WO2015144636A1 - Procédé de traitement de leucémies aiguës lymphoblastiques à lymphocytes t - Google Patents

Procédé de traitement de leucémies aiguës lymphoblastiques à lymphocytes t Download PDF

Info

Publication number
WO2015144636A1
WO2015144636A1 PCT/EP2015/056121 EP2015056121W WO2015144636A1 WO 2015144636 A1 WO2015144636 A1 WO 2015144636A1 EP 2015056121 W EP2015056121 W EP 2015056121W WO 2015144636 A1 WO2015144636 A1 WO 2015144636A1
Authority
WO
WIPO (PCT)
Prior art keywords
myc
cell
cells
acute lymphoblastic
saha
Prior art date
Application number
PCT/EP2015/056121
Other languages
English (en)
Inventor
Dominique PAYET-BORNET
Bertrand NADEL
Marie LOOSVELD
Yves Collette
Rémy CASTELLANO
Original Assignee
INSERM (Institut National de la Santé et de la Recherche Médicale)
Institut Jean Paoli & Irene Calmettes
Université D'aix Marseille
Centre National De La Recherche Scientifique (Cnrs)
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by INSERM (Institut National de la Santé et de la Recherche Médicale), Institut Jean Paoli & Irene Calmettes, Université D'aix Marseille, Centre National De La Recherche Scientifique (Cnrs) filed Critical INSERM (Institut National de la Santé et de la Recherche Médicale)
Publication of WO2015144636A1 publication Critical patent/WO2015144636A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/60—Medicinal preparations containing antigens or antibodies characteristics by the carrier linked to the antigen
    • A61K2039/6031—Proteins
    • A61K2039/6037—Bacterial toxins, e.g. diphteria toxoid [DT], tetanus toxoid [TT]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/106—Pharmacogenomics, i.e. genetic variability in individual responses to drugs and drug metabolism
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/158—Expression markers

Definitions

  • the present invention relates to methods for the treatment of T-cell acute lymphoblastic leukemias.
  • T-cell acute lymphoblastic leukemias are aggressive proliferations of transformed T-cell progenitors.
  • intensification of chemo therapeutic schedules greatly improved prognosis in the past 10 years, -30% of cases relapse within the first 2 years following diagnosis 1 ; for long-term survivors, acute and lasting toxicities remain important issues underlining the critical need of more adapted/targeted therapies, and better risk stratification.
  • This requires a detailed understanding of T-ALL oncogenic networks, and of escape pathways involved in acquisition of chemoresistance.
  • MYC has recently gained a central role 2"5 .
  • MYC alterations are rarely found in T-ALL ( ⁇ 5%), yet indirect upregulation by multiple frequently deregulated pathways makes it one of the most frequently activated oncogenes in T-ALL.
  • increased MYC transcription results from NOTCH mutations 2"4 .
  • MYC is activated post- translationally, via mutations in FBXW7 or of the PTEN/PI3K/A T pathway, impairing the sequential ubiquitinations or phosphorylations driving its degradation 6"8 .
  • afferent pathways e.g. ⁇ -secretase or AKT inhibitors
  • the present invention relates to methods for the treatment of T-cell acute lymphoblastic leukemias.
  • the present invention is defined by the claims.
  • T-ALL subjects treated with intensive chemotherapy achieve high rates of remission.
  • MYC inhibitors such as JQ1 (BET-bromodomain inhibitor), and SAHA (HDAC inhibitor).
  • JQ1 BET-bromodomain inhibitor
  • SAHA HDAC inhibitor
  • mice xenografted with human primary T-ALLs They also compared for the first time the in vivo relevance of such associations in mice xenografted with human primary T-ALLs.
  • the data indicate that although treatments combining JQ1 or SAHA with chemotherapeutic regimens might represent promising developments in T-ALL, combinations need to be tailored to specific subgroups of subjects depending of c-MYC expression level.
  • the present invention relates to a method for treating T-cell acute lymphoblastic leukemia comprising the steps of i) determining the expression level of c-MYC in a tumor sample obtained from the subject, ii) comparing the expression level determined at step i) with a predetermined reference value and iii) administering the subject with a therapeutically effective amount of at least one agent selected from the group consisting of BET bromodomain inhibitors and HDAC inhibitors when the level determined at step i) is higher than the predetermined reference value.
  • MYC has its general meaning in the art and refers to v-myc avian myelocytomatosis viral oncogene homolog gene which encodes for proto-oncogene c- Myc.
  • a typical cDNA sequence of MYC is represented by SEQ ID NO: l .
  • Determining an expression level of c-MYC in the tumor sample obtained from the subject can be implemented by a panel of techniques well known in the art. Typically, an expression level of a gene is assessed by determining the quantity of mRNA produced by this gene. Methods for determining a quantity of mRNA are well known in the art. For example nucleic acid contained in the samples (e.g., cell or tissue prepared from the subject) is first extracted according to standard methods, for example using lytic enzymes or chemical solutions or extracted by nucleic-acid-binding resins following the manufacturer's instructions. The thus extracted mRNA is then detected by hybridization (e. g., Northern blot analysis) and/or amplification (e.g., RT-PCR).
  • hybridization e. g., Northern blot analysis
  • amplification e.g., RT-PCR
  • the methods of the invention comprise the steps of providing total RNAs extracted from tumor cells and subjecting the RNAs to amplification and hybridization to specific probes, more particularly by means of a quantitative or semiquantitative RT-PCR.
  • Probes made using the disclosed methods can be used for nucleic acid detection, such as in situ hybridization (ISH) procedures (for example, fluorescence in situ hybridization (FISH), chromogenic in situ hybridization (CISH) and silver in situ hybridization (SISH)) or comparative genomic hybridization (CGH).
  • ISH in situ hybridization
  • FISH fluorescence in situ hybridization
  • CISH chromogenic in situ hybridization
  • SISH silver in situ hybridization
  • CGH comparative genomic hybridization
  • the expression level of a gene may be expressed as absolute expression level or normalized expression level. Both types of values may be used in the present method.
  • the expression level of a gene is typically expressed as normalized expression level when quantitative PCR is used as method of assessment of the expression level because small differences at the beginning of an experiment could provide huge differences after a number of cycles.
  • determining the expression level of MYC include the determination of the quantity of protein encoded by said gene (i.e. c-MYC). For instance, such methods comprise contacting the sample with a binding partner capable of selectively interacting with a marker protein present in the sample.
  • the binding partner is generally an antibody that may be polyclonal or monoclonal, preferably monoclonal.
  • the presence of the protein can be detected using standard electrophoretic and immunodiagnostic techniques, including immunoassays such as competition, direct reaction, or sandwich type assays.
  • Such assays include, but are not limited to, Western blots; agglutination tests; enzyme-labeled and mediated immunoassays, such as ELISAs; biotin/avidin type assays; radioimmunoassays; Immunoelectrophoresis; immunoprecipitation, flow cytometry etc.
  • the reactions generally include revealing labels such as fluorescent, chemiluminescent, radioactive, enzymatic labels or dye molecules, or other methods for detecting the formation of a complex between the antigen and the antibody or antibodies reacted therewith.
  • the aforementioned assays generally involve separation of unbound protein in a liquid phase from a solid phase support to which antigen-antibody complexes are bound.
  • Solid supports which can be used in the practice of the invention include substrates such as nitrocellulose (e. g., in membrane or microtiter well form); polyvinylchloride (e. g., sheets or microtiter wells); polystyrene latex (e.g., beads or microtiter plates); polyvinylidine fluoride; diazotized paper; nylon membranes; activated beads, magnetically responsive beads, and the like.
  • substrates such as nitrocellulose (e. g., in membrane or microtiter well form); polyvinylchloride (e. g., sheets or microtiter wells); polystyrene latex (e.g., beads or microtiter plates); polyvinylidine fluoride; diazotized paper; nylon membranes; activated beads, magnetically responsive beads, and the like.
  • the predetermined reference value is a threshold value or a cut-off value.
  • a “threshold value” or “cut-off value” can be determined experimentally, empirically, or theoretically.
  • a threshold value can also be arbitrarily selected based upon the existing experimental and/or clinical conditions, as would be recognized by a person of ordinary skilled in the art. For example, retrospective measurement of the expression level of MYC in properly banked historical subject samples may be used in establishing the predetermined reference value.
  • the threshold value has to be determined in order to obtain the optimal sensitivity and specificity according to the function of the test and the benefit/risk balance (clinical consequences of false positive and false negative).
  • the optimal sensitivity and specificity can be determined using a Receiver Operating Characteristic (ROC) curve based on experimental data.
  • ROC Receiver Operating Characteristic
  • a series of different cut-off values are set as continuous variables to calculate a series of sensitivity and specificity values. Then sensitivity is used as the vertical coordinate and specificity is used as the horizontal coordinate to draw a curve. The higher the area under the curve (AUC), the higher the accuracy of diagnosis.
  • AUC area under the curve
  • the point closest to the far upper left of the coordinate diagram is a critical point having both high sensitivity and high specificity values.
  • the AUC value of the ROC curve is between 1.0 and 0.5. When AUO0.5, the diagnostic result gets better and better as AUC approaches 1. When AUC is between 0.5 and 0.7, the accuracy is low. When AUC is between 0.7 and 0.9, the accuracy is moderate.
  • BET bromodomain inhibitor refers to any compound that is able to inhibit at least one member of the BET (bromodomain and extra-terminal) family.
  • the BET family is represented by six members in humans: BRD1, BRD2, BRD3, BRD4, BRD7 and the testis-specific isoform BRDT, with each containing two N-terminal bromodomains.
  • a BET bromodomain inhibitor is any molecule or compound that can prevent or inhibit, in part or in whole, the binding of at least one bromodomain to acetyl-lysine residues of proteins (e.g., to the acetyl- lysine residues of histones).
  • a BET bromodomain inhibitor may inhibit only one BET family member or it may inhibit more than one or all BET family members.
  • the BET bromodomain inhibitor may be any molecule or compound that inhibits a bromodomain as described above, including nucleic acids such as DNA and RNA aptamers, antisense oligonucleotides, siRNA and shRNA, small peptides, antibodies or antibody fragments, and small molecules such as small chemical compounds. It is to be understood that the BET bromodomain inhibitor may inhibit only one bromo-domain- containing protein or it may inhibit more than one or all bromodomain-containing proteins. BET bromodomain inhibitors are well known in the art.
  • BET bromodomain inhibitors are described in US 2011 143651, WO2009/084693A1, WO 2011143669, WO 2011143660, WO 2011054851, and JP 2008156311, which are incorporated herein by reference.
  • BET bromodomain inhibitors known in the art include, but are not limited to, RVX-208 (Resverlogix), PFI-1 (Structural Genomics Consortium), OTX015 (Mitsubishi Tanabe Pharma Corporation), BzT- Glaxo SmithKline).
  • the BET bromodomain inhibitor is JQ1 or any derivative thereof which typically include compounds of formulas I-XXII described in the International Patent Application WO 2011143669).
  • the BET bromodomain inhibitor is JQ1 ((S)-tert-butyl 2-(4-(4-chlorophenyl)-2,3,9-trimethyl-6H- thieno[3,2-fJ[l,2,4]triazolo[4,3-a][l,4]diazepin-6-yl)acetate) and has the formula below:
  • the BET bromodomain inhibitor is any molecule or compound that reduces or prevents expression of BET proteines.
  • examples of such inhibitors include siRNA, shRNA, dsRNA, oligomimics, and proteases that target one or more BET protein.
  • histone deacetylase inhibitor or "HDAC inhibitor” is used to identify a compound, which is capable of interacting with a histone deacetylase and inhibiting its activity, more particularly its enzymatic activity.
  • histone deacetylase and “HDAC” are intended to refer to any one of a family of enzymes that remove acetyl groups from the ⁇ -amino groups of lysine residues at the N-terminus of a histone.
  • histone is meant to refer to any histone protein, including HI, H2A, H2B, H3, H4, and H5, from any species.
  • HDAC proteins or gene products include, but are not limited to, HDAC-1, HDAC-2, HDAC-3, HDAC-4, HDAC-5, HDAC-6, HDAC-7, HDAC-8, HDAC-9, HDAC-10 and HDAC-11.
  • Inhibiting histone deacetylase enzymatic activity means reducing the ability of a histone deacetylase to remove an acetyl group from a histone or another protein substrate. Typically, such inhibition is specific, i.e. the histone deacetylase inhibitor reduces the ability of a histone deacetylase to remove an acetyl group from a histone or another protein substrate at a concentration that is lower than the concentration of the inhibitor that is required to produce some other, unrelated biological effect.
  • the HDAC inhibitor is a non-selective HDAC inhibitor.
  • the non-selective HDAC inhibitor is, by way of non-limiting example, N'-hydroxy-N-phenyl-octanediamide (suberoylanilide hydroxamic acid, SAHA), pyroxamide, CBHA, trichostatin A (TSA), trichostatin C, salicylihydroxamic acid (SBHA), azelaic bihydroxamic acid (ABHA), azelaic- l-hydroxamate-9-analide (AAHA), depsipeptide, FK228, 6-(3-chlorophenylureido) carpoic hydroxamic acid (3C1-UCHA), oxamflatin, A- 161906, scriptaid, PXD-101 (Belinostat or N-hydroxy-3-[3-](phylamin) (suberoylanilide hydroxamic acid, SAHA),
  • the agent is used in combination with a chemotherapeutic agent.
  • Chemotherapeutic agents include, but are not limited to alkylating agents such as thiotepa and cyclosphosphamide; alkyl sulfonates such as busulfan, improsulfan and piposulfan; aziridines such as benzodopa, carboquone, meturedopa, and uredopa; ethylenimines and methylamelamines including altretamine, triethylenemelamine, trietylenephosphoramide, triethiylenethiophosphoramide and trimethylolomelamine; acetogenins (especially bullatacin and bullatacinone); a camptothecin (including the synthetic analogue topotecan); bryostatin; callystatin; CC-1065 (including its adozelesin, carzelesin and bizelesin synthetic analogues); cryptophycins
  • calicheamicin especially calicheamicin gammall and calicheamicin omegall ; dynemicin, including dynemicin A; bisphosphonates, such as clodronate; an esperamicin; as well as neocarzinostatin chromophore and related chromoprotein enediyne antiobiotic chromophores, aclacinomysins, actinomycin, authrarnycin, azaserine, bleomycins, cactinomycin, carabicin, caminomycin, carzinophilin, chromomycinis, dactinomycin, daunorubicin, detorubicin, 6-diazo-5-oxo-L-norleucine, doxorubicin (including morpholino-doxorubicin, cyanomorpholino-doxorubicin, 2-pyrrolino- doxorubicin and deoxy dox
  • the present invention relates to a method for treating T-cell acute lymphoblastic leukemia comprising the steps of i) determining the expression level of c- MYC in a tumor sample obtained from the subject, ii) comparing the expression level determined at step i) with a predetermined reference value and iii) administering the subject with a therapeutically effective amount of at least one BET bromodomain inhibitor and with a therapeutically effective amount of vincristine.
  • the present invention relates to a method for treating T-cell acute lymphoblastic leukemia comprising the steps of i) determining the expression level of c- MYC in a tumor sample obtained from the subject, ii) comparing the expression level determined at step i) with a predetermined reference value and iii) administering the subject with a therapeutically effective amount of at least one HDAC inhibitor and with a therapeutically effective amount of vincristine.
  • a “therapeutically effective amount” is meant a sufficient amount of the compound to treat T-ALL at a reasonable benefit/risk ratio applicable to any medical treatment.
  • the total daily usage of the compounds of the present invention will be decided by the attending physician within the scope of sound medical judgment.
  • the specific therapeutically effective dose level for any particular subject will depend upon a variety of factors including the disorder being treated and the severity of the disorder; activity of the specific compound employed; the specific composition employed, the age, body weight, general health, sex and diet of the subject; the time of administration, route of administration, and rate of excretion of the specific compound employed; the duration of the treatment; drugs used in combination or coincidential with the specific compound employed; and like factors well known in the medical arts. For example, it is well within the skill of the art to start doses of the compound at levels lower than those required to achieve the desired therapeutic effect and to gradually increase the dosage until the desired effect is achieved.
  • the daily dosage of the products may be varied over a wide range from 0.01 to 1,000 mg per adult per day.
  • the compositions contain 0.01, 0.05, 0.1, 0.5, 1.0, 2.5, 5.0, 10.0, 15.0, 25.0, 50.0, 100, 250 and 500 mg of the active ingredient for the symptomatic adjustment of the dosage to the subject to be treated.
  • a medicament typically contains from about 0.01 mg to about 500 mg of the active ingredient, preferably from 1 mg to about 100 mg of the active ingredient.
  • An effective amount of the drug is ordinarily supplied at a dosage level from 0.0002 mg/kg to about 20 mg/kg of body weight per day, especially from about 0.001 mg/kg to 7 mg/kg of body weight per day.
  • the compounds of the invention are administered as a formulation in association with one or more pharmaceutically acceptable excipients to form pharmaceutical composition.
  • the term “Pharmaceutically” or “pharmaceutically acceptable” refers to molecular entities and compositions that do not produce an adverse, allergic or other untoward reaction when administered to a mammal, especially a human, as appropriate.
  • a pharmaceutically acceptable carrier or excipient refers to a non-toxic solid, semi-solid or liquid filler, diluent, encapsulating material or formulation auxiliary of any type.
  • Pharmaceutical compositions suitable for the delivery of compounds of the present invention and methods for their preparation will be readily apparent to those skilled in the art.
  • the active principle i.e. a compound of the invention
  • Suitable unit administration forms comprise oral-route forms such as tablets, gel capsules, powders, granules and oral suspensions or solutions, sublingual and buccal administration forms, aerosols, implants, subcutaneous, transdermal, topical, intraperitoneal, intramuscular, intravenous, subdermal, transdermal, intrathecal and intranasal administration forms and rectal administration forms.
  • the pharmaceutical compositions contain vehicles which are pharmaceutically acceptable for a formulation capable of being injected.
  • vehicles which are pharmaceutically acceptable for a formulation capable of being injected.
  • These may be in particular isotonic, sterile, saline solutions (monosodium or disodium phosphate, sodium, potassium, calcium or magnesium chloride and the like or mixtures of such salts), or dry, especially freeze-dried compositions which upon addition, depending on the case, of sterilized water or physiological saline, permit the constitution of injectable solutions.
  • the pharmaceutical forms suitable for injectable use include sterile aqueous solutions or dispersions; formulations including sesame oil, peanut oil or aqueous propylene glycol; and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions.
  • the form must be sterile and must be fluid to the extent that easy syringability exists. It must be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms, such as bacteria and fungi.
  • Solutions comprising compounds as free base or pharmacologically acceptable salts can be prepared in water suitably mixed with a surfactant, such as hydroxypropylcellulose.
  • Dispersions can also be prepared in glycerol, liquid polyethylene glycols, and mixtures thereof and in oils. Under ordinary conditions of storage and use, these preparations contain a preservative to prevent the growth of microorganisms.
  • Compounds of the invention can be formulated into a composition in a neutral or salt form as above described.
  • the carrier can also be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol, and the like), suitable mixtures thereof, and vegetables oils.
  • the proper fluidity can be maintained, for example, by the use of a coating, such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants.
  • the prevention of the action of microorganisms can be brought about by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal, and the like.
  • isotonic agents for example, sugars or sodium chloride.
  • Prolonged absorption of the injectable compositions can be brought about by the use in the compositions of agents delaying absorption, for example, aluminium monostearate and gelatin.
  • Sterile injectable solutions are prepared by incorporating the compounds of the invention in the required amount in the appropriate solvent with various of the other ingredients enumerated above, as required, followed by filtered sterilization.
  • dispersions are prepared by incorporating the various sterilized active ingredients into a sterile vehicle which contains the basic dispersion medium and the required other ingredients from those enumerated above.
  • the preferred methods of preparation are vacuum-drying and freeze-drying techniques which yield a powder of the active ingredient plus any additional desired ingredient from a previously sterile- filtered solution thereof.
  • solutions Upon formulation, solutions will be administered in a manner compatible with the dosage formulation and in such amount as is therapeutically effective.
  • the formulations are easily administered in a variety of dosage forms, such as the type of injectable solutions described above, but drug release capsules and the like can also be employed.
  • aqueous solutions For parenteral administration in an aqueous solution, for example, the solution should be suitably buffered if necessary and the liquid diluent first rendered isotonic with sufficient saline or glucose.
  • aqueous solutions are especially suitable for intravenous, intramuscular, subcutaneous and intraperitoneal administration.
  • sterile aqueous media which can be employed will be known to those of skill in the art in light of the present disclosure.
  • one dosage could be dissolved in 1 ml of isotonic NaCl solution and either added to 1000 ml of hypodermoclysis fluid or injected at the proposed site of infusion. Some variation in dosage will necessarily occur depending on the condition of the subject being treated. The person responsible for administration will, in any event, determine the appropriate dose for the individual subject.
  • Compounds of the invention may be formulated within a therapeutic mixture to comprise about 0.0001 to 1.0 milligrams, or about 0.001 to 0.1 milligrams, or about 0.1 to 1.0 or even about 10 milligrams per dose or so. Multiple doses can also be administered.
  • other pharmaceutically acceptable forms include, e.g. tablets or other solids for oral administration; liposomal formulations; time release capsules ; and any other form currently used.
  • FIGURES are a diagrammatic representation of FIGURES.
  • FIG. 1 Ex vivo evaluation of drug treatments.
  • A Drug screening. EC50 are reported in ⁇ .
  • B T-ALL cell lines were incubated for 48H with ⁇ JQ1 (J), ⁇ ⁇ SAHA (S), 50 nM Vincristine (V), 10 nM Bortezomib (B) or the vehicle DMSO, and cellular/molecular analysis were performed. Top: cell apoptosis was monitored by FACS using Annexin V/7-AAD labelling; histograms report the ratio of apoptotic cells treated with drugs versus DMSO. Bottom: cell cycle analysis of T-ALL cell lines treated with JQ1 or DMSO.
  • FIG. 1 In vivo analysis of JQ1/SAHA efficiencies in xenografts of human primary T-ALL.
  • A Design of xenografts and in vivo drug treatment assays.
  • NOD/SCID/yc (NSG) mice are grafted with human primary blasts. Following leukemia development, mice are sacrificed, and blasts from spleens are transplanted in secondary recipient mice for amplification (1-2 rounds).
  • a set of ⁇ 25 NSG mice are engrafted with 1.10 6 cells issued from the same tumor bulk (from amplification step).
  • mice Upon appearance of hCD45 + human blasts in blood ( ⁇ -25/ ⁇ ), mice are divided into pools of 5-6 for drug treatments.
  • Treatments were run over 21 days with indicated schedules: SAHA and JQ1 were injected (ip) 5 days weekly (grey boxes); Vincristine was injected (ip) 1 day weekly (hatched boxes); NT: control mice, not treated; Blood samples were drawn at days dO, dl4 and d21 post-treatment; mice were sacrificed at d21, and spleens harvested.
  • hCD45 + blasts were quantified by FACS; concentrations of hCD45 + cells/ ⁇ of blood (top plots) and numbers of hCD45 + cells per spleen (bottom plots) are shown for T-ALL#2 ( ⁇ , left plots) T-ALL#3 (A, middle plots) and T-ALL#4 ( ⁇ , right plots) xenografted mice. Median values are indicated by horizontal bars. The non-parametric Mann-Whitney test was used to calculate P values, differences statistically significant are indicated; * P ⁇ 0.05, ** P ⁇ 0.001.
  • V treated with Vincristine
  • V+J treated with Vincristine+JQ 1
  • V+S treated with Vincristine+SAHA.
  • Human T-ALL cell lines were cultured at 37°C with 5% C02 in RPMI media supplemented with 10% fetal bovine serum (Lonza) and antibiotics (penicillin 100 U/mL; streptomycin 50 ⁇ / ⁇ ).
  • Drugs (Table 1) are distributed in a 96 well plate and incubated with 1-2.10 5 cells of choice. T-ALL cell lines are incubated at 37°C during 72h.
  • the effect of drugs on cell viability/proliferation is defined by measuring intracellular ATP levels using CellTiter-Glo chemiluminescence kit (Promega) and a Centra XS3 LB 960 plate reader (Berthold technologies), as previously described (Salmi-Smail, et al 2010). Values were normalized to DMSO control. Dose-response curves were generated and effective dose 50 values (EC50) were calculated using nonlinear regression analysis (Graph Pad Prism).
  • Cell lines were cultured in 6-well plates at 1.10 6 cells/ml and were incubated in the control medium or with 1 ⁇ JQ1, 1 ⁇ SAHA, 10 nM Bortezomib or 50 nM Vincristine. At 24h, cells were harvested for western blot and RQ-PCR and at 48h for viability and cell cycle quantification. Drug treatments of human primary T-ALL were performed as for cell lines and were stopped after 24 H incubation for molecular analysis and for apoptosis assays. Molecular and cellular analysis
  • Primer sequences for MYC and ABL cDNA are the following: Q-MYC1A , d(GCAGCGACTCTGAGGAGGAA) ; Q-MYC1B d(CCAGGAGCCTGCCTCTTTT) ; Q-ABL-IA d(TTGTGGCCAGTGGAGATAACACT) and Q- ABL-1B, d(CTTGGCCATTTTTGGTTTGG). All RQ-PCR were performed in duplicate. To allow comparison between samples, transcript quantification was performed after normalization with ABL from previously generated standard curves using the ACt method and calculated according to the following formula 2A (ctABL_ctgene) .
  • Membranes were blocked in TTBS (137mM NaCl, 2mM KC1, 25mM Tris(hydroxymethyl)aminomethane and 0.1% tween 20) supplemented with 5% non-fat milk and incubated with primary antibodies against MYC (clone 9E10, Santa Cruz Biotechnology Inc.) or Actin (clone 1-19, Santa Cruz Biotechnology Inc.) overnight at 4°C with agitation.
  • the secondary Anti-rabbit, -mouse or - goat antibodies (Santa Cruz Biotechnology) conjugated to HRP were added for 1 hour at room temperature. Immunoblots were revealed using ECL western blotting detection reagents (GE Healthcare) and stripped using Restore western blot stripping buffer (Pierce).
  • mice were bred and maintained in specific-pathogen-free conditions in CIML or CRCM animal facilities in accordance with institutional guidelines.
  • Human primary T-ALL blasts (1.10 6 cells per mouse) were transplanted by intravenous injections in healthy NSG (NOD.Cg-iWc scid II2g tmlWji /SzJ) mice (Charles River, UK).
  • T-ALL onset was monitored by retro-orbital blood sampling and FACS analysis. Typically ⁇ of blood were first incubated with red cell lysis buffer (StemCell Technologies) and then incubated with anti- human CD45-APC-Cy7 (BD Pharmingen, ref. 557833) or Pacific blue anti-human CD45 (Bio legend, ref.
  • mice were sacrificed and human leukemic cells from the spleen were engrafted in secondary recipient NSG mice.
  • HDAC inhibitors ⁇ e.g. SAHA
  • SAHA BET-bromodomain inhibitors
  • JQ1 BET-bromodomain inhibitors
  • Optimal windows of drug molarities were first established by pre-screening, and a more focused panel of 4 serial dilutions was used to determine, for a given T-ALL, the average EC50 value of drugs tested side by side (Fig. lA).
  • Fig. lA the average EC50 value of drugs tested side by side
  • SAHA and JQl combined low EC50, relatively low molarity, and a large spectrum of activity across all T-ALLs (Fig. lA).
  • mice When leukemia-related first symptoms were observed mice were sacrificed and human leukemic cells from spleens harvested for secondary engraftments (amplification step). Then, leukemic blasts of T-ALL#2, T-ALL#3 and T-ALL#4 from secondary xenografts were transplanted (10 6 cells/mouse) into 25 recipient mice each. Upon appearance of hCD45 + blasts in blood ( ⁇ 5 weeks, 1-25 hCD45 7 ⁇ 1), pools of 5-6 mice were mock- or drug-treated. For each mouse, circulating hCD45 blasts were quantified by FACS at day 0, and dl4/d21 post-treatment.
  • mice were sacrificed, spleens harvested, weighed and blasts quantified as above (Fig.2B).
  • Vincristine induced a significant decrease in hCD45 + leukemic cell proliferation in spleen and blood at all time-points.
  • treatments with JQl also significantly inhibited tumor progression and spleen size/weight.
  • Similar results were obtained with SAHA in T-ALL#3, while in T-ALL#2 SAHA showed the best efficiency.
  • Vincristine+JQl or SAHA combinations further decreased progression, in line with the synergistic effect observed in ex vivo assays.
  • Notch signals positively regulate activity of the mTOR pathway in T-cell acute lymphoblastic leukemia.
  • Bortezomib suppresses the growth of leukemia cells with Notchl overexpression in vivo and in vitro. Cancer Chemother Pharmacol, 70, 801-809.
  • the ubiquitin ligase FBXW7 modulates leukemia- initiating cell activity by regulating MYC stability. Cell, 153, 1552-1566.
  • Notchl contributes to mouse T-cell leukemia by directly inducing the expression of c-myc. Mol. Cell Biol, 26, 8022-8031.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Pathology (AREA)
  • Analytical Chemistry (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Wood Science & Technology (AREA)
  • Physics & Mathematics (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Hospice & Palliative Care (AREA)
  • Biophysics (AREA)
  • Oncology (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

La présente invention se rapporte à des procédés de traitement de leucémies aiguës lymphoblastiques à lymphocytes T. En particulier, la présente invention se rapporte à un procédé de traitement d'une leucémie aiguë lymphoblastique à lymphocytes T, comprenant les étapes consistant i) à déterminer le niveau d'expression de c-MYC dans un échantillon de tumeur prélevé chez le sujet, ii) à comparer le niveau d'expression déterminé à l'étape i) avec une valeur de référence prédéfinie et iii) à administrer au sujet une quantité thérapeutiquement efficace d'au moins un agent choisi dans le groupe constitué par les inhibiteurs de bromodomaine BET et les inhibiteurs de l'HDAC lorsque le niveau déterminé à l'étape i) est supérieur à la valeur de référence prédéfinie.
PCT/EP2015/056121 2014-03-24 2015-03-23 Procédé de traitement de leucémies aiguës lymphoblastiques à lymphocytes t WO2015144636A1 (fr)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
EP14305419.5 2014-03-24
EP14305419 2014-03-24
EP14163087.1 2014-04-01
EP14163087 2014-04-01

Publications (1)

Publication Number Publication Date
WO2015144636A1 true WO2015144636A1 (fr) 2015-10-01

Family

ID=52697449

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2015/056121 WO2015144636A1 (fr) 2014-03-24 2015-03-23 Procédé de traitement de leucémies aiguës lymphoblastiques à lymphocytes t

Country Status (1)

Country Link
WO (1) WO2015144636A1 (fr)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP3413045A4 (fr) * 2016-02-09 2019-09-18 Japanese Foundation For Cancer Research Marqueur pour diagnostic de tumeur hématopoïétique rare, procédé d'inspection, agent thérapeutique, et procédé de dépistage

Citations (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2008156311A (ja) 2006-12-26 2008-07-10 Institute Of Physical & Chemical Research Ｂｒｄ２ブロモドメイン結合剤
WO2009084693A1 (fr) 2007-12-28 2009-07-09 Mitsubishi Tanabe Pharma Corporation Agent antitumoral
WO2011054851A1 (fr) 2009-11-05 2011-05-12 Glaxosmithkline Llc Nouveau procédé
US20110143651A1 (en) 2009-12-10 2011-06-16 Motorola, Inc. Method for selecting media for delivery to users at an incident
WO2011143660A2 (fr) 2010-05-14 2011-11-17 Dana-Farber Cancer Institute, Inc. Compositions et méthodes de traitement de la leucémie
WO2011143669A2 (fr) 2010-05-14 2011-11-17 Dana-Farber Cancer Institute, Inc Compositions et méthodes de traitement des néoplasies, des maladies inflammatoires et d'autres affections
WO2012088067A1 (fr) * 2010-12-20 2012-06-28 Quintiles Transnational Corporation Procédés pour prédire et/ou déterminer la réponse à un inhibiteur d'histone désacétylase (hdac)

Patent Citations (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2008156311A (ja) 2006-12-26 2008-07-10 Institute Of Physical & Chemical Research Ｂｒｄ２ブロモドメイン結合剤
WO2009084693A1 (fr) 2007-12-28 2009-07-09 Mitsubishi Tanabe Pharma Corporation Agent antitumoral
WO2011054851A1 (fr) 2009-11-05 2011-05-12 Glaxosmithkline Llc Nouveau procédé
US20110143651A1 (en) 2009-12-10 2011-06-16 Motorola, Inc. Method for selecting media for delivery to users at an incident
WO2011143660A2 (fr) 2010-05-14 2011-11-17 Dana-Farber Cancer Institute, Inc. Compositions et méthodes de traitement de la leucémie
WO2011143669A2 (fr) 2010-05-14 2011-11-17 Dana-Farber Cancer Institute, Inc Compositions et méthodes de traitement des néoplasies, des maladies inflammatoires et d'autres affections
WO2012088067A1 (fr) * 2010-12-20 2012-06-28 Quintiles Transnational Corporation Procédés pour prédire et/ou déterminer la réponse à un inhibiteur d'histone désacétylase (hdac)

Non-Patent Citations (25)

* Cited by examiner, † Cited by third party
Title
BONNET, M.; LOOSVELD, M.; MONTPELLIER, B.; NAVARRO, J.M.; QUILICHINI, B.; PICARD, C; DI CRISTOFARO, J.; BAGNIS, C.; FOSSAT, C.; HE: "Posttranscriptional deregulation of MYC via PTEN constitutes a major alternative pathway of MYC activation in T-cell acute lymphoblastic leukemia", BLOOD, vol. 117, 2011, pages 6650 - 6659
CHAN, S.M.; WENG, A.P.; TIBSHIRANI, R.; ASTER, J.C.; UTZ, P.J.: "Notch signals positively regulate activity of the mTOR pathway in T-cell acute lymphoblastic leukemia", BLOOD, vol. 110, 2007, pages 278 - 286
CHOU, T.C.; TALALAY, P.: "Quantitative analysis of dose-effect relationships: the combined effects of multiple drugs or enzyme inhibitors", ADV ENZYME REGUL, vol. 22, 1984, pages 27 - 55
CULLION, K.; DRAHEIM, K.M.; HERMANCE, N.; TAMMAM, J.; SHARMA, V.M.; WARE, C.; NIKOV, G.; KRISHNAMOORTHY, V.; MAJUMDER, P.K.; KELLI: "Targeting the Notch1 and mTOR pathways in a mouse T-ALL model", BLOOD, 2009
DE KEERSMAECKER, K.; LAHORTIGA, I.; MENTENS, N.; FOLENS, C.; VAN NESTE, L.; BEKAERT, S.; VANDENBERGHE, P.; ODERO, M.D.; MARYNEN, P: "In vitro validation of gamma-secretase inhibitors alone or in combination with other anti-cancer drugs for the treatment of T-cell acute lymphoblastic leukemia", HAEMATOLOGICA, vol. 93, 2008, pages 533 - 542
DELMORE, J.E.; ISSA, G.C.; LEMIEUX, M.E.; RAHL, P.B.; SHI, J.; JACOBS, H.M.; KASTRITIS, E.; GILPATRICK, T.; PARANAL, R.M.; QI, J.: "BET bromodomain inhibition as a therapeutic strategy to target c-Myc", CELL, vol. 146, 2011, pages 904 - 917
FILIPPAKOPOULOS, P.; QI, J.; PICAUD, S.; SHEN, Y.; SMITH, W.B.; FEDOROV, 0.; MORSE, E.M.; KEATES, T.; HICKMAN, T.T.; FELLETAR, I.: "Selective inhibition of BET bromodomains", NATURE, vol. 468, 2010, pages 1067 - 1073
HANN, S.R.: "Role of post-translational modifications in regulating c-Myc proteolysis, transcriptional activity and biological function", SEMIN CANCER BIOL, vol. 16, 2006, pages 288 - 302
HUANG, C.; HU, X.; WANG, L.; LU, S.; CHENG, H.; SONG, X.; WANG, J.; YANG, J.: "Bortezomib suppresses the growth of leukemia cells with Notch1 overexpression in vivo and in vitro", CANCER CHEMOTHER PHARMACOL, vol. 70, 2012, pages 801 - 809
JAKEE DELMORE ET AL: "BET Bromodomain Inhibition asa Therapeutic Strategy to Target c-Myc", CELL, CELL PRESS, US, vol. 146, no. 6, 15 August 2011 (2011-08-15), pages 904 - 917, XP028295705, ISSN: 0092-8674, [retrieved on 20110818], DOI: 10.1016/J.CELL.2011.08.017 *
KING, B.; TRIMARCHI, T.; REAVIE, L.; XU, L.; MULLENDERS, J.; NTZIACHRISTOS, P.; ARANDA-ORGILLES, B.; PEREZ-GARCIA, A.; SHI, J.; VA: "The ubiquitin ligase FBXW7 modulates leukemia-initiating cell activity by regulating MYC stability", CELL, vol. 153, 2013, pages 1552 - 1566
MARIE LOOSVELD ET AL: "Therapeutic targeting of c-Myc in T-cell acute lymphoblastic leukemia, T-ALL", ONCOTARGET, 27 March 2014 (2014-03-27), United States, pages 3168, XP055137250, Retrieved from the Internet <URL:http://www.ncbi.nlm.nih.gov/pubmed/24930440> [retrieved on 20140829] *
MERTZ, J.A.; CONERY, A.R.; BRYANT, B.M.; SANDY, P.; BALASUBRAMANIAN, S.; MELE, D.A.; BERGERON, L.; SIMS, R.J., 3RD: "Targeting MYC dependence in cancer by inhibiting BET bromodomains", PROC NATL ACAD SCI USA, vol. 108, 2011, pages 16669 - 16674
O'NEIL, J.; GRIM, J.; STRACK, P.; RAO, S.; TIBBITTS, D.; WINTER, C.; HARDWICK, J.; WELCKER, M.; MEIJERINK, J.P.; PIETERS, R.: "FBW7 mutations in leukemic cells mediate NOTCH pathway activation and resistance to {gamma}-secretase inhibitors", THE JOURNAL OF EXPERžMENTAL MEDICINE, vol. 204, 2007, pages 1813 - 1824
PALOMERO, T.; LIM, W.K.; ODOM, D.T.; SULIS, M.L.; REAL, P.J.; MARGOLIN, A.; BARNES, K.C.; O'NEIL, J.; NEUBERG, D.; WENG, A.P.: "NOTCHI directly regulates c-MYC and activates a feed-forward-loop transcriptional network promoting leukemic cell growth", PROC.NATL.ACAD.SCž. US.A, vol. 103, 2006, pages 18261 - 18266
PALOMERO, T.; SULIS, M.L.; CORTINA, M.; REAL, P.J.; BARNES, K.; CIOFANI, M.; CAPARROS, E.; BUTEAU, J.; BROWN, K.; PERKINS, S.L.: "Mutational loss of PTEN induces resistance to NOTCHI inhibition in T-cell leukemia", NAT.MED., vol. 13, 2007, pages 1203 - 1210
PUI, C.H.: "Acute lymphoblastic leukemia: introduction", SEMIN HEMATOL, vol. 46, 2009, pages 1 - 2
PUI, C.H.; JEHA, S.: "New therapeutic strategies for the treatment of acute lymphoblastic leukaemia", NAT REV DRUG DISCOV, vol. 6, 2007, pages 149 - 165
RODERICK, J.E.; TESELL, J.; SHULTZ, L.D.; BREHM, M.A.; GREINER, D.L.; HARRIS, M.H.; SILVERMAN, L.B.; SALLAN, S.E.; GUTIERREZ, A.;: "c-Myc inhibition prevents leukemia initiation in mice and impairs the growth of relapsed and induction failure pediatric T-ALL cells", BLOOD, 2014
SALMI-SMAIL, C.; FABRE, A.; DEQUIEDT, F.; RESTOUIN, A.; CASTELLANO, R.; GARBIT, S.; ROCHE, P.; MORELLI, X.; BRUNEL, J.M.; COLLETTE: "Modified cap group suberoylanilide hydroxamic acid histone deacetylase inhibitor derivatives reveal improved selective antileukemic activity", J MED CHEM, vol. 53, 2010, pages 3038 - 3047
SHARMA, V.M.; CALVO, J.A.; DRAHEIM, K.M.; CUNNINGHAM, L.A.; HERMANCE, N.; BEVERLY, L.; KRISHNAMOORTHY, V.; BHASIN, M.; CAPOBIANCO,: "Notch1 contributes to mouse T-cell leukemia by directly inducing the expression of c-myc", MOL. CELL BIOL., vol. 26, 2006, pages 8022 - 8031
THOMPSON, B.J.; BUONAMICI, S.; SULIS, M.L.; PALOMERO, T.; VILIMAS, T.; BASSO, G.; FERRANDO, A.; AIFANTIS, 1.: "The SCFFBW7 ubiquitin ligase complex as a tumor suppressor in T cell leukemia", THE JOURNAL OFEXPERIMENTAL MEDICINE, vol. 204, 2007, pages 1825 - 1835
UDDIN, S.; HUSSAIN, A.; AL-HUSSEIN, K.; PLATANIAS, L.C.; BHATIA, K.G.: "Inhibition of phosphatidylinositol 3'-kinase induces preferentially killing of PTEN-null T leukemias through AKT pathway", BIOCHEM BIOPHYS RES COMMUN, vol. 320, 2004, pages 932 - 938
WENG, A.P.; MILLHOLLAND, J.M.; YASHIRO-OHTANI, Y.; ARCANGELI, M.L.; LAU, A.; WAI, C.; DEL, B.C.; RODRIGUEZ, C.G.; SAI, H.; TOBIAS,: "c-Myc is an important direct target of Notchl in T-cell acute lymphoblastic leukemia/lymphoma", GENES DEV., vol. 20, 2006, pages 2096 - 2109
WIERSTRA, 1.; ALVES, J.: "The c-myc promoter: still MysterY and challenge", ADV CANCER RES, vol. 99, 2008, pages 113 - 333

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP3413045A4 (fr) * 2016-02-09 2019-09-18 Japanese Foundation For Cancer Research Marqueur pour diagnostic de tumeur hématopoïétique rare, procédé d'inspection, agent thérapeutique, et procédé de dépistage

Similar Documents

Publication Publication Date Title
Venkatesha et al. Sensitization of pancreatic cancer stem cells to gemcitabine by Chk1 inhibition
US9155723B2 (en) Anti-CXCR4 as a sensitizer to cancer therapeutics
JP2023017922A (ja) 少なくとも２つの非必須アミノ酸を欠くダイエタリー製品
US20210030703A1 (en) Use of caloric restriction mimetics for potentiating chemo-immunotherapy for the treatment of cancers
US20120270900A1 (en) Novel method of treatment
US20200248273A1 (en) Treatment of squamous cell carcinoma
US20220339184A1 (en) Compositions and methods to treat metastatic gastrointestinal cancer
US20240024281A1 (en) Methods and compositions for treating liver diseases
KR20170134462A (ko) Mdm2 저해제와 btk 저해제의 병용 치료법
WO2017140743A1 (fr) Procédés et compositions pharmaceutiques destinés au traitement du myélome multiple
KR20200112886A (ko) 암 환자의 치료에 유용한 오줌의 알칼리제
JP2013542965A (ja) 腫瘍の治療方法
ES2864681T3 (es) Tratamiento del cáncer hematológico refractario a un agente contra el cáncer
Zacharski Basis for selection of anticoagulant drugs for therapeutic trials in human malignancy
WO2015144636A1 (fr) Procédé de traitement de leucémies aiguës lymphoblastiques à lymphocytes t
JP7414230B2 (ja) 抗血液悪性腫瘍薬
US10265294B2 (en) Compositions and methods for treating epithelial cancer
Blaszczak Developing a model of acid-driven evolution for Pancreatic Ductal Adenocarcinoma (PDAC)
WO2023209625A1 (fr) Compositions et méthodes de traitement du cancer
WO2015127227A1 (fr) Utilisations de flagelline pour améliorer la chimiothérapie
WO2023196560A1 (fr) Méthodes de traitement du cancer
WO2023118165A1 (fr) Méthodes et compositions de traitement d&#39;un mélanome
WO2023196565A1 (fr) Méthodes de traitement du cancer
Valter Mitochondria Targeting and Its Consequences for Cell Death in Neuroblastoma
JP2020045319A (ja) 血液がんの予防及び／又は治療剤

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 15711224

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 15711224

Country of ref document: EP

Kind code of ref document: A1