 투여될 수도 있고, 이들은 특히 화학식 (-NR)++Z-(여기에서, R은 수소, 알킬 또는 벤질이고, Z는 클로라이드, 브로마이드, 요오다이드, -O-알킬, 톨루엔설포네이트, 메틸설포네이트, 설포네이트, 포스페이트 또는 카르복실레이트 (예컨대, 벤조에이트, 숙시네이트, 아세테이트, 글리콜레이트, 말레에이트, 말레이트, 시트레이트, 타르트레이트, 아스코르베이트, 벤조에이트, 신나모에이트, 만델로에이트, 벤질로에이트 또는 디페닐아세테이트)를 포함하는 반대이온이다)의 4차 암모늄 염을 포함한다.
본 발명은 본 발명의 화합물의 프로드럭도 포함한다. 용어 "프로드럭"은 담체에 공유적으로 결합된 화합물을 나타내려는 것이고, 프로드럭이 포유동물 피검체에 투여될 때 프로드럭은 프로드럭의 활성 성분을 방출시킬 수 있다. 활성 성분의 방출은 생체내에서 일어난다. 프로드럭은 당업자에게 공지된 기술에 의해 제조될 수 있다. 이러한 기술은 일반적으로 주어진 화합물의 적합한 작용기를 개질시킨다. 그러나 이렇게 개질된 작용기는 일상적인 조작에 의해 또는 생체내에서 원래 작용기를 재생시킨다. 본 발명의 화합물의 프로드럭은 히드록시기, 아미노기, 카르복실기 또는 유사한 기가 개질된 화합물을 포함한다. 프로드럭의 예로는 이로 제한되는 것은 아니나 에스테르 (예컨대, 아세테이트, 포르메이트 및 벤조에이트 유도체), 본 발명의 화합물에서 히드록시 또는 아미노 작용기의 카르바메이트 (예컨대, N,N-디메틸아미노카르보닐), 아미드 (예컨대, 트리플루오로아세틸아미노, 아세틸아미노 등) 등이 있다.
상기 히스톤 메틸 트랜스퍼라아제는 및 "HMTase"는 히스톤의 리신에 하나, 둘 또는 세개의 메틸을 전이하는 것을 촉진하는 효소로, 히스톤-변형 효소이다. 용어 "히스톤"은 어느 종으로부터의 H1, H2A, H2B, H3, H4, 및 H5를 포함한 어떠한 히스톤 단백질을 나타냄을 의미한다.
용어 "히스톤 메틸 트랜스퍼라아제 억제제"는 히스톤 메틸 트랜스퍼라아제와 상호작용하고 그의 효소적 활성을 억제할 수 있음을 의미한다. "히스톤 매틸 트랜스퍼라아제의 효소적 활성을 억제한다"는 표현은 히스톤에서 메틸 기를 전이하는 능력을 감소시킴을 의미한다. 예를 들어, 히스톤 메틸 트랜스퍼라아제 활성의 억제는 약 10% 이상일수 있다. 본 발명의 일부 바람직한 구체예에서, 히스톤 메틸 트랜스퍼라아제 활성의 그러한 감소는 약 50% 이상, 더욱 바람직하게는 약 75% 이상, 더욱 바람직하게는 약 90% 이상이다. 다른 바람직한 구체예에서, 히스톤 히스톤 메틸 트랜스퍼라아제 활성은 95% 이상까지, 더욱 바람직하게는 99% 이상까지 감소된다. IC50값은 히스톤 히스톤 메틸 트랜스퍼라아제의 활성을 50%까지 감소시키는 히스톤 탈아세틸화효소 억제제의 농도이다. 용어 "억제 유효량"은 히스톤 메틸 트랜스퍼라아제 활성의 억제를 야기하는데 충분한 투여량을 나타내기 위함이다.
히스톤 메틸 트랜스퍼라아제는 세포에 존재할 수 있고, 바꾸어 말해 다세포 유기체에 있을 수 있다. 다세포 유기체는, 예를 들어 식물, 진균 또는 동물, 바람직하게는 포유동물 및 더욱 바람직하게는 인간일 수 있다. 진균은 식물 또는 포유동물, 바람직하게는 인간을 감염시킬 수 있어서 식물 또는 포유동물 내에 및/또는 위에 존재할 수 있었다. 히스톤 메틸 트랜스퍼라아제가 다세포 유기체에 있는 경우, 본 발명의 상기 양태에 따른 방법은 유기체에 본 발명에 따른 화합물 또는 조성물을 투여하는 단계를 포함한다. 투여는 제한없이 비경구, 경구, 설하, 경피, 국소, 비내, 기관내 또는 직장내를 포함하는 임의의 경로에 의해 수행될 수 있다. 특히 바람직한 특정 구체예에서, 본 발명의 화합물은 병원 환경에서 정맥내 투여된다. 다른 바람직한 특정 구체예에서, 투여는 경구 경로에 의한 것이 바람직할 수 있다.
또한, 본 발명의 일 양상은 상기 화합물을 유효성분으로 포함하는, 암의 예방 또는 치료용 약학적 조성물을 제공한다. 상기 암은 림프종 (lymphoid malignancies), 급성 림프구성 백혈병 (Acute lymphoblastic leukemia, ALL), 만성 림프구성 백혈병 (Chronic lymphocytic leukemia, CLL), 골수종 (myeloma), 피부암, 원발성 흑색종 (primary melanomas), 난황주머니 종양 (Yolk sac tumour), 유방암, 폐암, 대장암, 췌장암, 난소암, 방광암, 전립선암, 신장암, 뇌종양(brain cancer), 자궁경부암, 백혈병, 육아종증(granulomatosis), 또는 세포 형질 변환 (cellular transformation) 일 수 있으며, 가장 바람직하게는 다발성 골수종일 수 있다.
또한, 본 발명의 일 양상은 상기 화합물을 유효성분으로 포함하는, 암의 예방 또는 개선용 식품 조성물을 제공한다.
또한, 본 발명의 다른 양상은 상기 화합물의 약학적으로 효과적인 양을 개체에게 투여하는 단계를 포함하는, 암을 치료하는 방법을 제공한다.
본 발명의 약제학적 조성물은 당 분야에 널리 공지된 임의의 방법에 의해 제형화될수 있고 제한 없이 비경구, 경구, 설하, 경피, 국소, 비내, 기관내 또는 직장내를 포함하는 임의의 경로에 의해 투여되기 위해 제조될 수 있다. 바람직한 특정 구체예에서, 본 발명의 약제학적 조성물은 병원 환경에서 정맥내 투여된다. 다른 바람직한 특정 구체예에서, 투여는 바람직하게는 경구 경로에 의해 이루어질 수 있다. 약제학적 조성물은 이로 제한되는 것은 아니나 용액 또는 현탁액을 포함하는 임의의 형태일 수 있다. 경구 투여를 위해, 제형은 정제 또는 캡슐의 형태일 수 있다. 비내 투여를 위해, 약제학적 조성물은 분말, 점비제 또는 에어로솔의 형태일 수 있다. 약제학적 조성물은 국소적으로 또는 전신적으로 투여될 수 있다. 담체의 특성은 투여 경로에 좌우될 것이다. 본원에서 사용된 용어 "약제학적으로 허용되는"은 생물학적 시스템, 예컨대, 세포, 세포 배양물, 조직, 또는 유기체와 양립가능하며, 활성성분(들)의 생물학적 활성의 효과를 방해하지 않는 무독성 물질을 의미한다. 따라서, 본 발명에 따른 조성물은, 억제제 외에, 희석제, 충전제, 염, 완충제, 안정화제, 가용화제 및 본 기술분야에 공지된 그 밖의 물질을 함유할 수 있다. 약제학적으로 허용 되는 제형의 제조방법은, 예를 들어, 문헌[Remington's Pharmaceutical Sciences, 18th Edition, ed. A. Gennaro, Mack Publishing Co., Easton, PA, 1990]에 기재되어 있다.
화합물, N-옥사이드, 수화물, 용매화물, 약제학적으로 허용되는 염, 복합체, 프로드럭 또는 혼합물, 또는 이의 라세믹 혼합물, 부분입체이성질체, 거울상이성질체 또는 호변이성질체는 치료되는 환자에게서 심각한 독성 효과를 야기하지 않으며 환자에게 치료적 유효량을 전달하기에 충분한 양으로 약제학적으로 허용되는 담체 또는 희석제에 포함된다. 통상적인 국소 투여량은 적합한 담체 중 0.01-3% wt/wt의 범위일 것이다. 약제학적으로 허용되는 유도체의 효과적인 투여량 범위는 전달하려는 부모 화합물의 중량에 기초하여 산출될 수 있다. 유도체가 본래 활성을 나타내는 경우, 효과적인 투여량은 유도체의 중량을 이용하여 상기대로 산정될 수 있거나, 당업자에게 공지된 임의의 수단에 의해 산정될 수 있다.
치료하려는 특정 질환 또는 질병에 따라서, 그 질환 또는 질병을 치료하기 위해 보통 투여될 수 있었던 추가의 치료제도 본 발명의 조성물에 존재할 수 있다. 대안적으로, 이러한 제제의 투여는 본 발명에 따른 조성물의 투여에 연속되거나 동시에 수행될 수 있다. 바꾸어 말해, 본 발명의 화합물은 단독의 약제학적 제제로서 투여되거나 조합이 어떠한 허용되지 않는 부작용도 일으키지 않는 하나 이상의 다른 추가 치료(약제학)제와 함께 투여될 수 있다. 이것은 암과 같은 과증식성 질병의 치료에 특히 적절할 수 있다. 이러한 예에서, 본 발명의 화합물은 공지된 항암제(들) 뿐만 아니라 이의 혼합물 및 조합물과 조합될 수 있다. 본원에서 사용된 대로, 특정 질병 또는 질환을 치료하기 위해 일반적으로 투여되는 추가의 치료제는 "치료하려는 질병 또는 질환에 적합한" 것으로서 공지되어 있다. 본원에서 사용된 대로, "추가 치료제"는 예를 들어 화학요법제 및 다른 항-증식제를 포함한다. 본 발명의 바람직한 특정 구체예에서, 조성물은 본 발명에 따른 하나 이상의 화합물(들)을 포함한다. 본 발명의 바람직한 특정 구체예에서, 조성물은 본 발명에 따른 하나 이상의 화합물(들) 및/또는 당업자에게 공지되어 있거나 발견될 또 다른 HMTase 억제제를 포함한다. 이러한 조성물의 활성 성분들은 바람직하게는 상승적으로 작용하여 치료 효과를 일으킨다.
실시예 1: NSD1, NSD2/MMSET/WHSC1, 및 NSD3/WHSC1L에 의한 히스톤 리신 메틸화
본 발명자들은 NSDs에 의한 히스톤 H3의 인식 및 메틸화에 대하여 살펴보았다. 본 발명자들은 일관된 실험적 접근을 통하여 3개의 NSD의 CTD (carboxyl terminal domain)을 살펴보는 것에 집중하였다. NSDs-CTD는 촉매적 중심부 및 히스톤-인식 모듈 내에 pre-SET, SET, post-SET, 및 PHD4 도메인을 포함한다. 본 발명자들은 in vitro H3K4, H3K9, H3K27, H3K36, H3K79, 및 H4K20에서의 NSD1, NSD2, 및 NSD3의 CTD의 메틸화 특성을 조사하였다. 다음, 본 발명자들은 분자 동력학적 (molecular dynamic) 시뮬레이션을 이용하여 히스톤 꼬리와 NSD 촉매적 SET 도메인의 결합을 설명하였다.
1.1 클로닝
HMTase인 NSDs 패밀리에 속하는 NSD1, NSD2, 및 NSD3의 일차구조를 도 1A에 나타내었다.
도1는 NSD1, NSD2, 및 NSD3의 일차 구조의 모식도이다: NSD 구성원 모두는 2개의 PWWP 도메인, 4개의 PHD 아연 핑거 (zinc finger) 도메인 및 촉매 도메인 (catalytic domain)을 포함한다. 촉매도메인은 HMTase 활성을 가지며, pre-SET, SET, 및 post-SET 도메인을 포함한다. 히스톤-결합 부분을 덮는 조절 루프 (regulatory loop)를 붉은 색으로 표시하였다.
NSD1, NSD2, 및 NSD3의 CTD (carboxyl terminal domain)를 하기와 같이 클로닝하였다.;
NSD1-CTD (1338 bp, 5325-6663 nt; encoding 446 a.a., 1775-2221 a.a.), NSD2-CTD (1287 bp, 2808-4095 nt; encoding 429 a.a., 936- 1365 a.a.), 및 NSD3-CTD (1344 bp, 2967-4311 nt; encoding 484 a.a., 989- 1437 a.a.)를 인간 간 cDNA 라이브러리 (TAKARA, Japan)를 주형으로 이용한 PCR로 증폭하였다.
사용된 포워드 및 리버스 프라이머는 하기와 같다.
NSD1-CTD의 경우,
5- GCTGAGGTCGAC(SalI)CATCCTCGAGCTGTTCCTTCC-3 및
5- CGGTACGCGGCCGC(NotI)GCACATACTCACGGATCTCCCC-3;
NSD2-CTD의 경우,
5-CAGGCGCATATG(NdeI)TTCCCGTACATGGAGGGGGAC-3 및
5-CGCCTGCTCGAG(XhoI)TTTGCCCTCTGTGACTCTCCG-3;
NSD3-CTD 의 경우
5-CTGAACGTCGAC(SalI)GGCCTTAAACATGACTTGGGG-3 및
5-GACACCGCGGCCGC(NotI)ATTCTTTTACTTC TTCTCCATG-3.
증폭된 NSD1-CTD NSD3-CTD 가닥 (SalI 및 NotI 제한효소 자리를 포함) 및 NSD2-CTD 가닥 (NdeI 및 XhoI 제한 효소 자리를 포함)을 단백질 발현 인테인 (Intein)-테그된 벡터, pTYB2 또는 pTYB12 (New England Biolabs, USA)의 다-클론자리의 제한효소 자리에 삽입하였다.
1.2 단백질 발현 및 정제
NSD1-CTD, NSD2-CTD, 및 NSD3-CTD (NSD-CTDs)를 포함하는 pTYB2 또는 pTYB12 플라스미드로 Escherichia coli 발현 주 (ER2566 또는 BL21)를 형질전환시켰다. 형질전환된 세포주를 100 g/mL 암피실린을 포함하는 LB 배지에서 배양하고, 재조합 NSD-CTDs의 발현을 250 M IPTG (isopropyl 1-thio-D-galactopyranoside)로 15 에서 4시간동안 유도하였다.
E. coli 세포를 회수하고 동결-융해 방법 (freeze-and-thaw method)으로 용해하고, 0.1% Triton X-100 및 1 mM PMSF (phenylmethanesulfonylfluoride)를 포함하는 버퍼 A [20 mM Tris (pH 8.0), 500 mM NaCl, 및 0.1 mM EDTA]에서 배양한 뒤, 얼음 상에서 20회 음파처리 (sonication)하였다.
NSD-CTD-Intein-CBD (chitin-binding domain) 융합 단백질을 포함하는 세포 추출물을 키틴 비드의 친화도 컬럼 상에서 로딩시키고, 0.1% Triton X-100를 포함하는 100-컬럼 부피의 버퍼 A로 워시한 뒤, Triton X-100를 포함하지 않는 20-컬럼 부피의 버퍼 A로 워시하였다. 재조합 단백질에 결합된 박테리아 샤페론을 제거하기 위하여, 10 mM ATP (adenosine triphosphate) 및 2.5 mM MgCl2를 포함하는 10-비드 부피의 버퍼 A로 재조합 NSDCTD- 결합된 키틴 비드를 워시하였다. 뒤이어, 박테리아 샤페론을 제거하기 위하여 친화도 컬럼을 20 비드 부피의 버퍼 A로 워시하였다. 50 mM 2-머캅토에탄올 (mercaptoethanol)을 포함하는 버퍼 A 내에서 4 에서 48시간동안 인큐베이션하여 키틴 비드로부터 NSD-CTD 단백질을 잘라내었다. 버퍼 A로 용출한 뒤, Amicon Ultra 원심분리 필터를 이용하여 농축한 뒤, 메틸트랜스퍼라아제 (methyltransferase) 어세이에 이용하였다. 정제된 NSD-CTDs의 일부를 SDSPAGE로 분석하였다. 쿠마시 염색 겔에서 50.8 kDa (NSD1-CTD), 48.9 KDa (NSD2-CTD) 및 51.1 KDa (NSD3-CTD)의 예상된 분자량의, 용해성의 순수 NSD-CTDs을 확인하였다 (도 1B). 재조합 NSD2-SET은 80 에서 보관될 때, 이후에서 안정적이고 촉매적 활성을 유지하였다.
1.3 히스톤 메틸트랜스퍼라아제 (Histone Methyltransferase) 어세이
H3K4, K9, K27, K36, K79, 및 H4K20 에서의 NSD-CTDs의 히스톤 메틸트랜스퍼라아제 활성을 비색 정량 키트 (colorimetric quantification kit) (Epigentek, USA)를 제조사의 프로토콜에 따라 측정하였다. H3K36, H3K79, 및 H4K20의 경우, 정제된 재조합 NSD-CTDs (0.2 g 및 2.0g)를 재조합 히스톤 H3 또는 H4 (Epigentek, USA)와 함께 배양하고, 특이적 항체로 코팅된 스트립 웰 내의 메틸 기 공여체 (Adomet)와 60- 90 분 동안 실온에서 배양하였다. 스트립 웰의 바닥에 결합된 특이적 항체는 메틸화된 기질을 포획하였다.
H3K4, H3K9, 및 H3K27의 경우, 항체로 코팅된 스트립 웰 대신, 비오티닐화된 (biotinylated) 히스톤 기질을 이용하였으며, 60분 동안 37 에서 스트립 웰 상에서 안정적으로 포획하였다. 포획된 피호티닐화된 히스톤 기질을 그 다음 고-친화성 항체와 함께 60분동안 실온에서 100 rpm 의 교반으로 배양하였다. 과량의 정제된 NSD-CTDs, 히스톤, Adomet, 및 항체를 세척하여 제거하고, 항체 결합된 또는 비오틴화된 H3/H4me가 결합된 스트립 웰을 라벨링된 검출 항체와 함께 60분동안 24 에서 암실에서 100 rpm의 소용돌이 조건에서 배양하였다. 웰을 워시한 후, 메틸화 정도를 HRP-결합된 이차 항체- 발색 시스템을 이용하여 ELISA 플레이트 리더로 450 nm에서 정량화하였다. Epigentek사에서 제공한 항체를 이용하여 기질 간의 교차반응이 일어나지 않음을 확인하였다. 어세이는 2회 수행하였다. 효소를 포함하지 않은 대조군 (도 2의 NC)을 바탕으로 결과를 정규화하였다.
1.4 분자 모델링, 도킹, 및 에너지 최소화
NSD2-CD (a.a. 971-1202) 및 NSD3-CD (a.a. 1044-1283)의 상동성 모델을 구성하기 위하여 NSD1의 촉매 도메인 (catalytic domain, CD)의 결정 구조 (PDB: 3OOI - a.a. 1850- 2080)를 주형으로 사용하였다. NSD2- CD (a.a. 971-1202)가 NSD1-CD (PDB: 3OO1)와 75.9% 동일성 (identity) 및 90.1% 유사성 (similarity)을 공유하고, NSD3-CD (a.a. 1044-1283)는 NSD1-CD와 72.9% 동일성 및 85% 유사성을 공유함을 나타내었다.
분자 모델을 정확하게 구성하기 위하여, 종래 본 발명자들이 기술한 가이드라인 및 방법에 따랐다. ClustalW V2.0.9를 이용한 다중서열정렬 (multiple-sequence alignment) 후, Modeler V9.5을 이용하여 100개의 모델을 생성하였다. 고유의 Modeler 기능에 따른, 최적의 모델을 SCWRL4 프로그램을 이용하여 잔기 포지셔닝 (side-chains positioning)을 수행하였다. 입체화학은 PROCHECK를 이용하여 확인하였다. 모델은 COOT를 이용하여 수동으로 점검하였다. 히스톤 꼬리 펩티드를 H3K4 (a.a. 1- 7), H3K9 (a.a. 5-11), H3K27 (a.a. 23-29), H3K36 (a.a. 32-38), H3K79 (a.a. 75-81), 및 H4K20 (a.a. 16-22)의 잔기로, COOT내에 수동으로 구성하였다. COOT 에서 SSM 알로리즘을 이용하여, NSD1-CD, NSD2-CD, 및 NSD3-CD의 히스톤 결합 부분에 H3- 또는 H4- 펩티드 꼬리를 위치시키고 맞추는데 NSD1- CD (PDB: 3OOI)와 히스톤 H4 펩티드 (PDB: 3F9Y) 와 결합된 SET8의 결정 구조와의 구조적 오버레이를 이용하였다. APBS V1.2.1 를 이용하여 정전기학적 계산을 수행하였으며, 분자 표면의 정전기적 특성을 VMD V1.8.7 및 PyMOL V1.2으로 나타내었다.
1.5 에너지 최소화 및 분자 동역학적 시뮬레이션
펩티드- NSD-CD 복합체를 VMD 1.9를 이용하여 수조 (140 x 100 x 110)에서 완전히 용매화하였다. 에너지 최소화 (energy minimizations, EM) 및 분자 동역학 (molecular dynamics, MD)에 이용되는 분자 시스템은 하기의 원자 수를 포함한다: NSD1-CD-H3K4(1- 7), 42,121 원자; NSD1-CD-H3K9(5-11), 42,104 원자; NSD1-CD-H3K27(23-27), 42,095 원자; NSD1-CD-H3K36(32-38), 42,106 원자; NSD1- CD-H3K79(75-81), 42,120 원자; NSD1-CDH4K20(32-38), 42,130 원자; NSD2-CDH3K4(1-7), 44,848 원자; NSD2-CD-H3K9(5- 11), 44,840 원자; NSD2-CD-H3K27(23-27), 44,828 원자; NSD2-CD-H3K36(32-38), 44,830 원자; NSD2-CD-H3K79(75-81), 44,844 원자; NSD2-CD-H4K20(32-38), 44,860 원자; NSD3- CD-H3K4(1-7), 44,367 원자; NSD3-CDH3K9( 5-11), 44,353 원자; NSD3-CDH3K27( 23-27), 44,341 원자; NSD3-CDH3K36( 32-38), 44,349 원자; NSD3-CDH3K79(75-81), 44,366 원자; NSD3-CDH4K20(32-38), 44,379 원자. 약 90 %의 원자는 물분자로부터 유래하였다. EM 및 MD은 CHARMM force field를 이용한 NAMD v2.8으로 수행하였다. 항온은 300K에서의 Langevin 댐핑을 이용하여 유지하였으며, 압력은 Langevin 피스톤을 이용하여 1 압력으로 일정하게 유지하였다. 정전기력은 PME (particle mesh Ewald) 방법을 이용하여 10 컷-오프 거리 (cut-off distance)로 고려하였다. 용매화된 복합체, 히스톤펩티드- NSD-CD를 5,000 단계의 (5ns) 공액 경사 (conjugate gradient) EM, 뒤이은 20,000 단계의 (20ns) 분자 동력학 및 5,000 단계(5ns)의 EM의 5회 반복으로 최초 평형화시켰다. 마지막 단계는 EM의 5ns 였다. 용매화된 히스톤-펩티드-NSD-CD 복합체 각각에 대하여 총 100,000 단계(100ns)의 MD 및 총 30,000 단계(30ns)의 EM을 수행하였다. MD 시뮬레이션 후, 용매화된 복합체를 이상적 입체화학을 위하여 수동으로 COOT으로 확인하였다. MD 궤적을 VMD 1.9으로 분석하였다.
1.6 결합 에너지의 결정
결합 에너지를 NAMD 54 의 총 에너지 계산을 이용하여 하기와 같이 계산하였다.
binding = complex (peptide + NSD).
최종 MD 단계의 모델을 용매 분자로부터 분리하고, 복합체의 결합 에너지를 계산하는데에 사용하였다. 결합 복합체, 펩티드, 및 NSD-CD apo의 모델 모두를 동일한 EM 과정을 거치게 한 다음 결합 에너지 계산을 하였다. 모델을 4,000 단계(4ns)의 공액 경사 (conjugate gradient) EM, 뒤이어 2,000 단계(2ns)의 MD, 및 6,000 단계(6ns)의 EM (NAMD v2.8)로 에너지 최소화하였다. EM 단계는 <1 kJ/mol의 국소 최소점 (local minimum)에 도달하기에 충분할 정도로 길었다. 항온은 300K에서의 Langevin 댐핑을 이용하여 유지하였으며, 압력은 Langevin 피스톤을 이용하여 1 압력으로 일정하게 유지하였다.
1.7 모델 분석 및 확인
NSD-CD과 H3- 또는 H4- 펩티드간의 상호작용의 디테일은 Ligplot로 분석하였다. COOT 내에서의 모델의 시각적 검토를 통하여 상호작용 구조를 수동으로 매핑하였다.
1.8 NSD 구성원의 CTD가 in vitro에서 다중 히스톤 리신을 메틸화 할 수 있음을 확인
NSD1, NSD2, 및 NSD3의 CTD가 in vitro 에서 H3 및 H4 내의 다중의 상이한 리신을 특이적으로 인식하고 메틸화할 수 있는지 여부를 확인하기 위하여, 본 발명자들은 H3K4, H3K9, H3K27, H3K36, H3K79, 및 H4K20 상에서의 NSD1-CTD, NSD2-CTD, 및 NSD3- CTD의 전체-메틸화 (pan-methylation) 활성을 정량화 하였다.
그 결과를 도 2에 나타내었다. 도 2는 in vitro 에서 H3 및 H4 기질에 대한 NSD1-CTD, NSD2-CTD, 및 NSD3-CTD의 HMTase 활성을 나타낸 도이다.
도 2에 나타난 바와 같이, NSD1-CTD, NSD2-CTD, 및 NSD3-CTD는 유사한 기질 인식 및 메틸화 특성을 나타내지만, NSD3-CTD에서 감소된 메틸화 활성을 확인하였다 (도 2). NSD1-CTD 및 NSD2-CTD에서 H3K4me3 및 H3K27me3 종이 me1 및 me2 종보다 더 많이 검출되었다. 그러나, H3K9-me1 & -me2 및 H3K79- me1 & -me2 종이 me3 종보다 더 선호되었다. NSD1-CTD 및 NSD2-CTD와 비교하여 볼 때, NSD3-CTD는 H3K4 및 H3K9에 대한 미미한 활성을 제외하고, 현저한 메틸화 활성 (~1.5 배)를 나타내었다. 특이적 기질에 대하여, H3K9, H3K27, 및 H3K79에의 NSD3-CTD의 메틸화 활성은 NSD1- CTD 및 NSD2-CTD의 활성과 거의 동일하였다.
그러나, H4K20 메틸화는 NSD-CTDs 사이에서 다양하였다. 그렇더라도, H4K20에서 NSD1-CTD의 현저한 mono-/tri-메틸화 활성, NSD2-CTD의 di-/tri-메틸화 활성, 및 NSD3-CTD의 di-/tri- 메틸화 활성이 확인되었으며, 이는 H4K20가 in vitro 에서 모든 NSD-CTDs의 표적임을 나타낸다. H3K36는 NSD-CTDs 모두에 의해 메틸화되었으며, NSD1-CTD의 바람직한 기질이었다.
종합하여 볼 때, 상기 결과는, NSD1, NSD2, 및 NSD3의 CTD는 in vitro에서 기질에 따라 매우 다양한 촉매적 활성으로, H3K4, H3K9, H3K27, H3K36, H3K79, 및 H4K20를 인식하고 메틸화 할 수 있음을 나타낸다. 일부 HMTases (예를 들어 SET9)은 in vitro 에서 현저한 메틸트랜스퍼라아제 활성을 보유하지 않지만, 이는 현저한 촉매 활성이 확인된 NSD의 구성원이 아니다.
1.9 촉매 도메인의 열린 및 닫힌 구조 및 분자 모델링의 확인
상기 결과는 NSD1, NSD2, 및 NSD3의 CTD가 다수의 히스톤 리신을 인식하고 메틸화 할 수 있음을 나타낸다 (도 2). NSD 구성원에 의한 히스톤 리신의 메틸화를 더 구체적으로 살펴보기 위하여, 본 발명자들은 촉매 도메인 (catalytic domain, CD)을 구조적 변형하여 리신-결합 주머니에 접근을 시도하였다.
그 결과를 도 3에 나타내었다.
좌측 패널: 촉매 도메인의 구조는 삼각형 방식 (triangular fashion)으로 정렬된 3개 군의 정규형 -시트 및 보존된 -헬릭스와 매우 인접한 두 -시트의 1개 군으로 이루어져, 리신-히스톤 리간드의 결합을 위한 틈을 형성한다. 공인자 AdoMet는 채널을 통하여 CD에 적합한 구성으로 결합한다. 유동적 조절 루프를 적색으로 표시하였다. 조절 루프의 이동을 굽은 역화살로 표시하였다.
우측패널: MD 시뮬레이션 후 H3-펩티드 (a.a. 32-38)에 결합된 NSD-CDs의 모델. H3K36를 표시하였다. 정전기적 표면을 하기와 같이 색으로 표시하였다: 푸른색: 양전하; 붉은색; 음전하. 단위 +5/-5 kb.T.ec -1.
도 3에 나타난 바와 같이, NSD1-CD (PDB: 3OOI)의 결정 구조는 펩티드 기질이 없으며, 히스톤-리신 결합 부분은 SET 및 post-SET 부분의 인터페이스에서 조절 루프 (regulatory loop)로 폐색되어 있다. 이 조절 루프의 분자적 행렬식 (molecular determinant)은 히스톤 결합 부분까지 확장되며, 다른 기질의 결합을 입체적으로 방해한다. H3K4 HMTase MLL1는 리신-기실 결합 부분의 열린- 및 닫힌 구조의 원인이 되는 유동적인 post-SET과 유사한 특성을 공유한다. NSD2 및 NSD3의 CDs를 구성하기 위하여 NSD1-CD (PDB: 3OOI - a.a. 1850-2080)의 결정 구조를 이용하였으며, 이는 40 % 이상의 서열 동일성을 공유하여 유사한 구조를 가짐에 따른 상동성 모델링을 통하여 수행하였다.
주형과 표적간의 쌍별 서열 정렬 (pair-wise sequence alignment)은 NSD2- CD (a.a. 971-1202)가 NSD1-CD (PDB: 3OO1)와 75.9% 동일성 (identity) 및 90.1% 유사성 (similarity)을 공유하고, NSD3-CD (a.a. 1044-1283)는 NSD1-CD와 72.9% 동일성 및 85% 유사성을 공유함을 나타내었다. NSD1-CD, NSD2-CD, 및 NSD3-CD는 매우 높은 염기 상동성을 공유하며, 이는 매우 유사한 구조를 공유하는 것을 나타낸다 (도 1).
그 다음, 본 발명자들은 MD (molecular dynamics)을 이용하여 히스톤-리신 (H3K4, H3K9, H3K27, H3K36, H3K79, H4K20) 및 NSD1-CD, NSD2-CD, NSD3-CD을 포함하는 펩티드의 도킹을 조사하였다. 최초 모델은 밝혀진바 있는 닫힌 구조의, 기질이 없는 NSD1-CD의 결정 구조를 바탕으로 하였다. 따라서, 펩티드에 도킹된 NSD1, NSD2, 및 NSD3의 apo CD의 모델은 의도적으로 입체적으로 불안한 구조가 되게 한다. 수조 (water box)에서 에너지 최소화 및 장기 MD 시뮬레이션을 수행하여, 입체적 충돌이 없게 하고 CDs가 기질을 수용하는 열린 구조가 되도록 하는 것에 초점을 두었다.
도 4는 H3K4, H3K9 및 H3K27 결합의 분자 행렬식 (Molecular determinant)을 나타내는 도이다.
펩티드 H3K4 (a.a.1-7), H3K9 (a.a. 5-11), 및 H3K27 (a.a. 23-29)을 수직으로 맞추고 잔기의 원자 디테일을 보라색으로 나타내어다. NSD의 CDs로부터의 아미노산의 상호작용을 갈색으로 표시하고 숫자를 부여하였다. 녹색 점선을 수소결합을 나타낸다. 소수성 상호작용은 생략하였다. 이 도면은 프로그램 Ligplot를 이용하여 구성하였다.
도 5는 H3K36, H3K79 및 H4K20 결합의 행렬식은 나타내는 도이다. 펩티드 H3K36 (a.a. 32-38), H3K79 (a.a. 75-81), 및 H4K20 (a.a.16-22)을 나타내었다.
장기 MD 시뮬레이션은 복합체가 post-SET 부분에서 관찰되는 작은 RMSD 진동 (oscillation)으로 안정한 구조로 평형화시키는데 적용되었다 (overall c- RMSD < 0.6 A). 결과 모델은 뉴클레오좀의 DNA가 다른자리 입체적작동체 (allosteric effector)로서 결합하는 것으로부터 야기되는 열린 CD의 구조와 가까울 수 있다. MD 시뮬레이션에 이어, NSD2 및 NSD3의 CD 상의, 특히 SET 및 post-SET 부분 간(NSD2-CD 경우 a.a. 1178 내지 1191, 및 NSD3-CD의 경우 a.a. 1260-1273)의 인터페이스의 루프 상의 구조적 변형을 관찰하였다. 이 루프는 ~40로 회전하였으며, 끝은 ~6로 변형 (translated) 되었으며, 이는 매우 현저한 변위 (displacement)이다 (도 3). 백본의 나머지는 총 c- RMSD <0.6 로 현저한 구조적 변형을 겪지 않았다.
1.10 H3K4, H3K9, H3K27, H3K36, H3K79, 및 H4K20 펩티드의 결합의 분자적 디테일.
NSD 구성원의 CD는 유사한 기능적 도메인을 공유하며, 일반적인 구조적 특성 역시 공유한다 (도 1A). 히스톤 꼬리-결함 부분은 SET 및 post-SET 부분 사이의 인터페이스의 조절 루프가 회전되고 옮겨져서, 음으로 하전된 표면 부위가 노출되어 양으로 하전된 H3 및 H4 펩티드 꼬리가 도킹하기에 적합해 질 때에 한하여 접근이 가능하다 (도 3).
NSD-CDs에 의한 기질 인식의 분자적 디테일을 이해하기 위하여, 본 발명자들은 수조 내에서 장기 MD 시뮬레이션을 수행하여, H3K4, H3K9, H3K27, H3K36, H3K79, 및 H4K20 펩티드의 결합 특성을 시험하였다.
최종적으로, 본 발명자들은 시험된 모든 히스톤 H3 및 H4 펩티드 (H3K4 a.a.1-7; H3K9 a.a.5-11; H3K27 a.a.23-29; H3K36 a.a.32-38; H3K79 a.a.75-81; H4K20 a.a.16-22)가 유사한 입체 장해 (steric hindrance)를 공유하며, 전기장 및 분자 표면에 유사한 양전하를 갖는 것을 확인하였다. 이들 특성은 NSD-CDs의 선호되는 결합 에너지를 암시한다 (표 1).
표 1은 NSD1, NSD2, 및 NSD3의 촉매 도메인 상에서 리신-히스톤 기질을 포함할 때의 펩티드의 결합 에너지를 나타낸 표이다. 펩티드는 하기와 같다: H3K4 (a.a. 1-7); H3K9 (a.a. 5-11); H3K27 (a.a. 23-29); H3K36 (a.a. 32-38); H3K79 (a.a. 75-81); H4K20 (a.a. 16-22). 도킹시험에서 대조 실험으로 polyE를 사용하였다. polyE는 6-mer 폴리-글루타민산 펩티드이다.
[표 1]
Figure PCTKR2014002796-appb-I000011
MD 시뮬레이션 후 복합체의 총 에너지는 시험된 기질 간에 매우 비슷하였으며 (NSD1 및 NSD2에서 0.12%의 표준편차, NSD3에서 0.11%의 표준편차), 이는 시험된 모든 펩티드가 NSD구성원과 유사하게 결합함을 나타낸다 (표 1). 또한, 조절 루프는 안전밸트처럼 작용하여 단일 히스톤 꼬리를 결합 도메인에 고정시켜, 리신 기질이 공인자 (cofactor)-결합 부분까지 연장되어 촉매 반응을 일으키도록 한다 (도 3). 펩티드-결합 부분은 7-아미노산 펩티드를 수용할 정도로 충분히 크다. 흥미롭게도, 7-아미노산 펩티드 (H3K4, H3K9, H3K27, H3K36, H3K79, 및 H4K20 포함)는 매우 유사한 입체적 및 정전기적 특성을 공유한다 (도 1). 시험된 모든 H3 및 H4 히스톤 펩티드는 수소결합의 광범위한 네트워크를 통하여 NSD1, NSD2, 및 NSD3의 히스톤-꼬리 결합 틈 (histone-tail binding cleft)에서 매우 단단하게 안정화되어 있다 (도 4 & 5).
이러한 관찰은 계산된 결합 에너지와 일치하며, 이는 히스톤 펩티드와 CDs간의 바람직한 입체적 및 정전기적 양립성을 나타낸다 (Table 1).
CD에서의 모든 히스톤 펩티드의 도킹은 유의적으로 유리한 도킹 에너지와 관련성이 있으며, 이는 좋은 기질 양립성을 강조한다. 대조 실험으로서, 본 발명자들은 단백질 결합-주머니에 유의적인 입체 장해를 유발하는 크게 음전하된 7-mer의 polyE (poly-glutamic acid) 펩티드의 도킹을 모델링하였다. polyE 펩티드의 도킹은 매우 분리한 결합 에너지와 관련성이 있으며, 이는 어떠한 NSD-CDs과도 좋지 못한 조화를 나타냄을 강조한다 (표 1).
종합하여 볼 때, 상기 결과는 NSD 구성원의 히스톤-결합 주머니가 시험되는 히스톤 펩티드와 동등하게 양립될 수 있으며, 이는 H3 및/또는 H4 히스톤 꼬리의 안정성을 위한 입체적 및 정전기적 매치를 제공한다.
실시예 2: HMTase인 NSD2의 소분자 억제제
본 발명자들은 NSDs의 선택적인 억제가, 보존된 SAM 결합 위치 상의 히스톤-꼬리 위치를 표적하는 소분자에 의하여 달성 될 수 있음을 가정하였다. 기존의 SAM 결합 주머니를 표적하는 억제 방법을 보안하기 위하여, 본 발명자는 NSD2-SET의 히스톤-꼬리 결합 부분에 결합할 수 있는 분자를 스크리닝하였다.
2.1 클로닝
인간 간 cDNA 라이브러리 (TAKARA, Japan)를 주형으로 이용한 PCR을 수행하여 인간 NSD2 유전자 (NSD2-SET, 873 bp, 2844-3717 nt; 291 a.a., 948-1239 a.a)를 증폭하였다. 포워드 및 리버스 프라이머는 각각 PK162, 5- GGCAGCCATATG(NdeI)CAGGGGGTCAGAGGGATCGGAAGAG -3 및 PK163, 5- GAAGCACTCGAG(XhoI)CTCTGACTGCCTCTTCCCTTCCCC -3이었다. PCR 증폭된 NSD2-SET DNA 조작을 NdeI 및 XhoI으로 분해시키고, 단백질 발현 인테인 (Intein)-테그된 벡터, pTYB2 (New England Biolabs, USA)의 다중 클로닝 위치 내로 삽입하였다. 시퀀싱을 통하여 시퀀스를 확인하였다.
2.2 단백질 발현 및 정제
NSD2-SET를 포함하는 pTYB2 플라스미드로 형질전환된 Escherichia coli 발현 주, BL21를 100 g/mL 암피실린을 포함하는 LB 배지로 배양하였다. 재조합 NSD2-SET의 발현을 250 M IPTG (isopropyl 1-thio-D-galactopyranoside)로 15 4시간동안 유도하였다. E. coli 세포를 회수하고 동결-융해 방법 (freeze-and-thaw method)으로 용해하고, 0.1% Triton X-100 및 10 mM PMSF (phenylmethanesulfonylfluoride)를 포함하는 버퍼 A [20 mM Tris (pH 8.0), 500 mM NaCl, 및 0.1 mM EDTA]에서의 배양한 뒤, 얼음 상에서 20회 음파처리 (sonication)하였다. NSD2- SET-인테인-키틴-결합 도메인 융합 단백질을 포함하는 세포 추출물을 키틴 비드의 친화도 컬럼 상에서 로딩시키고, 0.1% Triton X-100를 포함하는 100-컬럼 부피의 버퍼 A로 워시한 뒤, Triton X-100를 포함하지 않는 20-컬럼 부피의 버퍼 A로 워시하였다. 재조합 단백질에 결합된 박테리아 샤페론을 제거하기 위하여, 10 mM ATP (adenosine triphosphate) 및 2.5 mM MgCl2를 포함하는 10-비드 부피의 버퍼 A로 재조합 NSD2- SET-결합된 키틴 비드를 워시하였다. 50 mM 2-머캅토에탄올 (mercaptoethanol)을 포함하는 버퍼 A 내에서 4 에서 48시간동안 인큐베이션하여 키틴 비드로부터 NSD2-SET 단백질을 잘라내고, 버퍼 A로 용출하고, Amicon Ultra 원심분리 필터를 이용하여 농축한 뒤, 메틸트랜스퍼라아제 (methyltransferase) 어세이에 이용하였다. 정제된 NSD2-SET의 일부를 SDSPAGE로 분석하였다. 쿠마시 염색 겔에서 33.2 KDa의 예상된 분자량의, 용해성의 순수 NSD2-SET을 확인하였다 (도 6B). 재조합 NSD2-SET은 80 에서 보관될 때, 이후에서 안정적이고 촉매적 활성을 유지하였다.
2.3 화합물
화합물은 MolPort (http://www.molport.com/) (Table 2)으로부터 구매하여, DMSO (dimethyl sulfoxide) 내 >99.9% 순도로 준비하였다 (D8418 Sigma).
2.4 히스톤 메틸트랜스퍼라아제 (Histone Methyltransferase) 억제제 어세이 (Inhibitor Assay)
H3K36 상에서의 NSD2-SET의 히스톤 메틸트랜스퍼라아제 활성을 비색 정량 키트 (colorimetric quantification kit) (Epigentek, USA)를 제조사의 프로토콜에 따라 측정하였다. 정제된 재조합 NSD2-SET (4.0 g, 최종 2.42 M)을 재조합 인간 히스톤 H3.1 (5 M) (New- England Biolabs NEB, USA)와 함께 선배양 (preincubate)하고, 어세이 키트의 C2 버퍼 내에서 억제제/DMSO 또는 DMSO 단독 (0 mM 억제제) 의 농도를 측정하였다. 이 어세이에 이용된 재조합 히스톤은 E. coli 에서의 생산에서 어떠한 잠재적 변형도 받지 않았으며, 제조사 (NEB) 의 지시에 따라 ESI-TOF 질량 분석법을 이용하여, 이를 확인하였다. 선배양된 혼합물에 메틸 기 공여체 (50 M)를 첨가하고, 즉시 스트립 웰로 옮겨 120분 동안 실온 조건의 암실에서 배양하였다. 모노-메틸화된 H3K36 (H3K36me1)를 스트립 웰의 바닥에 붙어있는 항-모노- H3K36 항체를 이용하여 포획하였다. 과량의 정제된 NSD2-SET, 히스톤 H3, 억제제, 및 Adomet를 세척하여 제거하고, 라벨링된 검출 항체, 뒤이은 발색제 (colour development reagent)가 포획된 항체-H3K36me1를 검출하였다. 스트립 웰은 ELISA 플레이트 리더로 450 nm에서 분석하였다. H3K36me1의 수준은 흡광도의 강도와 비례한다. 어세이는 독립적으로 3차례 수행되었다. 결과는 효소를 포함하지 않은 대조군으로 정규화 하였다.
2.5 NSD2-SET 의 닫힌 구조의 분자 모델링
상동성 모델링을 이용하여 (homology modelling) NSD1 의 SET 도메인 (PDB: 3OOI - a.a. 1850-2080)의 결정 구조를 NSD2 (a.a. 971-1202)의 SET 도메인을 구성하기 위한 주형으로 사용하였다. NSD2-SET (a.a. 971-1202)의 서열은 주형 NSD1-SET (PDB: 3OO1)와 75.9% 동일성 (identity) 및 90.1% 유사성 (similarity)를 공유한다. ClustalW V2.0.9를 이용한 조심스러운 다중-서열 정렬 (multiple-sequence alignment) 후, Modeler V9.5을 이용하여 100개의 모델을 제조하였다. 고유의 모델 기능 (intrinsic Modeler function)에 따라, SCWRL4 프로그램을 이용하여, 최적의 모델에 대하여 잔기 포지셔닝 (side-chains positioning)을 수행하였다. 입체화학은 PROCHECK를 이용하여 확인하였다. 모델은 COOT를 이용하여 수동으로 점검하였다. NSD2-SET의 모델은 18.1%으로 H-인자를 가졌다. 모델 세트의 품질 및 정확도를 H-인자로 평가하였다. 이는 상동성 모델링에 있어서 새로운 품질 지수 (quality metric)이다. NSD1와 NSD2 사이에서 SET 도메인의 높은 서열 보존에 의하여, NSD2-SET의 모델링은 이상적인 경우를 나타내었다.
2.6 NSD2-SET의 열린 구조의 분자 모델링
히스톤 꼬리 H3K36 (a.a. 32-38) 펩티드를 COOT에서 수동으로 구성하였다. NSD1-SET (PDB: 3OOI)와 히스톤 H4 펩티드 (PDB: 3F9Y)에 결합된 SET8의 결정 구조 간의 구조적 오버레이 (overlay)를 NSD2의 닫힌 구조 모델의 히스톤 결합 위치 내에 H3K36 (a.a. 32-38) 펩티드를 수동으로 위치시키고 맞추는데 이용하였다. 구조적 오버레이는 COOT 내의 SSM 알고리즘을 이용하여 수행하였다. 펩티드-NSD2- SET 복합체를 VMD 1.9를 이용하여 수조 (140 x 100 x 110)에서 완전히 용매화하였다. 에너지 최소화 및 분자 동력학 (molecular dynamics, MD)은 CHARMM force field를 이용하여 NAMD v2.8으로 수행하였다. 항온은 300K에서의 Langevin 댐핑을 이용하여 유지하였으며, 압력은 Langevin 피스톤을 이용하여 1 압력으로 일정하게 유지하였다. 정전기력은 PME (particle mesh Ewald) 방법을 이용하여 10 컷-오프 거리 (cut-off distance)로 고려하였다. 용매화된 펩티드-NSD2- SET 복합체에 대하여 총 100,000 단계의 (100ns) MD 및 총 30,000 단계의 (30ns) 에너지 최소화를 수행하였다. MD 시뮬레이션 후, 용매화된 복합체를 이상적 입체화학을 위하여 수동으로 COOT으로 확인하였다. MD 궤적은 VMD 1.9으로 분석하였다. 펩티드 H3K36 (a.a. 32-38) 및 물 분자를 펩티드-NSD2- SET 복합체로부터 제거하고 가상적 리간드 스크리닝에 적합한 NSD2-SET의 열린 구조를 남겼다.
2.7 가상적 리간드 스크리닝 및 화합물의 선별
ZINC 도킹 데이터베이스 버젼 11 42으로부터 다운로드한 Clean Drug-Like compounds로 도킹을 수행하기 위하여 AutoDock Vina를 사용하였다. 열린 NSD2-SET 상의 없어진 수소 원자를 PDB2PQR 프로그램과 CHARMM force field을 함께 이용하여 첨가하였다. 리간드는 AutoDock tools (ADT) v1.5.4 r29으로 제조하였다. 도킹 격자 크기 및 위치는 ADT를 이용하여 수동으로 설정하였다. 격자의 크기 (22x20x20)는 열린 NSD2- SET를 덮기에 충분히 컸으며, NSD1-SET에서 확인된 효소적 채널의 중심이었다. 40,325 분자 (190 Da < MW < 500 Da)의 일부분을 도킹하였으며, 상위 3,000개의 결과를 Cresset의 FieldView (Herts, AL7 3AX, United Kingdom)로 분석하고 여과하였다. 각 분자에서, 상위 9개의 결합 구조를 보존하였다. 상위 도킹 용액을 COOT 및 PyMOL을 이용하여 수동으로 점검하였다.
2.8 결과
NSD2/MMSET은 다발성 골수종에 대한 치료학적인 주요 표적이다. 다발성 골수종은 매우 낮은 생존률을 나타내며 치료방법이 없는 악성종양 (malignancy)이다. HMTase 억제제는 매우 희귀하며 단 하나의 NSD2 억제제인, MCTP39, SAM 경쟁자가 지금까지 확인되었다. 본 발명에서는, 구조-기초적 발견 접근을 이용하여, 본 발명자들은 in vitro에서 NSD2의 H3K36 HMTase 활성을 억제하는 소분자를 확인하였다.
NSD2의 구조는 아직 밝혀진 바가 없으며, 확인된 가장 가까운 결정구조는 NSD1의 apoSET 도메인이다. 본 발명자들은 상동성 모델링을 이용하여, NSD1-SET 결정 구조를 활용한 NSD2-SET 모델을 구성하였으며, 이들이 매우 높은 서열 동일성 (75.9%) 및 유사성 (90.1%)을 공유하는 것으로 확인하였다. 종래 본 발명자들은 NSD1-SET에서의 SET과 postSET 도메인 사이의 인터페이스에 위치하는 조절 루프의 운동 및 역할을 연구하였다
그 결과를 도 6에 나타내었다.
도 6은 NSD2/MMSET의 구조 및 LEM-14을 포함하는 열린 SET 도메인의 모델을 나타낸 도이다.
(A) NSD2의 일차구조: PWWP 도메인; PHD zinc 핑거 도메인; preSET 및 postSET를 포함하는 SET HMTase (histone methyl transferase). 히스톤-결합 부분을 닫는 조절 루프를 붉은 색으로 표시하였다.
(B) 정제후의 재조합 NSD2-SET 를 SDS-PAGE 겔 상에서 쿠마시 염색한 결과이다.
(C) 가상 리간드 스크리닝을 통하여 LEM-14와 가장 선호되는 구조로 결합되어 있는 열린 NSD2-SET 모델이다. 조절 루프는 붉은 색으로 표시하였다.
(D) LEM-14와 결합한 NSD2-SET의 분자 표면을 나타낸 도이다. 정전기적 표면을 아래와 같이 색으로 표시하였다:
푸른색: 양전하; 붉은색: 음전하, 단위 +5/-5 kb.T.ec-1.
도 6에 나타난 바와 같이, 닫힌 구조에서, H3 또는 H4 꼬리의 결합은 입체학적으로 방지되었다. 이에 따라 장기 MD 시뮬레이션을 이용하여 열린 구조의 NSD2-SET를 모델링하였다. 본 발명자들은 NSD2-SET의 닫힌 구조의, SET과 postSET 서브-도메인의 인터페이스에서의 조절 루프의 밑에 7-mer H3 펩티드 (a.a. 32-38)를 삽입하였다. NSD2- SET-H3K36 (a.a. 32-38) 복합체를 의도적으로 입체학적으로 불안정한 구조가 되게 하였다. 에너지 최소화 및 장기 MD 시뮬레이션은 입체적 제약을 완화하고 SET 도메인이 기질을 수용하도록 하였다 (도 6C 및 D). MD 시뮬레이션은 복합체가 안정한 구조로 안정화되도록 하였다. NSD2-SET의 조절 루프는 끝부분에서 ~45 회전 (rotation) 및 ~6 변형 (translation)으로 현저한 변위 (displacement)를 겪었으며, 이는 H3 또는 H4 꼬리의 도킹에 적합하도록 매우 크게 음전화된 결합 그루브를 열게 한다 (도 6D). NSD1-SET 및 NSD2-SET 모두는 H4K20 HMTase SET8의 일부 에서 7개 이상의 아미노산을 포함하는 인식 서열을 갖는다.
BIX-01294은 G9a 유사 단백질 HMTase의 SET 도메인을 표적하는 히스톤-꼬리 모방체이다. GLP의 히스톤꼬리 틈에 결합된 BIX-01294의 결정구조를 확인함으로써, 본 발명자들은 NSD2-SET의 열린 구조의 히스톤-꼬리 결합 주머니에 중점을 둔 가상 리간드 스크리닝 방법을 디자인 하였다. HMTase 억제제 BIX-01294, BIX-01338, 및 케토신 (Chaetocin)은 각각 492 Da, 535 Da, 및 696 Da의 분자량을 갖는다 (도 9). BIX-01294, BIX-01338 및 케토신은 히스톤 꼬리의 결합 그루브와 매칭되는 입체 장해 (steric hindrance)와 함께 양성 정전기장을 갖는다. 그러나, 500 Da 이상의 분자는 저하된 약동학적 파라미터를 가진다. 따라서, 본 발명자들은 500 Da 미만의 분자량으로 화합물을 선별하여, 도킹에 사용하기 위한 40,325개 분자의 부분 집합을 형성하였다. 40,325개 도킹 결과를 최적으로 도킹된 컨포머 (conformer)의 최적의 도킹 에너지에 따라 정렬시켰다. 본 발명자는 선택된 화합물이 NSD2-SET의 히스톤-꼬리 결합 그루브와 매칭되는 양성적 전자기장을 갖는지 여부 (priority #1), COOT을 이용한 수동적 점검에 따른 SET 도메인에서의 적합한 구조적 조화 및 결합 상호작용을 갖는지 여부 (priority #2), Lipinski의 5의 법칙을 따르는지 여부 (priority #3), 총 극성 표면 범위 (polar surface area) <100 2(priority #4), 분자 굴절 (molar refractivity) (priority #5)을 확인하기 위하여 상위 3,000 개의 화합물에 대하여 스크리닝 필터를 적용하였다. 중원자를 갖는 분자는 고려되지 않았다. 20 개의 엄선한 분자 중에서, 9개의 분자를 H3K36 모노메틸화 (H3K36me1)에 대하여 in vitro 어세이를 수행하였다. 그 결과를 표 2에 나타내었다.
[표 2]
Figure PCTKR2014002796-appb-I000012
선별된 9개의 분자와 BIX-01294를 재조합 NSD2-SET와 재조합 변형되지 않은 인간 히스톤 H3.1을 이용하여 H3K36me1의 억제활성을 시험하였다. 화합물 LEM-06, LEM-14, 및 BIX-01294는 각각 890 M, 11.2 M, 및 9.4 M의 IC50으로 NSD2-SET을 억제하였다. LEM-14 in vitro IC50는 MCTP39, TMDC 1c, AMI-1, AMI-5, AMI-6, AMI-9 및 GSK343와 같은 다른 HMTase 억제제의 IC50범위와 상응하였다.
도 8은 NSD2-SET H3K36 모노-메틸화 활성에 대한 억제제의 농도반응 곡선을 나타낸 도이다. NSD2-SET H3K36 모노-메틸화 활성을 후보 억제제의 다양한 농도에서 표시하였다. LEM-06, LEM-14, 및 BIX-01294의 농도반응곡선 및 IC50을 GraphPad Prism 6.0를 이용하여 표시하였다.
도 9는 LEM-06, LEM-07 및 BIX-01294의 화학 구조이다.
LEM- 14 및 BIX-01294 보다 약한 LEM-06의 억제는 SET 도메인에서 LEM-15 및 BIX-01294가 5개의 수소결합을 갖는 반면, LEM-06는 3개의 수소결합을 갖는 것으로부터 기인한 약한 안정화로 설명된다 (도 9). 다른 LEM 들이 in vitro에서 현저한 H3K36me1 HMTase 억제 효과를 나타내지 못하는 이유는 명확하지 않다. 그러나, 가능한 설명은 히스톤 H3.1과의 결합과 효과적으로 경쟁하는 시험된 분자들의 분자 굴절에 있다. LEM-14 및 BIX-01294는 모두 다른 LEMs와 비교하여 가장 강력한 양성 정전기장을 가지며, 이는 히스톤-꼬리 결합 도메인의 음전하된 표면과의 상호작용의 세기와 관계가 있을 수 있다 (도 6D 및 도 11). BIX-01294는 HMTase G9a의 히스톤-결합 그루브와 결합하고 3M의 IC50으로 활성을 억제한다. 또한 BIX-01294의 유도체는 H3K9 주몬지 디메틸라아제 (Jumonji demethylase)의 패밀리를 0.05- 75M의 IC50으로 억제할 수 있다.
SAM 결합 주머니 내로 히스톤-꼬리 대신 LEM-07 및 BIX-01294가 결합하는 것을 배제하지 않는다. 따라서, 결합의 가능성을 평가하기 위하여, 본 발명자들은 NSD2-SET 의 SAM-결합 주머니 내로 LEM-14 및 BIX-01294를 도킹하였다. LEM-14 및 BIX-01294는 각각 -9.2 Kcal/mol 및 - 7.6 Kcal/mol의 도킹 애너지로 결합한다. 이는 LEM-14 및 BIX- 01294가 각각 -10.7 Kcal/mol 및 9.7 Kcal/mol의 도킹 에너지로 히스톤-꼬리 주머니에 더 선호되는 결합을 하는 것과 아주 극명한 대조이다 (표 2). 또한, LEM-14 및 BIX-01294 모두 MCTP39 또는 AdoMet 보다 더 부피가 크며, 전자들의 NSDs의 SAM결합주머니 내로 입체적으로 제한된 (sterically constrained) 결합은 더 큰 에너지를 소비하고, 발생의 가능성이 감소한다.
본 발명에서, 본 발명자들은 H3K36 메틸화에 대한 신규한 NSD2 억제제인 LEM-07를 개발하였으며, 이는 in vitro IC50=11.2M를 나타내었다. 또한, 본 발명자들은 BIX- 01294 가 G9a에서 관찰되는 것과 유사한 결합 특성으로 NSD2를 억제 (IC50=9.4M)하는 것을 확인하였다.
종합적으로 본 발명자들은 LEM- 14의 유도체가 다발성 골수종을 포함하는 다양한 종양에 적합한 특이적 NSD2/MMSET 억제제로서 사용할 수 있음을 밝혔다.

Claims (10)

  1. 하기의 식으로 이루어진 화합물 또는 이의 약제학적으로 허용되는 염:
    Figure PCTKR2014002796-appb-I000013
    여기서,
    상기 A 기는 하기의 기로 이루어진 군으로부터 선택된 것이고,
    Figure PCTKR2014002796-appb-I000014
    상기 B 기는 하기의 기로 이루어진 군으로부터 선택된 것이며,
    Figure PCTKR2014002796-appb-I000015
    상기 C 기는 하기의 기로 이루어진 군으로부터 선택된 것으로서;
    Figure PCTKR2014002796-appb-I000016
    상기 R1은 메틸, 에틸, 다이-메틸 및 i-Pr로 이루어진 군으로부터 선택된 것이고,
    R2 및 R3는 독립적으로, 수소, 치환 또는 비치환된 알킬기, 치환 또는 비치환된 시클로알킬기, 및 이종원소로 O, N, S 또는 P를 갖는 치환 또는 비치환된 헤테로시클로알킬기로 이루어진 군으로부터 선택된 것이며,
    R4는 플루오르, 염소, 메틸, 및 OMe으로 이루어진 군으로부터 선택된 것이고,
    R5는 메틸, 에틸, tert-부틸, 치환 또는 비치환된 페닐, 및 이종원소로 O, N, S 또는 P를 갖는 치환 또는 비환치된 페닐기로부터 이루어진 군으로부터 선택된다.
  2. 청구항 1에 있어서, 상기 화합물은 히스톤 라이신-메틸 트랜스퍼라아제의 억제제인 것인, 화합물.
  3. 청구항 2에 있어서, 상기 히스톤 라이신-메틸 트랜스퍼라아제는 인간 NSD (nuclear receptor binding SET domain) 패밀리인 것인, 화합물.
  4. 청구항 3에 있어서, 상기 NSD는 NSD2/MMSET인 것인, 화합물.
  5. 청구항 2에 있어서 상기 히스톤 라이신-메틸 트랜스퍼라아제 억제제는 하기의 화학식으로 이루어진 것인, 화합물.
    Figure PCTKR2014002796-appb-I000017
  6. 청구항 1 내지 5 중 어느 한 항의 화합물을 유효성분으로 포함하는, 암의 예방 또는 치료용 약학적 조성물.
  7. 청구항 6에 있어서, 상기 암은 림프종 (lymphoid malignancies), 급성 림프구성 백혈병 (Acute lymphoblastic leukemia, ALL), 만성 림프구성 백혈병 (Chronic lymphocytic leukemia, CLL), 골수종 (myeloma), 피부암, 원발성 흑색종 (primary melanomas), 난황주머니 종양 (Yolk sac tumour), 유방암, 폐암, 대장암, 췌장암, 난소암, 방광암, 전립선암, 신장암, 뇌종양(brain cancer), 자궁경부암, 백혈병, 육아종증(granulomatosis), 및 세포 형질 변환 (cellular transformation)으로 이루어진 군으로부터 선택된 것인, 약학적 조성물.
  8. 청구항 6에 있어서, 상기 암은 다발성 골수종인 것인, 약학적 조성물.
  9. 청구항 1 내지 5 중 어느 한 항의 화합물을 유효성분으로 포함하는, 암의 예방 또는 개선용 식품 조성물.
  10. 청구항 1 내지 5 중 어느 한 항의 화합물의 약학적으로 효과적인 양을 개체에게 투여하는 단계를 포함하는, 암을 치료하는 방법.
PCT/KR2014/002796 2014-04-01 2014-04-01 신규한 히스톤 메틸 트랜스퍼라아제 억제제 및 그 용도 Ceased WO2015152437A1 (ko)

Priority Applications (2)

Application Number Priority Date Filing Date Title
KR1020167027278A KR102285119B1 (ko) 2014-04-01 2014-04-01 신규한 히스톤 메틸 트랜스퍼라아제 억제제 및 그 용도
PCT/KR2014/002796 WO2015152437A1 (ko) 2014-04-01 2014-04-01 신규한 히스톤 메틸 트랜스퍼라아제 억제제 및 그 용도

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
PCT/KR2014/002796 WO2015152437A1 (ko) 2014-04-01 2014-04-01 신규한 히스톤 메틸 트랜스퍼라아제 억제제 및 그 용도

Publications (1)

Publication Number Publication Date
WO2015152437A1 true WO2015152437A1 (ko) 2015-10-08

Family

ID=54240738

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2014/002796 Ceased WO2015152437A1 (ko) 2014-04-01 2014-04-01 신규한 히스톤 메틸 트랜스퍼라아제 억제제 및 그 용도

Country Status (2)

Country Link
KR (1) KR102285119B1 (ko)
WO (1) WO2015152437A1 (ko)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN113121561A (zh) * 2021-04-06 2021-07-16 丽水市中医院 一种含硫双烯化合物及其制备方法和应用
WO2022182953A1 (en) * 2021-02-26 2022-09-01 Celgene Corporation Methods for treating multiple myeloma

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2012075500A2 (en) * 2010-12-03 2012-06-07 Epizyme, Inc. 7-deazapurine modulators of histone methyltransferase, and methods of use thereof
WO2013063417A1 (en) * 2011-10-27 2013-05-02 Memorial Sloan-Kettering Cancer Center Methyltransferase inhibitors for treating cancer

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2012075500A2 (en) * 2010-12-03 2012-06-07 Epizyme, Inc. 7-deazapurine modulators of histone methyltransferase, and methods of use thereof
WO2013063417A1 (en) * 2011-10-27 2013-05-02 Memorial Sloan-Kettering Cancer Center Methyltransferase inhibitors for treating cancer

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
DATABASE Registry 18 August 2011 (2011-08-18), retrieved from STN Database accession no. 1319363-08-0 *
DATABASE Registry 27 June 2008 (2008-06-27), retrieved from STN Database accession no. 1031202-86-4 *
MARTINEZ-GARCIA ET AL.: "The MMSET histone methyl transferase switches global histone methylation and alters gene expression in t (4; 14) multiple myeloma cells", BLOOD, vol. 117, no. 1, 2011, pages 211 - 220, XP055058336, ISSN: 0006-4971 *

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2022182953A1 (en) * 2021-02-26 2022-09-01 Celgene Corporation Methods for treating multiple myeloma
CN113121561A (zh) * 2021-04-06 2021-07-16 丽水市中医院 一种含硫双烯化合物及其制备方法和应用
CN113121561B (zh) * 2021-04-06 2023-06-23 丽水市中医院 一种含硫双烯化合物及其制备方法和应用

Also Published As

Publication number Publication date
KR102285119B1 (ko) 2021-08-02
KR20160136334A (ko) 2016-11-29

Similar Documents

Publication Publication Date Title
CA3045303C (en) 7-phenylethylamino-4h-pyrimido[4,5-d][1,3]oxazin-2-one compounds as mutant idh1 and idh2 inhibitors
US9469646B2 (en) Modulators of methyl modifying enzymes, compositions and uses thereof
FI114794B (fi) HIV-proteaasin estäjät
Bruce et al. Development of isoform selective PI3-kinase inhibitors as pharmacological tools for elucidating the PI3K pathway
Catalano et al. A drug repurposing screening reveals a novel epigenetic activity of hydroxychloroquine
di Luccio Inhibition of nuclear receptor binding SET domain 2/multiple myeloma SET domain by LEM-06 implication for epigenetic cancer therapies
KR20230140606A (ko) 에스트로겐 수용체 단백질 분해 조절제 및 관련 사용 방법
Zhao et al. Design, synthesis and evaluation of benzoheterocycle analogues as potent antifungal agents targeting CYP51
WO2016130396A1 (en) Modulators of methyl modifying enzymes, compositions and uses thereof
Tamborini et al. Synthesis and biological evaluation of CTP synthetase inhibitors as potential agents for the treatment of African trypanosomiasis
EP3604303B1 (en) Novel pyrrolopyridine derivative, method for producing same, and use thereof
Abdo et al. Brucella suis histidinol dehydrogenase: synthesis and inhibition studies of a series of substituted benzylic ketones derived from histidine
WO2015152437A1 (ko) 신규한 히스톤 메틸 트랜스퍼라아제 억제제 및 그 용도
KR20140132382A (ko) 암의 후생적 결함을 교정하기 위한 작동자 단백질의 상호작용을 리프로그래밍하는 방법
US20090131407A1 (en) Tetracyclic kinase inhibitors
Kovac et al. Diazenedicarboxamides as inhibitors of D-alanine-D-alanine ligase (Ddl)
US20150119250A1 (en) Methods for modulating plant response to environmentally-induced stress
Lee et al. Discovery of potent nucleotide pyrophosphatase/phosphodiesterase3 (NPP3) inhibitors with ancillary carbonic anhydrase inhibition for cancer (immuno) therapy
Komiya et al. Synthesis and structure based optimization of 2-(4-phenoxybenzoyl)-5-hydroxyindole as a novel CaMKII inhibitor
Thaler et al. Spiro [chromane‐2, 4′‐piperidine]‐Based Histone Deacetylase Inhibitors with Improved in vivo Activity
NZ247993A (en) Iminoquinoline derivatives and pharmaceutical compositions
KR20220114569A (ko) 항암 화합물로서 cullin 3 어댑터 kbtbd4의 모듈레이터
EP3386988A1 (en) Novel dihydropyranopyrimidinone derivatives, and use thereof
US9988341B2 (en) Bacterial topoisomerase inhibitors and use thereof
WO2023068881A1 (ko) 아릴 또는 헤테로아릴 유도체, 및 이를 유효성분으로 포함하는 키나아제 관련 질환의 예방 또는 치료용 약학적 조성물

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 14888386

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 20167027278

Country of ref document: KR

Kind code of ref document: A

NENP Non-entry into the national phase
122 Ep: pct application non-entry in european phase

Ref document number: 14888386

Country of ref document: EP

Kind code of ref document: A1