WO2015147379A1 - 숙주세포의 생체 회로 간섭 없이 외래 유전자를 발현하기 위한 재조합 벡터 및 이의 용도 - Google Patents

숙주세포의 생체 회로 간섭 없이 외래 유전자를 발현하기 위한 재조합 벡터 및 이의 용도 Download PDF

Info

Publication number
WO2015147379A1
WO2015147379A1 PCT/KR2014/005807 KR2014005807W WO2015147379A1 WO 2015147379 A1 WO2015147379 A1 WO 2015147379A1 KR 2014005807 W KR2014005807 W KR 2014005807W WO 2015147379 A1 WO2015147379 A1 WO 2015147379A1
Authority
WO
WIPO (PCT)
Prior art keywords
gene
cgmp
expression
host cell
recombinant vector
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/KR2014/005807
Other languages
English (en)
French (fr)
Inventor
김근중
이은빈
유성환
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Industry Foundation of Chonnam National University
Original Assignee
Industry Foundation of Chonnam National University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Industry Foundation of Chonnam National University filed Critical Industry Foundation of Chonnam National University
Priority to US14/410,063 priority Critical patent/US9963708B2/en
Publication of WO2015147379A1 publication Critical patent/WO2015147379A1/ko
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/10Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/1034Isolating an individual clone by screening libraries
    • C12N15/1055Protein x Protein interaction, e.g. two hybrid selection
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/70Vectors or expression systems specially adapted for E. coli
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12PFERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P21/00Preparation of peptides or proteins

Definitions

  • the present invention relates to a recombinant vector and its use for expressing a foreign gene without interfering with the biological circuit of the host cell, and more particularly, a gene encoding a microorganism-based guanyly cyclase, cGMP receptor protein
  • a recombinant vector capable of independently expressing a foreign gene without intervening the biological circuit of the host cell, wherein the gene to which the gene and the cGMP receptor protein bind to the regulatory sequence is recombined into one or more plasmids.
  • a method of transforming a recombinant vector operably linked to a host cell to independently express a foreign gene without interfering with the biological circuit of the host cell, comprising the host cell transformed with the recombinant vector, and the recombinant vector as an active ingredient, Foot of foreign genes without interference of host cells It relates to compositions and kits for increasing the.
  • Protein expression and production technology using genetic recombination technology is a very important foundation technology in life science research and biological industry.
  • protein production methods using microorganisms or yeasts have been used in the production of various recombinant proteins for research and industrial field applications due to their excellent protein expression ability, along with the ease of genetic engineering and host culture.
  • This technology can be applied to metabolic engineering that induces the overproduction of useful products by inducing the production of recombinant proteins through the introduction of foreign genes or the metabolic circuit of the host, thereby producing high value products such as biofuels, food materials and pharmaceutical preparations.
  • a gene expression module or a circuit consisting of one or more inducible expression systems IPTG-LacI, L-arabinose-AraC, anhydrotetracycline-TetR
  • IPTG-LacI inducible expression systems
  • L-arabinose-AraC L-arabinose-AraC
  • anhydrotetracycline-TetR a gene expression module or a circuit consisting of one or more inducible expression systems
  • Gene expression is reduced in such a way as to reduce the interference of foreign gene expression (interference due to host transcription and translation tool sharing), thereby reducing the problem of growth delay or contamination (unnecessary metabolite) caused by cell physiological disturbance or burden.
  • Cell-free reaction which extracts the major components from cells from cells and mixes them with genes of interest, synthesizes or reacts proteins in vitro.
  • the method has the advantage of minimizing the separation and purification process because it can be efficiently reacted / synthesized in a short time and does not require cell culture, it is expensive and has the problem of sensitively adjusting the experimental conditions.
  • unlike the system using the cell as an expression host there is a clear limitation of productivity because it is impossible to reproduce by division.
  • an orthogonally functional factor is introduced to allow for selective response or gene expression by introducing an independently controllable expression system that is functionally isolated from the host's innate gene expression system. ) Can be used.
  • an orthogonal mRNA with a Shine-Dalgarno sequence modified so that the intrinsic ribosome is not recognized
  • an orthogonal ribosome (O-ribosome) that recognizes it
  • an orthogonal aminoacyl- Using a set of t-aminoacyl tRNA synthetase, it is possible to implement an independent protein production system without using the host's translation mechanism.
  • O-mRNAs and O-ribosomes are not essential for physiology at the time of host entry and provide a route to protein synthesis without the use of their own translation network.
  • Disadvantages may include a translational delay for gene expression, which is less than the level of protein expression using the intrinsic system due to the in vivo amount of relatively low orthogonal elements.
  • the orthogonal system of the transcription process includes a well-known T7 RNA polymerase. This process uses a phage-derived polymerase and its promoter so as not to compete with the host's native transcription tool (a promoter that binds to RNA polymerase).
  • the problem still to be solved in this enterprise orthogonal system is that it is difficult to guarantee complete independence. This is because, as is well known, the conservation sequence of the microbial promoter or the selectivity of the polymerase binding thereto is relatively low.
  • T7 polymerase can be bound to a certain level or more by the host native promoter, and that the E. coli transcription polymerase can be recognized in the case of the T7 promoter. Therefore, it is possible to interact with the host transcription factor so that a certain level or more of the transcript is measured without a derivative.
  • expressing the gene of interest using a driving factor independent of the host expression system is still the new attentional logic of expression.
  • the available orthogonal systems exist in part at the level of transcription and translation, the fundamental construction of the orthogonal system has not yet been achieved.
  • the problem is that the typical expression control logic used to express orthogonal ribosomes or transcriptional polymerases in vivo is responsible for metabolic / physiology in hosts such as conventional IPTG and lac repressors, arabinose and AraC. It depends on how it can be disturbed.
  • the subjects of transcription and translation are orthogonal, but the logic to control / regulate them is not orthogonal, so that IPTG (or lactose) and arabinose introduced as a signal for inducing expression of orthogonal factors are not induced by the expression of orthogonal factors. This is because they may be involved in or interfere with the expression or regulation of genes involved.
  • the present inventors obtained a complete set of components involved in transcriptional signal transduction (induction) from microorganisms that are heterologous to Escherichia coli and driven in E. coli to generate a signal separated from the host (orthogonalization without mutual interference). Furthermore, it confirms signal amplification (amplification of a small amount of signals) and simultaneous expression of multiple genes in which expression is induced by receiving these signals simultaneously (simulation of global regulation in which multiple gene expression is controlled by one signal). The present invention has been completed.
  • Korean Patent No. 0958095 discloses a method for mass expression of antimicrobial peptides using a translation companion system
  • Korean Patent Publication No. 2010-0075884 discloses a bacterium by co-expression of a eukaryotic type I interferon response inhibitor.
  • the present invention is derived from the above requirements, and the present inventors use a regulatory sequence to which guanyl cyclase , cGMP receptor protein, and cGMP receptor protein bind from Rhodospirillum centenum .
  • To produce a recombinant vector insert the foreign gene into the recombinant vector and transform the E. coli cells, and compare the control gene with E. coli transformed with the empty vector without affecting the growth or stress resilience of the cells. By confirming that expression was induced, the present invention was completed.
  • the present invention is a microorganism-derived gene encoding guanyly cyclase (guanylyl cyclase), a gene encoding a cGMP receptor protein and a regulatory sequence that the cGMP receptor protein binds to one or more plasmids
  • a recombinant vector capable of independently expressing a foreign gene without interfering with a biological circuit of a host cell.
  • the present invention is independent of the foreign gene without interference of the biological circuit of the host cell, characterized in that the gene encoding the microorganism-derived cGMP receptor protein and the regulatory sequence to which the cGMP receptor protein binds to one or more plasmids It provides a recombinant vector that can be expressed as.
  • the present invention provides a method for independently expressing a foreign gene without interfering with the biological circuit of the host cell by transforming the host cell into a recombinant vector inserted with the foreign gene in the recombinant vector.
  • the present invention provides a composition or kit comprising the recombinant vector as an active ingredient, to increase the expression of foreign genes without interfering with the biological circuit of the host cell.
  • the present invention recombinants any one of bait and prey to the catalytic domain and ATP hydrolysis domain of the microorganism guanylyl cyclase protein and the bait expressed by the expression in yeast and It provides a method for confirming the interaction of the bait with the bait comprising the step of detecting the interaction of the Frey.
  • the recombinant vector of the present invention reduces the physiological burden of the host due to its non-interference with the expression signal of the host cell, and amplifies the gene transcriptional activity signal by using a secondary messenger involved in intracellular signal transduction as a parameter.
  • Trace signals can be used to efficiently induce gene expression. Due to these characteristics, it is possible to economically mass-produce the desired product because it does not require a large amount of expensive synthetic chemical derivatives required for gene expression, and it is difficult to inject an excessive amount of chemical derivatives in a biological experiment (drugs requiring injection of expression signals from a long distance) Suitable for mass production of medical proteins and industrial enzymes in fermenters and culture baths). In addition, since it can induce the expression of a number of genes at the same time can be applied to various metabolic engineering fields, it is expected to be useful industrially.
  • Figure 1 is a schematic diagram illustrating the driving principle of the cGMP dependent orthogonal signaling system inducing gene expression of the present invention. It shows the mechanism of transcription induction by metabolites, cGMP production and receptors, and cGMP-receptor complexes that are not used in general microbial hosts.
  • Figure 2 is a schematic diagram showing the process of cloning the guanyl cyclase and cGMP receptor proteins, which are the key genes constituting the cGMP dependent orthogonal signaling system and the recombinant vector produced.
  • Figure 3 is a schematic diagram showing the reporter fusion process to confirm the function of the regulatory sequence inducing transcription by binding to cGMP-receptor protein as a cGMP-dependent orthogonal signaling system expression control element.
  • Figure 4 is a schematic diagram showing the final product of the dual (dual) vector system for evaluating the cGMP dependent orthogonal signaling system of the present invention.
  • the two vectors have all the components for stable compatibility in one host.
  • FIG. 5 is a diagram evaluating the cell growth inhibition and stress recovery ability by the recombinant vector introduced into the host to evaluate the cGMP dependent orthogonal signaling system of the present invention.
  • A shows no growth inhibition of the host cell
  • B shows no difference in stress recovery ability.
  • the relatively low fluorescence value is a result of using a small amount of cells, and the reason why the value of the control group is high is due to the measurement of fluorescence using whole cells.
  • Figure 7 shows the expression amount of the reporter after applying a heat shock (heat shock) to see whether the sigma element binding to the regulatory sequence involved in the orthogonal signal reception is related to the stress response in the cGMP dependent orthogonal signaling system of the present invention Is the result of comparing.
  • the fourth regulatory sequence confirmed the likelihood.
  • FIG. 8 is a vector schematic diagram showing the result of fusion cloning of the Pbad promoter whose transcription is strongly regulated in order to reduce noise caused by leaking during the operation of the cGMP dependent orthogonal signaling system of the present invention.
  • FIG. 11 is a schematic diagram showing an evaluation system for monitoring the signal amplification effect that is an advantage of the cGMP dependent orthogonal signaling system of the present invention.
  • Figure 13 is a result of comparing the signal amplification effect by the cGMP dependent orthogonal signaling system of the present invention with the fluorescence value by reporter expression.
  • Figure 14 shows the result of the simultaneous expression of a number of genes fused regulatory sequences by the amplified signal of the cGMP dependent orthogonal signaling system of the present invention. After inducing simultaneous expression of the fluorescent protein reporter and two industrial enzymes for driving evaluation, the functional overexpression of the high value-added industrial enzyme was confirmed by a zymogram.
  • 15 is a result of co-expression of a plurality of genes fused regulatory sequences by amplified signals of the cGMP dependent orthogonal signaling system of the present invention, and shows the results of co-expression of a medicinal protein applied to treatment of intractable cancer. Simultaneous expression of the reporter and two medicinal enzymes was induced, and functional overexpression was confirmed by Western blot using the antibody.
  • FIG. 16 shows the results of driving a transcriptional induction system using cGMP directly as a derivative without guanyl cyclase as a modification of the cGMP dependent orthogonal signaling system of the present invention.
  • FIG. 17 shows a novel double-hybrid in which transcription of guanyl cyclase, which is a component of the cGMP dependent orthogonal signaling system of the present invention, is fused with other proteins to induce transcription by interaction between the fused proteins.
  • a and B show the existing dual-hybrid principle of operation
  • C shows the operation principle of the new orthogonal signal amplification double-hybrid combined with the signal amplification effect of the result of the present invention.
  • Figure 18 shows the results of the operation of the new orthogonal signal amplification double-hybrid of the present invention. It shows clear differences in signal values that can operate sensitively and accurately without interference.
  • the present invention provides a gene encoding a guanylyl cyclase, a gene encoding a cGMP receptor protein and a regulatory sequence to which the cGMP receptor protein binds at least one plasmid.
  • a recombinant vector capable of independently expressing a foreign gene without interfering with a biological circuit of a host cell, wherein the host cell is recombinant.
  • the present invention is independent of the foreign gene without interference of the biological circuit of the host cell, characterized in that the gene encoding the microorganism-derived cGMP receptor protein and the regulatory sequence to which the cGMP receptor protein binds to one or more plasmids It provides a recombinant vector that can be expressed as.
  • a gene encoding a microorganism-derived guanylyl cyclase, a gene encoding a cGMP receptor protein and a regulatory sequence to which the cGMP receptor protein binds at least one Recombinant plasmids for example, the three genes may be recombined into each plasmid, one gene encoding a microorganism guanylyl cyclase and two genes encoding a cGMP receptor protein Recombinant to the plasmid of, the regulatory sequence may be inserted into one plasmid, the three genes may be inserted into one plasmid, but is not limited thereto.
  • cGMP may be artificially added instead of a gene encoding a microorganism guanylyl cyclase, in which case guanyl cyclase is used. Since unnecessary, the gene encoding the microorganism-derived cGMP receptor protein and the regulatory sequence to which the cGMP receptor protein binds can be recombined into one or more plasmids.
  • the microorganism may be Rhodospirillum centenum , but is not limited thereto.
  • 'Guanylyl cyclase' is an enzyme that generates 3 ', 5'-cGMP (cyclic guanosine monophosphate) or 2', 5'-cGMP by using guanosine triphosphate (GTP) as a substrate.
  • GTP guanosine triphosphate
  • class III nucleotidyl cyclase
  • the gene encoding guanyl cyclase of the present invention may include a nucleotide sequence represented by SEQ ID NO: 1.
  • homologues of the above nucleotide sequences are included within the scope of the present invention.
  • the gene has a nucleotide sequence having sequence homology with at least 70%, more preferably at least 80%, even more preferably at least 90%, and most preferably at least 95% with the nucleotide sequence of SEQ ID NO: 1, respectively. It may include.
  • the "% sequence homology" for a polynucleotide is identified by comparing two optimally arranged sequences with a comparison region, wherein part of the polynucleotide sequence in the comparison region is the reference sequence (addition or deletion) for the optimal alignment of the two sequences. It may include the addition or deletion (ie, gap) compared to).
  • the gene encoding the cGMP receptor protein of the present invention may comprise a nucleotide sequence represented by SEQ ID NO: 3.
  • homologues of the base sequences are included in the scope of the present invention, specifically, as described above.
  • the regulatory sequence is a hybrid histidine kinase ( cyd2 , hybrid histidine kinase), a dihydroorase-like protein ( pyrC ' , dihydroorotase-like protein), chemotaxis-like A protein ( cheY 3 , chemotaxis-like protein) or a sensor-kinase-response regulator hybrid ( cstS1 ) may be a sequence derived from a gene, but is not limited thereto.
  • nucleotide sequence represented by the nucleotide sequence of SEQ ID NO: 4, 5, 6 or 7 and the homolog of the nucleotide sequence are within the scope of the present invention. Included are specifically as described above.
  • the present invention also provides a recombinant vector in which a foreign gene is inserted downstream of the regulatory base sequence of the recombinant vector.
  • recombinant refers to a cell in which a cell replicates a heterologous nucleic acid, expresses the nucleic acid, or expresses a protein encoded by a peptide, a heterologous peptide, or a heterologous nucleic acid.
  • Recombinant cells can express genes or gene fragments that are not found in their natural form in either the sense or antisense form.
  • Recombinant cells can also express genes found in natural cells, but the genes are modified and reintroduced into cells by artificial means.
  • the gene encoding the guanylyl cyclase, the gene encoding the cGMP receptor protein and the regulatory sequence to which the cGMP receptor protein binds can be inserted into the recombinant expression vector.
  • the term "recombinant vector” means a bacterial plasmid, phage, yeast plasmid, plant cell virus, mammalian cell virus, or other vector. In principle, any plasmid and vector can be used as long as it can replicate and stabilize in the host.
  • An important feature of the expression vector is that it has an origin of replication, a promoter, a marker gene and a translation control element.
  • Expression vectors comprising a gene encoding guanylyl cyclase, a gene encoding a cGMP receptor protein and a regulatory sequence to which the cGMP receptor protein binds and an appropriate transcriptional / translational control signal are well known to those skilled in the art. Can be built by. Such methods include in vitro recombinant DNA techniques, DNA synthesis techniques, in vivo recombinant techniques, and the like. The DNA sequence can be effectively linked to a suitable promoter in the expression vector to drive mRNA synthesis. Expression vectors may also include ribosomal binding sites and transcription terminators as translation initiation sites.
  • the expression vector will preferably comprise one or more selectable markers.
  • the marker is typically a nucleic acid sequence having properties that can be selected by chemical methods, and all genes that can distinguish transformed cells from non-transformed cells. Examples include, but are not limited to, antibiotic resistance genes such as ampicillin, kanamycin, G418, bleomycin, hygromycin, and chloramphenicol.
  • the present invention also provides a host cell transformed with the recombinant vector into which the foreign gene is inserted.
  • the host cell may be Escherichia coli , but is not limited thereto.
  • a host cell capable of continuously cloning and expressing the vector of the present invention in prokaryotic cells may be Any known host cell can be used, for example E. coli JM109, E. coli BL21, E. coli RR1, E. coli LE392, E. coli B, E. coli X 1776, E. coli W3110, Bacillus sub Strains of the genus Bacillus, such as Tilis, Bacillus thuringiensis, and enterobacteria and strains such as Salmonella typhimurium, Serratia marsonsons and various Pseudomonas species.
  • yeast Sacharomyce cerevisiae
  • insect cells e.g., human cells (e.g., CHO cell line (Chinese hamster ovary), W138, BHK, COS-7, 293) as host cells , HepG2, 3T3, RIN and MDCK cell lines) and plant cells and the like
  • human cells e.g., CHO cell line (Chinese hamster ovary), W138, BHK, COS-7, 293
  • W138 e.g., BHK, COS-7, 293
  • HepG2, 3T3, RIN and MDCK cell lines e.g., CHO cell line (Chinese hamster ovary), W138, BHK, COS-7, 293) as host cells , HepG2, 3T3, RIN and MDCK cell lines
  • plant cells and the like can be used.
  • the present invention provides a method for transforming a recombinant vector into which the foreign gene is inserted into a host cell to independently express the foreign gene without interfering with the biological circuit of the host cell.
  • the method of carrying the vector of the present invention into a host cell is, if the host cell is a prokaryotic cell, the CaCl 2 method, one method (Hanahan, D., J. Mol. Biol., 166: 557-580 (1983)). And the electroporation method.
  • the vector can be injected into the host cell by microinjection, calcium phosphate precipitation, electroporation, liposome-mediated transfection, DEAE-dextran treatment, gene bombardment, or the like. have.
  • the present invention is characterized in that the gene encoding the guanylyl cyclase, the gene encoding the cGMP receptor protein, and the regulatory sequence to which the cGMP receptor protein binds to one or more plasmids.
  • a living body of a host cell comprising a recombinant vector comprising a recombinant vector or a gene encoding a microorganism-derived cGMP receptor protein and a regulatory sequence to which the cGMP receptor protein binds to one or more plasmids.
  • compositions or kits for increasing expression of foreign genes without circuit interference are provided.
  • Recombinant vector included in a composition or kit according to an embodiment of the present invention is a gene encoding a guanyl cyclase, a gene encoding a cGMP receptor protein and a regulatory sequence to which the cGMP receptor protein binds to one plasmid
  • the recombinant vector may be introduced, or may be a recombinant vector introduced in a separate plasmid, two may be a recombinant vector introduced in one plasmid and the other in a separate plasmid.
  • the composition or kit of the present invention contains the recombinant vector as an active ingredient, and by transforming the recombinant vector into a host cell, the expression of a foreign gene can be increased without interfering with the biological circuit of the host cell.
  • the kit of the present invention can be prepared using a method commonly used in the art.
  • It provides a method for confirming the interaction of the bait and the prey comprising the step of detecting the interaction of the expressed bait and the prey.
  • the method is a new double hybridization method using guanyl cyclase in the conventional yeast two hybrid method.
  • the method of the present invention comprises the step of recombining any one of bait and prey to the catalytic domain and ATP hydrolysis domain of guanylyl cyclase protein, respectively, for example.
  • the bait may be recombined to the catalytic domain, or the prey may be recombined.
  • the bait may be recombined to the ATP hydrolysis domain, or the prey may be recombined. That is, the bait and the prey can be recombined with one of the catalytic domain and the ATP hydrolysis domain, respectively.
  • the recombined bait and prey are expressed in yeast, and the interaction between the expressed baits and prey is detected.
  • the catalytic domain of the guanylyl cyclase protein and the ATP hydrolysis domain bind to the guanyl cyclase to activate cGMP from GTP.
  • the resulting cGMP forms a complex with the cGMP-receptor protein to bind to the regulatory sequence to which the cGMP receptor protein binds, and induces the expression of the reporter gene downstream of the regulatory sequence. For example, GFP) is expressed.
  • the bait and prey do not interact, the catalytic domain of the guanylyl cyclase protein and the ATP hydrolysis domain do not bind and the guanyl cyclase does not have activity, thus producing cGMP from GTP. If the cGMP is not produced, the complex cannot be formed with the cGMP-receptor protein, thereby preventing the cGMP receptor protein from binding to the regulatory sequence to which the cGMP receptor protein binds, and inducing the expression of the reporter gene downstream of the regulatory sequence. (Eg GFP) expression is not achieved.
  • the bait and the prey interact with each other when the expression of the reporter is detected, and the bait and the prey do not interact with each other when the expression of the reporter is not detected. If you use it can be confirmed whether the interaction between the bait and Frey (see Fig. 17).
  • the catalytic domain of the guanyl cyclase of the present invention is composed of amino acids 14 to 197 of the amino acid sequence of SEQ ID NO: 2, ATP hydrolysis domain is amino acid sequence of 221 to 595 amino acids of the amino acid sequence of SEQ ID NO: 2 It consists of, but is not limited thereto.
  • It provides a method for screening a prey that binds to the bait, comprising detecting the interaction of the expressed bait with the prey.
  • the screening method of the present invention uses a cGMP-dependent signal transduction system, it is a method that can efficiently detect protein-to-protein interactions even when the amount of interacting protein is low or weak.
  • chromosomes were extracted from the microorganisms using a DNA extraction kit (Wizard ® Genomic DNA Purification Kit, Promega, USA). Purity was analyzed and concentration was determined according to general recombinant genetic engineering. Using the extracted chromosome as a template, a polymerase chain reaction (PCR) was performed using oligonucleotide primers to amplify DNA fragments required for circuit driving. In the case of a polynucleotide encoding guanyl cyclase, the gene size was composed of 3,051bp base, and PCR was performed by dividing into two fragments. Primers used are shown in Table 1 below.
  • the PCR reaction was carried out using 8 ng of chromosomal DNA as a template, and 1 ⁇ l of each 10 pmole of the primer solution and 2 ⁇ l of dNTP containing 2.5 mM of dATP, dGTP, dTTP, and dCTP, respectively, 4 ⁇ l of 10 ⁇ buffer, and 2.5 U / ⁇ l of heat resistant DNA.
  • 0.4 ⁇ l of polymerase (Speed-Pfu polymerase, Nanohelix, Korea) was mixed, and the reaction solution was used to adjust the total amount to 40 ⁇ l by adding sterile water thereto. After preheating the reaction solution at 98 ° C.
  • Cyc1 gene fragment amplified using Cyc1-F and Cyc1-R primers was cut with restriction enzymes BamH I and Sal I and Cyc2 amplified using Cyc2-F and Cyc2-R primers.
  • Recombinant vector pTrc99a-Cyc was constructed by cutting the gene fragments with restriction enzymes Sal I and Hind III and inserting them into pTrc99a vectors digested with restriction enzymes BamH I and Hind III.
  • genes amplified using CRP-F and CRP-R primers are obtained, followed by overlapping PCR reactions with always-expressing trc promoter sequences amplified using PF and PR primers. This ensured the expression trc promoter-cGMP receptor fusion gene at all times.
  • the amplified gene fragment was digested with restriction enzyme Hind III and inserted into the pTrc99a-Cyc vector to prepare pTrc99a-Cyc-P-CRP (FIG. 2).
  • Gene structure including a polynucleotide encoding the fluorescent protein GFPuv to confirm the foreign protein expression by the transcriptional induction function of the signal transduction components were produced as follows. Primers used are shown in Table 2 below.
  • Overlapping PCR was performed using GFPuv fragments having sequences fused with four regulatory sequences amplified in the previous procedure.
  • the amplified DNA fragment was treated with restriction enzymes ApaL I and EcoR I and then inserted into the pPROtrc vector, a pTrc99a-derived vector digested with the same enzyme, thereby confirming GFPuv expression by cGMP-receptor complex binding (pPRO0896-GFPuv, pPRO1525-GFPuv, pPRO2133-GFPuv and pPRO2847-GFPuv) were produced (FIG. 3).
  • the pPROtrc plasmid removed the trc promoter in the vector by treatment with ApaL I and EcoR I restriction enzymes to confirm the ability to induce GFP expression by a regulatory sequence inserted into the vector itself as the trc promoter was present ('pPRO').
  • ApaL I and EcoR I restriction enzymes to confirm the ability to induce GFP expression by a regulatory sequence inserted into the vector itself as the trc promoter was present ('pPRO').
  • Orthogonal signaling circuit evaluation module is a plasmid (pPROcis-GFPuv) in which a plasmid (pTrc99a-Cyc-P-CRP) in which guanyl cyclase and cGMP receptor gene are inserted and a control sequence and reporter are fused to cGMP receptor protein.
  • pPROcis-GFPuv a plasmid in which guanyl cyclase and cGMP receptor gene are inserted and a control sequence and reporter are fused to cGMP receptor protein.
  • E. coli with the dual vector was prepared by electroshock transformation according to the method described previously. Specifically, the pTrc99a-Cyc-P-CRP vector containing the guanyl cyclase and the gene encoding the cGMP receptor protein was transformed into Escherichia coli XL1-Blue, and then the transformed single colony was transformed into ampicillin (50 ⁇ g / ml). ) was cultured at 37 °C, 200rpm in LB medium containing. When the absorbance (OD 600 ) value of the culture medium reached 2.0, E. coli was inoculated to induce a concentration of 1% of the culture medium, and the culture was induced.
  • the cells were washed twice with cold 10% glycerol. Electrocompetent cells were prepared. To 20 ⁇ l of the cells, 5-10 ng of pPRO0896-GFPuv, pPRO1525-GFPuv, pPRO2133-GFPuv, and pPRO2847-GFPuv plasmids were added to the electroporation apparatus (Bio-Rad, USA), followed by a 2.5 kV current of 4.8. Transformation was added for ms.
  • Host cells used for orthogonal signaling circuit function evaluation are known to increase the number of intracellular GTP molecules up to 4.9 mM when cultured in minimal nutrient medium supplemented with 0.4% glucose.
  • ppGpp guanosine tetraphosphate
  • ppGpp guanosine tetraphosphate
  • host cells must be cultured in a condition that is free of nutrients (amino acids and carbon sources). Therefore, the host cell equipped with the signal transduction circuit was used in the experiment to reduce stress-induced factors caused by the environment or nutrients by culturing before entering the stationary phase in the nutrient medium (LB).
  • E. coli single colonies selected by the above process were pre-cultured at 37 ° C. and 200 rpm in LB medium containing ampicillin (50 ⁇ g / ml) and kanamycin (50 ⁇ g / ml).
  • OD 600 absorbance
  • the culture medium was re-inoculated to reach 1% of the culture medium, and when the absorbance value reached 0.5, 0.1 mM IPTG was treated to express guanyl cyclase expression for 6 hours. Induced. Cells were sampled at two-hour intervals and OD 600 values were compared to compare cell growth.
  • CGMP for the five transformation strains (clone with pTrc99a-Cyc-P-CRP vectors in common and pPRO0896-GFPuv, pPRO1525-GFPuv, pPRO2133-GFPuv, pPRO2847-GFPuv or pPROtrc vectors respectively)
  • culture and heat shock were given by the methods described above. Cell cultures were sampled every 2 hours, and the sampled cultures were collected by high-speed centrifugation (13,000 rpm), washed with distilled water, and suspended in 50 mM Tris-Cl (pH7.9) buffer.
  • the relatively low absolute value of fluorescence is a result of the amount of the sample used less, which can be easily solved by controlling the amount of the sample or increasing the cyclase activity (the amount of the expression of the wild type is extremely low).
  • fluorescence microscopy or FACS fluorescence-activated cell sorter
  • FACS fluorescence-activated cell sorter
  • Example 2 it was confirmed that expression of the reporter gene was induced when E. coli was driven by securing a signaling set capable of transcription control from heterologous cells. Guanyl cyclase or cGMP receptor protein and its regulatory sequence, which are components of the circuit, are not present in Escherichia coli and cannot be recognized as signal transduction mediators. It was estimated that the signal transmission system would function independently without mutual interference. That is, since cGMP, which is not naturally used in Escherichia coli, is used as a transcription induction signal to transmit an activity signal, there is no signal disturbance or interference by other proteins in the host, so that all generated activity signals (cGMP) are introduced into the foreign protein. Because it will induce the expression of.
  • cGMP which is not naturally used in Escherichia coli
  • the polynucleotide encoding the guanyl cyclase is transferred to a pBAD system having a relatively tight expression regulation compared to other expression induction systems, and the guanyl cyclase vector is compatible with the pBAD vector. Insertion into plasmids with different antibiotic markers and replication origin was considered.
  • a new orthogonal signal expression system was designed to position a polynucleotide encoding the always-expressing P CEM promoter-cGMP receptor protein behind a reporter gene fused with a regulatory sequence (FIG. 8). ).
  • the designed recombinant vector was produced by the following procedure.
  • pBAD24 vector was treated with Age I and Hind III restriction enzymes to remove the P BAD promoter moiety, and cloned each regulatory sequence fusion fluorescent gene digested with the same enzyme to vector p0896-GFPuv, p1525-GFPuv. , p2133-GFPuv and p2847-GFPuv were produced.
  • a vector pBAD24-GFPuv having a fluorescent gene inserted under the P BAD promoter was prepared.
  • the p0896-GFPuv, p1525-GFPuv, p2133-GFPuv, p2847-GFPuv, and pBAD24-GFPuv vectors were treated with restriction enzyme Hind III, and the pTrc99a-Cyc-P-CRP plasmid was treated with the same restriction enzyme.
  • the pTrc99a-Cyc-P-CRP plasmid was treated with restriction enzymes BamH I and Hind III to obtain a polynucleotide encoding guanyl cyclase, and then cloned into the pPROtrc vector treated with the same restriction enzyme, thereby vector pPROtrc- Cyc was produced.
  • Orthogonal signaling circuit for identifying non-interference / independence in the host is to produce a recombinant system transformed with pPROtrc-Cyc plasmid in order to produce a dual vector format system in the same manner as in Example 2 above, Recombinant with both vectors was introduced by introducing p0896-GFPuv-P-CRP, p1525-GFPuv-P-CRP, p2133-GFPuv-P-CRP, p2847-GFPuv-P-CRP or pBAD24-GFPuv-P-CRP plasmids, respectively. Strains were prepared (FIG. 8). After selecting E. coli resistant to ampicillin and kanamycin among the transformants, single colonies were inoculated into the nutrient medium, the cells were cultured and sampled by the method described in Example 2, and fluorescence was measured.
  • the established signal transmission circuit proved to be an orthogonal system that can be driven independently of E. coli.
  • cGMP which is not used as a signaling material of E. coli host itself
  • a circuit that does not overlap with the host's intrinsic signal transduction system was fabricated and its performance was evaluated.
  • the fabricated circuit is expected to be capable of signal amplification because the circuit is driven by the cGMP molecule, which is the result of enzymatic activity.
  • multi-gene (operon) co-expression induction capable of simultaneously expressing a plurality of genes or operons having a regulatory sequence in which transcription is induced by a secondary transporter may be implemented by an orthogonal signaling system.
  • This is an example of artificial and orthogonal implementation of a natural global regulation mechanism involving secondary signal transmitters in the middle of the signal transduction cascade of many natural biogenes and signaling circuits. .
  • the plasmid pPRO0896-GFPuv (regulatory sequence of hybrid histidine kinase) identified as having the highest activity by cGMP in the above example was selected, and fused with the same regulatory sequence at the end of the green fluorescent gene.
  • Polynucleotides encoding fluorescent genes were inserted consecutively to design a system with three reporters. Insert 200bp of the intervening nucleotide sequence after the first fluorescent gene to eliminate the effects of the first regulatory sequence (which does not complete transcription of the first gene and then to the second gene) and reduce the impact of the second regulatory sequence.
  • a recombinant strain transformed with pPRO (0896-GFPuv) 3 plasmid was prepared, and two vectors were introduced by introducing a pTrc99a-Cyc-P-CRP plasmid. Recombinant strains were prepared (FIG. 11).
  • the control group consisted of a pTrc99a plasmid without guanyl cyclase and cGMP receptor protein, a recombinant strain with pPRO (0896-GFPuv) 3 plasmid, and a pTrc99a-P-CRP plasmid with only guanyl cyclase and pPRO ( Recombinant strain with 0896-GFPuv) 3 plasmid, recombinant strain with only the empty vectors (pTrc99a, pPROtrc) was used.
  • clones resistant to ampicillin and kanamycin were selected, and single colonies were inoculated in nutrient medium and pre-cultured at 37 ° C. and 200 rpm.
  • the preculture was re-inoculated to 1% of the culture, 0.01 mM IPTG was added when the OD 600 value of the culture was 0.5, and cultured for 6 hours, and then the cell culture was sampled.
  • RT-PCR quantified the relative mRNA levels of the fluorescent genes of the recombinant strains.
  • Recombinant strains with guanyl cyclase and cGMP receptor proteins removed showed similar levels of mRNA as the recombinant strains with empty vectors.
  • the transcript of the fluorescent gene was about 2 times higher than the recombinant strain having the empty vector.
  • Strains containing both guanyl cyclase and cGMP receptor protein have a fluorescent gene transcript about 8 times higher than the recombinant strain with the empty vector, and these results fluoresce against the recombinant strain in the same manner as in Example 2. It was correlated with the result of measuring (Fig.
  • control sequence-reporter fusion gene was converted to a Ptrac-reporter fusion gene in which the transcription was induced in molar ratio by the initial input signal IPTG as a control group, showing a baseline fluorescence.
  • the effect of the invention is a very effective means for signal amplification.
  • the first of the completed constructs is pPRO0896- Recombinant strains transformed with the GFPuv-0896-est-0896-glu plasmid were prepared, and the other plasmid was introduced to prepare a recombinant strain with two vectors.
  • a strain having a pTrc99a empty vector from which a gene encoding guanyl cyclase and a cGMP receptor protein was removed was used.
  • the zymogram in the solid phase was used for clearer activity measurement.
  • esterases the obtained cells were suspended in a buffer solution (50 mM Tris-HCl, pH 8.0) and then disrupted using ultrasonic equipment (Sonics and materials, USA).
  • the prepared sample was subjected to 8% Native-PAGE electrophoresis by fractionating soluble protein through centrifugation, and then reacting at room temperature for 20 minutes by adding a substrate ( ⁇ -naphthyl acetate, Fast Blue RR) solution.
  • substrate ⁇ -naphthyl acetate, Fast Blue RR
  • the soluble protein was electrophoresed through 8% Native-PAGE, and then a buffer solution containing 1 mM MUG was added to induce a 1 hour reaction in a 37 ° C shake incubator (200 rpm).
  • cGMP co-expression effect by cGMP is applicable to drug genes that are difficult to express simultaneously in E. coli.
  • the pPRO0896-RLuc8 plasmid was prepared by inserting a polynucleotide encoding Renilla luciferase under the regulatory sequence of the hybrid histidine kinase.
  • EGFR epidermal growth factor receptor
  • a control vector was an empty vector (pTrc99a) into which guanyl cyclase and cGMP receptor protein was not inserted, and a recombinant strain having the above structure capable of targeting tumor cells.
  • the transformed strain was cultured under the same conditions as in Example 5, and luciferase activity of the cell lysate was measured.
  • Bacterial samples required for luminescence measurements were diluted 1,000-fold to prevent signal saturation, and the prepared bacterial samples were dissolved for 20 minutes in 5x lysis buffer (promega, USA) and coelenterazine (4 ⁇ g / ml) as a substrate. ) was added, and the luminescence signal was measured with a luminometer.
  • Western blot was performed by a known technique using an artificial antibody that recognizes the epidermal growth factor receptor and an antibody that recognizes a cell lytic factor (FIG. 15).
  • the control group showed a high amount of luminescence reaching saturation level in E. coli, which produced cGMP, unlike the basal level of luminescence.
  • Western blots for the expression of the other two genes revealed distinct bands by artificial antibodies that recognize epidermal growth factor receptors and by antibodies selective for cell lysis factor. Therefore, it was confirmed that the orthogonal signaling system of the present invention, which uses the cGMP molecule as a secondary signaling device, can also be used for expression of high value-value proteins such as drug genes.
  • Inducible expression systems are generally used in various fields in which a large amount of target gene products are expressed when internal / external derivatives (chemicals, heat, oxygen, osmotic pressure, etc.) are present as signals.
  • the most widely used induction system is IPTG as a derivative, but since it is a chemical synthetic derivative, it is harmful to cells and excessive protein is rapidly produced in a short time. Therefore, it may act as a factor that inhibits growth by inducing metabolic burden in the host. Can be.
  • Derivatives are also expensive and are not suitable for the production of industrial enzymes and medical proteins. Therefore, inducible expression systems using non-chemical derivatives are preferred, and its prerequisites should not be metabolized in the cell or disturb other systems.
  • the cGMP of the present invention is a kind of natural compound that satisfies the above conditions, and with excellent properties in which no special side effects are reported, it is metabolizable in the human body and is a substance with low side reactions due to residual toxicity. Therefore, in addition to the orthogonal signaling system, it was verified whether cGMP can be directly used as a transcription inducer. To this end, after removing the guanyl cyclase converting GTP to cGMP molecules, cGMP was added to the medium as a derivative to check the gene expression.
  • the specific experimental method is as follows.
  • the pTrc99a-Cyc-P-CRP plasmid was treated with BamH I and Hind III restriction enzymes to remove polynucleotides encoding guanyl cyclase, and then treated with Klenow fragments to self-ligation.
  • pPRO (0896-GFPuv) 3 completed in the same manner as in Example 5, first, a recombinant strain transformed with pPRO (0896-GFPuv) 3 plasmid was prepared and another plasmid was introduced. To prepare a recombinant strain with two vectors.
  • the control group was a strain having pTrc99a, an empty vector.
  • a single colony of transformed E. coli was transformed to 37 ° C. and 200 rpm in LB medium containing ampicillin (50 ⁇ g / ml) and kanamycin (50 ⁇ g / ml). Pre-culture. After inoculation to 1% of the culture solution (15 mL), when the OD 600 value was about 0.5, cGMP dissolved in 0.1% DMSO was added to 500 ⁇ M to induce green fluorescent protein expression for 6 hours. Cell culture was sampled every 2 hours and fluorescence was measured in the same manner as in Example. As a result, green fluorescent protein was expressed, and thus it was confirmed that gene expression could be induced when cGMP was directly used as a derivative (FIG. 16).
  • Two-hybrid systems are widely used throughout the field of biology for the identification of protein-protein interactions.
  • a typical method of the dual-hybridization system first developed in yeast is to take advantage of the properties of the GAL4p protein of Saccharomyces cerevisiae .
  • the system attaches the target protein (bait) to the DNA-binding domain of the protein GAL4p to make a hybrid protein, and attaches the hybrid protein which attaches the transcriptional activity induction domain of GAL4p to the protein (prey) that binds to the protein.
  • the two hybrid proteins have a binding property between the bait and the prey, they act as a functional GAL4 protein, that is, a transcription factor that binds to DNA and induces transcription, followed by the GAL4p binding region (transfer regulatory sequence). It functions to mediate the expression of the gene (reporter) located.
  • GAL4p binding region transfer regulatory sequence
  • domain-dissection of proteins with enzymatic activity is performed by fusion and expression of baits and prey to each, and if there is interaction between the fused proteins, the original enzyme
  • the function of the recovery is to use the principle that represents the activity.
  • the transcription factor division system there is a time gap to detect the expression of the reporter as a transcription induction resultant, and there is inconvenience in selecting all clones.
  • the beta-lactamase division system the degree of enzyme activity The screening process is very easy because it has a property that is proportional to the survival rate and the cell growth rate in the antibiotic medium.
  • a novel dual-hybridization system having the advantages of both methods has been developed to find a protein that interacts with guanyl cyclase.
  • the interaction of bait and prey fused to the divided domains results in the binding of domains to become active, and the resulting product, cGMP, binds to the receptor and induces reporter expression.
  • the method of the present embodiment can be used as a highly efficient protein interaction detection system with the same amplification principle as in Example 4.
  • it has a characteristic of orthogonal signal transmission and is driven in an environment free from interference, so that the limit of detection power is extremely low, that is, it is a very sensitive system.
  • Guanyl cyclase N-terminal domain fused to the DNA-binding domain (DBD) of the GAL4p protein and guanyl cyclase C-terminal domain fused to the transcriptional activation domain (AD) of GAL4p are co-expressed in the same yeast .
  • DBD DNA-binding domain
  • AD transcriptional activation domain
  • the domains of the guanyl cyclase are brought into contact with each other to become active and induce the expression of the reporter gene by increasing cGMP production (FIG. 17). Because the system uses orthogonal factors that are not present in yeast, it was expected to be active only by protein binding reactions, eliminating false-positives of the existing double-hybridization system. The following examples were carried out as follows.
  • DBD / Cyc and AD in which the DNA-binding domain and the transcriptional activation domain of GAL4p protein were fused to the rest of the guanyl cyclase including the catalytic domain (amino acids 14-197) and ATP hydrolysis domain (amino acids 221-595), respectively.
  • / ATP was allowed to be expressed under the control of the IPTG inducible promoter and the arabinose inducible promoter.
  • Plasmids pTrc99a-DBD / Cyc-P-CRP, pBAD-AD / ATP and pPRO0896-GFPuv were co-transformed into yeast.
  • the control group consisted of cells with pTrc99a-P-CRP, pBAD-AD / ATP and pPRO0896-GFPuv vectors from which the DBD / Cyc protein was removed. After adding 0.1 mM IPTG and 0.0002% arabinose to the green fluorescent protein, the GFP levels began to increase rapidly over time in the cells expressing DBD / Cyc and AD / ATP proteins. Only baseline fluorescence was observed for the control group (FIG. 18). This is the result of guanyl cyclase having cGMP production ability by interacting DNA-binding domain and transcriptional activation domain of GAL4p protein. In addition, due to the orthogonal characteristics, the interference due to the interaction with the unspecified protein is very small, indicating that the sensitivity is high. Using this system, it is predicted that it is possible to screen accurately and with high sensitivity proteins that interact with specific proteins.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biomedical Technology (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • General Health & Medical Sciences (AREA)
  • Molecular Biology (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Bioinformatics & Computational Biology (AREA)
  • Crystallography & Structural Chemistry (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

본 발명은 미생물 유래 구아닐 고리화효소(guanylyl cyclase)를 코딩하는 유전자, cGMP 수용체 단백질을 코딩하는 유전자 및 cGMP 수용체 단백질이 결합하는 조절성 염기서열이 하나 이상의 플라스미드에 재조합된 것을 특징으로 하는 숙주세포의 생체 회로 간섭 없이 외래 유전자를 독립적으로 발현할 수 있는 재조합 벡터 및 상기 재조합 벡터를 이용한 숙주세포의 생체 회로 간섭 없이 외래 유전자를 독립적으로 발현하는 방법에 관한 것이다.

Description

숙주세포의 생체 회로 간섭 없이 외래 유전자를 발현하기 위한 재조합 벡터 및 이의 용도
본 발명은 숙주세포의 생체 회로 간섭 없이 외래 유전자를 발현하기 위한 재조합 벡터 및 이의 용도에 관한 것으로, 더욱 상세하게는 미생물 유래 구아닐 고리화효소(guanylyl cyclase)를 코딩하는 유전자, cGMP 수용체 단백질을 코딩하는 유전자 및 cGMP 수용체 단백질이 결합하는 조절성 염기서열이 하나 이상의 플라스미드에 재조합된 것을 특징으로 하는 숙주세포의 생체 회로 간섭 없이 외래 유전자를 독립적으로 발현할 수 있는 재조합 벡터, 상기 재조합 벡터에 외래 유전자를 작동 가능하게 연결한 재조합 벡터를 숙주세포에 형질전환시켜 숙주세포의 생체 회로 간섭 없이 외래 유전자를 독립적으로 발현하는 방법, 상기 재조합 벡터로 형질전환된 숙주세포, 상기 재조합 벡터를 유효성분으로 포함하는, 숙주세포의 생체 회로 간섭 없이 외래 유전자의 발현을 증가시키기 위한 조성물 및 키트에 관한 것이다.
유전자 재조합 기술을 이용한 단백질 발현과 생산 기술은 생명과학 연구와 생물산업에 있어서 매우 중요한 기반 기술이다. 특히 미생물이나 효모를 이용한 단백질 생산 방법은 유전자 조작과정과 숙주배양의 수월성과 함께, 뛰어난 단백질 발현능력으로 인해 연구와 산업 현장 적용을 위한 다양한 재조합 단백질들의 생산 공정에 이용되고 있다. 이러한 기술은 외래 유전자 도입을 통한 재조합 단백질 생산이나 숙주의 대사 회로를 조작하여 유용 산물의 과생산을 유도하는 대사공학에 적용됨으로써 바이오연료, 식품 소재 및 의약용 제재 등 고부가가치 산물을 생산할 수 있다.
잘 알려진 바와 같이 숙주세포에 외래 DNA가 도입되어 발현되면 정상적인 세포기능에 영향을 주어 숙주 본래의 대사생리를 변화시키거나 교란을 유발할 수 있다. 이러한 현상을 외부 DNA에 의해 숙주에 부과되는 대사 부담(metabolic burden)이라 칭하며, 플라스미드 카피 수 증가, 단백질의 과다생산 또는 재조합 단백질 활성에 의한 세포기능 방해를 비롯한 다양한 부작용을 포함한다. 특히 재조합 외래 유전자 발현과정에서 숙주의 내재적 유전자 발현 시스템(전사와 번역도구)을 공유해야 하기 때문에 재조합 외래 유전자의 과발현을 유도할 경우, 숙주에 필요한 전사/번역 요소와 자원이 고갈되어 성장과 생리를 저해하게 된다. 이러한 현상은 짧은 시간에 과발현을 유도(explosive induction)하는 재조합 유전자 발현시스템에 의해 증가한 스트레스가 숙주의 생리적 부담을 경감시키려는 샤페론이나 단백질 가수분해 효소 등의 동시 발현을 유도하여 단백질 분해나 오접힘(misfolding), 세포막의 물리·화학적 변화를 유발하며, 최종적으로는 목적 산물에 대한 수율 저하를 초래한다. 특히, 특정 생산물 생산에 다단계의 효소 반응이 필요한 경우, 생산 경로를 인위적으로 구축하기 위해서는 관련 효소 유전자를 다중 혹은 오페론 형태로 발현시켜야 한다. 따라서 한 종 이상의 유도성 발현 시스템(IPTG-LacI, L-arabinose-AraC, anhydrotetracycline-TetR)으로 구성된 유전자 발현 모듈이나 회로(genetic circuit)를 통해 여러 가지 유전자가 동시에 다량으로 발현되어야 함으로 숙주에 더욱 심화된 생리적 부담 현상이 나타난다.
상기와 같은 외래 유전자 발현에 대한 상호간섭(숙주의 전사와 번역도구 공유로 인한 간섭)을 줄여, 세포 생리 교란이나 부담에 의한 성장지연이나 오염(불필요한 대사 산물)의 문제를 줄이는 방법으로, 유전자 발현에 필요한 주요 성분을 세포로부터 추출한 후 목적 유전자와 혼합하여 생체 외에서 단백질을 합성하거나 반응시키는 무세포 반응(cell-free reaction)법이 고려되기도 한다. 상기 방법은 단시간에 효율적으로 반응/합성할 수 있으며 세포 배양이 필요 없기 때문에 분리와 정제 과정을 최소화할 수 있다는 장점을 가지나, 고가이며 실험 조건을 민감하게 조절해주어야 하는 문제점을 가진다. 또한 세포를 발현숙주로 이용하는 시스템과 달리 분열에 의한 재생이 불가능함으로 분명한 생산성의 한계가 존재한다. 따라서 근본적으로는 분열이 가능한 살아있는 세포를 숙주로 적절한 조절 기작을 설계해 단백질이나 대사물을 생산하는 것이 보다 유리하다. 이러한 목적에 가장 부합되는 방법으로, 독립적으로 조절이 가능한 발현시스템을 도입해 숙주의 내재적(innate) 유전자 발현 시스템과 기능적으로 격리되어 선택적인 반응이나 유전자 발현이 가능하도록 직교적인 기능 인자(orthogonally functional factor)를 이용하는 방법이 있다. 예를 들어 내재적 리보솜이 인식하지 못하도록 변형된 샤인-달가노(Shine-Dalgarno) 서열을 갖는 직교적인 mRNA (O-mRNA)와 그것을 인식하는 직교적인 리보솜 (O-ribosome), 그리고 직교적인 아미노아실-tRNA 합성효소 (O-aminoacyl tRNA synthetase) 세트를 이용하면 숙주의 번역기구를 사용하지 않는 독립적인 단백질 생산 시스템의 구현이 가능하다. O-mRNA와 O-ribosome은 숙주입장에선 생리에 비필수적인 요소임과 동시에 자신의 번역 네트워크를 사용하지 않고 단백질을 합성할 수 있는 길(route)를 제공하기 때문이다. 단점으로는 유전자 발현에 대한 번역 지연(translational delay)이 나타날 수 있으며, 상대적으로 낮은 직교 요소의 생체 내 양으로 인해 내재적 시스템을 이용하였을 때의 단백질 발현 수준에 미치지 못한다. 상기 번역과정 외에 전사 과정의 직교시스템은 잘 알려진 T7 RNA 중합효소를 이용하는 방법이 있다. 이 과정에서는 숙주의 고유한 전사 도구(RNA 중합효소와 결합하는 프로모터)와 경쟁하지 않도록 파지 유래의 중합효소와 해당 프로모터를 이용한다. 이러한 전사직교 시스템에서 아직 해결해야 하는 문제점은 완전한 독립성의 담보가 어렵다는 것이다. 이는 잘 알려진 바와 같이, 미생물 프로모터의 보존서열이나 이에 결합하는 중합효소의 선택성이 상대적으로 낮은데 그 원인이 있다. T7 중합효소는 숙주 본래의 프로모터와도 일정한 수준이상의 결합이 가능하며, T7 프로모터의 경우도 대장균 전사 중합효소가 인식이 가능한 것으로 알려져 있다. 따라서 숙주 전사 인자에 의한 상호작용이 가능해 일정 수준 이상의 전사체가 유도체 없이도 측정된다. 이러한 단점에도 불구하고, 숙주 발현시스템에 독립적인 구동 인자를 사용하여 목적 유전자를 발현시키는 것은 여전히 가장 주목받는 새로운 발현 논리이다. 하지만 활용 가능한 직교시스템이 전사와 번역수준에서 부분적으로 존재함에도 불구하고, 아직까지 근본적인 직교 시스템의 완전한 구축은 이루어지지 않고 있다. 이러한 문제는 직교 리보솜이나 전사 중합효소를 생체에서 발현시키는 과정에 사용하는 전형적인 발현 조절 논리가 기존의 일반적인 IPTG와 lac 리프레서(repressor), 아라비노스(arabinose)와 AraC 등, 숙주 내 대사/생리를 교란할 수 있는 방법에 의존적이기 때문이다. 전사와 번역의 주체는 직교적이지만 이들을 제어/조절하는 논리는 직교적이지 않아, 직교 인자의 발현 유도신호로 도입된 IPTG(혹은 락토스)와 아라비노스가 직교 인자의 발현 유도 외에 생체 내 다른 당대사에 관련된 유전자들의 발현이나 조절에 관여하거나 간섭할 수 있기 때문이다. 이러한 관점에서 최근에 보고된 진핵세포의 키나제 다단계 신호 전달(kinase cascade signal transduction) 시스템을 원핵세포(대장균)에 도입하여 구동시킨 예는 좋은 직교시스템의 발현 조절논리로 현 문제의 대안이 될 수 있다. 하지만 일반화엔 아직 미비된 특성 평가 결과를 보여주고 있어, 좀더 일반적으로 적용 가능한 직교인자의 발현 조절논리가 필요한 실정이다. 전사와 번역 주체는 물론, 이들의 생체 내 구동 유도에 반드시 필요한 직교화된 발현 조절 시스템의 접목만이 완전한 직교시스템을 의미하기 때문이다.
이에 본 발명자들은 대장균(Escherichia coli)과 이종 관계인 미생물로부터 전사 신호 전달(유도)에 관여하는 완전한 구성 성분 세트를 확보하여 대장균에서 구동시킴으로써 숙주와 분리(상호 간섭이 없는 직교화)되는 신호를 생성하였으며 더 나아가 이를 이용한 신호 증폭(소량의 신호를 증폭)과 이들 신호를 동시 다발적으로 수용해 발현이 유도되는 다중 유전자 동시 발현(하나의 신호에 의한 다중 유전자 발현이 조절되는 global regulation 모사)을 확인하고 본 발명을 완성하게 되었다.
한편, 한국등록특허 제0958095호에는 '번역 동반 시스템을 이용한 항균 펩타이드의 대량 발현방법'이 개시되어 있고, 한국공개특허 제2010-0075884호에는 '진핵 타입 I 인터페론 반응 억제제의 동시-발현에 의해 세균-계 전달 시스템으로부터 형질전이 유전자 발현을 증가시키는 방법'이 개시되어 있으나, 본 발명의 숙주세포의 생체 회로 간섭 없이 외래 유전자를 발현하기 위한 재조합 벡터 및 이의 용도에 대해서는 기재된 바가 없다.
본 발명은 상기와 같은 요구에 의해 도출된 것으로, 본 발명자들은 로도스피릴룸 센테눔(Rhodospirillum centenum)으로부터 분리한 구아닐 고리화 효소, cGMP 수용체 단백질 및 cGMP 수용체 단백질이 결합하는 조절성 염기서열을 이용하여 재조합 벡터를 제작하고, 상기 재조합 벡터에 외래 유전자를 삽입하여 대장균 세포에 형질전환한 후, 공벡터로 형질전환된 대조구 대장균과 비교하여 세포의 성장 또는 스트레스 회복력에 영향을 미치지 않고 상기 외래 유전자가 발현 유도되는 것을 확인함으로써, 본 발명을 완성하였다.
상기 과제를 해결하기 위해, 본 발명은 미생물 유래 구아닐 고리화효소(guanylyl cyclase)를 코딩하는 유전자, cGMP 수용체 단백질을 코딩하는 유전자 및 cGMP 수용체 단백질이 결합하는 조절성 염기서열이 하나 이상의 플라스미드에 재조합된 것을 특징으로 하는 숙주세포의 생체 회로 간섭 없이 외래 유전자를 독립적으로 발현할 수 있는 재조합 벡터를 제공한다.
또한, 본 발명은 미생물 유래 cGMP 수용체 단백질을 코딩하는 유전자 및 cGMP 수용체 단백질이 결합하는 조절성 염기서열이 하나 이상의 플라스미드에 재조합된 것을 포함하는 것을 특징으로 하는 숙주세포의 생체 회로 간섭 없이 외래 유전자를 독립적으로 발현할 수 있는 재조합 벡터를 제공한다.
또한, 본 발명은 상기의 재조합 벡터에 외래 유전자를 삽입한 재조합 벡터를 숙주세포에 형질전환시켜 숙주세포의 생체 회로 간섭 없이 외래 유전자를 독립적으로 발현하는 방법을 제공한다.
또한, 본 발명은 상기의 재조합 벡터를 유효성분으로 포함하는, 숙주세포의 생체 회로 간섭 없이 외래 유전자의 발현을 증가시키기 위한 조성물 또는 키트를 제공한다.
또한, 본 발명은 미생물 유래 구아닐 고리화효소(guanylyl cyclase) 단백질의 촉매 도메인과 ATP 가수분해 도메인 각각에 베이트(bait)와 프레이(prey) 중 어느 하나를 재조합하여 효모에서 발현시켜 발현된 베이트와 프레이의 상호작용을 검출하는 단계를 포함하는 베이트와 프레이의 상호작용 여부를 확인하는 방법을 제공한다.
본 발명의 재조합 벡터는 숙주세포 고유의 발현 신호와 상호간섭하지 않는 특성으로 인해 숙주의 생리적 부담을 줄이는 동시에, 세포 내 신호 전달에 관여하는 2차 전달자를 매개 인자로 이용해 유전자 전사 활성 신호를 증폭함으로써 초기 미량 신호만으로 유전자 발현을 효율적으로 유도할 수 있다. 이러한 특성으로 인해 유전자 발현에 필요한 고가의 합성 화학 유도체를 대량으로 요구하지 않아 경제적으로 목적 산물의 대량 생산이 가능하며, 화학 유도체를 과량으로 주입하기 어려운 생체 실험(원거리에서 발현 신호를 주입해야 하는 약물 전달이나 유전자 치료 등), 발효기나 배양조에서의 의료용 단백질과 산업용 효소의 대량생산에 적합하다. 또한 동시에 다수 유전자의 발현을 유도할 수 있어 다양한 대사공학 분야에 적용될 수 있으므로, 산업적으로 유용하게 이용될 것으로 기대된다.
도 1은 본 발명의 유전자 발현을 유도하는 cGMP 의존적 직교 신호전달 시스템의 구동 원리를 설명하는 모식도이다. 일반적인 미생물 숙주에서는 이용하지 않는 대사물, cGMP의 생성과 이를 수용하는 수용체, cGMP-수용체 복합체에 의한 전사 유도 기작을 보여준다.
도 2는 cGMP 의존적 직교 신호전달 시스템을 구성하는 핵심 유전자인 구아닐 고리화효소와 cGMP 수용체 단백질을 클로닝하는 과정과 제작된 재조합 벡터를 나타낸 모식도이다.
도 3은 cGMP 의존적 직교 신호전달 시스템 발현조절 요소로서 cGMP-수용체 단백질과 결합하여 전사를 유도하는 조절서열의 기능을 확인하기 위한 리포터 융합과정을 나타낸 모식도이다.
도 4는 본 발명의 cGMP 의존적 직교 신호전달 시스템을 평가하기 위한 이중(dual) 벡터 시스템의 최종 결과물을 나타낸 모식도이다. 두 개의 벡터는 하나의 숙주에서 안정적으로 양립하기 위한 모든 구성 요소를 지니고 있다.
도 5는 본 발명의 cGMP 의존적 직교 신호전달 시스템을 평가하기 위해 숙주로 도입한 재조합 벡터에 의한 세포 성장 저해와 스트레스 복구 능력을 평가한 그림이다. A는 숙주세포의 성장 저해가 없음을 보여주며, B는 스트레스 복구능력에 차이가 없음을 보여준다.
도 6은 본 발명의 cGMP 의존적 직교 신호전달 시스템을 평가하기 위해, 각기 다른 세포농도에서 단백질의 발현을 유도해 리포터의 발현양을 비교한 결과이다. 상대적으로 낮은 형광값은 세포 양을 적게 사용한 결과이며, 대조군의 값이 높은 이유는 전세포를 이용해 형광을 측정한 것에 기인한다.
도 7은 본 발명의 cGMP 의존적 직교 신호전달 시스템에서 직교 신호 수용에 관련된 조절 서열에 결합하는 시그마 요소가 스트레스 반응과 관련이 있는지를 살펴보기 위해 열 충격(heat shock)을 가한 후, 리포터의 발현양을 비교한 결과이다. 4번째 조절서열에서 가능성을 확인하였다.
도 8은 본 발명의 cGMP 의존적 직교 신호전달 시스템 작동과정에서 leaking에 의한 노이즈를 줄이기 위해, 강하게 전사가 조절되는 Pbad 프로모터를 융합해 클로닝한 결과물을 나타낸 벡터 모식도이다.
도 9는 본 발명의 cGMP 의존적 직교 신호전달 시스템을 Pbad 프로모터와 접목시킨 결과로, 강화된 신호와 전사유도 양을 보여주는 개선된 결과를 보여준다. 즉 직교 신호의 특성을 잘 반영하며 단백질 발현유도로 신호로 사용하기에 충분한 결과물을 보여준다.
도 10은 기존의 전형적인 발현 유도체만을 이용하는 전사 유도시스템(a)과 본 발명의 cGMP 의존적 직교 신호전달 시스템에서 채용한 2차 전달자(cGMP)를 포함하는 신호 증폭의 원리(b), 이를 이용해 적은 입력신호만으로 다중의 유전자(오페론)를 동시 발현(c)할 수 있는 장점을 비교해 도식화한 그림이다.
도 11은 본 발명의 cGMP 의존적 직교 신호전달 시스템의 장점인 신호증폭 효과를 모니터링하기 위한 평가 시스템을 나타낸 모식도이다.
도 12는 본 발명의 직교 신호전달 발현유도 시스템에 의한 신호증폭 효과를 전사체 수준에서 비교한 결과이다.
도 13은 본 발명의 cGMP 의존적 직교 신호전달 시스템에 의한 신호증폭 효과를 리포터 발현에 의한 형광값으로 비교한 결과이다.
도 14는 본 발명의 cGMP 의존적 직교 신호전달 시스템의 증폭된 신호에 의해 조절서열을 융합한 다수의 유전자를 동시 발현시킨 결과물을 보여준다. 구동평가를 위한 형광단백질 리포터와 산업용 효소 2종의 동시 발현을 유도한 후, 활성 측정법(zymogram)으로 고부가가치 산업용 효소의 기능적 과발현(functional overexpression)을 확인하였다.
도 15는 본 발명의 cGMP 의존적 직교 신호전달 시스템의 증폭된 신호에 의해 조절서열을 융합한 다수의 유전자를 동시 발현시킨 결과물로써, 난치암 치료에 적용되는 의약용 단백질의 동시발현 결과를 보여 준다. 리포터와 의약용 효소 2종의 동시 발현을 유도한 후, 항체를 이용한 웨스턴 블랏으로 기능적 과발현을 확인하였다.
도 16은 본 발명의 cGMP 의존적 직교 신호전달 시스템의 변형으로, 구아닐 고리화효소 없이 유도체로써 직접 cGMP를 이용하는 전사 유도 시스템의 구동 결과를 보여준다.
도 17은 본 발명의 cGMP 의존적 직교 신호전달 시스템의 구성 요소인 구아닐 고리화 효소를 분할(dissection)하고 다른 단백질과 융합해, 융합된 단백질 사이의 상호작용에 의해 전사가 유도되는 새로운 이중-하이브리드 시스템의 원리를 나타낸 모식도이다. A와 B 는 기존의 이중-하이브리드 작동 원리를 보여주며, C 는 본 발명의 결과물이 지닌 신호증폭 효과가 결부된 새로운 직교신호 증폭 이중-하이브리드의 작동원리를 보여준다.
도 18은 본 발명의 새로운 직교신호 증폭 이중-하이브리드의 작동에 의한 결과물을 보여준다. 간섭이 없어 예민하고 정확하게 작동할 수 있는 신호 값의 분명한 차이를 보여준다.
본 발명의 목적을 달성하기 위하여, 본 발명은 미생물 유래 구아닐 고리화효소(guanylyl cyclase)를 코딩하는 유전자, cGMP 수용체 단백질을 코딩하는 유전자 및 cGMP 수용체 단백질이 결합하는 조절성 염기서열이 하나 이상의 플라스미드에 재조합된 것을 특징으로 하는 숙주세포의 생체 회로 간섭 없이 외래 유전자를 독립적으로 발현할 수 있는 재조합 벡터를 제공한다.
또한, 본 발명은 미생물 유래 cGMP 수용체 단백질을 코딩하는 유전자 및 cGMP 수용체 단백질이 결합하는 조절성 염기서열이 하나 이상의 플라스미드에 재조합된 것을 포함하는 것을 특징으로 하는 숙주세포의 생체 회로 간섭 없이 외래 유전자를 독립적으로 발현할 수 있는 재조합 벡터를 제공한다.
본 발명의 일 구현 예에 따른 재조합 벡터에 있어서, 미생물 유래 구아닐 고리화효소(guanylyl cyclase)를 코딩하는 유전자, cGMP 수용체 단백질을 코딩하는 유전자 및 cGMP 수용체 단백질이 결합하는 조절성 염기서열이 하나 이상의 플라스미드에 재조합될 수 있는데, 예를 들면 상기 3개의 유전자가 각각의 플라스미드에 재조합될 수도 있고, 미생물 유래 구아닐 고리화효소(guanylyl cyclase)를 코딩하는 유전자 및 cGMP 수용체 단백질을 코딩하는 유전자 2개가 하나의 플라스미드에 재조합되고, 조절성 염기서열이 하나의 플라스미드에 삽입될 수도 있고, 상기 3개의 유전자가 하나의 플라스미드에 삽입될 수도 있으나, 이에 제한되지 않는다.
또한, 본 발명의 일 구현 예에 따른 재조합 벡터에 있어서, 미생물 유래 구아닐 고리화효소(guanylyl cyclase)를 코딩하는 유전자 대신에 cGMP를 인위적으로 첨가할 수도 있으며, 이러한 경우에는 구아닐 고리화효소가 불필요하므로 미생물 유래 cGMP 수용체 단백질을 코딩하는 유전자 및 cGMP 수용체 단백질이 결합하는 조절성 염기서열이 하나 이상의 플라스미드에 재조합될 수 있다.
본 발명의 일 구현 예에 따른 재조합 벡터에 있어서, 상기 미생물은 로도스피릴룸 센테눔(Rhodospirillum centenum)일 수 있으나, 이에 제한되지 않는다.
'구아닐 고리화효소(guanylyl cyclase)'는 GTP(guanosine triphosphate)를 기질로 사용하여 3',5'-cGMP(cyclic guanosine monophosphate) 또는 2',5'-cGMP를 생성하는 효소로, 로도스피릴룸 센테눔 균주에서는 클라스 Ⅲ 뉴클레오티딜 고리화효소(class Ⅲ nucleotidyl cyclase)로 알려져 있다.
본 발명의 구아닐 고리화효소를 코딩하는 유전자는 서열번호 1로 표시되는 염기서열을 포함할 수 있다. 또한, 상기 염기서열의 상동체가 본 발명의 범위 내에 포함된다. 구체적으로, 상기 유전자는 서열번호 1의 염기서열과 각각 70% 이상, 더욱 바람직하게는 80% 이상, 더 더욱 바람직하게는 90% 이상, 가장 바람직하게는 95% 이상의 서열 상동성을 가지는 염기서열을 포함할 수 있다. 폴리뉴클레오티드에 대한 "서열 상동성의 %"는 두 개의 최적으로 배열된 서열과 비교 영역을 비교함으로써 확인되며, 비교 영역에서의 폴리뉴클레오티드 서열의 일부는 두 서열의 최적 배열에 대한 참고 서열(추가 또는 삭제를 포함하지 않음)에 비해 추가 또는 삭제(즉, 갭)를 포함할 수 있다.
'cGMP 수용체 단백질'은 cGMP와 결합하여 전사를 유도하는 기능을 하며, 본 발명의 cGMP 수용체 단백질을 코딩하는 유전자는 서열번호 3으로 표시되는 염기서열을 포함할 수 있다. 또한, 상기 염기서열의 상동체가 본 발명의 범위 내에 포함되는데, 구체적으로는 전술한 바와 같다.
본 발명의 일 구현 예에 따른 재조합 벡터에 있어서, 상기 조절성 염기서열은 하이브리드 히스티딘 인산화효소(cyd2, hybrid histidine kinase), 디하이드로오로타제 유사 단백질(pyrC', dihydroorotase-like protein), 주화성 유사 단백질(cheY 3 , chemotaxis-like protein) 또는 센서 인산화효소 반응 조절자 하이브리드(cstS1, sensor-kinase-response regulator hybrid) 유전자 유래 염기서열일 수 있으나, 이에 제한되지 않는다. 본 발명의 상기 cyd2, pyrC', cheY 3 또는 cstS1 유전자 유래 조절성 염기서열은 각각 서열번호 4, 5, 6 또는 7의 염기서열로 표시되는 염기서열 및 상기 염기서열의 상동체가 본 발명의 범위 내에 포함되는데, 구체적으로 전술한 바와 같다.
또한, 본 발명은 상기 재조합 벡터의 조절성 염기서열의 하류에 외래 유전자가 삽입된 재조합 벡터를 제공한다.
용어 "재조합"은 세포가 이종의 핵산을 복제하거나, 상기 핵산을 발현하거나 또는 펩티드, 이종의 펩티드 또는 이종의 핵산에 의해 암호된 단백질을 발현하는 세포를 지칭하는 것이다. 재조합 세포는 상기 세포의 천연 형태에서는 발견되지 않는 유전자 또는 유전자 절편을, 센스 또는 안티센스 형태 중 하나로 발현할 수 있다. 또한 재조합 세포는 천연 상태의 세포에서 발견되는 유전자를 발현할 수 있으며, 그러나 상기 유전자는 변형된 것으로서 인위적인 수단에 의해 세포 내 재도입된 것이다.
본 발명에서, 상기 구아닐 고리화효소(guanylyl cyclase)를 코딩하는 유전자, cGMP 수용체 단백질을 코딩하는 유전자 및 cGMP 수용체 단백질이 결합하는 조절성 염기서열은 재조합 발현 벡터 내로 삽입될 수 있다. 용어 "재조합 벡터"는 세균 플라스미드, 파아지, 효모 플라스미드, 식물 세포 바이러스, 포유동물 세포 바이러스, 또는 다른 벡터를 의미한다. 대체로, 임의의 플라스미드 및 벡터는 숙주 내에서 복제 및 안정화할 수 있다면 사용될 수 있다. 상기 발현 벡터의 중요한 특성은 복제 원점, 프로모터, 마커 유전자 및 번역 조절 요소(translation control element)를 가지는 것이다.
구아닐 고리화효소(guanylyl cyclase)를 코딩하는 유전자, cGMP 수용체 단백질을 코딩하는 유전자 및 cGMP 수용체 단백질이 결합하는 조절성 염기서열 및 적당한 전사/번역 조절 신호를 포함하는 발현 벡터는 당업자에 주지된 방법에 의해 구축될 수 있다. 상기 방법은 시험관 내 재조합 DNA 기술, DNA 합성 기술 및 생체 내 재조합 기술 등을 포함한다. 상기 DNA 서열은 mRNA 합성을 이끌기 위해 발현 벡터 내의 적당한 프로모터에 효과적으로 연결될 수 있다. 또한 발현 벡터는 번역 개시 부위로서 리보좀 결합 부위 및 전사 터미네이터를 포함할 수 있다.
발현 벡터는 바람직하게는 하나 이상의 선택성 마커를 포함할 것이다. 상기 마커는 통상적으로 화학적인 방법으로 선택될 수 있는 특성을 갖는 핵산 서열로, 형질전환된 세포를 비형질전환 세포로부터 구별할 수 있는 모든 유전자가 이에 해당된다. 그 예로는 암피실린(ampicillin), 카나마이신(kanamycin), G418, 블레오마이신(Bleomycin), 하이그로마이신(hygromycin), 클로람페니콜(chloramphenicol)과 같은 항생제 내성 유전자가 있으나, 이에 한정되는 것은 아니다.
또한, 본 발명은 상기 외래 유전자가 삽입된 재조합 벡터로 형질전환된 숙주세포를 제공한다.
본 발명의 일 구현 예에서, 상기 숙주세포는 대장균(Escherichia coli)일 수 있으나, 이에 제한되지 않으며, 본 발명의 벡터를 원핵세포에 안정되면서 연속적으로 클로닝 및 발현시킬 수 있는 숙주세포는 당업계에 공지된 어떠한 숙주세포도 이용할 수 있으며, 예컨대, E. coli JM109, E. coli BL21, E. coli RR1, E. coli LE392, E. coli B, E. coli X 1776, E. coli W3110, 바실러스 서브틸리스, 바실러스 츄린겐시스와 같은 바실러스 속 균주, 그리고 살모넬라 티피무리움, 세라티아 마르세슨스 및 다양한 슈도모나스 종과 같은 장내균과 균주 등이 있다.
또한, 본 발명의 벡터를 진핵 세포에 형질전환시키는 경우에는 숙주세포로서, 효모(Saccharomyce cerevisiae), 곤충세포, 사람세포 (예컨대, CHO 세포주 (Chinese hamster ovary), W138, BHK, COS-7, 293, HepG2, 3T3, RIN 및 MDCK 세포주) 및 식물세포 등이 이용될 수 있다.
또한, 본 발명은 상기 외래 유전자가 삽입된 재조합 벡터를 숙주세포에 형질전환시켜 숙주세포의 생체 회로 간섭 없이 외래 유전자를 독립적으로 발현하는 방법을 제공한다.
본 발명의 벡터를 숙주세포 내로 운반하는 방법은, 숙주 세포가 원핵 세포인 경우, CaCl2 방법, 하나한 방법(Hanahan, D., J. Mol. Biol., 166:557-580(1983)) 및 전기천공 방법 등에 의해 실시될 수 있다. 또한, 숙주세포가 진핵세포인 경우에는, 미세주입법, 칼슘 포스페이트 침전법, 전기천공법, 리포좀-매개 형질감염법, DEAE-덱스트란 처리법 및 유전자 밤바드먼트 등에 의해 벡터를 숙주세포 내로 주입할 수 있다.
또한, 본 발명은 미생물 유래 구아닐 고리화효소(guanylyl cyclase)를 코딩하는 유전자, cGMP 수용체 단백질을 코딩하는 유전자 및 cGMP 수용체 단백질이 결합하는 조절성 염기서열이 하나 이상의 플라스미드에 재조합된 것을 특징으로 하는 재조합 벡터 또는 미생물 유래 cGMP 수용체 단백질을 코딩하는 유전자 및 cGMP 수용체 단백질이 결합하는 조절성 염기서열이 하나 이상의 플라스미드에 재조합된 것을 포함하는 것을 특징으로 하는 재조합 벡터를 유효성분으로 포함하는, 숙주세포의 생체 회로 간섭 없이 외래 유전자의 발현을 증가시키기 위한 조성물 또는 키트를 제공한다.
본 발명의 일 구현 예에 따른 조성물 또는 키트에 포함되는 재조합 벡터는 구아닐 고리화효소를 코딩하는 유전자, cGMP 수용체 단백질을 코딩하는 유전자 및 cGMP 수용체 단백질이 결합하는 조절성 염기서열이 하나의 플라스미드에 도입된 재조합 벡터일 수도 있고, 별개의 플라스미드에 각각 도입된 재조합 벡터일 수도 있으며, 두 개는 하나의 플라스미드에 그리고 나머지 하나는 별개의 플라스미드에 도입된 재조합 벡터일 수도 있다. 본 발명의 조성물 또는 키트는 상기 재조합 벡터를 유효성분으로 함유하며, 상기 재조합 벡터를 숙주세포에 형질전환시킴으로써 숙주세포의 생체 회로 간섭 없이 외래 유전자의 발현을 증가시킬 수 있는 것이다.
본 발명의 상기 키트는 당업계에서 통상적으로 사용되는 방법을 이용하여 제조될 수 있다.
또한, 본 발명은
서열번호 2의 아미노산 서열로 이루어진 미생물 유래 구아닐 고리화효소(guanylyl cyclase) 단백질의 촉매 도메인과 ATP 가수분해 도메인 각각에 베이트(bait)와 프레이(prey) 중 어느 하나를 재조합하여 효모에서 발현시키는 단계; 및
상기 발현된 베이트와 프레이의 상호작용을 검출하는 단계를 포함하는 베이트와 프레이의 상호작용 여부를 확인하는 방법을 제공한다.
본 발명의 일 구현 예에 따른 방법에 있어서, 상기 방법은 종래의 효모 이중 혼성화(yeast two hybrid) 방법에 구아닐 고리화효소를 이용한 새로운 이중 혼성화 방법이다. 본 발명의 방법은 구아닐 고리화효소(guanylyl cyclase) 단백질의 촉매 도메인과 ATP 가수분해 도메인 각각에 베이트(bait)와 프레이(prey) 중 어느 하나를 재조합하여 효모에서 발현시키는 단계를 포함하는데, 예를 들면 촉매 도메인에 베이트를 재조합할 수도 있고, 아니면 프레이를 재조합할 수도 있으며, 마찬가지로 ATP 가수분해 도메인에 베이트를 재조합할 수도 있고, 아니면 프레이를 재조합할 수도 있다. 즉, 베이트와 프레이는 촉매 도메인과 ATP 가수분해 도메인 둘 중의 하나에 각각 재조합될 수 있는 것이다. 이렇게 재조합된 베이트와 프레이를 효모에서 발현시키고, 발현된 베이트와 프레이의 상호작용을 검출하게 된다. 상호작용 검출에서, 만일 베이트와 프레이가 상호작용을 하게 되면 구아닐 고리화효소(guanylyl cyclase) 단백질의 촉매 도메인과 ATP 가수분해 도메인이 결합하여 구아닐 고리화효소가 활성을 가지게 되어 GTP로부터 cGMP를 생성하게 되며, 생성된 cGMP는 cGMP-수용체 단백질과 복합체를 형성하여 cGMP 수용체 단백질이 결합하는 조절성 염기서열에 결합하게 되고, 조절성 염기서열 하류에 위치한 리포터 유전자의 발현을 유도하게 되어 리포터(예를 들면, GFP)가 발현된다.
반면, 베이트와 프레이가 상호작용을 하지 않는다면 구아닐 고리화효소(guanylyl cyclase) 단백질의 촉매 도메인과 ATP 가수분해 도메인이 결합하지 못하여 구아닐 고리화효소가 활성을 가지지 못하게 되어 GTP로부터 cGMP를 생성하지 못하며, cGMP가 생성되지 못하면 cGMP-수용체 단백질과 복합체가 형성되지 못하여 cGMP 수용체 단백질이 결합하는 조절성 염기서열에 결합하지 못하게 되고, 조절성 염기서열 하류에 위치한 리포터 유전자의 발현을 유도하지 못하게 되어 리포터(예를 들면, GFP)의 발현이 이루어지지 못한다.
따라서, 리포터의 발현이 검출되면 베이트와 프레이는 상호작용을 한다는 것을 알 수 있으며, 리포터의 발현이 검출되지 않으면 베이트와 프레이는 상호작용을 하지 않는다는 것을 알 수 있으므로, 본 발명의 효모 이중 혼성화 시스템을 이용하면 베이트와 프레이의 상호작용 여부를 확인할 수 있는 것이다 (도 17 참고).
본 발명의 상기 구아닐 고리화효소의 촉매 도메인은 서열번호 2의 아미노산 서열 중 14번째 아미노산부터 197번째 아미노산으로 이루어져 있으며, ATP 가수분해 도메인은 서열번호 2의 아미노산 서열 중 221번째 아미노산부터 595번째 아미노산으로 이루어져 있으나, 이에 제한되지 않는다.
또한, 본 발명은
서열번호 2의 아미노산 서열로 이루어진 미생물 유래 구아닐 고리화효소(guanylyl cyclase) 단백질의 촉매 도메인과 ATP 가수분해 도메인 중 어느 하나에 베이트(bait) 유전자를 재조합하고, 나머지 도메인에 검출하고자 하는 프레이(prey) 유전자를 재조합하여 효모에서 발현시키는 단계; 및
상기 발현된 베이트와 프레이의 상호작용을 검출하는 단계를 포함하는 베이트에 결합하는 프레이를 스크리닝하는 방법을 제공한다.
본 발명의 스크리닝 방법은 cGMP 의존적인 신호 전달 시스템을 이용하므로, 상호작용하는 단백질의 양이 적거나 약한 결합력을 지닌 경우에도 매우 효율적으로 단백질간 상호작용을 검출할 수 있는 방법이다.
이하, 본 발명을 실시예에 의해 상세히 설명한다. 단, 하기 실시예는 본 발명을 예시하는 것일 뿐, 본 발명의 내용이 하기 실시예에 한정되는 것은 아니다.
실시예 1. 숙주세포의 생체 회로와 독립적인 신호 전달회로를 포함하는 재조합 벡터 및 재조합 벡터가 도입된 형질전환체 제작
로도스피릴룸 센테눔(Rhodospirillum centenum) 균주로부터 신호 전달 회로를 구성하는 요소들을 확보하기 위해, DNA 추출용 키트(Wizard® Genomic DNA Purification Kit, Promega, 미국)를 이용하여, 상기 미생물로부터 염색체를 추출하였고, 일반적인 재조합 유전자 조작법에 따라 순도를 분석하고 농도를 결정하였다. 추출한 염색체를 주형으로 하고, 올리고 뉴클레오티드 프라이머를 이용하여 중합효소연쇄반응(PCR)을 수행하여 회로 구동에 필요한 DNA 절편들을 증폭시켰다. 구아닐 고리화효소를 암호화하는 폴리뉴클레오티드의 경우, 유전자 크기가 3,051bp의 염기로 구성되어 있어 두 개의 절편으로 나눠 PCR을 수행하였다. 사용된 프라이머는 하기 표 1과 같다.
표 1 PCR용 프라이머 정보
유전자 프라이머 염기서열(5'→3') (서열번호)
구아닐 고리화효소절편 1 증폭 Cyc1-F CTGGGATCCATGGCGACGAGCGGAAGCAC (8)
Cyc1-R CAGTCGACGACACGGGCACCGACCCGCCAG (9)
구아닐 고리화효소절편 2 증폭 Cyc2-F TCGTCGACTGGCGGATGCACGCGATGCAGC (10)
Cyc2-R ATGGGCCCAAGCTTCTAGCGGCCGGCAGCCGGGAG (11)
cGMP 수용체 단백질 코딩 유전자 CRP-F CGGGGATCCTCTAGAGAATTCATTAAAGAG (12)
CRP-R CAGAAGCTTTCAGCCGGCGAGCTT (13)
PCEM 프로모터 P-F ATAAAGCTTATAGGGGGATCCGCG (14)
P-R ATGCGATCCTCTCATTCTAGAGGATCCCCG (15)
cyd2 0896-F ATAGTGCACAGGCGACAGGCTCACGGATG (16)
0896-R TTCTCCTTTACTCATGACACCCTTCCCTGCCCGAC (17)
pyrC' 1525-F TTCTCCTTTACTCATTGGCTTTCCTCCTTTTTCGG (18)
1525-R TATGAATTCGGGTCCGGGACTATGGCTTC (19)
cheY3 2133-F TTCTCCTTTACTCATCGCTTCCCCCGTGGATGCGC (20)
2133-R TATGAATTCACCGCCGCCGGCCCCATCCG (21)
cstS1 2847-F TTCTCCTTTACTCATAGGCTCGGCTCGCTGGAACG (22)
2847-R TATGAATTCACCGGCCCGGCCTGACCGGC (23)
PCR 반응은 염색체 DNA 8 ng를 주형으로 10pmole의 상기 프라이머 용액 각 1㎕와 dATP, dGTP, dTTP 및 dCTP가 각각 2.5mM로 포함된 dNTP를 2㎕, 10x 완충액 4㎕, 2.5 U/㎕의 내열성 DNA 중합효소(Speed-Pfu polymerase, Nanohelix, 한국)를 0.4㎕ 혼합하고, 이에 멸균수를 첨가하여 총량을 40㎕로 맞춘 반응액을 사용하였다. 상기 반응액을 98℃에서 10분간 예열한 후, 98℃에서 30초, 52℃에서 40초, 72℃에서 연장하고자 하는 DNA 길이에 따라 30초 내지 1분 10초간을 1 사이클로 하여 총 30 사이클 조건으로 PCR을 수행하였다. 증폭된 DNA 단편들을 아가로스겔로부터 회수한 후, 목적에 따라 하기의 방법으로 각각을 서브 클로닝하였다.
먼저 구아닐 고리화효소의 경우, Cyc1-F와 Cyc1-R 프라이머를 이용하여 증폭한 Cyc1 유전자 절편을 제한효소 BamHⅠ과 SalⅠ으로 자르고, Cyc2-F와 Cyc2-R 프라이머를 이용하여 증폭한 Cyc2 유전자 절편은 제한효소 SalⅠ과 HindⅢ로 자른 후, 제한효소 BamHⅠ과 HindⅢ로 절단한 pTrc99a 벡터에 삽입함으로써 재조합 벡터 pTrc99a-Cyc를 제작하였다.
cGMP 수용체 단백질을 암호화하는 폴리뉴클레오티드의 경우, CRP-F와 CRP-R 프라이머를 이용하여 증폭한 유전자를 확보한 후, P-F와 P-R 프라이머를 이용하여 증폭한 항시 발현 trc 프로모터 서열과 중첩 PCR 반응을 수행함으로써 항시 발현 trc 프로모터-cGMP 수용체 융합 유전자를 확보하였다. 증폭된 유전자 절편은 제한효소 HindⅢ로 절단하고 pTrc99a-Cyc 벡터에 삽입함으로써 pTrc99a-Cyc-P-CRP를 제작하였다(도 2).
상기 신호 전달회로 구성요소들의 전사유도 기능에 의한 외래 단백질 발현 확인을 위해 형광 단백질 GFPuv를 암호화하는 폴리뉴클레오티드를 포함하는 유전자 구조는 하기와 같이 제작하였다. 사용된 프라이머는 하기 표 2와 같다.
표 2 GFPuv 유전자 합성을 위한 PCR용 프라이머 정보
유전자 프라이머 서열정보(5'→3')
cyd2-GFP 0896 G-F GTCGGGCAGGGAAGGGTGTCATGAGTAAAGGAGAA (서열번호 24)
0896 G-R GCGGAATTCTTATTTGTAGAGCTCATCCA (서열번호 25)
pyrC'-GFP G-F CGGGTGCACTTATTTGTAGAGCTCATCCA (서열번호 26)
1525 G-R CCGAAAAAGGAGGAAAGCCAATGAGTAAAGGAGAA (서열번호 27)
cheY3-GFP G-F CGGGTGCACTTATTTGTAGAGCTCATCCA
2133 G-R GCGCATCCACGGGGGAAGCGATGAGTAAAGGAGAA (서열번호 28)
cstS1-GFP G-F CGGGTGCACTTATTTGTAGAGCTCATCCA
2847 G-R CGTTCCAGCGAGCCGAGCCTATGAGTAAAGGAGAA (서열번호 29)
선행과정에서 증폭한 4개의 조절서열과 융합된 서열을 지닌 GFPuv 절편을 이용하여 중첩 PCR 반응(overlapping PCR)을 수행하였다. 증폭한 DNA 절편은 제한효소 ApaLⅠ과 EcoRⅠ을 처리한 후, 동일한 효소로 절단한 pTrc99a 유래 벡터인 pPROtrc 벡터에 삽입함으로써 cGMP-수용체 복합체 결합에 의해 GFPuv 발현을 확인할 수 있는 구조(pPRO0896-GFPuv, pPRO1525-GFPuv, pPRO2133-GFPuv 및 pPRO2847-GFPuv)를 제작하였다(도 3). pPROtrc 플라스미드는 벡터 자체에 trc 프로모터가 존재함으로 삽입한 조절 서열에 의한 GFP 발현 유도능을 확인하기 위해서 ApaLⅠ과 EcoRⅠ 제한효소 처리를 통해 벡터 내의 trc 프로모터를 제거하였다('pPRO'). 이러한 구조들을 숙주인 대장균 XL1-Blue에 CaCl2 방법 또는 FSB(frozen storage buffer) 용액 처리 방법으로 형질전환시켜 안정성과 서열을 분석한 후, 기능성 평가에 이용하였다.
실시예 2. 직교능을 지닌 신호전달 회로에 의한 외래 유전자 발현 유도 성능평가
제작된 직교 신호전달 회로에 의해 cGMP 의존적으로 전사를 유도하는 능력이 있는지 확인하기 위해 듀얼 벡터 형태의 신호 전달 회로 모듈을 단일 숙주에 도입하였다(도 4). 직교 신호전달 회로 평가모듈은 구아닐 고리화효소와 cGMP 수용체 유전자가 삽입된 플라스미드(pTrc99a-Cyc-P-CRP)와 cGMP 수용체 단백질이 결합하는 조절 서열과 리포터가 융합된 플라스미드(pPROcis-GFPuv)로 구성되어 있으며, IPTG에 의해 구아닐 고리화효소가 발현되면 생체 내 GTP 분자가 cGMP 분자로 전환되고 이에 결합하는 수용체 단백질에 의해 녹색 형광 유전자(리포터)의 발현을 유도하는 시스템이다.
듀얼 벡터를 지닌 대장균은 종래 기술된 방법에 따라 전기 충격 형질전환법을 통해 제조하였다. 구체적으로, 구아닐 고리화효소와 cGMP 수용체 단백질을 암호화하는 유전자가 도입된 pTrc99a-Cyc-P-CRP 벡터를 대장균 XL1-Blue에 형질전환 시킨 후, 형질전환된 단일 콜로니를 암피실린(50㎍/㎖)이 함유된 LB 배지에서 37℃, 200rpm 조건으로 배양하였다. 배양액의 흡광도(OD600) 값이 2.0에 도달하였을 때, 본 배양액의 1% 농도가 되도록 대장균을 접종하고 배양을 유도해, OD600이 0.5값을 가질 때 냉각 10% 글리세롤로 두 번 세척함으로써 전기 천공능 세포(electrocompetent cell)를 준비하였다. 상기 세포 20㎕에 pPRO0896-GFPuv, pPRO1525-GFPuv, pPRO2133-GFPuv 및 pPRO2847-GFPuv 플라스미드를 각각 5 내지 10ng을 첨가해 전기천공장치(Bio-Rad, 미국)에 적재한 후, 2.5kV의 전류를 4.8ms 동안 가해 형질전환하였다. 이후 1㎖ SOC 배지(0.5% Yeast Extract, 2% 트립톤, 10 mM NaCl, 2.5 mM KCl, 10 mM MgCl2, 10 mM MgSO4 및 20 mM 글루코스)를 첨가하여 37℃에서 1 시간 동안 배양한 후 도말하여, 암피실린과 가나마이신에 저항성을 가지는 클론을 선별하였다. 이때, 대조군으로 pTrc99a-Cyc-P-CRP 벡터를 함유하는 세포에 trc 프로모터를 포함한 pPROtrc 공벡터를 넣은 세포를 준비하였다.
(1) 균주배양 및 성장분석
직교 신호전달 회로 기능평가에 이용된 숙주세포는 0.4% 글루코스가 첨가된 최소영양배지에서 배양했을 때, 세포 내 GTP 분자수가 최대 4.9mM 까지 증가하는 것으로 알려져 있다. 또한 미생물에서 대표적인 기아 신호(starvation signal) 전달 물질로 알려진 구아노신 테트라포스페이트(ppGpp)의 증가는 GTP 합성을 저해하는 것으로 연구된 바 있으므로, GTP 분자로부터 직교 신호 생성에 필요한 다량의 cGMP 분자를 확보하기 위해서는 숙주세포를 영양분(아미노산과 탄소원)이 결핍되지 않는 조건에서 배양해야 한다. 따라서 신호 전달 회로가 장착된 숙주세포는 영양배지(LB)에서 정체기(stationary phase) 진입 전까지 배양함으로써 환경이나 영양분에 의한 스트레스 유발 요소를 줄여 실험에 이용하였다.
상기 과정으로 선별된 대장균 단일 콜로니를 암피실린(50㎍/㎖)과 가나마이신(50㎍/㎖)이 함유된 LB 배지에서 37℃, 200rpm의 조건으로 전배양하였다. 상기 배양액의 흡광도(OD600) 값이 2.0에 도달하면 본 배양액의 1%가 되도록 배양액을 재접종하고, 흡광도 값이 0.5에 도달하였을 때 0.1mM IPTG를 처리하여 구아닐 고리화효소 발현을 6시간 동안 유도하였다. 2시간 간격으로 세포를 샘플링하고 OD600 값을 측정하여 세포 성장 정도를 비교한 결과, 직교 신호전달 유전자를 지닌 숙주세포 성장이 대조군인 공벡터를 지닌 숙주와 매우 유사한 특성을 나타내어 프로모터 교체나 외래 유전자의 도입에 따른 성장 지연이나 저해가 없음을 확인하였다(도 5A). 또한, 전사 유도에 필요한 시그마 인자(RpoD, RpoN, RpoH) 결합 서열을 지닌 것을 앞서 확인한 조절 서열(cGMP-수용체 복합체 결합부위)에 결합 가능한 시그마 인자 중, RpoD를 제외한 나머지는 대안적 시그마 인자(alternative sigma factor)로서 세포 성장이 정체기에 도달하거나 질소원 결핍, 열 충격(스트레스 유발) 상태일 때 RNA 중합효소와 결합하여 전사를 유도하는 것으로 알려져 있다. 따라서 조절 서열에 결합 가능한 대안적 시그마 인자에 의한 전사 활성 신호를 증대시키기 위해 IPTG 첨가 후 열 충격(42℃)을 30분 정도 가한 후, 37℃로 옮겨 배양하며 2시간 간격으로 배양액의 OD600 값을 측정한 결과, 열 충격을 받은 직후 OD600 값이 대조군에 비해 0.1~0.2 정도 감소된 것을 볼 수 있으나 배양 시간이 길어질수록 다시 정상 성장 속도를 회복하는 것을 확인하였다(도 5B). 따라서, 직교 인자의 활성 증대나 신호강화를 위해 스트레스를 유발하더라도 세포 성장에는 큰 문제가 없음을 확인할 수 있었다.
(2) 직교 신호 전달 회로의 외래 유전자 발현에 대한 활성 측정
상기 5종의 형질전환 균주(pTrc99a-Cyc-P-CRP 벡터를 지닌 것을 공통으로 하며 각각 pPRO0896-GFPuv, pPRO1525-GFPuv, pPRO2133-GFPuv, pPRO2847-GFPuv 또는 pPROtrc 벡터가 도입된 클론)를 대상으로 cGMP 의존적인 유전자 발현 정도를 비교하기 위하여, 전술한 방법으로 배양 및 열 충격을 주었다. 매 2시간 간격으로 세포 배양액을 샘플링하였고, 샘플링한 배양액을 고속 원심분리(13,000rpm)하여 세포를 회수한 후, 증류수로 세척하여 50mM Tris-Cl(pH7.9) 완충액에 부유시켰다. 준비된 시료에 세포 용해액(50mM Tris-Cl, 150mM NaCl, 1mM DTT, 5% glycerol, 1mM EDTA, 0.5% SDS, pH 7.9)을 1:1 비율로 섞어 15분간 반응시킨 후, 시료의 형광값을 형광감도계(infinite M200, Tecan, 스위스)로 측정하였다.
그 결과, 열 충격을 주지 않았을 때, IPTG 첨가 후 4시간까지는 대조군(pPROtrc)과 비슷한 수준의 형광이 관찰되었으나 6시간 이 후, pPRO0896-GFPuv, pPRO1525-GFPuv 또는 pPRO2133-GFPuv 벡터를 가진 세포가 대조군보다 높은 수준의 형광을 보이는 것을 확인하였다(도 6). pPRO2847-GFPuv의 경우, 형광 수준이 대조군과 비슷했으나 IPTG를 첨가한 직 후에만 형광이 증가하는 특성을 지니고 있어, 조절 서열에 결합하는 시그마 인자의 종류가 다르거나 결합력이 차이가 있는 것으로 추정된다. 열 충격을 주었을 때는, RpoH 결합 부분을 가진 pPRO2133-GFPuv 또는 pPRO2847-GFPuv 와 RpoD 결합 부분을 가진 pPRO0896-GFPuv 경우만 대조군보다 높은 수준의 형광을 보임을 확인하였다(도 7). 이러한 결과는 발굴한 직교 신호전달 회로가 고리화 효소활성으로 cGMP를 생성하고, 이를 수용하는 수용체와 복합체를 형성한 후, 전사를 유도하여야 나타나는 결과물임으로, 상기 신호 전달 회로 구성 요소들을 이용해 외래 단백질 발현이 가능할 수 있음을 보여준다. 상대적으로 적은 형광 절대값은 적게 사용한 시료 양에 의한 결과로써, 샘플양의 조절이나 고리화효소 활성을 증대(야생형의 발현양이 극히 적음)를 통해 쉽게 해결할 수 있는 문제이다. 이에 대한 보다 직접적인 증거로써, 형광현미경이나 FACS(fluorescence-activated cell sorter)를 이용하면 고리화효소 활성이나 cGMP 농도 의존적인 리포터의 발현 유도를 쉽게 관찰할 수 있다. 위와 같은 과정으로 직교 신호전달 시스템에 의한 전사 유도 기능(리포터 발현)을 재확인 후, 다음 실험을 진행하였다.
실시예 3. 직교 신호 전달 회로의 숙주 비간섭/독립구동 기능 평가
전술한 실시예 2에서 볼 수 있듯이, 이종 세포로부터 전사조절이 가능한 신호전달 세트를 확보하여 대장균에서 구동시켰을 때, 리포터 유전자의 발현이 유도되는 것이 확인되었다. 상기 회로의 구성 요소인 구아닐 고리화효소나 cGMP 수용체 단백질 및 이와 결합하는 조절 서열은 대장균에는 존재하지 않아 신호 전달 매개자로 인식될 수 없는 요소임으로, 전사 유도 결과물인 리포터의 발현 과정에서 숙주세포 고유의 신호전달 시스템과는 상호 간섭 없이 독립적으로 기능하였을 것으로 추정되었다. 즉, 자연적으로는 대장균에서 이용되지 않는 cGMP를 전사 유도신호로 활용하여 활성 신호를 전달하므로, 숙주 내 다른 단백질에 의한 신호교란이나 간섭이 없어, 생성된 모든 활성 신호(cGMP)가 도입된 외래 단백질의 발현을 유도할 것이기 때문이다. 하지만, 실시예 2에서 이용한 직교 신호전달 회로의 구동 유도인자(신호생성을 위한 최초 전사 유도인자)로 채용한 trc 프로모터의 경우, 기저 수준(basal level) 이상의 leaking이 존재해 신호 전달과정에 노이즈나 백그라운드가 높고, 생성된 활성 신호(cGMP)가 모두 단백질 발현에 이용되는 지와 신호 강도를 측정하기에는 부적절하여 다음과 같은 추가 실험을 진행하였다.
상기 문제의 보완책으로 다른 발현 유도 시스템에 비해 상대적으로 강한 발현 억제 기작(tight regulation)을 갖는 pBAD 시스템으로 조절 서열을 옮기고, 구아닐 고리화효소를 암호화하는 폴리뉴클레오티드는 상기 벡터와 양립시키기 위해 pBAD 벡터와 다른 항생제 마커와 복제 기원을 갖는 플라스미드에 삽입을 고려하였다. 또한 조절 서열로의 cGMP 수용체 단백질의 접근성을 높이기 위해, 항시 발현 PCEM 프로모터-cGMP 수용체 단백질을 암호화하는 폴리뉴클레오티드를 조절 서열과 융합된 리포터 유전자 뒤에 위치시키는 새로운 직교신호 발현 시스템을 설계하였다(도 8). 설계된 재조합 벡터는 하기 과정으로 제작하였다.
4개의 조절 서열 융합 형광 유전자는 AgeⅠ과 HindⅢ 제한효소 인식 서열이 포함된 프라이머를 사용하여 DNA 단편을 증폭하였다. 증폭한 유전자를 삽입하기 위해 pBAD24 벡터에 AgeⅠ과 HindⅢ 제한효소를 처리하여 PBAD 프로모터 부분을 제거하고, 동일한 효소로 절단한 각 조절 서열 융합 형광 유전자를 클로닝하여 벡터 p0896-GFPuv, p1525-GFPuv, p2133-GFPuv 및 p2847-GFPuv를 제작하였다. 대조군으로 PBAD 프로모터 하부에 형광 유전자를 삽입한 벡터 pBAD24-GFPuv를 제작하였다. 또한 p0896-GFPuv, p1525-GFPuv, p2133-GFPuv, p2847-GFPuv 및 pBAD24-GFPuv 벡터 각각에 제한효소 HindⅢ를 처리한 후, pTrc99a-Cyc-P-CRP 플라스미드에 동일한 제한효소를 처리하여 확보한 항시 발현 PCEM 프로모터-cGMP 수용체 폴리뉴클레오티드를 삽입함으로써, 재조합 벡터 p0896-GFPuv-P-CRP, p1525-GFPuv-P-CRP, p2133-GFPuv-P-CRP, p2847-GFPuv-P-CRP 및 pBAD24-GFPuv-P-CRP를 제작하였다. 마지막으로 pTrc99a-Cyc-P-CRP 플라스미드에 제한효소 BamHⅠ과 HindⅢ를 처리하여 구아닐 고리화효소를 암호화하는 폴리뉴클레오티드를 확보한 후, 동일한 제한 효소를 처리한 pPROtrc 벡터에 클로닝함으로써 벡터 pPROtrc-Cyc를 제작하였다.
숙주 내 비간섭/독립구동을 확인하기 위한 직교 신호전달 회로는 전술한 실시예 2와 동일한 방법으로 듀얼 벡터 형식의 시스템을 제작하기 위해, 먼저 pPROtrc-Cyc 플라스미드로 형질전환된 재조합 균주를 제작하고, 각각에 p0896-GFPuv-P-CRP, p1525-GFPuv-P-CRP, p2133-GFPuv-P-CRP, p2847-GFPuv-P-CRP 또는 pBAD24-GFPuv-P-CRP 플라스미드를 도입하여 두 벡터를 지닌 재조합 균주를 제조하였다(도 8). 형질전환체 중 암피실린과 가나마이신에 저항성을 가지는 대장균을 선별한 후, 단일 콜로니를 영양배지에 접종하고 실시예 2에서 전술한 방법으로 세포를 배양하고 샘플링한 후, 형광을 측정하였다.
그 결과 IPTG를 첨가한 후, 4시간까지는 대조군(pBAD24-GFPuv-P-CRP)과 비슷한 수준의 형광이 관찰되었으나 6시간 때 p0896-GFPuv-P-CRP, p1525-GFPuv-P-CRP 또는 p2133-GFPuv-P-CRP 플라스미드를 가진 형질전환 세포가 대조군보다 높은 수준의 형광을 보이는 것을 확인하였다. 이와는 달리 p2847-GFPuv-P-CRP의 경우, OD600 값이 0.7일 때 IPTG를 첨가하면 형광이 증가하는 것을 관찰하였다(도 9). 대조군 세포의 형광값은 시간의 경과에 상관없이 낮게 측정되는 것으로 보아, 대장균은 IPTG 첨가로 발현된 구아닐 고리화효소가 전환시키는 cGMP에 대해 반응하지 않는 것을 알 수 있었다. 따라서 대장균 숙주에서는 cGMP 의존적인 유전자 전사 유도가 불가능한 것을 알 수 있다. 즉 구축한 신호 전달 회로는 대장균과 독립적으로 구동할 수 있는 직교 시스템임이 증명되었다.
실시예 4. 직교 신호전달 시스템에 의한 전사활성 신호 증폭 구현
상기에서 볼 수 있듯이, 대장균 숙주 자체의 신호전달 물질로 이용되지 않는 cGMP를 이용해 전사활성을 조절함으로써 숙주의 내재적 신호 전달 시스템과 겹치지 않는 회로를 제작하고 그 성능을 평가하였다. 제작한 회로는 독립적인 신호 전달 기능 이외에도, 효소 활성 결과물인 cGMP 분자를 이용하여 회로를 구동시키기 때문에 신호 증폭 기능이 가능할 것으로 추정되었다. 즉, 반응 초기에 적은 입력신호(제한된 수준의 구아닐 고리화효소 합성 유도에 필요한 화합물)가 주어지면 구아닐 고리화효소의 합성이 유도되고, 발현된 효소 양이 제한적이더라도 촉매상수(Kcat)에 상응하는 과량의 cGMP 생성이 수 분 이내에 가능하기 때문에, 이에 의해 조절 받는 유전자 발현은 초기 입력신호 대비 과발현의 특성을 지니게 되어, 초기 신호의 증폭이 신호 2차 전달자인 cGMP에 의해 구현되는 것이다(도 10). 또한 하기와 같이 2차 전달자에 의해 전사가 유도되는 조절서열을 지닌 다수의 유전자 혹은 오페론을 동시에 발현시킬 수 있는 다중유전자(오페론) 동시발현 유도가 직교 신호전달 시스템에 의해 구현 가능할 것이다. 이는 많은 자연 생체 유전회로나 신호전달 회로가 지닌 신호 전달 캐스케이드(signal transduction cascade) 중간에 2차 신호 전달자가 참여하는 자연적인 전체적 조절(global regulation) 기작을 인위적이며 직교적으로 구현한 예라 할 수 있다.
신호증폭 효과를 확인하기 위하여 상기 실시예에서 cGMP에 의한 활성이 가장 높은 것으로 확인된 플라스미드 pPRO0896-GFPuv(하이브리드 히스티딘 인산화효소의 조절 서열)를 선정하여, 녹색 형광 유전자 말단에 동일한 조절 서열과 융합된 녹색 형광 유전자를 코딩하는 폴리뉴클레오티드를 연속으로 삽입해, 3개의 리포터를 지닌 시스템을 설계하였다. 첫 번째 위치한 조절 서열에 의한 영향(첫 번째 유전자 전사가 끝나지 않고 두 번째 유전자까지 전사하는 현상)을 배제하기 위해 첫번째 형광 유전자 뒤로 intervening nucleotide sequence를 200bp개 삽입하고, 두 번째 조절 서열에 의한 영향을 낮추기 위해 세 번째 조절 서열과 유전자의 방향을 반대로 삽입하는 방법을 고안하였다. 본 실험은 하기와 같은 과정으로 진행하였다.
상기 실시예 2와 동일한 방법으로 듀얼 벡터 형식의 회로를 제작하기 위해, 먼저 pPRO(0896-GFPuv)3 플라스미드로 형질전환된 재조합 균주를 제작하고 pTrc99a-Cyc-P-CRP 플라스미드를 도입하여 두 벡터를 갖는 재조합 균주를 제조하였다(도 11). 대조군은 구아닐 고리화효소와 cGMP 수용체 단백질이 제거된 pTrc99a 플라스미드와 pPRO(0896-GFPuv)3 플라스미드를 갖는 재조합 균주, 그리고 구아닐 고리화효소만 제거된 형태인 pTrc99a-P-CRP 플라스미드와 pPRO(0896-GFPuv)3 플라스미드를 갖는 재조합 균주, 공벡터(pTrc99a, pPROtrc)만 갖는 재조합 균주를 사용하였다. 형질전환체 중, 암피실린과 가나마이신에 저항성을 가지는 클론을 선별하였으며 단일 콜로니를 영양배지에 접종하여 37℃, 200rpm 조건으로 전배양하였다. 본 배양액의 1%가 되도록 전배양액을 재접종하고 배양액의 OD600 값이 0.5일 때 0.01mM IPTG 첨가하고 6시간 동안 배양한 후, 세포 배양액을 샘플링하였다.
우선 시료의 형광값을 전세포로 측정한 결과, 대조군에 비해 3.5 내지 5배 정도 높은 리포터의 발현양을 확인하였다. 하지만 형광단백질의 성숙시간(maturation time)과 안정성에 의한 부가 효과(side or additive effect)를 배제할 수 없어, 보다 직접적인 방법으로 전사체 양(신호증폭에 따른)을 비교하는 실험을 진행하였다. 전사체 양을 비교하기 위해 시판 RNA 추출용 키트(easy-BLUE™ Total RNA Extraction Kit, 인트론, 한국)를 이용하여 상기 시료로부터 총 RNA를 추출하여 cDNA를 합성한 후, 하기 프라이머를 이용하여 형광 유전자에 대한 전사체 양을 대조군(GapA 하우스키핑 유전자를 이용)과 비교하여 상대적으로 정량하였다(도 12). 사용된 프라이머는 다음 표 3과 같다.
표 3 RT-PCR용 프라이머 정보
프라이머 서열정보(5'→3')
GFPuv RT-F CGCGTCTTGTAGTTCCCGTCA (서열번호 30)
GFPuv RT-R TGACAAGTGTTGGCCATGGAACA (서열번호 31)
GapA RT-F TGATCCGGCTAACCTGAA (서열번호 32)
GapA RT-R GCGGTGATGTGTTTACGA (서열번호 33)
RT-PCR을 통해 재조합 균주들의 형광 유전자에 대한 상대적인 mRNA 양을 정량한 결과, 구아닐 고리화효소와 cGMP 수용체 단백질이 제거된 재조합 균주의 경우 공벡터를 갖는 재조합 균주와 비슷한 기저 수준의 mRNA를 갖는 것을 확인하였으며, 구아닐 고리화효소만 제거된 경우 공벡터를 갖는 재조합 균주보다 약 2배 정도 높은 양의 형광 유전자의 전사체를 갖는 것이 확인되었다. 구아닐 고리화효소와 cGMP 수용체 단백질이 모두 존재하는 균주의 경우 공벡터를 갖는 재조합 균주보다 약 8배 높은 형광 유전자 전사체를 가지며, 이러한 결과는 상기 실시예 2와 동일한 방법으로 재조합 균주에 대해 형광을 측정한 결과와 상관관계가 있었다(도 13). 이것은 구아닐 고리화효소가 존재해야만 생성되는 cGMP에 의한 영향이라고 볼 수 있으며, 다량의 cGMP 분자가 cGMP 수용체 단백질을 활성화시켜 전사 유도를 유지하므로 형광 단백질이 대량 생산된 것으로 볼 수 있다. 초기 미량의 입력신호(0.01mM IPTG)에도 cGMP 분자의 대량 생산에 의한 전사 활성 증폭 효과에 의해, 리포터의 과발현이 가능함으로 발효 산물 또는 산업용 단백질 생산 목적에 효과적으로 사용될 수 있음을 의미한다.
보다 직접적인 비교로써, 대조군으로 각각의 조절 서열-리포터 융합 유전자를 초기 입력신호인 IPTG에 의해 몰 비율로 전사가 유도되는 Ptrac-리포터 융합유전자로 바꾸어 실험한 결과, 기저수준의 형광을 보여 줌으로써, 본 발명의 효과가 신호 증폭에 매우 효과적인 수단임을 재확인하였다.
실시예 5. 다수 외래 유용 유전자의 동시 발현 시스템 구현
(1) 리포터를 포함한 산업용 효소 동시 발현
직교 신호전달에 의한 다중 유전자 동시발현 시스템 구축을 위해, pPRO(0896-GFPuv)3 플라스미드에서 하부의 두 개의 형광 유전자를 에스터라아제와 β-글루코시다아제를 코딩하는 폴리뉴클레오티드로 치환하였다. 구체적인 실험 방법은 다음과 같다. 상기 실시예 4와 동일한 방법으로 듀얼 벡터 시스템 기반 신호 증폭 회로를 제작하기 위해, 완성된 컨스트럭트(pTrc99a-Cyc-P-CRP 및 pPRO0896-GFPuv-0896-est-0896-glu) 중 먼저 pPRO0896-GFPuv-0896-est-0896-glu 플라스미드로 형질전환된 재조합 균주를 제작하고, 다른 플라스미드를 도입하여 두 벡터를 갖는 재조합 균주를 제조하였다. 대조군은 구아닐 고리화효소와 cGMP 수용체 단백질 코딩하는 유전자가 제거된 pTrc99a 공벡터를 가진 균주를 사용하였다. 제작된 균주로부터 유전자발현을 확인하기 위해, 형질전환된 대장균의 단일 콜로니를 암피실린(50㎍/㎖)과 가나마이신(50㎍/㎖)이 함유된 LB 배지에서 37℃, 200rpm 조건으로 전배양하였다. 본 배양액(15㎖)의 1%가 되도록 접종한 후, OD600 값이 약 0.5일 때 IPTG를 0.1mM이 되도록 첨가하여 6시간 동안 녹색 형광 단백질과 에스터 가수분해효소, β-글루코시드 가수분해 효소의 발현을 유도하였다. 6시간 후 세포 배양액을 샘플링한 후 녹색 형광 단백질은 상기 실시예 2와 동일한 방법으로 형광을 측정하였다. 하기 두 효소의 경우, 보다 분명한 활성 측정을 위해 고체상에서의 자이모그램을 이용하였다. 에스터라아제의 경우, 확보한 세포를 완충 용액(50mM Tris-HCl, pH 8.0)에 현탁한 후, 초음파 장비(Sonics and materials, 미국)를 이용해 파쇄하였다. 준비된 시료는 원심분리를 통해 가용성 단백질을 분획하여 8% Native-PAGE 로 전기영동한 후, 기질(α-나프틸 아세테이트, Fast Blue RR) 용액을 첨가해 상온에서 20분 반응시켰다. β-글루코시다아제의 경우, 가용성 단백질을 8% Native-PAGE 를 통해 전기영동한 후, 1mM MUG가 포함된 완충 용액을 첨가하여 37℃ 진탕 배양기(200rpm)에서 1시간 반응을 유도하였다.
그 결과 녹색 형광 단백질과 에스터 가수분해효소, β-글루코시드 가수분해 효소의 과발현을 확인할 수 있었다. 특히 일반적인 발현 방법과 달리, 6시간 발현을 유도한 세포 파쇄액의 효소 활성을 육안으로 관찰할 수 있을 정도의 기능적 과발현이, cGMP에 의해 동시에 유도되는 우수한 발현능이 확인되었다(도 14).
(2) 종양 세포 표적 및 세포 용해 유전자 동시 발현 확인
cGMP에 의한 동시 발현 효과가 대장균에서는 난발현되어 동시에 발현시키기어려운 약물 유전자에 적용가능한지를 실험하였다. 상기 예로, 종양 세포 표적 및 세포 용해 기능을 각기 지닌 인공항체와 리신 발현을 시도하였다. 이를 위해, 하이브리드 히스티딘 인산화효소의 조절 서열 하에 레닐라 루시퍼라제를 암호화하는 폴리뉴클레오티드를 삽입하여 pPRO0896-RLuc8 플라스미드를 제조하였다. 상기 실시예 5의 pPRO0896-GFPuv-0896-est-0896-glu 벡터와 동일한 방식으로 대표적인 종양 바이오 마커인 표피성장인자 수용체(EGFR, epidermal growth factor receptor)를 인식하는 인공 항체와 세포 용해를 유도하는 인자를 암호화하는 폴리뉴클레오티드를 삽입하여 새로운 구조(pPRO0896-RLuc8-0896-EGFR-0896-lysin)를 제작하였다. 이때 실시예 5와 동일하게 pTrc99a-Cyc-P-CRP 플라스미드를 사용하여 듀얼 벡터 시스템 기반으로 유전자의 동시 발현을 유도하였다. 구아닐 고리화효소와 cGMP 수용체 단백질이 삽입되지 않은 공벡터(pTrc99a)와 종양 세포 표적이 가능한 상기 구조를 갖는 재조합 균주를 대조군으로 하였다. 상기 실시예 5와 동일한 조건으로 형질전환된 균주를 배양하고 세포 용해액의 루시퍼라제 활성을 측정하였다. 발광 측정에 필요한 박테리아 시료는 신호의 포화(saturation)를 방지하기 위해 1,000배 희석하였고, 준비된 박테리아 시료를 5x 용해 완충액(promega, 미국)으로 20분간 용해시키고 기질인 코엘렌테라진(4㎍/㎖)을 첨가한 후, 발광 신호를 루미노미터로 측정하였다. 또한, 표피성장인자 수용체를 인식하는 인공 항체와 세포 용해 인자를 인식하는 항체를 이용하여 공지된 기술로 웨스턴 블랏을 수행하였다(도 15).
그 결과, 대조군에서는 기저 수준의 발광을 보인 것과 달리 cGMP가 생산되는 대장균은 발광이 포화수준에 이르는 높은 양을 확인하였다. 다른 두 유전자의 발현측정을 위한 웨스턴 블랏 결과, 표피성장인자 수용체를 인식하는 인공 항체와 세포 용해 인자에 선택적인 항체에 의한 밴드가 뚜렷하게 검출되었다. 따라서 cGMP 분자를 2차 신호전달자로 이용하는 본 발명의 직교 신호전달 시스템을 약물 유전자와 같은 고부가 가치 단백질 발현에도 이용 가능함을 확인하였다. 이러한 결과는, 직교 신호 전달 발현 시스템을 지닌 치료용 미생물에 약물 유전자를 탑재해 생체 내(in vivo)로 적용할 경우, 표피성장인자 수용체를 인식하는 인공 항체에 의해 고형 암 표적이 가능하며 동시에 발현되는 약물 단백질에 의한 탐치/치료 동시 기능 구현이 가능한 효과적인 시스템을 구축할 수 있음을 의미한다. 이때 신호가 증폭되는 효과가 동시에 적용됨으로, 외부에서 트리거링(triggering)에 필요한 극소량의 입력신호(고리화효소 발현 유도체)만 필요한 획기적인 약물 전달 회로 원형으로 가치를 지닐 것이다.
실시예 6. cGMP를 유도체로 사용하는 유도성 발현 시스템
유도성 발현 시스템은 일반적으로 신호로서 내/외부 유도체(화학물질, 열, 산소, 삼투압 등)가 존재할 때 목적 유전자 산물이 다량 발현되는 것으로 이를 응용한 다양한 분야에서 활용되고 있다. 가장 많이 이용되는 유도 시스템으로는 IPTG를 유도체로 이용하는 것이지만, 화학합성유도체이기 때문에 세포에 유해하며 짧은 시간에 과량의 단백질이 급격하게 생성되기 때문에 숙주에 대사부담을 유발하여 성장을 억제하는 요인으로 작용할 수 있다. 유도체 단가 또한 고가이기 때문에 산업용 효소 및 의료용 단백질 생산에는 적합하지 않다. 그러므로 비화학 유도체를 이용한 유도성 발현 시스템이 선호되며, 그 전제 요건은 세포 내에서 대사되거나 다른 시스템을 교란시키지 않아야 한다. 본 발명의 cGMP는 상기 조건을 만족하는 천연화합물의 일종이며, 특별한 생체 부작용이 보고되지 않는 우수한 특성과 함께, 인체에서는 대사가 가능해 잔류 독성에 의한 부반응이 적은 물질이다. 따라서 직교 신호전달 시스템 외에, cGMP를 전사 유도물질(inducer)로 직접 활용할 수 있는지를 검증하였다. 이를 위해, GTP를 cGMP 분자로 전환시키는 구아닐 고리화효소를 제거한 후, cGMP를 유도체로서 배지에 첨가하여 유전자 발현 정도를 확인하였다. 구체적인 실험 방법은 하기와 같다.
상기 pTrc99a-Cyc-P-CRP 플라스미드에 BamHⅠ과 HindⅢ 제한효소를 처리하여 구아닐 고리화효소를 코딩하는 폴리뉴클레오티드를 제거한 후, 클레나우 단편(Klenow fragment)을 처리해 자가결찰(self-ligation)을 유도하여 pTrc99a-P-CRP 구조를 완성하였다. 상기 실시예 5와 동일한 방법으로 완성된 구조(pTrc99a-P-CRP, pPRO(0896-GFPuv)3) 중, 먼저 pPRO(0896-GFPuv)3 플라스미드로 형질전환된 재조합 균주를 제작하고 다른 플라스미드를 도입하여 두 벡터를 갖는 재조합 균주를 제조하였다. 대조군은 공벡터인 pTrc99a를 갖는 균주로 하였다. 제작된 균주에서 cGMP에 의한 리포터 발현유도를 확인하기 위해 형질전환된 대장균의 단일 콜로니를 암피실린(50㎍/㎖)과 가나마이신(50㎍/㎖)이 함유된 LB 배지에서 37℃, 200rpm 조건으로 전배양하였다. 본 배양액(15㎖)의 1%가 되도록 접종한 후, OD600 값이 약 0.5 때 0.1% DMSO에 녹인 cGMP를 500μM이 되도록 첨가하여 6시간 동안 녹색 형광 단백질 발현을 유도하였다. 2시간 마다 세포 배양액을 샘플링하여 상기 실시예와 동일한 방법으로 형광을 측정하였다. 결과 녹색 형광 단백질이 발현되었으며, 따라서 cGMP를 유도체로 직접 사용하였을 때 유전자 발현 유도가 가능함을 확인하였다(도 16).
실시예 7. 효모 이중 혼성화 시스템에 도입된 cGMP 의존적인 신호 전달 시스
이중-혼성화(two-hybrid) 시스템은 단백질-단백질 상호작용의 확인을 위해 생물학 전분야에서 광범위하게 사용되고 있다. 효모에서 최초로 개발된 이중-혼성화 시스템의 전형적인 방법은 사카로마이세스 세레비지애(Saccharomyces cerevisiae)의 GAL4p 단백질의 성질을 이용한 것이다. 상기 시스템은 단백질 GAL4p의 DNA-결합 도메인에 연구대상이 되는 단백질(베이트, bait)을 붙여 하이브리드 단백질을 만들고 그 단백질과 결합하는 단백질(프레이, prey)에 GAL4p의 전사활성 유도 도메인을 붙인 하이브리드 단백질을 만들어 효모 내에서 동시에 발현시킨다. 두 개의 하이브리드 단백질은 베이트와 프레이 사이에 결합하는 성질이 있으면 서로 결합하여 기능적인 GAL4 단백질, 즉 DNA에 결합해 전사를 유도하는 전사인자(transcription factor)로 작용해 GAL4p 결합 부분(전사조절 서열) 뒤에 위치한 유전자(리포터)의 발현을 매개하는 작용을 한다. 이중-혼성화 시스템의 변형된 기술로써, 전사 인자를 분할해 이용하지 않고 효소활성을 통해 상호작용하는 단백질을 찾는 방법도 개발되었다. 이러한 시스템에서는, 베타-락타마제(beta-lactamase)와 같은 효소활성을 지닌 단백질을 분할(domain-dissection)하여, 각각에 베이트와 프레이를 융합해 발현시키고, 융합된 단백질간의 상호작용이 있으면 원래 효소의 기능이 회복되어 활성을 나타내는 원리를 이용하는 것이다. 전사인자가 분할된 시스템에서는 전사 유도 결과물로써 리포터의 발현을 검출해야 하는 시간적인 갭이 존재하고, 모든 클론을 대상으로 선별해야 하는 불편함이 있으나, 베타-락타마제 분할 시스템의 경우, 효소활성 정도가 항생제 배지에서의 생존율과 세포성장 속도에 비례하는 특성을 지녀 선별과정이 매우 용이한 장점을 지닌다.
본 실시 예에서는 상기 두 방법의 장점을 모두 지닌 새로운 이중-혼성화 시스템으로 구아닐 고리화효소를 분할해 상호작용하는 단백질을 찾는 방법을 개발하였다. 분할된 도메인에 융합된 베이트와 프레이의 상호작용이 있으면, 도메인이 결합되어 활성을 나타내고, 활성 결과물인 cGMP가 수용체와 결합해 리포터의 발현을 유도하는 새로운 방법이다. 본 실시예의 방법은 상호작용하는 단백질의 양이 적거나 약한 결합력을 지닌 경우에도, 실시예 4와 같은 신호증폭의 원리를 지녀 매우 효율적인 단백질 상호작용 검출 시스템으로 활용할 수 있을 것이다. 또한 직교 신호전달의 특성을 지녀, 간섭이 없는 환경에서 구동함으로 검출력의 한계가 극히 낮은, 즉 매우 예민한 시스템으로서 구동 가능한 시스템이다.
상기 원리를 구동시켜 단백질 상호작용에 따른 이중-혼성화 시스템의 구현과정에는, 전술한 바와 같이 단백질간 상호작용이 기확인된 효모의 전사인자를 이용해 설계하였다. 본 실시예는 구동 확인을 위한 시스템의 원형(prototype)으로서, 실제 사용과정에는 상호작용을 확인하기 위한 단백질들이 분할된 구아닐 고리화효소에 융합된다. 전술한 목적에 따라 본 실시예의 새로운 단백질 상호작용 탐침 방법으로써, cGMP에 의존적인 전사유도 시스템은 다음과 같이 설계되었다. GAL4p 단백질의 DNA-결합 도메인(DBD)에 융합된 구아닐 고리화효소 N-말단 도메인과 GAL4p의 전사 활성화 도메인(AD)에 융합된 구아닐 고리화효소 C-말단 도메인이 동일한 효모에서 동시 발현된다. 2개의 융합 단백질이 상호작용(분할된 GAL4p의 상호작용) 하면 구아닐 고리화효소를 이루는 도메인이 접촉하게 되어 활성을 갖게 되고 cGMP 생성을 증가시킴으로써 리포터 유전자의 발현을 유도한다(도 17). 이 시스템은 효모에 없는 직교 인자를 사용하였기 때문에 기존 이중-혼성화 시스템이 갖는 가짜 양성반응(false-positive)을 제거하여 오직 단백질 결합 반응에 의해서만 활성을 나타낼 것으로 예상되었다. 이하 실시예를 하기와 같이 실시하였다.
구아닐 고리화효소에서 촉매 도메인(아미노산 14-197)과 ATP 가수분해 도메인(아미노산 221-595)을 포함한 나머지 부분에 GAL4p 단백질의 DNA-결합 도메인과 전사 활성화 도메인을 각각 융합시킨 DBD/Cyc 및 AD/ATP를 IPTG 유도성 프로모터와 아라비노스 유도성 프로모터의 제어 하에 발현되게 하였다. 플라스미드 pTrc99a-DBD/Cyc-P-CRP, pBAD-AD/ATP와 pPRO0896-GFPuv를 효모에 동시-형질전환시켰다. 대조군은 DBD/Cyc 단백질이 제거된 pTrc99a-P-CRP, pBAD-AD/ATP와 pPRO0896-GFPuv 벡터를 가진 세포로 하였다. 0.1mM IPTG와 0.0002% 아라비노스를 첨가한 후 시간별로 녹색 형광 단백질을 측정하였을 때, DBD/Cyc와 AD/ATP 단백질이 발현되는 세포의 경우 시간이 지남에 따라 GFP 수준이 급격하게 증가하기 시작하였으며 대조군의 경우 기저 수준의 형광만이 관찰되었다(도 18). 이는 GAL4p 단백질의 DNA-결합 도메인과 전사 활성화 도메인이 상호작용함으로써 구아닐 고리화효소가 cGMP 생성능을 갖기 때문에 나타난 결과이다. 또한 직교적인 특성 때문에 불특정 단백질과의 상호작용에 의한 간섭이 매우 적어 높은 감도를 지닌 것을 알 수 있다. 이 시스템을 이용한다면 특정 단백질과 상호작용하는 단백질을 정확하고 높은 감도로 스크리닝하는 것이 가능할 것으로 예측된다.

Claims (15)

  1. 미생물 유래 구아닐 고리화효소(guanylyl cyclase)를 코딩하는 유전자, cGMP 수용체 단백질을 코딩하는 유전자 및 cGMP 수용체 단백질이 결합하는 조절성 염기서열이 하나 이상의 플라스미드에 재조합된 것을 특징으로 하는 숙주세포의 생체 회로 간섭 없이 외래 유전자를 독립적으로 발현할 수 있는 재조합 벡터.
  2. 제1항에 있어서, 상기 구아닐 고리화효소를 코딩하는 유전자는 서열번호 1의 염기서열로 이루어진 것을 특징으로 하는 재조합 벡터.
  3. 미생물 유래 cGMP 수용체 단백질을 코딩하는 유전자 및 cGMP 수용체 단백질이 결합하는 조절성 염기서열이 하나 이상의 플라스미드에 재조합된 것을 포함하는 것을 특징으로 하는 숙주세포의 생체 회로 간섭 없이 외래 유전자를 독립적으로 발현할 수 있는 재조합 벡터.
  4. 제1항 또는 제3항에 있어서, 상기 cGMP 수용체 단백질을 코딩하는 유전자는 서열번호 3의 염기서열로 이루어진 것을 특징으로 하는 재조합 벡터.
  5. 제1항 또는 제3항에 있어서, 상기 조절성 염기서열은 서열번호 4, 5, 6 또는 7의 염기서열로 이루어진 것을 특징으로 하는 재조합 벡터.
  6. 제1항 내지 제5항 중 어느 한 항의 재조합 벡터의 조절성 염기서열의 하류에 외래 유전자가 삽입된 재조합 벡터.
  7. 제6항의 재조합 벡터로 형질전환된 숙주세포.
  8. 제6항의 재조합 벡터를 숙주세포에 형질전환시켜 숙주세포의 생체 회로 간섭 없이 외래 유전자를 독립적으로 발현하는 방법.
  9. 제8항에 있어서, 상기 숙주세포는 대장균(Escherichia coli)인 것을 특징으로 하는 방법.
  10. 제1항 내지 제5항 중 어느 한 항의 재조합 벡터를 유효성분으로 포함하는, 숙주세포의 생체 회로 간섭 없이 외래 유전자를 발현시키기 위한 조성물.
  11. 제1항 내지 제5항 중 어느 한 항의 재조합 벡터를 유효성분으로 포함하는, 숙주세포의 생체 회로 간섭 없이 외래 유전자를 발현시키기 위한 키트.
  12. 서열번호 2의 아미노산 서열로 이루어진 미생물 유래 구아닐 고리화효소(guanylyl cyclase) 단백질의 촉매 도메인과 ATP 가수분해 도메인 각각에 베이트(bait)와 프레이(prey) 중 어느 하나를 재조합하여 효모에서 발현시키는 단계; 및
    상기 발현된 베이트와 프레이의 상호작용을 검출하는 단계를 포함하는 베이트와 프레이의 상호작용 여부를 확인하는 방법.
  13. 제12항에 있어서, 상기 촉매 도메인은 서열번호 2의 아미노산 서열 중 14번째 아미노산부터 197번째 아미노산으로 이루어진 것을 특징으로 하는 방법.
  14. 제12항에 있어서, 상기 ATP 가수분해 도메인은 서열번호 2의 아미노산 서열 중 221번째 아미노산부터 595번째 아미노산으로 이루어진 것을 특징으로 하는 방법.
  15. 서열번호 2의 아미노산 서열로 이루어진 미생물 유래 구아닐 고리화효소(guanylyl cyclase) 단백질의 촉매 도메인과 ATP 가수분해 도메인 중 어느 하나에 베이트(bait) 유전자를 재조합하고, 나머지 도메인에 검출하고자 하는 프레이(prey) 유전자를 재조합하여 효모에서 발현시키는 단계; 및
    상기 발현된 베이트와 프레이의 상호작용을 검출하는 단계를 포함하는 베이트에 결합하는 프레이를 스크리닝하는 방법.
PCT/KR2014/005807 2014-03-26 2014-07-01 숙주세포의 생체 회로 간섭 없이 외래 유전자를 발현하기 위한 재조합 벡터 및 이의 용도 Ceased WO2015147379A1 (ko)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US14/410,063 US9963708B2 (en) 2014-03-26 2014-07-01 Recombinant vector for foreign gene expression without biological circuit interference of host cell and uses thereof

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR10-2014-0035119 2014-03-26
KR1020140035119A KR101550217B1 (ko) 2014-03-26 2014-03-26 숙주세포의 생체 회로 간섭 없이 외래 유전자를 발현하기 위한 재조합 벡터 및 이의 용도

Publications (1)

Publication Number Publication Date
WO2015147379A1 true WO2015147379A1 (ko) 2015-10-01

Family

ID=54195867

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2014/005807 Ceased WO2015147379A1 (ko) 2014-03-26 2014-07-01 숙주세포의 생체 회로 간섭 없이 외래 유전자를 발현하기 위한 재조합 벡터 및 이의 용도

Country Status (3)

Country Link
US (1) US9963708B2 (ko)
KR (1) KR101550217B1 (ko)
WO (1) WO2015147379A1 (ko)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101830792B1 (ko) 2016-01-27 2018-02-21 건국대학교 산학협력단 항균 펩타이드를 포함하는 불용성 융합단백질 및 이를 이용한 항균 펩타이드의 제조 방법

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5652131A (en) * 1993-05-27 1997-07-29 Icos Corporation Cyclic GMP-binding, cyclic GMP-specific phosphodiesterase materials and methods
KR20030062510A (ko) * 2002-01-17 2003-07-28 학교법인 포항공과대학교 단백질간의 상호 결합을 조사할 수 있는 이중 라이브러리단백질 결합 검색방법에 의한 검색 방법 및 이에 이용되는재조합 효모 균주
KR20100075884A (ko) * 2007-09-12 2010-07-05 아에라스 글로벌 티비 백신 파운데이션 진핵 타입 i 인터페론 반응 억제제의 동시-발현에 의해 세균-계 전달 시스템으로부터 형질전이 유전자 발현을 증가시키는 방법

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR100958095B1 (ko) 2007-12-31 2010-05-14 한국과학기술원 번역 동반 시스템을 이용한 항균 펩타이드의 대량 발현방법

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5652131A (en) * 1993-05-27 1997-07-29 Icos Corporation Cyclic GMP-binding, cyclic GMP-specific phosphodiesterase materials and methods
KR20030062510A (ko) * 2002-01-17 2003-07-28 학교법인 포항공과대학교 단백질간의 상호 결합을 조사할 수 있는 이중 라이브러리단백질 결합 검색방법에 의한 검색 방법 및 이에 이용되는재조합 효모 균주
KR20100075884A (ko) * 2007-09-12 2010-07-05 아에라스 글로벌 티비 백신 파운데이션 진핵 타입 i 인터페론 반응 억제제의 동시-발현에 의해 세균-계 전달 시스템으로부터 형질전이 유전자 발현을 증가시키는 방법

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
DATABASE NCBI, GenBank 10 June 2013 (2013-06-10), Database accession no. YP_002299938.1 *
MARDEN, JEREMIAH N. ET AL.: "Cyclic GMP controls Rhodospirillum centenum cyst development", MOLECULAR MICROBIOLOGY, vol. 79, no. 3, 9 January 2011 (2011-01-09), pages 600 - 615, XP055225026 *
PILZ, RENATE B. ET AL.: "Regulation of gene expression by cyclic GMP", CIRCULATION RESEARCH, vol. 93, no. 11, 28 November 2003 (2003-11-28), pages 1034 - 1046, XP055225029 *

Also Published As

Publication number Publication date
KR101550217B1 (ko) 2015-09-04
US20170002364A1 (en) 2017-01-05
US9963708B2 (en) 2018-05-08

Similar Documents

Publication Publication Date Title
Myronovskyi et al. β-Glucuronidase as a sensitive and versatile reporter in actinomycetes
Yamazaki et al. An A-factor-dependent extracytoplasmic function sigma factor (ςAdsA) that is essential for morphological development in Streptomyces griseus
Czaplinski et al. Purification and characterization of the Upf1 protein: a factor involved in translation and mRNA degradation.
Letek et al. DivIVA is required for polar growth in the MreB-lacking rod-shaped actinomycete Corynebacterium glutamicum
AU2008238982B2 (en) Recombinant microorganism
Berendt et al. Cell wall amidase AmiC1 is required for cellular communication and heterocyst development in the cyanobacterium Anabaena PCC 7120 but not for filament integrity
HU193504B (en) Process for preparing and applying recombinated plasmids containing basic phosphatase gens
US9422566B2 (en) Gene cluster for biosynthesis of griselimycin and methylgriselimycin
Zhang et al. Holomycin, an antibiotic secondary metabolite, is required for biofilm formation by the native producer Photobacterium galatheae S2753
Yushchuk et al. Heterologous AdpA transcription factors enhance landomycin production in Streptomyces cyanogenus S136 under a broad range of growth conditions
US20060084136A1 (en) Production of fusion proteins by cell-free protein synthesis
WO2017036903A1 (en) Improved vitamin production
Mitsuyama et al. Identification and characterization of a cell wall hydrolase for sporangiospore maturation in Actinoplanes missouriensis
Kotowska et al. Type II thioesterase ScoT is required for coelimycin production by the modular polyketide synthase Cpk of Streptomyces coelicolor A3 (2).
Valladares et al. The role of SepF in cell division and diazotrophic growth in the multicellular cyanobacterium Anabaena sp. strain PCC 7120
Bellier et al. Post-translational control of the Streptomyces lividans ClgR regulon by ClpP
KR102359972B1 (ko) 화합물의 제조를 위한 조성물 및 방법
Lin et al. Functional analysis of fengycin synthetase FenD
WO2015147379A1 (ko) 숙주세포의 생체 회로 간섭 없이 외래 유전자를 발현하기 위한 재조합 벡터 및 이의 용도
Christensen‐Dalsgaard et al. RNA decay by messenger RNA interferases
Akutsu et al. The ssgB gene is required for the early stages of sporangium formation in Actinoplanes missouriensis
EA024834B1 (ru) Регуляция индуцируемых промоторов
Birštonas et al. Multiplex genetic engineering exploiting pyrimidine salvage pathway-based self-encoded selectable markers
Bednarz et al. The gamma-butyrolactone receptors ScbR and AtrA form a quorum sensing switch between coelimycin and actinorhodin synthesis in Streptomyces coelicolor A3 (2)
CN102533800A (zh) 一种海洋链霉菌卤化酶基因及其产物,以及其修饰产物的生物合成基因簇

Legal Events

Date Code Title Description
WWE Wipo information: entry into national phase

Ref document number: 14410063

Country of ref document: US

121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 14887006

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 14887006

Country of ref document: EP

Kind code of ref document: A1