WO2015125849A1 - METHOD FOR MASS-PRODUCING BACTERIOCHLOROPHYL b, AND PRODUCING STRAIN - Google Patents

Abstract

　Provided is a bacteriochlorophyl b-producing variant obtained by deleting the bciA gene and bchY and/or bchZ gene inherent to a photosynthetic bacterium which produces bacteriochlorophyl a, and performing a manipulation so as to express the bchY and bchZ genes derived from photosynthetic bacterium that produce bacteriochlorophyl b or bacteriochlorophyl g. Also provided is a method for producing bacteriochlorophyl b, which entails culturing said variant in a culture, and recovering bacteriochlorophyl b from the culture obtained.

Description

Mass production method of bacteriochlorophyll b and producing bacteria

The present invention relates to a recombinant bacteriochlorophyll b high-producing bacterium, a method for producing the same, and a method for mass production of bacteriochlorophyll b using the high-producing bacterium.

In order to expand the use of renewable energy, it is necessary to proceed with the introduction of solar power generation. To that end, it is important to reduce the cost and mass production of solar cells. However, high-purity silicon, which is the current raw material for solar cells, is expensive and has a problem in securing its stability in Japan.
As a next-generation solar cell that replaces a silicon solar cell, a dye-sensitized solar cell that uses photo-induced electron transfer of a dye similar to the initial process of photosynthesis has attracted attention. So far, in addition to those using artificial porphyrins as sensitizing dyes, dye-sensitized solar cells using natural chlorophyll a derivatives have been reported. However, in order to increase the light energy conversion efficiency, it is desired to extend the absorption wavelength to a longer wavelength near infrared region.

Bacteriochlorophyll (BChl) is a name given to tetrapyrroles found in non-oxygen-producing photosynthetic bacteria. There are 7 types from a to g, and 6 types except BChl f so far. It is found from nature. Among these, BChl a, BChl b and BChl g have a bacteriochlorin skeleton in which the CC double bond at the β-position of both the B and D rings of the tetrapyrrole ring is reduced to a single bond. BChl a and BChl b are present in red photosynthetic bacteria and BChl g are present in heliobacteria, and form non-covalent bonds with oligopeptides to form dye-protein complexes.
The absorption spectrum of (bacterio) chlorophyll has four absorption bands from the long wavelength side: Qy, Qx, By, and Bx (By and Bx bands are collectively referred to as the Soray band), but BChl a / has a bacteriochlorin skeleton. In b / g, the Qy band is greatly shifted in the near infrared region by a longer wavelength than BChl c / d / e and chlorophyll having a chlorin skeleton. In particular, BChl b has a longer wavelength shift in the Qy band than BChl a due to the presence of the ethylidene side chain at the C8 position. Therefore, BChl b, bacteriochlorophyllide b (BChlide b) from which the long-chain hydrocarbon group in the propionate residue on the 17th position is removed, bacteriopheophytin b (BPhe b) and bacteriopheophore from which the central metal is eliminated. If bide b (BPheoide b) can be supplied at low cost and in large quantities, it is useful for the production of optical devices with improved light energy conversion efficiency.

In BChl a-producing bacteria, 8-vinyl chlorophyllide a (8V-Chlide a) is reduced to ethyl group by the action of 8-vinyl reductase (or divinyl reductase, called DVR). a (Chlide a) is generated. Next, from Chlide a, chlorophyllide a oxidoreductase (COR) consisting of three proteins, BchX, BchY and BchZ, turns the double bond at the C7-8 position of the B ring into a single bond. Bacteriochlorophyllide a (3V-BChlide a) is produced (Non-patent Document 1), and the C3 position is acetylated by the action of 3-vinyl bacteriochlorophyllide hydratase (BchF) and 3-hydroxyethylbacteriochlorophyllide dehydrogenase (BchC). After being converted to BChlide a, a long-chain hydrocarbon group is added to the propionate residue at position 17 by the action of BchG to generate BChl a.
On the other hand, there is no DVR in BChl b and BChl g producing bacteria, and BchX / Y / Z (COR) reduces the conjugated diene of the B ring of the chlorin ring of 8V-Chlide a by 1,4 addition and reduces the bacterio BChlide g, which is a precursor of BChl b and BChl g, is produced directly from 8V-Chlide a by catalyzing the reaction of providing an ethylidene group at the C8 position of the chlorin ring (Patent Document 1). In BChl b-producing bacteria, BChF and BchC act to acetylate the C3 position of BChlide g to produce BChlide b, and then BchG acts to produce BChl b, as in BChla-producing bacteria. BchF / BchC does not exist in BChl g-producing bacteria, and BChl g is produced from BChlide g by the action of BchG.

Many species belonging to the red photosynthetic bacteria produce BChl a, whereas those that produce BChl b are rare, and all of the currently known BChl b-producing bacteria are slow growing under anaerobic conditions However, since it can only grow and genetic manipulation is impossible, a technique for easily mass-producing BChl b has not yet been established.

JP 2014-003938 A

Therefore, an object of the present invention is to provide a BChl b high-producing bacterium, and to provide a method for mass-producing BChl b using the bacterium.

The inventors of the present invention have proposed that the reaction from BChlide g to BChl b in BChl b-producing bacteria is the same as the reaction from 3V-BChlide a to BChla in BChla-producing bacteria, as well as the acetyl group of the C3-vinyl group by BchF and BchC. Focusing on the conversion to the C17-propionate group by BchG and the addition of a long-chain hydrocarbon group, it grows quickly, can grow even in dark (slight) aerobic conditions, and is easy to culture And BchX / Y / Z (hereinafter referred to as “BvCOR”) derived from BChl b producing bacterium Blastochloris viridis and Rhodobacter sphaeroides It was tried whether BChlb could be produced by expressing. However, it alone did not lead to production of BChlb (FIG. 2). Several hypotheses were conceivable as the reason, but the present inventors originally found that R. spheroides was originally endogenous to R. spheroides rather than the reaction that produced BChlide g from 8V-Chlide a by the action of BvCOR. The reaction that generates Chlide a from 8V-Chlide a is overwhelmingly dominant due to the action of DVR, so BchX / Y / Z (hereinafter referred to as “RsCOR”) in R. sphaeroides using the generated Chlide a as a substrate. It was predicted that only BChl a would still be produced by the action of (also called).
Then, next, the bciA gene encoding the enzyme BciA having the DVR activity inherent in R. spheroides was deleted, but mass production of BChlb was not achieved. In R. sphaeroides, the bciA (rsp_3070) gene and the bchJ gene that is thought to be responsible for the reduction of 8V-Chlide a to Chlide a in the BChla-producing bacterium Rhodobacter capsulatus belonging to the same genus as R. spheroides In addition to BciA and BchJ, the bacterium has a third enzyme that can reduce 8V-Chlide a to Chlide a. It has been suggested (Canniffe, DP et al., Biochem. J., 450: 397-405 (2013)) that the present inventors confer the ability to produce BChlb to R. sphaeroides. I thought that at least this unknown enzyme gene needs to be destroyed.
When the present inventors contact BchX / Y / Z (hereinafter also referred to as “RcCOR”) derived from R. capsulatus with 8V-Chlide a that should not be a substrate, surprisingly, Chlide a and 3V -I found that BChlide a generates. This indicates that RcCOR can catalyze not only the reaction that produces 3V-BChlide a from Chlide a but also the reaction that reduces 8V-Chlide a to Chlide a. Based on such findings, the present inventors predicted that an unknown enzyme having DVR activity inherent in R. sphaeroides is RsCOR, and attempted to destroy a gene encoding a constituent protein of RsCOR. Specifically, the BchYZ component of RsCOR was inactivated by deleting the endogenous bchZ gene in R. sphaeroides, and the BchY and bchZ genes derived from B. viridis were introduced instead.
As a result, the bciA and bchZ genes endogenous to R. sphaeroides were deleted, and the Bch viridis-derived bchY and bchZ genes were introduced to successfully produce recombinant bacteria producing large amounts of BChl b. .
(1) The reason that BChl b could not be produced simply by expressing BvCOR in a wild strain of R. spheroides is that BchF and BchC endogenous to R. spheroides are not able to produce BChlide g or 3-hydroxyethylbacteriochlorophyllide b. (For example, R. sphaeroides 2.4.1 and BChl b producing bacterium, Thioflaviococcus mobilis), whose genome sequence is already known. BchF and BchC show 71% / 80% and 56% / 69% amino acid identity / similarity respectively, but 80% / 90%, 70% / 75% and 65% / 77% respectively. COR with BchX, BchY and BchZ showing high amino acid identity / similarity shows different substrate specificity between both species);
(2) BchJ, which is known to have DVR activity, was not deleted in the same genus R. capsulatus;
(3) Only BchY and BchZ were replaced with proteins derived from B. viridis, and BchX was used as it was in R. sphaeroides;
In consideration of uncertain factors such as the above, it is possible to confer high production capacity of BChl b to R. sphaeroides only by the above-mentioned genetic manipulation (deletion of the endogenous bciA gene and bchZ gene and introduction of the bchYZ gene derived from B. viridis). This was surprising and surprising, even for those skilled in the art.
As a result of further studies based on these findings, the present inventors have completed the present invention.

That is, the present invention provides the following.
[1] In a photosynthetic bacterium that produces bacteriochlorophyll a, it lacks the endogenous bciA gene and bchY and / or bchZ gene, and expresses bchY and bchZ genes derived from a photosynthetic bacterium that produces bacteriochlorophyll b or bacteriochlorophyll g. Bacteriochlorophyll b producing mutants, engineered as follows.
[2] The mutant strain according to the above [1], wherein the photosynthetic bacterium producing bacteriochlorophyll a is a bacterium belonging to the genus Rhodobacter.
[3] The mutant strain of [2] above, wherein the bacterium belonging to the genus Rhodobacter is Rhodobacter spheroides or Rhodobacter capsulatus.
[4] The mutant strain of [2] above, wherein the bacterium belonging to the genus Rhodobacter is Rhodobacter spheroides.
[5] The mutant strain according to any one of the above [1] to [4], which is engineered to express bchY and bchZ genes derived from Blast chloris viridis.
[6] BciA gene and bchY and / or bchZ gene inherent in photosynthetic bacteria producing bacteriochlorophyll a are deleted, and bchY and bchZ genes derived from photosynthetic bacteria producing bacteriochlorophyll b or bacteriochlorophyll g are expressed. And a method for producing a bacteriochlorophyll b-producing mutant strain, which comprises manipulating the bacterium.
[7] A method for producing bacteriochlorophyll b, comprising culturing the mutant strain according to any one of [1] to [5] in a medium and recovering bacteriochlorophyll b from the obtained culture.

According to the present invention, BChl b or a derivative thereof in which the Qy band is in the near-infrared region having a longer wavelength can be provided easily and in large quantities, and thus functional dyes having a changed light absorption band are used industrially. It becomes possible to do.

It is a figure which shows BChl a biosynthesis pathway (upper) in BChl a producing bacteria R. spheroides and BChl b biosynthesis pathway (lower) in BChl b producing bacteria B. viridis. It is a figure which shows the HPLC analysis result of the pigment | dye which the mutant strain which introduce | transduced the bchYZ gene derived from B. cocoon viridis into the wild strain (upper) and bciA / bchZ gene deletion mutant strain (middle) of R. The bottom shows the pigment (BChl b) produced by the wild strain of B. pylori.

In the photosynthetic bacterium producing BChl a, the endogenous bciA gene and bchY and / or bchZ gene are deleted, and bchY and bchZ genes derived from photosynthetic bacteria producing BChl b or BChl g are expressed. An engineered BChlb producing mutant is provided.
In the present invention, the strain used as a parent strain for genetic manipulation is a photosynthetic bacterium capable of producing BChla, which grows quickly, can grow under dark (slight) aerobic conditions, and can be genetically manipulated. There is no particular limitation as long as it is correct. Examples of BChl a-producing bacteria include R. spheroides, R. capslatas, Rhodospirillum photometricum, Rhodopseudomonas palustris, Thiocapsa marina, Thiocapsa marina, Allochromatium chromium vinosum) and the like, but is not limited thereto. BChla-producing bacteria include, for example, ATCC, CAUP, CCAP, CCMP, CCCM, CGCCCC, CSIRO, DSMZ, Kagawa Prefectural Fisheries Experiment Station, Akashi Research Institute, Kobe University Seaweed Collection (KU-MACC), National Institute for Environmental Studies It can be obtained from culture collections of photosynthetic organisms, such as the Microbiology Preservation Facility (NIES) and the Biotechnology Center (NBRC) of the National Institute of Technology and Evaluation (NITE). For example, R. spheroides (NBRC 12203, 100037 and 100038) and R. Capslatas (NBRC 16435 and 16581) are registered in NBRC (URL: http://www.nbrc.nite.go.jp/NBRC2 / NBRCCatalogueSearchServlet)
BChla-producing bacteria that can grow under microaerobic conditions and can be genetically modified are preferably R. spheroides, R. capsulatus, Rps. Pulstris, etc., more preferably R. spheroides and R. capsulatus, particularly preferably R. Spheroides is mentioned.
If BChl a-producing bacteria, such as R. spheroides and R. capsulatus, have not established an efficient natural transformation / electroporation system, and if gene transfer is performed by conjugative transfer via E. coli, donor / In order to facilitate removal of the helper E. coli, it is preferable to use a rifampicin-resistant BChla-producing bacterium. Rifampicin resistant bacteria can be easily obtained by, for example, seeding BChla-producing bacteria on a solid medium containing 100 μg / ml rifampicin and picking up naturally occurring resistant colonies.

The “bciA gene” to be deleted in the present invention is a gene having a coding region (cds) consisting of the nucleotide sequence shown in SEQ ID NO: 1 isolated from the R. sphaeroides genome (the amino acid encoded by the cds) The sequence is shown in SEQ ID NO: 2), as well as its orthologs in other BChla producing bacteria. The bciA genes of R. sphaeroides 2.4.1 strain and R. capsulatus SB1003 strain whose entire genome sequences have been decoded are listed in the NCBI database as Gene ID: 552536492 (positions 111258-112292 (complementary strand) of NC_007494.2); locus tag : RSP_3070), and Gene ID: 294675557 (NC_014034.1, positions 3460325-3461290 (complementary strand); locus tag: RCAP_rcc03260), and those skilled in the art can easily obtain the genome sequence information of the gene and its upstream and downstream regions. Can be obtained. For the bciA gene of BChla-producing bacteria whose genome sequence has not been decoded, the genome sequence is decoded by a conventional method, and then the Blast search is performed on the obtained genome sequence using the nucleotide sequence shown in SEQ ID NO: 1 as a query. Can be identified. The Blast search can be performed, for example, under the following conditions (expected value = 10; allow gap; matrix = BLOSUM62; filtering = OFF). As a result of the Blast search, a gene encoding an amino acid sequence having a similarity of about 70% or more, preferably about 80% or more with the amino acid sequence shown in SEQ ID NO: 2 can be estimated as the bciA gene of the strain. . Confirmation that the hit gene is the bciA gene is, for example, whether 8V-Chlide a is brought into contact with a recombinant protein obtained by introducing an expression vector containing the gene into Escherichia coli to produce Chlide a. Can be done by examining.
Based on the nucleotide sequence information of the bciA gene thus obtained, an appropriate oligonucleotide was synthesized as a primer, and a genomic DNA fraction prepared from a BChla-producing bacterium was used as a template. The target bciA gene can be amplified by “PCR method”.
The nucleotide sequence of the DNA obtained as described above can be determined using a known sequence technique such as the Maxam-Gilbert method or the dideoxy termination method.

The “bchY gene” to be deleted in the present invention is a gene having a coding region (cds) consisting of the nucleotide sequence shown in SEQ ID NO: 3 isolated from the R. sphaeroides genome (the amino acid encoded by the cds) The sequence is shown in SEQ ID NO: 4), as well as its orthologs in other BChla producing bacteria. The bchY genes of R. spheroides 2.4.1 strain and R. capsulatus SB1003 strain whose entire genome sequence has been decoded are respectively listed in the NCBI database as Gene ID: 552535527 (1984719-1986227 positions of NC_007493.2 (complementary strand); locus tag : RSP_0261), and Gene ID: 294675557 (No. 759425-760918 in NC_014034.1; locus tag: RCAP_rcc00688). Those skilled in the art can easily obtain the genome sequence information of the gene and its upstream and downstream regions. Can do. For the bchY gene of BChla-producing bacteria whose genome sequence has not been decoded, the genome sequence is decoded by a conventional method, and then the Blast search is performed on the obtained genome sequence using the nucleotide sequence shown in SEQ ID NO: 3 as a query. Can be identified. The Blast search can be performed, for example, under the following conditions (expected value = 10; allow gap; matrix = BLOSUM62; filtering = OFF). As a result of the Blast search, a gene encoding an amino acid sequence having similarity of about 70% or more, preferably about 80% or more with the amino acid sequence shown in SEQ ID NO: 4 can be estimated as the bchY gene of the strain. . Confirmation that the hit gene is the bchY gene can be performed, for example, by examining whether or not the BChla production ability is lost when the gene is deleted.
Based on the nucleotide sequence information of the bchY gene thus obtained, an appropriate oligonucleotide was synthesized as a primer, and a genomic DNA fraction prepared from BChla-producing bacteria was used as a template, and the target bchY was obtained by PCR. Genes can be amplified.
The nucleotide sequence of the DNA obtained as described above can be determined using a known sequence technique such as the Maxam-Gilbert method or the dideoxy termination method.

The “bchZ gene” to be deleted in the present invention is a gene having a coding region (cds) consisting of the nucleotide sequence shown in SEQ ID NO: 5 isolated from the R. sphaeroides genome (the amino acid encoded by the cds) The sequence is shown in SEQ ID NO: 6), as well as its orthologs in other BChla producing bacteria. The bchZ genes of R. sphaeroides 2.4.1 strain and R. capsulatus SB1003 strain whose entire genome sequences have been decoded are listed in the NCBI database as Gene ID: 552535527 (NC_007493.2 at positions 1983244-1984719 (complementary strand); locus tag : RSP_0260) and Gene ID: 294675557 (positions 760918-762390 of NC_014034.1; locus tag: RCAP_rcc00689), and those skilled in the art can easily obtain the genome sequence information of the gene and its upstream and downstream regions. Can do. For the bchZ gene of BChla producing bacteria whose genome sequence has not been decoded, the genome sequence is decoded by a conventional method, and then the Blast search is performed on the obtained genome sequence using the nucleotide sequence shown in SEQ ID NO: 5 as a query. Can be identified. The Blast search can be performed, for example, under the following conditions (expected value = 10; allow gap; matrix = BLOSUM62; filtering = OFF). As a result of the Blast search, a gene encoding an amino acid sequence having about 70% or more, preferably about 80% or more similarity to the amino acid sequence shown in SEQ ID NO: 6 can be estimated as the bchZ gene of the strain. . Confirmation that the hit gene is the bchZ gene can be performed, for example, by examining whether or not the BChla production ability is lost when the gene is deleted.
Based on the nucleotide sequence information of the bchZ gene thus obtained, an appropriate oligonucleotide was synthesized as a primer, and a genomic DNA fraction prepared from a BChla-producing bacterium was used as a template. Genes can be amplified. In many photosynthetic bacteria, the bchY gene and the bchZ gene are close to each other and partially overlap. In that case, both genes (may be referred to as bchYZ gene) may be cloned together. .
The nucleotide sequence of the DNA obtained as described above can be determined using a known sequence technique such as the Maxam-Gilbert method or the dideoxy termination method.

“Deleting an endogenous gene” in a BChl a-producing bacterium means that complete mRNA cannot be produced by destroying or removing the gene. As a specific means for deleting an endogenous gene, a target gene (genomic DNA) 由来 derived from a target BChl a-producing bacterium is isolated according to a conventional method.For example, (1) コ ー ド its coding region (cds) or other DNA in the promoter region Insert a fragment (e.g., drug resistance gene or reporter gene) cd to destroy the function of cds or promoter, or (2) cut out all or part of the target gene and delete the gene (e.g., drug (3) Insert a stop codon in cds to disable complete protein translation, or (4) DNA that terminates gene transcription into the transcription region By inserting a sequence (terminator sequence) に す る and disabling the synthesis of complete mRNA, the resulting DNA strand を (hereinafter referred to as a terminator) having a DNA sequence constructed to inactivate the gene. Tsu the computing vector and abbreviated), may a scheme of incorporated target locus of interest BChl a producing bacteria is used by homologous recombination. Preferably, a drug resistance gene is inserted into cds to destroy the target gene, or all or part of the target gene is replaced with a drug resistance gene.

As the drug resistance gene, kanamycin resistance gene, streptomycin resistance gene, spectinomycin resistance gene, gentamicin resistance gene, chloramphenicol resistance gene, erythromycin resistance gene and the like can be used. For example, as the kanamycin resistance gene, the neo gene contained in pUCKM1 (J. Biol. Chem., 266 (20): 12889-12895 (1991)) is used as the streptomycin and spectinomycin resistance gene, pHP45Ω (Gene, 29: 303-313 (1984)), pSRA2, pSRA81 Method (Methods Mol. Biol., 274; 325-340 2004 (2004)) a, the aadA gene is pMS255, pMS266 (Gene, 162: 37 -39 (1995)), the aacC1 gene contained in, erythromycin resistance gene and chloramphenicol resistance gene, ermC gene and cat gene contained in pRL409 (Gene, 68: 119-138 (1988)) It is done. These genes can be excised from the plasmid with an appropriate restriction enzyme, or can be amplified by PCR using the plasmid as a template and the upstream and downstream regions of these genes as primers.

For details on the construction of a targeting vector in which a drug resistance gene is inserted into cds of a target gene or all or part of the target gene is replaced with a drug resistance gene, see, for example, MethodsMethodin Enzymology, 497: 519-538 (2011) However, the method is not limited thereto, and a method well known in the technical field can be used as appropriate.

By introducing the above targeting vector into the target BChl a-producing bacterium, the vector can be incorporated into the target locus of the target BChl a-producing bacterium by homologous recombination. The gene transfer method is not particularly limited as long as it is a method applicable to the target BChl a-producing bacterium, and any method known per se (for example, natural transformation method, electroporation method, etc.) may be used. In the case of R. sp. Ferroides and R. capsulatus, selection of homologous recombinants using gene transfer by conjugation transfer and drug selection using a suicide vector is a preferred embodiment. Methods in Enzymology, 497: 519-538 (2011)).

Hereinafter, a preferred method for producing a deletion mutant by homologous recombination of bciA gene and bchY and / or bchZ gene when R. spheroides or R. Capsulatas is used as a BChl a-producing bacterium will be specifically described.

By treating the bciA gene isolated as described above (or bchY and / or bchZ gene (hereinafter sometimes abbreviated as bchY / Z gene)) with an appropriate restriction enzyme, the gene is treated in cds. A sequence homologous to the target enzyme gene at both ends of the inactivated enzyme gene by cutting or excluding a part of the gene and inserting the drug resistance gene isolated as described above. Construct a cassette containing Different drug resistance genes are inserted into the bciA gene and the bchY / Z gene, respectively. The obtained cassette is obtained by using an appropriate suicide gene (for example, sacB gene derived from Bacillus subtilis (producing a fructose polymer that inhibits the growth of Gram-negative bacteria)) and the origin of replication of the donor E. coli (eg, colE1 Etc.) but is inserted into a vector (suicide vector) that cannot be replicated by the recipients R. spheroides or R. capsulatus to construct a targeting vector. Subsequently, donor E. coli is transformed with the targeting vector by a conventional method.

Transformation of R. sphaeroides and R. Capsulatus (introduction of targeting vector) is performed by conjugating with E. coli (donor E. coli containing the targeting vector, helper E. coli that induces conjugation, and recipients such as R. Spheroides and R. Capsulatus. Or a parental transformant (donor E. coli) obtained by introducing the target expression vector into Escherichia coli having the ability to transfer conjugation with R. Spheroides or R. Capsulatus. There are no particular limitations on the donor Escherichia coli in the triple parental conjugation, and a normal strain such as JM105 may be used, such as XL1-Blue, DH5, and C600 having the helper plasmid pDPT51. On the other hand, examples of Escherichia coli having conjugation transmission ability used for double parental joining include, (Bio / Technology, 1: 784-791 (1983)) The conjugation of donor Escherichia coli with the recipients R. Spheroides and R. Capsulatus (additional E. coli in the case of triple parental joining) is known per se. (For example, see Cryogenic Science, 67: 選 択 649-653 (2009)) If the recipient is given rifampicin resistance, for example, it can be easily done by selecting on rifampicin-containing medium. Contamination of donor and helper E. coli can be prevented.

A transformant can be obtained by culturing a bacterial cell into which a targeting vector has been introduced on a solid medium containing a drug and selecting resistant colonies. As the medium used here, any medium suitable for the growth of the target BChla-producing bacterium can be used. For example, a medium recommended by a culture collection that stores BChla-producing bacteria can be used. Specifically, for example, when the BChla-producing bacterium is R. spheroides or R. capsulatus, medium No. 802 (available from Wako Pure Chemical Industries) listed in the medium information of online catalog search provided by NBRC Examples include Medium No. 360 (SA medium). Alternatively, PYS medium (1% polypeptone, 0.5% yeast extract, 1% sodium chloride; J. Mol. Evol., 45 (2): 131-136 (1997)) is also preferably used. The concentration of the selective agent added to the medium varies depending on the type of antibiotic and the type of strain.For example, in the case of R. sphaeroides 2.4.1, 25 μg / mL kanamycin, 10 μg / mL gentamicin, 50 μg, respectively. / mL Streptomycin, 50 μg / mL spectinomycin can be added to the medium to a final concentration. It is desirable to start the drug selection by plating the cells on a selective medium after culturing in a non-selective medium for about 1 to 3 days from the gene transfer treatment. Cultivation is usually carried out at a temperature of 20-40 ° C., preferably 25-30 ° C., in a dark (slight) aerobic condition.
When the targeting vector is inserted into the target enzyme gene on the genome by one homologous recombination, it becomes drug resistant by the expression of the drug resistance gene and can grow on the drug-containing medium. However, since the suicide gene is also inserted into the genome, for example, when the sacB gene is used, this insertion mutant cannot grow in the presence of 10% sucrose. Only when a defective enzyme gene into which a drug (antibiotic) resistance gene is inserted remains in the genome and the sacB gene is excised from the genome by the second homologous recombination (the suicide vector is autonomously replicated in the recipient) The strain can grow in the presence of drugs (antibiotics) and sucrose.

Usually, resistant colonies are obtained in about 1-2 weeks from the start of selection. It can be confirmed by genomic PCR and / or sequence analysis of the target gene region that the obtained resistant clone is a homologous recombinant (bciA gene (bchY / Z gene) -deficient mutant).
By carrying out the above operation for each of the bciA gene and the bchY / Z gene, homologous recombination mutants lacking these genes can be obtained.
The obtained mutant strain can be cryopreserved (−70 or 80 ° C. or lower) in a medium containing 5% DMSO or 15% glycerol.

When gene transfer by conjugation transfer is low in efficiency and homologous recombinants cannot be obtained successfully, a gene disruption method using phage-like particles called GTA can be used. For example, using a mutant strain of G. overcapillus (eg, R121, Y262, CB1127) of R. Capsulatas and introducing a targeting vector into the mutant strain by conjugation with E. coli, a large amount of GTA accumulates in the medium. Some of these have cut out targeting vectors and incorporated them into the particles. Therefore, when this culture filtrate is brought into contact with the recipient's R. Capsulatus, the targeting vector is introduced from the GTA into the recipient cell, and homologous recombination is induced, so that the target gene is efficiently targeted to the target locus. be able to.

The introduction of bchY and bchZ genes derived from BChl b or BChl g-producing bacteria into BChl a-producing bacteria can be performed as follows.

In the present invention, the photosynthetic bacterium from which the bchY and bchZ genes introduced into BChl a-producing bacteria are derived is not particularly limited as long as it produces BChl b or BChl g. Examples of BChl b-producing bacteria include Blastochloris viridis, Thioflavicoccus mobilis, Thiococcus pfennigii, Thioalkalicoccus limnaeus, Thioalkalicoccus ブ ラ limnaeus, Phobilis (Blastochloris sulfoviridis), Halorhospira halochloris (Halorhodospira halochloris) and the like, and BChl g producing bacteria, for example, Heliobacterium modesticaldum, Heliobacterium chlorum (Heliobacterium chlorum), Examples include Heliobacterium gestii, Heliophilum fasciatum, and Heliobacillus mobilis. Preferably, B. viridis, T. mobilis, H. modern dam, more preferably B. viridis-derived bchY and bchZ genes can be used.

Cloning of enzyme genes is usually performed by the following method. First, the enzyme is completely or partially purified from a cell or tissue that produces the desired enzyme, and its N-terminal amino acid sequence is determined using the Edman method or mass spectrometry. In addition, the amino acid sequence of an oligopeptide obtained by partially decomposing the enzyme with a protease or chemical substance that cleaves the peptide in a sequence-specific manner is similarly determined by Edman method or mass spectrometry. An oligonucleotide having a nucleotide sequence corresponding to the determined partial amino acid sequence is synthesized, and this is used as a probe from a cDNA or genomic DNA library prepared from a cell or tissue producing the enzyme. ) The DNA encoding the enzyme is cloned by a hybridization method.
Alternatively, an antibody against the enzyme is prepared according to a conventional method using all or part of the completely or partially purified enzyme as an antigen, and the antibody is prepared from a cDNA or genomic DNA library prepared from a cell or tissue producing the enzyme. DNA encoding the enzyme can also be cloned by a screening method.
When the gene of an enzyme similar in enzymatic properties to the target enzyme is known, for example, the NCBI BLAST website (http://www.ncbi.nlm.nih.gov/BLAST/) is accessed and the known gene Search for a sequence homologous to the nucleotide sequence of the gene, create a probe as described above based on the hit nucleotide sequence, and clone the DNA encoding the enzyme by colony (or plaque) hybridization be able to. For example, in the case of B. viridis-derived BchY and BchZ consisting of the amino acid sequences shown in SEQ ID NOs: 8 and 10, respectively, 33% respectively at the amino acid level with B. ch. And BchZ (SEQ ID NOs: 12 and 14) derived from H. And 37% identity (similarities are 53% and 54%, respectively), so that a homology search with the nucleotide sequences of BchY and bchZ genes from B. viridis (SEQ ID NOs: 7 and 9) revealed that H. ORFs (SEQ ID NOs: 11 and 13) encoding BchY and BchZ on the genome of Rudeum can be found.
In addition, based on the hit nucleotide sequence, an appropriate oligonucleotide was synthesized as a primer, and a genomic DNA fraction prepared from BChl b / g-producing bacteria or a total RNA or mRNA fraction was used as a template for Polymerase Chain Reaction ( Hereinafter, it can also be directly amplified by “PCR method” or Reverse Transcriptase-PCR (hereinafter abbreviated as “RT-PCR method”).
The nucleotide sequence of the DNA obtained as described above can be determined using a known sequence technique such as the Maxam-Gilbert method or the dideoxy termination method.

The cloned DNA can be used as it is depending on the purpose, or after digestion with a restriction enzyme or addition of a linker as desired. The DNA may have ATG as a translation initiation codon on the 5 'end side and TAA, TGA or TAG as a translation termination codon on the 3' end side. These translation initiation codon and translation termination codon can be added using an appropriate synthetic DNA adapter.

Examples of large-scale expression vectors in R. Spheroides and R. Capsulatus include pJN3 and pJNY constructed from the broad host range vector pBBR1-MCS2 (Gene, 166: 175 (1995)) (Cryogenic Science, 67: 649- 653 (2009)). Both vectors control the expression of pucAB encoding a light-harvesting bacteriochlorophyll-binding protein, and have a cloning site downstream of the puc promoter that exhibits high transcriptional activity under anaerobic conditions, allowing insertion of DNA encoding the target protein. . Between the puc promoter and the cloning site, a 6xHN tag is inserted in pJN3 and a Strep tag is inserted in pJNY, facilitating purification of the expressed protein. In addition to the pBBR1-MCS2-derived kanamycin resistance gene, a streptomycin / spectinomycin resistance gene has been newly introduced as a drug resistance marker. Therefore, when pJN3 and pJNY are used as they are as expression vectors for introducing bchY and Z genes from BChl b / g-producing bacteria, bciA and bchY / Z gene-deficient mutants endogenous to BChl a-producing bacteria It is necessary to use a drug resistance gene other than the kanamycin resistance gene, streptomycin resistance gene, and spectinomycin resistance gene for selection. Alternatively, if a kanamycin resistance gene, streptomycin resistance gene, or spectinomycin resistance gene is used to create bciA and bchY / Z gene deletion mutants, other drug resistance genes (eg, gentamicin resistance gene) for pJN3 and pJNY Can be used.

An expression vector containing DNA encoding BchY or BchZ is, for example, excising a target DNA fragment from DNA encoding BchY or BchZ, and the DNA fragment is extracted from the above-mentioned large-scale expression vectors in R. Spheroides and R. Capsulatus. Can be produced by ligating downstream of the promoter. The DNAs encoding BchY and BchZ may be inserted into separate vectors, but it is desirable to insert both into a single vector. Since the bchY and bchZ genes are present in one operon on the genome of BChl b / g producing bacteria, by subcloning the genome sequence containing both the ORF encoding BchY and the ORF encoding BchZ into an expression vector, It can be designed to express BchYZ from a single promoter polycistronic.

The obtained expression vector containing the bchY gene and the bchZ gene can be introduced using an efficient gene transfer system depending on the BChl a-producing bacterium serving as the host, but the host is R. spheroides or R. Capsulatus. In this case, gene transfer by conjugation transfer is preferably used, as in the case of producing the bciA and bchY / Z deletion mutants. Specific methods are described in Cryogenic Science, 67: 649-653 (2009). When an expression vector containing a puc promoter such as pJN3 or pJNY is used, a strain in which the puc promoter is more strongly induced than a wild type strain, such as R. Capsulatus DB176, may be used as a recipient.

Transformants into which the bchY and bchZ genes derived from BChl b / g-producing bacteria have been successfully introduced can be selected by culturing on an appropriate drug-containing solid medium. As in the case of selecting the homologous recombinant, the culture is usually performed at a temperature of 20-40 ° C., preferably 25-30 ° C., in a dark (slight) aerobic condition. Usually, resistant colonies are obtained in about 1-2 weeks from the start of selection.
The obtained mutant strain can be cryopreserved (−70 or 80 ° C. or lower) in a medium containing 5% DMSO or 15% glycerol.

Which is the first of the deletion mutations in the endogenous bciA and bchY / Z genes by homologous recombination and the introduction of bchY and bchZ genes from BChl b / g producing bacteria (hereinafter sometimes abbreviated as bchYZ gene). May be implemented.

The bciA and bchY / Z gene-deficient / BChl b / g-producing bchYZ gene-introduced mutants derived from BChl a-producing bacteria thus obtained are deficient in endogenous BciA and BchYZ having DVR activity. However, 8V-Chlide a cannot be converted to Chlide a. Instead, 8V-Chlide a is converted to BChlide g by the action of BchYZ derived from BChl b / g producing bacteria. BChlide g is converted to BChlide b by the action of endogenous BchF and BchC, and further BChl b is produced by the action of intrinsic BchG (see Fig. 1). The long chain ester group on the C17 position is usually a farnesyl group, but may be a phytyl group, a geranylgeranyl group, a dihydrogeranyl group or a tetrahydrogeranyl group.

Therefore, the present invention also provides a method for producing BChl b, which comprises culturing the BChl b-producing mutant strain of the present invention in a medium and recovering BChl b from the resulting culture.
The BChl b production mutant can be cultured by the same method as used in the selection of the bciA and bchY / Z gene-deficient mutants, except that a liquid medium is used instead of the solid medium. Although it is not essential to add a selection agent used for selecting a gene-deficient / transgene-expressing mutant, it is desirable to add it to prevent the introduced drug resistance gene from falling off. However, the concentration of the selective agent may be lower than that used in the selective medium.

Extraction of BChlb from the BChlb-producing mutant strain of the present invention can be performed, for example, as follows, but any method known in the art can be used as well.
First, the cultured cells of the BChlb-producing mutant are collected by filtration or centrifugation. Under an anaerobic atmosphere in which nitrogen gas is passed, an acetone / methanol mixed solvent is added to the cells and stirred, and then the liquid phase is recovered, and the same extraction operation is repeated on the residue until no pigment is extracted. The obtained extract is collected, separated and washed with ether and water, and then the ether layer is dehydrated and washed with saturated brine, and further dehydrated by adding anhydrous sodium sulfate. The solvent is distilled off on a rotary evaporator. The residue can be stored frozen by filling with nitrogen gas, or can be stored frozen using diethyl ether or acetone as a solvent. In either case, the container is shielded from light. If light shielding, temperature control, and maintenance of anaerobic conditions are thoroughly implemented, yearly storage is possible.
The carotenoid dye is separated and removed from the dye obtained by the above extraction operation by column chromatography, recrystallization or the like, and BChlb is isolated and purified. Sepharose or cellulose can be used as the column, but Sepharose has a higher resolution. Since BChlb has low solubility in nonpolar solvents such as hexane, it can be easily isolated and purified by recrystallization.

Hereinafter, the present invention will be further described with reference to examples. However, the present invention is not limited to these examples.

Example 1 <Preparation of bciA / bchZ-deficient strain of R. sphaeroides as host>
By replacing most of the bciA and bchZ gene regions of R. sphaeroides with different drug resistance genes, bciA and bchZ gene-deficient mutants (hereinafter referred to as dA / Z strains) were obtained. The method is shown below.
R. sphaeroides 2.4.1 strain (FEBS Lett 580 (28-29): 6644-6648 2006) was added to the PYS agar medium (J Mol Evol 45 (2): 131-136 1997) containing the antibiotic rifampicin (100 μg / mL). ) To obtain colonies that spontaneously became rifampicin resistant. This was designated as R. spheroides J001 strain and the parent strain for transformation.
In order to delete the bciA gene region of R. sphaeroides J001 strain by homologous recombination by a genetic modification method, a plasmid for mutagenesis, pJSCbciAKm, was constructed as follows. Using the genomic DNA of R. sphaeroides J001 as a template, bciA-F primer (sequence: GGGCATATGCCCGAGACCGCCCCC (SEQ ID NO: 15)) and bciA-R primer (sequence: TTTT GAATTC TCTAGA ATCACGATTTCCGGGCGATCCTT (SEQ ID NO: 16), underline (GAATTC) PCR was performed using the EcoRI site (underlined (TCTAGA indicates XbaI site)) to obtain a 1.04 kbp DNA fragment containing the bciA gene [using KOD-Plus-DNA polymerase (TOYOBO, Japan)] . This fragment was treated with the restriction enzyme EcoRI and cloned into the SmaI and EcoRI sites of the cloning vector pUC118 (Takara, Japan) to obtain a pUCbciA plasmid. A DNA fragment containing the kanamycin resistance gene neo was obtained by treatment with HindIII and SmaI from pUCKM1 (J Biol Chem 266 (20): 12889-12895 1991), and the cut ends were blunted. On the other hand, the XhoI site inside the bciA gene of pUCbciA was cleaved with a restriction enzyme to make blunt ends. This plasmid fragment and the above neo gene fragment were ligated by a ligation reaction to obtain a pUCbciAKm plasmid. This pUC-bciAKm was treated with restriction enzymes SmaI and XbaI, and the DNA fragment containing the region where the neo gene was replaced with the majority of the bciA gene was converted into the SmaI and XbaI sites of the pJSC vector (Biochemistry 41 (37): 11211-11217 2002). To prepare pJSCbciAKm. pJSC is a suicide vector, and E. coli JM109 (λ-pir) strain was used for cloning. Since this vector has a sacB gene, it is possible to perform negative selection in the presence of shoe cloth. Furthermore, pJSC has a mobility site and can be transferred to the J001 strain by transforming it into the Escherichia coli S17-1 (λ-pir) strain capable of conjugation and then mating with the R. sphaeroides J001 strain. is there. Therefore, S17-1 (λ-pir) transformed with pJSCbciAKm was mixed with R. sphaeroides J001 strain for conjugation, spotted on PYS agar medium, and incubated at 30 ° C. overnight in the dark. The spots are then scraped off, suspended in PYS liquid medium, spread on PYS agar medium containing rifampicin (100 μg / mL), kanamycin (25 μg / mL), and 5% shoecloth, and at 30 ° C in the dark. Incubated. After 5-7 days, a colony of a strain lacking the bciA gene was obtained by homologous recombination. Confirmation of mutagenesis was performed by PCR using bciA-comf-F primer (sequence: CTGTGTCATGTGAGAGCTT (SEQ ID NO: 17)) and bciA-comf-R primer (sequence: CCAATGTCAACGATTTCCGG (SEQ ID NO: 18)). Further, the PCR amplification sequence was determined using a DNA sequencer ABI PRISM (registered trademark) 3100 Genetic Analyzer (Applied Biosystems, USA), and further mutagenesis was confirmed. The strain in which the mutation was confirmed was named dbciA.
In order to further delete the bchZ gene region from the R. sphaeroides dbciA strain, a plasmid for mutagenesis, pJSCbchZSm, was constructed as follows. First, the region containing the streptomycin resistance gene aadA was amplified by PCR using the pHH45Ω plasmid (Gene 29 (3): 303-313 1984) as a template. At this time, an aadA-F primer (sequence: CTGTTCGGTTCGTAAGCTGT (SEQ ID NO: 19)) and an aadA-R primer (sequence: CGTCGGCTTGAACGAATTGT (SEQ ID NO: 20)) were used. Next, bchYZ-F (sequence: ATGGCATCGCCGCCGACA (SEQ ID NO: 21)) and bchYZ-R (sequence: TAAGACTGACGCCACATGCT (SEQ ID NO: 22)) primer set was used for PCR using the genomic DNA of R. sphaeroides J001 strain as a template. A DNA fragment containing a part of the gene and the entire bchZ gene region was obtained. The fragment was cloned into the TA cloning site of T-vector pTA2 (TOYOBO, Japan) to obtain the pTA2bchYZ plasmid. In order to remove most of the inside of bchZ of this pTAbchYZ plasmid, inverse PCR using this plasmid as a template was performed using bciYZ-inf-FI primer (sequence: TCGTTCAAGCCGACG CGTAGAGGAGCATCCGGTT (SEQ ID NO: 23)) and bciYZ-inf-RI primer (sequence: TTACGAACCGAACAG AATGCAGCACCGAGGTCAC (SEQ ID NO: 24)) was used. The underlines of these primer sequences were designed to overlap with the sequences of the aadA-R and aadA-F primers, respectively, for subsequent In-Fusion cloning. Therefore, the PCR fragment amplified as a result and the fragment containing the aadA gene amplified with the above-mentioned aadA-F and aadA-R were obtained using In-Fusion (registered trademark) HD Cloning Kit (Clontech, USA). Ligation was performed to obtain the pTAbchYZSm plasmid. Using this pTAbchYZSm as a template, PCR was performed using the bchYZ-inf-FII primer (sequence: TCGAGCTCGGTACCC TATGAGGGCTCCGAGCTGA (SEQ ID NO: 25)) and bchYZ-inf-RII primer (sequence: CTCTAGAGGATCCCC ACCATGCCCTCCCGATTAAT (SEQ ID NO: 26)). Obtained a DNA fragment containing a region in which most of the bchZ gene was replaced. The underline of the bchYZ-inf-FII and bchYZ-inf-RII primer sequences was designed to overlap with the cut end region of the SmaI site at the multiple clone site of pJSC for subsequent In-Fusion cloning. Therefore, pJSC treated with SmaI and its PCR amplified DNA fragment were ligated by the reaction of In-Fusion kit to prepare pJSCbchYZSm. This pJSCbchYZSm was transformed into E. coli S17-1 (λ-pir), cultured, mixed with the R. sphaeroides dbciA strain for conjugation, and the bchZ gene was deleted as described above. At that time, for selection of colonies, a PYS agar medium containing rifampicin (100 μg / mL), streptomycin (50 μg / mL), and 5% shoe cloth was used. Confirmation of mutagenesis of the obtained colonies is performed by PCR using bchYZ-comf-F primer (sequence: GGCGATCCATCCCTTCTAC (SEQ ID NO: 27)) and bchYZ-comf-R primer (sequence: TATCAGCCATGCTATCCTCC (SEQ ID NO: 28)). In addition, the PCR amplification sequence was determined and further mutation introduction was confirmed. The strain in which the introduction of the mutation was confirmed was named dA / Z.

Example 2 <Preparation method of expression vector pJN7 used for introduction of bchYZ gene of BChl b-producing bacterium B. viridis>
Two primers pPucf6 (5'-ata gtcgac ttcactgggattttgcgccc-3 (SEQ ID NO: 29)) and pJr6 (5'-tat ggtacc gatatcaGAGACCccgcGGTCTCggcgccgaccctatgcgactgcattctcgaactgcggtg) ) To obtain a DNA fragment. This DNA fragment contains the promoter Ppuc region and the BsaI restriction enzyme site (uppercase) for use in cloning. This fragment was treated with BamHI and SalI (underlined), and then an approximately 0.2 kbp fragment was purified (Wizard SV Gel and PCR Clean-Up System: Promega). Similarly, the broad host range vector pBBR1MCS2 (provided by Professor Carl E. Bauer, Indiana University) was treated with BamHI and SalI. The treated mixture was loaded onto a 1% agarose gel and run at 100 V for 1 hour to purify the approximately 5.3 kbp fragment. Wizard SV Gel and PCR Clean-Up System was used for DNA recovery from the agarose gel. PBBR1MCS2 contains a gene cassette that provides resistance to the antibiotic kanamycin as a marker gene. The fragment containing the obtained Ppuc sequence and the partial fragment of pBBR1MCS2 were mixed (mixing ratio = 4: 1), and both were ligated using DNA Ligation Kit Ver. 2 (Takara Shuzo Co., Ltd.) to obtain pJN6.
This pJN6 plasmid has a BsaI restriction enzyme site derived from pBBR1MCS2 in one place in addition to the BsaI restriction enzyme site used for cloning. To eliminate this, two primers; KOBsaI-f1 (5'-ttcaggcgctcccgaa gatccc gggccgtctcttgg-3 '(SEQ ID NO: 31)) and KOBsaI-r1 (5'-aagagacggccc gggatc ttcgggagcgc-3' (SEQ ID NO: 32)) Was used to amplify the entire region of pJN6 by PCR. This was designated as pJN7pre.
Next, using pJN3 plasmid as a template and two primers Spc2f1 (5'-ATA GAGCTCTAGA TAATGCAAGTAGCGTATGC-3 '(SEQ ID NO: 33)) and Spc2r1 (5'-ATA GAGCTCTAGA GCGGATGTTGCGATTACTTCG-3' (SEQ ID NO: 34)) Amplification was performed by PCR to obtain Spc2. This DNA fragment contains a gene cassette that confers resistance to the antibiotic spectinomycin / streptomycin. This fragment was purified after treatment with SacI (underlined) (Wizard SV Gel and PCR Clean-Up System). Similarly, the pJN7pre fragment obtained by treating and purifying the pJN7pre vector with SacI was mixed (mixing ratio). = 3: 1), DNA Ligation Kit Ver. 2 (Takara Shuzo Co., Ltd.) was used to link both together to obtain pJN7.
The completed pJN7 has been shown to be retained in E. coli and the red non-sulfur bacterium R. capsulatus. Cloning of the gene of interest into this vector utilizes the BsaI restriction enzyme site and can be selected using spectinomycin / streptomycin / kanamycin.

Example 3 <Preparation of R. sphaeroides mutant producing BChl b>
The bciA and bchZ gene-deficient mutant dA / Z obtained in Example 1 and the R. sphaeroides wild strain were grown in PYS medium under dark microaerobic conditions. Using these strains as hosts, bchY and bchZ genes derived from B. viridis were introduced.
B. Using the following primers, BvYZ-infu-F1 (sequence: CGAGAAGGGCGGCGCCAGGGCTGCCAGTTACGTTC (SEQ ID NO: 35)) and BvYZ-infu-R1 (sequence: CTGGGTACCGATATCTCACAGAGCCTGCCCCCCGACA (SEQ ID NO: 36)) using the viridis genome as a template, PCR, B. Bilidis-derived bchY and bchZ genes were amplified together (in photosynthetic bacteria, both genes usually overlap, and the start codon of the bchZ gene precedes the stop codon of the bchY gene). The amplified DNA fragment was excised from an agarose gel and purified using NucleoSpin Extract II kit (Macherey-Nagel, Duren, Germany). This purified DNA fragment containing the B. viridis bchYZ gene was subcloned into the Bsa I restriction site of the pJN7 plasmid prepared in Example 2 using the In-Fusion HD Cloning kit (Clontech, USA), and the plasmid pJ7-BvYZ was Obtained. In this plasmid, the Kpn I restriction site is located after the coding region of bchZ. The gentamicin resistance gene aacC1 was obtained from the plasmid pUCGM-star (Biotechniques, 15: 831-834 (1993)) with the following primers, Gm-JN7-F (sequence: CTGCGTGAGATATCGCAACTGGTCCAGAACCTTGA (SEQ ID NO: 37)) and Gm-JN7-R ( The sequence was amplified using GGGAACAAAAGCTGGAAGCTTGCATGCCTGCAGG (SEQ ID NO: 38)). The obtained PCR product containing the aacC1 gene and the Kpn I digested pJ7-BvYZ plasmid were ligated using the In-Fusion HD Cloning kit to obtain pJ7-BvYZ-Gm.
This plasmid was introduced into R. sphaeroides bciA and bchZ gene-deficient mutant dA / Z by three-parental conjugation using E. coli Tec5 strain (J Bacteriol. 1983; 154: 580-590 1983) containing a helper plasmid. . Transconjugant was selected on PYS solid medium (J Mol Evol 45 (2): 131-136 1997) containing rifampicin (100 μg / ml), kanamycin (25 μg / ml) and gentamicin (10 μg / ml) . The thus obtained transconjugate expressing B. viridis-derived BchYZ under the control of the puc promoter was named ΔbciA / bchZ + BvYZ.

Example 4 <BChlb production by R. sphaeroides ΔbciA / bchZ + BvYZ strain>
The R. sphaeroides ΔbciA / bchZ + BvYZ strain obtained in Example 3 and the strain obtained by introducing the B. viridis-derived bchYZ gene into the wild strain of R. spheroides were each cultured in PYS medium, and the culture solution was centrifuged. Each cell was collected and the pigment was extracted with acetone / methanol (7: 2, vol / vol). To an acetone / methanol solution of the dye mixture, an equal amount of a petroleum ether / diethyl ether mixture (1: 1, vol / vol) and then distilled water were added, and the ether phase was dried under reduced pressure by a stream of nitrogen gas.
The dried dye was then dissolved in HPLC solvent and subjected to HPLC analysis. HPLC measurement was performed using Cosmosil 5C18-AR-II column (4.6 × 150 mm; Nacalai Tesque, Kyoto, Japan) and methanol / water (96: 4; flow rate: 1.0 mL / min) as the mobile phase. As a control for the BChl b peak, the same measurement was performed on a pigment extracted from a wild strain of B. viridis. As a result, expression of BchYZ derived from B. viridis in the wild strain of R. sphaeroides did not lead to BChl b production, whereas expression of BchYZ from B. viridis was expressed in the R. sphaeroides dA / Z strain. (ΔbciA / bchZ + BvYZ strain) and BChl b could be produced in large quantities (FIG. 2).
BChlb could not be produced even when BchYZ derived from B. viridis was expressed in an R. sphaeroides dbciA strain lacking only the bciA gene.

According to the present invention, BChlb or a derivative thereof having a Qy band in the near-infrared region having a longer wavelength can be provided simply and in large quantities. BChl b or its derivative has the longest absorption wavelength maximum shifted to the near infrared region compared to other chlorin or bacteriochlorin compounds. By using this as a dye sensitizer, light energy conversion than before is possible. There is a possibility that a dye-sensitized solar cell excellent in efficiency can be provided.
In addition, cancer cells actively divide and proliferate and easily take up fat-soluble porphyrin compounds having a large π plane, so porphyrin compounds can be used to distinguish cancer cells from normal cells. Attempts have been made to use. However, there is a problem that visible light cannot reach the cancerous part because the living body pigment such as heme absorbs the part deep from the cell surface. BChlb or a derivative thereof has an absorption band in the near-infrared region of a longer wavelength, and thus is useful for deep cancer diagnosis.
Furthermore, it has been clarified that chlorophyll molecules also have an anticancer effect, and research is being conducted as photodynamic therapy. Therefore, BChlb or a derivative thereof having a strong absorption band in the near infrared region that is selectively adsorbed to cancer cells can be a useful tool for cancer treatment.
This application is based on Japanese Patent Application No. 2014-030085 filed in Japan (filing date: February 19, 2014), the contents of which are incorporated in full herein.

Claims (7)

1. Operate to express bchY and bchZ genes derived from photosynthetic bacteria that produce bacteriochlorophyll b or bacteriochlorophyll g and lack bciA and bchY and / or bchZ genes in photosynthetic bacteria that produce bacteriochlorophyll a A bacteriochlorophyll b-producing mutant.
2. The mutant according to claim 1, wherein the photosynthetic bacterium producing bacteriochlorophyll a is a bacterium belonging to the genus Rhodobacter.
3. The mutant according to claim 2, wherein the bacterium belonging to the genus Rhodobacter is Rhodobacter spheroides or Rhodobacter capsulatus.
4. The mutant according to claim 2, wherein the bacterium belonging to the genus Rhodobacter is Rhodobacter spheroides.
5. The mutant strain according to any one of claims 1 to 4, which has been engineered to express bchY and bchZ genes derived from Blast chloris viridis.
6. In order to express bchY and bchZ genes derived from photosynthetic bacteria that produce bacteriochlorophyll b or bacteriochlorophyll g, and that lack bciA gene and bchY and / or bchZ gene endogenous to the photosynthetic bacterium that produces bacteriochlorophyll a A method for producing a bacteriochlorophyll b-producing mutant, characterized by manipulating bacteria.
7. A method for producing bacteriochlorophyll b, comprising culturing the mutant strain according to any one of claims 1 to 5 in a medium and recovering bacteriochlorophyll b from the obtained culture.

Images