WO2015124138A1 - Antigènes associés à une tumeur et produits géniques dans le diagnostic et la thérapie - Google Patents

Antigènes associés à une tumeur et produits géniques dans le diagnostic et la thérapie Download PDF

Info

Publication number
WO2015124138A1
WO2015124138A1 PCT/DE2015/000077 DE2015000077W WO2015124138A1 WO 2015124138 A1 WO2015124138 A1 WO 2015124138A1 DE 2015000077 W DE2015000077 W DE 2015000077W WO 2015124138 A1 WO2015124138 A1 WO 2015124138A1
Authority
WO
WIPO (PCT)
Prior art keywords
expression
nucleic acid
tumor
agent
tumors
Prior art date
Application number
PCT/DE2015/000077
Other languages
German (de)
English (en)
Inventor
Dominik Kraus
Rainer Probstmeier
Jochen Winter
Original Assignee
Rheinische Friedrich-Wilhelms-Universität Bonn
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from DE102014002256.0A external-priority patent/DE102014002256A1/de
Priority claimed from DE102014011258.6A external-priority patent/DE102014011258A1/de
Application filed by Rheinische Friedrich-Wilhelms-Universität Bonn filed Critical Rheinische Friedrich-Wilhelms-Universität Bonn
Publication of WO2015124138A1 publication Critical patent/WO2015124138A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/158—Expression markers

Definitions

  • the invention relates to a pharmaceutical composition
  • a pharmaceutical composition comprising an agent which detects or inhibits the expression or activity of a tumor-associated antigen, and a method for the treatment and diagnosis of a tumor disease.
  • tumor cells differ biologically significantly from their non-malignant cells of origin.
  • tumor development can be attributed to the formation of qualitatively or quantitatively altered molecular structures in the cancer cells.
  • tumor-associated antigens stems from the fact that the recognition of antigens on cells that promote neoplasm of tumors can cause the elimination of cancer cells by the immune system. Accordingly, a central goal of tumor immunology is to define these structures molecularly. The molecular structure of many antigens has long been unrecognized. Only after the development of suitable cloning techniques, such as cDNA expression libraries of tumors, was it possible to systematically identify tumor-associated antigens by analysis of the target structures. For this purpose, cDNA expression libraries were prepared from fresh tumor tissue and expressed recombinantly as proteins.
  • Elimination (as part of therapeutic procedures) of tumor cells allows. This task is therapeutically by a pharmaceutical
  • a composition for inhibiting or inhibiting expression of a tumor-associated antigen wherein the tumor-associated antigen has a sequence selected from a nucleic acid selected from the group consisting of:
  • nucleic acid comprising a nucleic acid sequence derived from the
  • nucleic acid which can be added to the nucleic acid under (a), (b) or (c)
  • tissue areas such as in the intestinal, Lung, kidney, bladder, gastrointestinal, skin, brain, bone, breast,
  • Thyroid, ovarian, pancreatic, prostate, liver, lymphatic tissue Thyroid, ovarian, pancreatic, prostate, liver, lymphatic tissue.
  • these genes can activate tumor cells and, in addition, tumor growth in other tissues.
  • the invention relates to the possibility of identifying
  • the tumor-associated antigens identified according to the invention relate in particular to acrosin, ACRBP, CATSPER1, CATSPER2, CATSPER4, CATSPERB, CATSPERD, CATSPERG, CRISP3, FER1 L5, FER1 L6, FOLR4, GGN, GGNBP2, IZUMO1, PSG1, PSG2, PSG5, ROPN1L, SPAG6 , SPAG8, SPAG17, CRISP1, CRISP2, DYSF, MMP15, MMP16, MMP17, MMP20, MYOF, OTOF, SED-1, ZAN, ZP1, ZP2, ZP3.
  • genes are described which are selectively expressed in tumor cells and represent tumor-associated antigens. These genes or their derivatives, in particular nucleic acids, are preferred targets for therapeutic
  • the therapeutic approaches may target an inhibition of the activity of the selectively expressed tumor-associated gene product.
  • a nucleic acid is preferably deoxyribonucleic acid (DNA) or ribonucleic acid (RNA).
  • Nucleic acids according to the invention comprise genomic DNA, cDNA, mRNA, recombinantly produced and chemically
  • a nucleic acid can be used according to the invention as
  • nucleic acid it is meant that single or multiple nucleotide substitution, deletion and / or addition are present in the nucleic acid.
  • the term comprises a chemical derivatization of a nucleic acid on a nucleotide base, on the sugar or on the phosphate.
  • derivative also includes nucleic acids containing non-naturally occurring nucleotides and nucleotide analogs.
  • isolated nucleic acid means according to the invention that the nucleic acid (i) has been amplified in vitro, for example by polymerase chain reaction (PCR), (ii) (iii) was purified, for example by cleavage and gel electrophoretic separation, or (iv) was synthesized, for example by chemical synthesis.
  • PCR polymerase chain reaction
  • isolated nucleic acid is one
  • a recombinant DNA molecule according to the invention is a vector, optionally with a promoter, which promotes the expression of a nucleic acid, e.g. a nucleic acid encoding an antigen associated with a tumor of the invention.
  • a promoter which promotes the expression of a nucleic acid, e.g. a nucleic acid encoding an antigen associated with a tumor of the invention.
  • vector is used in its most general meaning. Vectors are preferably replicated and / or expressed in the cell. Vectors include plasmids, phagemids or viral genomes.
  • RNA or of RNA and protein are used according to the invention in its most general meaning and includes the production of RNA or of RNA and protein.
  • antisense molecule or “antisense nucleic acid” as used in the invention refers to an oligonucleotide which is an oligoribonucleotide, oligodeoxyribonucleotide, modified oligoribonucleotide or modified oligodeoxyribonucleotide according to the invention
  • proteins and polypeptides described in this invention may be in a substantially purified state.
  • substantially purified means that the protein or polypeptide is substantially free of other substances present in nature or in vivo. Such proteins and polypeptides are used, for example, for the production of
  • Proteins and polypeptides described in accordance with the invention can be isolated from biological samples and can also be expressed recombinantly in a variety of pro- or eukaryotic expression systems.
  • the present invention relates in general to the use of tumor-associated antigens identified in accordance with the invention or of parts thereof, nucleic acids coding therefor or nucleic acids directed against the coding nucleic acids or of antibodies directed against the tumor-associated antigens identified in accordance with the invention or parts thereof are directed for therapy and diagnosis.
  • the usage can be single, but also combinations of several of these
  • Antigens, functional fragments, nucleic acids, antibodies, etc. in one embodiment, but also in combination with other tumor-associated genes and antigens for diagnosis, therapy and follow-up.
  • Preferred diseases for therapy and / or diagnosis are those in which there is a selective expression or also abnormal expression of one or more of the tumor-associated antigens identified according to the invention.
  • the invention also relates to nucleic acids and gene products which are expressed associated tumor cells and caused by altered processing, for example, in the transcription or translation of known genes.
  • nucleic acids comprise the sequences according to identification numbers corresponding to page "http://www.ncbi.nlm.nih.gov/nuccore/":
  • ACR Homo sapiens acrosin; NM_001097.2.
  • ACRBP Homo sapiens acrosin binding protein; NM_032489.2.
  • CATSPER1 Homo sapiens cation channel, sperm associated 1 1; NM_053054.
  • CATSPER2 Homo sapiens cation channel, sperm associated 2; NM_172095.2.
  • CATSPER4 Homo sapiens cation channel, sperm associated 4; NM_198137.1.
  • CATSPERB Homo sapiens catsper Channel auxiliary subunit beta; NM_024764.2.
  • CATSPERD Homo sapiens catsper Channel auxiliary subunit delta; NM_152784.3.
  • CATSPERG Homo sapiens catsper Channel auxiliary subunit gamma; NM_021185.4.
  • CRISP3 Homo sapiens cysteine-rich secretory protein 3; NM_001190986.1.
  • FER1 L5 Homo sapiens fer-1-like 5; NM_001113382.1.
  • FER1 L6 Homo sapiens fer-1 -like 6; NM_001039112.2.
  • FOLR4 Homo sapiens folate receptor 4, delta; NM_001199206.1
  • GGN Homo sapiens gametogenin
  • GGNBP2 Homo sapiens gametgenin binding protein 2; BC137491.1.
  • IZUM01 Homo sapiens izumo sperm-egg fusion 1; NM_182575.2
  • PSG1 Homo sapiens pregnancy specific beta-1-glycoprotein; NM_001184825.1
  • PSG2 Homo sapiens pregnancy specific beta-1-glycoprotein 2; NM_031246.3
  • PSG5 Homo sapiens pregnancy specific beta-1-glycoprotein 5; NM_002781.3
  • ROPN1 L Homo sapiens rhophilin associated tail protein 1 -like; NM_031916.4.
  • SPAG6 Homo sapiens sperm associated antigen 6; CR533552.1.
  • SPAG8 Homo sapiens sperm associated antigen 8; NM_172312.1.
  • SPAG17 Homo sapiens sperm associated antigen 17; NM_206996.2.
  • DYSF Homo sapiens dysferlin; GenBank: AF075575.1.
  • ZP1 Homo sapiens zona pellucida glycoprotein 1; NM_207341.2
  • ZP2 Homo sapiens zona pellucida glycoprotein 2; NM_003460.1.
  • ZP3 Homo sapiens zona pellucida glycoprotein 3; NM_007155.5 ..
  • MYOF Homo sapiens myoferlin (MYOF); GenBank: AF182316.1.
  • OTOF Homo sapiens otoferlin (OTOF); NM_004802.3.
  • MMP15 Homo sapiens matrix metallopeptidase 15; NM_002428.2.
  • MMP16 Homo sapiens matrix metalloproteinase 16; NM_005941.4 1.
  • MMP17 Homo sapiens matrix metalloproteinase 17; NM_016155.4.
  • MMP20 Homo sapiens matrix metalloproteinase 20; NM_004771.3.
  • SED1 secreted protein containing EGF repeats and discoidin / F5 / 8.
  • ZAN Homo sapiens zonadhesin variant 1 (ZAN); GenBank: AF332975.1
  • gene products comprise sequences according to (SEQ ID NO: 1 to 36) of the sequence listing.
  • the antigens are according to the invention as targets for the
  • a variety of mechanisms may be causative, such as the use of variable transcription sites, the use of additional exons, the mutation altered regulatory sequences or the
  • Proteins / antigens can act as molecular markers for both the detection of
  • Tumor cells are used as well as for the therapeutic targeting of tumors.
  • radioactive or non-radioactive isotopes, photosensitizers, nanoparticles, radionuclides, enzymes or antibodies can be used for the detection.
  • the diagnosis and / or treatment of tumor cells for example in blood, serum, bone marrow, sputum, bronchial lavage, elaboratesekreten and tissue biopsies can be carried out according to the invention, for example, after extraction of nucleic acids by PCR amplification.
  • all sequence-dependent are suitable
  • Detection systems In addition to the PCR, these are e.g. Microarray systems, Northern blot, RNAse protection assays (RDA) and others. All detection systems have in common that the detection on a specific hybridization with
  • tumor cells can also be carried out according to the invention by antibodies which recognize a coded specific epitope.
  • composition of the invention for inhibiting or inhibiting the expression of a tumor-associated antigen may further comprise an agent or agent which recognizes the tumor-associated antigen identified according to the invention and is preferably selective for cells having a
  • the agent may, in certain embodiments as a diagnostic or therapeutic agent, be the induction of cell death, the reduction of the
  • Cell growth causing damage to the cell membrane or the secretion of cytokines and preferably has a tumor-inhibiting activity.
  • the agent is an antisense nucleic acid that selectively hybridizes to the nucleic acid encoding the tumor-associated antigen.
  • the agent is an antibody that selectively binds to the tumor-associated antigen, in particular a complement-activating or toxin-conjugated antibody that selectively binds to the tumor-associated antigen.
  • an anti-cytokine antibody in particular an anti-cytokine antibody. It is also according to the invention.
  • the agent comprises a plurality of agents, each of which selectively recognizes different tumor-associated antigens, wherein at least one of the tumor-associated antigens according to the invention
  • the agent is an antisense nucleic acid that selectively hybridizes to the nucleic acid encoding the tumor-associated antigen.
  • the agent is an antibody that selectively binds to the tumor-associated antigen.
  • the agent comprises a plurality of agents each selectively inhibiting the expression or activity of various tumor-associated antigens, wherein at least one of the tumor-associated antigens comprises a tumor-associated antigen identified in accordance with the invention
  • Antigen is.
  • a monoclonal, a chimeric or humanized antibody, a fragment of a natural antibody, or a synthetic antibody can be used.
  • the antibodies may be coupled to a therapeutically or diagnostically useful agent.
  • Therapeutic agents may according to the invention taxines, alkylating agents, colchicines, vinca alkaloids such as vinblastine and vincristine, bleomycin,
  • Anticancer agents include anticancer agents, radioactive iodine-containing compounds, toxins, cytostatic or cytolytic drugs, etc.
  • aminoglutethimide for example, aminoglutethimide, azathioprine, bleomycin sulfate, busulfan, carmustine, chlorambucil, cisplatin, cyclophosphamide, cyclosporin, cytarabidine, dacarbazine, dactinomycin, daunorubin, doxorubicin, taxol, etoposide, fluorouracil, interferon- ⁇ , lomustine, mercaptopurine, methotrexate, mitotane, procarbazine HCI, thioguanine and high energy emitting radionuclides such as cobalt-60, as well as mixtures of these agents.
  • Diagnostic agents may include, but are not limited to, barium sulfate, locetamic acid, lopanoic acid, calcium ipodate, sodium diatrizoate, meglumine diatrizoate, metrizamide, sodium tylopanoate and radiodiagnostics for the
  • Computed tomography including positron emitters such as fluorine-18 and carbon-11, gamma emitters such as iodine-123, technitium-99m, iodine-131 and indium-111, Nuclides, in particular nanoparticles for nuclear magnetic resonance such as fluorine, gadolinium, iron oxide, etc. include.
  • An antisense nucleic acid contained in a pharmaceutical composition of the invention may comprise a sequence of 8-20 bases, preferably from the translated region of the transcript, with contiguous nucleotides from the nucleic acid encoding antigens associated with the invention identified according to the invention.
  • an ADCC-activating antibody or antibody will elicit further humoral or cellular immune responses
  • an anti-cytokine antibody either directly or through the
  • nucleic acid provided tumor-associated antigen on the surface of cells, wherein the binding preferably induces or prevents a cytokine secretion.
  • a pharmaceutical composition according to the invention can be a
  • Excipient may be selected from the group of saponin, GM-CSF, CpG nucleotides, RNA or a cytokine.
  • a pharmaceutical composition according to the invention is preferably used for the treatment of a disease, such as cancer, which is characterized by the selective expression or abnormal expression of a tumor-associated antigen.
  • a disease such as cancer
  • the term "disease” according to the invention relates to any pathological condition in which tumor-associated antigens are expressed or abnormally expressed.
  • cancer especially seminomas, melanomas, teratomas, gliomas, gastrointestinal, colorectal, pancreatic, cervical, nasal, ear (ENT), breast, prostate, uterine, ovarian and lung cancers, Seminomas, melanomas, teratomas, tumors of the nervous system (such as gliomas, meningiomas, neuroblastomas, medulloblastomas, schwannomas, neuroendocrine tumors), gastrointestinal, pancreatic, cervical, nasal, ear (ENT), bladder, breast, bone , Liver, kidney, prostate, uterus, ovarian, Pulmonary and thyroid tumors, lymphomas, as well as tumor types of the blood-forming system (leukemia, etc.).
  • the nervous system such as gliomas, meningiomas, neuroblastomas, medulloblastomas, schwannomas, neuroendocrine tumors
  • gastrointestinal, pancreatic, cervical, nasal, ear (ENT) bladder, breast,
  • the invention also relates to a method for the treatment or diagnosis of a disease characterized by the expression of one or more tumor-associated antigens, comprising the treatment of the administration of a disease
  • inventive pharmaceutical composition is provided.
  • the invention relates to a method for the treatment and / or diagnosis comprising a tumor disease
  • the antigen has a sequence selected from the group consisting of: a nucleic acid comprising a nucleic acid sequence derived from the
  • nucleic acid which under stringent conditions with the
  • nucleic acid which is degenerate with respect to the nucleic acid under (a) or (b), and
  • nucleic acid complementary to the nucleic acid of (a), (b) or (c),
  • Detecting the interaction of said agent with components of the sample comprising PCR, ELISA, Northern, Southern, Western blot, immunocytochemistry and immunohistology, MRI, CT, PET, LC / MS.
  • a biological sample is preferably isolated from patients who have or are suspected of having or are suspected to have cancer, the presence of the nucleic acid and / or the tumor-associated antigen and / or or a certain amount of a nucleic acid and / or of the tumor associated antigen, as an indication of a cancer or as a potential starting point for the development of cancer.
  • the method of diagnosis and / or treatment also includes the detection or determination of the amount of nucleic acid and / or the tumor-associated antigen. So it is possible to predict whether a metastasis of a
  • Cancer can be done. This is done by using PCR, ELISA, Northern, Southern, Western blotting, immunocytochemistry and immunohistology, MRI, CT, PET, LC / MS methods.
  • the detection of a nucleic acid using an oligo- or polynucleotide which hybridizes specifically to the nucleic acid carried out, wherein a selective amplification of the nucleic acid, for. B. by PCR amplification.
  • the method according to the invention relates to the treatment, diagnosis of a disease which is characterized by the expression of a tumor-associated antigen identified according to the invention, comprising the
  • RNA extraction From 500 ng total RNA was in a reaction mixture according to the
  • a first-strand cDNA synthesis was performed. Integrity and quality of the cDNA were checked by amplification in a 40-cycle PCR.
  • Hybridization temperatures were determined using the online tool "TM Calculator” (NEB) After 5 minutes at 95 ° C to activate the polymerase, 40 cycles of PCR (denaturation at 95 ° C for 15 s, hybridization temperature 65 ° C for 30 s and final elongation at 72 ° C for 30 sec.) 20 ⁇ of this reaction was separated on an ethidium bromide stained 2% agarose gel and analyzed.
  • Antisense 5 '-ATGGCCTGGGGGCTTTCTCTTC-3'
  • ACRBP Acrosine binding protein
  • Antisense 5 ' -GGAGCTCCTGCTGCTTCTCAGTC-3 ' cation channel, sperm associated 2 (CATSPER2):
  • Catsper Channel auxiliary subunit beta (CATSPERB):
  • Antisense 5 '-CTCCAGTTGACAGTAGCTGTAGTACGG-3'
  • Catsper Channel auxiliary subunit gamma (CATSPERG):
  • Cysteine-rich secretory protein 3 (CRISP3):
  • Fer-1-like 6 Fer-1 L6
  • Antisense 5 ' - ACAGTCTTCCCACCACTCCT -3 ' lzumo-1 (IZUM01)
  • Antisense 5 ' - GACCGTTAGGAAGGGTGCTC -3 '
  • PSG2 Pregnancy specific beta-1 glycoprotein 2
  • Antisense 5 -GTCTGGACCATAGAGGACATTCAGG-3 '
  • GGNBP2 Gametogenetin binding protein 2
  • ROPN1 L Rhophilin associated tail protein 1-like
  • Antisense 5 -TGG AGGTAACACCGGTATGTTCCC-3 '
  • Antisense 5 '-ACATCCAGGTCAGGCAGAGT-3' ZP 1 (zona pellucida glycoprotein 1)
  • Antisense 5 -G AAAGGGCATCCGTCTG ACA-3 '
  • ZP 2 (zona pellucida glycoprotein 2)
  • Antisense 5 ' -TTGGTTGGCGGAGGAATCTC-3 '
  • ZP 3 (Zona pellucida glycoprotein 3)
  • CRISP 1 Cysteine-rich secretory protein 1
  • CRISP 2 (Cysteine-rich secretory protein 2)
  • Antisense 5 -CAGGTCCTTCAGGGCTACAG-3 ' OTOF (Otoferlin)
  • SED-1 secreted protein containing EGF repeats
  • MMP 15 matrix metallopeptidase 15
  • Antisense 5 ' -TGCTCCCACACGCGGAAGGC-3 '
  • MMP 16 matrix metallopeptidase 16
  • MMP 17 matrix metallopeptidase 17
  • Antisense 5 -ACCAGCGCATGGCGTCGTCC-3 ' MMP 20 (matrix metallopeptidase 20)
  • Antisense 5 -TTAGCAACCAATCCAGGAACTAGAT-3 '
  • HL60 Birnia GD.
  • the HL60 cell line a model for human myeloid cell differentiation.
  • A549 Watanabe T, Miura T, Degawa Y, Fujita Y, Inoue M, Kawaguchi M, Furihata C. Comparison of lung cancer cell lines versus four histopathological subtypes with gene expression profiling using quantitative real-time PCR. Cancer Cell Int. 2010; 10: 2nd doi: 10.1186 / 1475-2867-10-2 .; BHY, MG63, SaOS-2, SW-872, MCF7, PC3 (Cell Line Service, Eppelheim, Germany), HN (DSMZ, Braunschweig, Germany).
  • cDNA was amplified with a gene-specific primer pairs in RT-PCR analyzes in the following cell lines: A 172, SKMG5, U87, U251, U373, TC620, MG63, SaOS-2, SW-872, B-CPAP, A549, BHY , GLC-2, HN, HeLa, HT29, MCF7, PC3, HL60.
  • RT-PCR analyzes of tumor antigens were carried out, the names of the tumor antigens being abbreviated to the left of the gel traces (see Fig. 1).
  • Example 1 Identification of Acrosine (ACR) as a Diagnostic and Therapeutic Target
  • ACR is the major protease in the acrosome of sperm. It causes lysis of the zona pellucida of the egg.
  • the sequence is published in the gene database under accession number NM_001097.2.
  • Acrosin has a molecular weight of 46 kD as preproprotein. In tumors so far no expression has been described.
  • ACR transcripts can be used according to the invention as target structures (targets) of antibodies. These antibodies, monoclonal or too
  • Tumor cells can be used for both diagnostic and therapeutic procedures.
  • the protein coding sequences can be used to induce tumor-specific immune responses (T cell and B cell mediated immune responses).
  • T cell and B cell mediated immune responses can be used to induce tumor-specific immune responses.
  • the invention according to the cellular function of the ACR molecule, it is possible to develop substances, in particular smaller molecules, which inhibit or modulate the function of ACR on tumor cells.
  • the gene product according to the invention is suitable as a target for diagnosis and therapy.
  • the sequence of the acrosin binding protein is in the Genbank under the
  • ACRBP is a protein with a molecular weight of approximately 59 kDa that is expressed in the acrosome of the testis. Expression in bladder, breast, lung, liver and colon tumors has been demonstrated (Ono T, Kurashige T, Harada N, Noguchi Y, Saika T, Nikamawa N, Aoe M, Nakamura S, Higashi T, Hiraki A, Wada H, Kumon H, Old LJ, Nakayama E. Identification of proacrosin binding protein sp32 precursor as a human cancer / testis antigen. Proc Natl Acad See USA 2001 Mar 13; 98 (6): 3282-7).
  • RT-PCR studies with an ACRBP-specific primer pair in Figure 1 show an expression of ACRBP in the following cell lines: A 172, U87-MG, U251, TC620, MG63, SW-872, B-CPAP, A549, GLC-2 , HN, HeLa, HT29, MCF7, PC3, HL60.
  • the expected PCR product is 270 bp long.
  • the gene product according to the invention is suitable as a target for diagnosis and therapy.
  • CATSPER1 is a membrane protein of molecular weight 90 kDa expressed in flagella of spermatozoa. Expression in tumors is not known (Ren D, Navarro B, Perez G, Jackson AC, Hsu S, Shi Q, Tilly JL, Clapham DE, Sperm ion Channel required for sperm motility and male fertility, Nature, 2001 Oct 11; 413 (6856): 603-9).
  • RT-PCR analysis in Fig. 1 with a CATSPER1-specific primer pair confirms expression in the following cell lines (245 bp expected fragment length): A 172, SKMG5, U87-MG, U251, U373, TC620, MG63, SW-872, B CPAP, A549, BHY, GLC-2, HN, HeLa, HT29, MCF7, PC3, HL60.
  • Example 4 Identification of CATSPER2 as a Diagnostic and Therapeutic Target
  • CATSPER2 is published in GenBank under accession number NM_172095.2.
  • CATSPER2 is a membrane protein with a molecular weight of 62 kDa expressed in flagella of spermatozoa. Expression in tumors is not known (Quill TA, Ren D, Clapham DE, Garber's DL, A voltage-gated ionic channel, specifically in spermatozoa.) Proc Natt Acad See USA 2001 Oct 23; 98 (22): 12527-31 ,
  • RT-PCR assay in Fig. 1 with a specific primer pair confirms expression in the following cell lines (expected fragment length 270 base pairs): A172, SKMG5, U87-MG, U251, U373, TC620, MG63, SW-872, B-CPAP , BHY, GLC-2, HN, HeLa, HT29, MCF7, PC3, HL60.
  • the gene product according to the invention is suitable as a target for diagnosis and therapy.
  • CATSPER4 is a membrane protein with a molecular weight of 54 kDa that is expressed exclusively in spermatozoa. Expression in tumors is not yet known (Lobley A, Pierron V, Reynolds L, Allen L, Michalovich D. Identification of human and mouse CatSper3 and CatSper4 genes: characterization of a common interaction domain and evidence for expression in testis Reprod Biol Endocrino 2003; 1: 53)
  • CATSPERB is published in the GenBank under the accession number v NM_024764.2.
  • CATSPERB is a membrane protein of molecular weight 125 kDa expressed in flagella of spermatozoa. Expression in tumors is not known (Liu J, Xia J, Cho KH, Clapham DE, Ren D. CatSperbeta, a novel transmembrane protein in the CatSper Channel Complex J Biol Chem. 2007 Jun 29; 282 (26): 18945- 52nd Epub 2007 May 3).
  • CATSPERB in the following cell lines examined (expected fragment length 371 bp): TC620, A549, BHY, HeLa, HT29, MCF7.
  • the gene product according to the invention is suitable as a target for diagnosis and therapy.
  • CATSPERD The sequence of CATSPERD is published in GenBank under accession number NM_152784.3.
  • CATSPERD is a membrane protein with a molecular weight of 91 kDa expressed in flagella of spermatozoa. Expression in tumors is not known (Chung JJ, Navarro B, Krapivinsky G, Krapivinsky L, Clapham DE, A novel gene required for male fertility and functional CATSPER channel formation in spermatozoa, Nat Commun., 2011 Jan 11; 2: 153).
  • Base pairs A172, U251, U373, TC620, A549, HN, HeLa, HT29, MCF7.
  • Example 8 Identification of CATSPERG as a Diagnostic and Therapeutic Target
  • CATSPERG The sequence of CATSPERG is published in GenBank under accession number NM_021185.4.
  • CATSPERG is a transmembrane protein with a MW of 129 kD that is expressed in flagella of spermatozoa. Expression in tumors is not known (Wang H, Liu J, Cho KH, Ren D.
  • a novel, single transmembrane protein CATSPERG is associated with CATSPER1 channel protein, Biol Reprod., 2009 Sep; 81 (3): 539-44. doi: 10.1095 / biolreprod.109.077107. Epub 2009 Jun 10. RT-PCR assay in Fig.
  • the gene product according to the invention is suitable as a target for diagnosis and therapy.
  • CRISP3 is published in GenBank under accession number NM_001190986.1.
  • CRISP3 is a 28 kD MW protein. Expression in salivary glands, pancreas, prostate, epididymis, ovaries, thymus and large intestine as well as in prostate tumors is known (Grupp K, Kohl S, Sirma H, Simon R, Steurer S, Becker A, Adam M, Izbicki J, Sauter G, Minner S, Schlomm T, Tsourlakis MC Cysteine-rich secretory protein 3 overexpression is linked to a subset of PTEN-deleted ERG fusion-positive prostate cancers with early biochemical recurrence. Mod Pathol.
  • CRISP cysteine-rich secretory protein family -1, CRISP-2 and CRISP-3, Eur J Biochem 1996 Mar 15; 236 (3): 827-36).
  • RT-PCR analysis in Fig. 1 with a specific primer pair confirms expression in the following cell lines examined (expected fragment size: 149 base pairs): SKMG5, TC620, MG63, A549, HT29, PC3.
  • the gene product according to the invention is suitable as target for diagnosis and therapy.
  • FER1 L5 The sequence of FER1 L5 is published in GenBank under accession number NM_001 113382.1.
  • FER1 L5 is a membrane protein with a MW of 242 kD and is expressed in myoblasts. Expression in tumors is not known (Posey AD Jr, Pytel P, Gardikiotes K, Demonstration AR, Rainey M, George M, Band H, McNally EM, Endocytic recycling proteins EHD1 and EHD2 interact with fer-1-like-5 (Fer1 L5) and mediate myoblastic fusion J Biol Chem., 2011 Mar 4; 286 (9): 7379-88, doi: 10.1074 / jbc.M110.157222. Epub 2010 Dec 22.
  • RT-PCR assay in Fig. 1 with a specific primer pair confirms expression in the following cell lines examined (expected fragment length of 278 base pairs): U87-MG, U251, TC620, B-CPAP, HT29, PC3.
  • the gene product according to the invention is suitable as target for diagnosis and therapy.
  • FER1 L6 The sequence of FER1 L6 is published in GenBank under accession number NM_001039112.2. FER1L6 is a membrane protein with an MW of around 209 kD. Expression in ovaries. Expression in tumors is not known (S, Röpke A, Wieacker, P. Copy number variants in premature ovarian failure and ovarian dysgenesis, Sex Dev., 2010, Sep; 4 (4-5): 225-32, doi: 10.1159 / 000314958 Epub 2010 Jul 3).
  • RT-PCR assay in Fig.1 with a specific primer pair confirms expression in the following cell lines examined (expected fragment length 260 base pairs): A172, SKMG5, U87-MG, U251, U373, SW-872, B-CPAP, A549 , BHY, GLC-2, HT29, MCF7, PC3.
  • the gene product according to the invention is suitable as a target for diagnosis and therapy.
  • FOLR4 is a GPI-anchored protein with a MW of around 28 kD. Expression is probably confined to oocytes (Bianchi E, Doe B, Goulding D, Wright GJ, Juno is the Egg Izumo receptor and essential for mammalian fertilization, Nature. 2014; 508: 483-7).
  • RT-PCR examination in Fig. 1 with a specific primer pair confirms expression in the following cell lines examined (expected fragment length 288 base pairs): U87-MG, TC620, A549, B-CPAP, BHY.
  • the gene product according to the invention is suitable as a target for diagnosis and therapy.
  • GGN1 gametogenetin 1
  • CRISP2 cysteine-rich secretory protein 2
  • GGN2 Germ cell specific protein gametogenetine protein 2
  • RT-PCR assay in Fig. 1 with a specific primer pair confirm expression in the following cell lines examined (expected fragment length 280 base pairs): A 172, SKMG5, U87-MG, U251, U373, TC620, MG63, SW-872, B-CPAP, A549, BHY, GLC-2, HN, HeLa, HT29, MCF7, PC3, HL60.
  • the gene product according to the invention could also serve as target for diagnosis and therapy.
  • GGNBP2 The sequence of GGNBP2 is in the GenBank under the accession number
  • GGNBP2 is a 79 kDa protein expressed in germ cells (Zhang J, Wang Y, Zhou Y, Cao Z, Huang P, Lu B. Yeast two-hybrid screens imply that GGNBP1, GGNBP2 and OAZ3 are potential interaction partners of testicular germ cell-specific protein GGN1, FEBS Lett., 2005; 579 (2): 559-66). Expression in tumors is unknown.
  • RT-PCR assay in Fig. 1 with a specific primer pair confirms expression in the following cell lines examined (expected fragment length 344 base pairs): A172, SKMG5, U87-MG, U251, U373, TC620, MG63, SW-872, B CPAP, A549, BHY, GLC-2, HN, HeLa, HT29, MCF7, PC3, HL60. Since all
  • Example 15 Identification of IZUM01 as a Diagnostic and Therapeutic Target
  • IZUM01 The sequence of IZUM01 is in the GenBank under the accession number
  • IZUM01 is a 56 kDa transmembrane protein expressed on sperm cells (Ellerman DA, Pei J, Gupta S, Snell WJ, Myles D, Primakoff P. Izumo is part of a multiprotein family members of large scale mammalian sperm. Mol Reprod Dev. 2009; 76: 1188-99).
  • RT-PCR examination in Fig.1 with a specific primer pair showed no expression in the following cell lines examined (expected fragment length 394 base pairs): A172, SKMG5, U87-MG, U251, U373, TC620, MG63, SW-872, B CPAP, A549, BHY, GLC-2, HN, HeLa, HT29, MCF7, PC3, HL60. Since no expression is detectable in any of the investigated cell lines, the gene is
  • PSG1 The sequence of PSG1 is published in GenBank under accession number NM_182575.2. Is a secreted protein with a molecular weight of about 70 kDa expressed in the placenta (Camolotto SA, Racca AC, Ridano ME, Genti-Raimondi S, Panzetta-Dutari GM.) PSG gene expression is up-regulated by lysine acetylation involving histone and nonhistone proteins. PLoS One.
  • RT-PCR examination in Fig. 1 with a specific primer pair showed expression in the following investigated cell lines (expected fragment length 305 Base pairs): A172, SKMG5, U87-MG, U251, U373, TC620, MG63, SW-872, B-CPAP, A549, BHY, HN, HeLa, MCF7, PC3. Since the cell lines investigated have an expression, the gene product according to the invention could also serve as target for diagnosis and therapy.
  • PSG2 The sequence of PSG2 is published in GenBank under accession number NM_031246.3. Is a secreted protein with a molecular weight of about 60 kDa expressed in the placenta (Pan CJ, Chamberlin ME, Wu SM, Chan WY, Chou JY, Pregnancy-specific glycoprotein gene expression and the induction by 5-bromo-2 ' -deoxyuridine, Biochemistry, 1994 Jun 14; 33 (23): 7260-6).
  • RT-PCR analysis in Fig. 1 with a specific primer pair showed expression in the following cell lines examined (expected fragment length 305 base pairs): A 172, SKMG5, U87-MG, U251, U373, TC620, MG63, SW-872, B CPAP, BHY, HN, HeLa, MCF7, PC3. Since the examined cell lines a
  • the gene product according to the invention could also serve as a target for diagnosis and therapy.
  • PSG5 The sequence of PSG5 is published in GenBank under accession number NM_002781.3. Is a secreted protein with a molecular weight of about 60 kDa expressed in the placenta (Pan CJ, Chamberlin ME, Wu SM, Chan WY, Chou JY, Pregnancy-specific glycoprotein gene expression and the induction by 5-bromo-2 ' -deoxyuridine, Biochemistry, 1994 Jun 14; 33 (23): 7260-6).
  • RT-PCR examination in Fig. 1 with a specific primer pair showed no expression in the following investigated cell lines (expected fragment length 394 Base pairs): A172, SKMG5, U87-MG, U251, U373, TC620, MG63, SW-872, B-CPAP, A549, BHY, GLC-2, HN, HeLa, HT29, MCF7, PC3, HL60. Since no expression is detectable in any of the investigated cell lines, the gene is
  • ROPN1 L is published in GenBank under accession number NM_031916.4.
  • ROPN1L is a 26 kDa protein.
  • Normal expression in spermatozoa (Carr DW 1 , Fujita A, Stentz CL, Liberty GA, Olson GE, Narumiya S. Identification of sperm-specific proteins that interact with A-kinase anchoring proteins in a manner similar to the type II regulatory subunit of PKA. J Biol Chem. 2001; 276 (20): 17332-8, Epub 2001 Feb. 7) is also associated with breast cancer (Sehrawat B, Sridharan M, Ghosh S, Robson P, Cass CE, Mackey JR, Greiner R, Damaraju S.
  • RT-PCR assay in Fig. 1 with a specific primer pair confirms expression in the following cell lines examined (expected fragment length 185 base pairs): A172, SKMG5, U87-MG, U251, U373, TC620, MG63, SW-872, B CPAP, A549, BHY, GLC-2, HN, HeLa, HT29, MCF7, PC3, HL60. Since all
  • SPAG6 is published in GenBank under accession number CR533552.1.
  • SPAG6 is a 55 kDa protein. Normal expression is restricted to spermatozoa (Neilson LI, Schneider PA, Van Deerlin PG, Kiriakidou M, Driscoll DA, Pellegrini MC, Millinder S, Yamamoto KK, French CK, Strauss JF 3rd.
  • spermatozoa Neilson LI, Schneider PA, Van Deerlin PG, Kiriakidou M, Driscoll DA, Pellegrini MC, Millinder S, Yamamoto KK, French CK, Strauss JF 3rd.
  • RT-PCR assay in Fig. 1 with a specific primer pair confirms expression in the following cell lines examined (Expected fragment length 362 base pairs): SKMG5, U87-MG, U251, U373, SW-872, B-CPAP, GLC-2, HeLa, MCF7, PC3.
  • the gene product according to the invention could also serve as target for diagnosis and therapy
  • SPAG8 is in the GenBank under the accession number
  • SPAG8 is a 55 kDa protein. Normal expression is restricted to spermatozoa (Zhang XD, Miao SY, Wang LF, Li Y, Zong SD, Yan YC, Koide SS. Human sperm membrane protein (hSMP-1): a developmental testis-specific component during germ cell differentiation. Arch Androl 2000 Nov-Dec; 45 (3): 239-46). Expression in lung and lung
  • RT-PCR examination in FIG. 1 with a specific primer pair confirms expression in the following investigated cell lines (expected fragment length 365 Base pairs): A172, SKMG5, U87-MG, U251, U373, MG63, SW-872, B-CPAP, A549, BHY, GLC-2, HeLa, HT29, MCF7, PC3, HL60.
  • the gene product according to the invention could also serve as target for diagnosis and therapy.
  • SPAG17 is in the GenBank under the accession number
  • SPAG17 is a 252 kDa protein. Normal expression is restricted to spermatozoa (Zhang Z, Jones BH, Tang W, Moss SB, Wei Z, Ho C, Pollack M, Horowitz E, Bennett J, Baker ME, Strauss JF 3rd Dissecting the axoneme interactome: the mammalian orthologue of Chlamydomonas PF6 interacts with sperm-associated antigen 6, the mammalian orthologue of Chlamydomonas PF16, Mol Cell Proteomics, 2005 Jul; 4 (7): 914-23, Epub 2005 Apr 12). Expression in lung and breast tumors is described (Silina K, Zayakin P, Kalnina Z, Ivanova L, Master I, Endlet E, Abol's A,
  • RT-PCR assay in Fig. 1 with a specific primer pair confirms expression in the following cell lines tested (expected fragment length 325 base pairs): A172, SKMG5, U87-MG, U251, U373, MG63, SW-872, B-CPAP , A549, BHY, HN, HeLa, MCF7, PC3, HL60.
  • the gene product according to the invention could also serve as target for diagnosis and therapy.
  • Dysferlin is a transmembrane protein with a molecular weight of 230 kD. The expression of dysferlin occurs in monocytes and tracheal epithelium. In tumors so far no expression has been described. (Leung C, Shaheen F, Bernatchez P, hackett TL) Expression of myoferlin in human airway epithelium and its role in cell adhesion and zonula occludens-1 expression, PLoS One. 2012; 7 (7): e40478. Doi: 10.1371 / journal .pone.0040478). RT-PCR analysis revealed specific expression of DYSF in the following cell lines ( Figure 2, expected 250 bp PCR product): A 1207, SK-MG-5, SKN-MC, HL 60, BCPAP.
  • the gene product according to the invention is suitable as a target for diagnosis and therapy.
  • ZP1 glycosylated membrane protein with a molecular weight of approximately 97 kDa that is expressed in oocytes. Expression in tumors is unknown.
  • Schabanowitz RB, O'Rand MG Molecular Changes in the Human Zone of Pellucida Associated with Fertilization and Human Sperm-zona Interactions, Ann NY Acad Sci. 1988; 541: 621- RT-PCR studies with a ZP 1 -specific primer pair show in Fig.
  • Example 25 Identification of ZP2 as a Diagnostic and Therapeutic Target
  • ZP2 is published in GenBank under accession number NM_003460.1.
  • ZP2 is a glycosylated membrane protein with a molecular weight of 64 to 78 kDa that is expressed in oocytes. Expression in tumors is not known (Gupta SK, Bhandari B, Shrestha A, Biswal BK, Palaniappan C, Malhotra SS, Gupta N.Mammalian zona pellucida glycoproteins: structure and function during fertilization., Cell Tissue Res. 2012; 349: 665- 78).
  • the RT-PCR assay in Figure 2 with a specific primer pair confirms expression in the following cell lines (358 bp expected fragment length): GLC-8A. Since an examined cell line has an expression, the gene product according to the invention is suitable as a target for diagnosis and therapy.
  • Example 26 Identification of ZP3 as a Diagnostic and Therapeutic Target
  • ZP3 is published in GenBank under accession number NM_007155.5.
  • the sequence of ZP 3 is published in GenBank under accession number NM_007155.5.
  • ZP3 is a glycosylated membrane protein with a molecular weight of 57 to 73 kDa that is expressed in oocytes. Expression in ovarian tumors has been described (Rahman NA, et al., A novel treatment strategy for ovarian cancer based on immunization against zona pellucida protein (ZP) 3. FASEB J. 2012; 26: 324-33).
  • the gene product according to the invention is suitable as a target for diagnosis and therapy.
  • Example 27/28 Identification of CRISP 1 and CRISP 2 as a Diagnostic and Therapeutic Target
  • the sequence of CRISP 1 is published in GenBank under accession number NM_001131.2.
  • the sequence of CRISP 2 is published in GenBank under accession number NM_003296.3.
  • CRISP1 and CRISP2 are secreted or membrane-associated proteins with molecular weights between 25 and 32 kDa. Expression of CRISP1 or CRISP2 is not previously described in tumors. In the mouse, CRISP proteins show not only testis-restricted expression.
  • a RT-PCR assay with a specific primer pair confirms expression of CRISP1 in the following cell lines (expected fragment length 183 bp, TV2 only): A 172, A 1207, U251, U373, SK-MG-5, U 87-MG, TC620, U178, SKN-MC, GLC 8A, SCLC-24H, H 146, HL 60, HELA, HT-29, BCPAP, FTC-133, CAL-62, GLC-2, 1184, A549. Since three investigated cell lines have no expression, the gene product according to the invention is suitable as a target for diagnosis and therapy.
  • RT-PCR assay confirms expression of CRISP2 in the following cell lines (expected fragment lengths 257, 263, 294, 300 bp): A172, U373, U87-MG, U178, SH-SY5Y, HL-60, BCPAP, H1184. Since at least one examined cell line has an expression, the gene product according to the invention is suitable as a target for diagnosis and therapy.
  • Example 29 Identification of MYOF as a Diagnostic and Therapeutic Target
  • MYOF The sequence of MYOF is published in GenBank under accession number AF182316.1.
  • Myoferlin is a transmembrane protein with a MW of 234 kD and is expressed in muscle and endothelial cells. Expression in mammary carcinomas has been demonstrated (Leung C, Yu C, Lin MI, Tognon C, Bernatchez P. Expression of myoferlin in human and murine carcinoma tumors: role in membrane repair, cell proliferation, and tumorigenesis.) On J Pathol., 2013; 182: 1900-9).
  • the RT-PCR assay in Fig. 2 with a specific primer pair confirms expression in the following cell lines (expected fragment length 259 base pairs): A 172, A 1207, U 251, U 373, SK-MG-5, U87-MG, TC 620, U 178, SKN-MC, HL 60, HELA, HT 29, BCP AP, GLC-2, GLC-36, H1184. Since several investigated cell lines have an expression, the gene product according to the invention is suitable as a target for diagnosis and therapy.
  • Example 30 Identification of OTOF as Diagnostic and Therapeutic
  • Otoferlin is a transmembrane protein of 227 kD. In the mouse, otoferlin is expressed in the inner ear, cerebellum, hippocampus, testes, perhaps also in kidney or heart. For humans, there are no exact dates. Expression in tumors is not described (Schug N, Braig C, Zimmermann U, Engel J, Winter H, Ruth P, Blin N, Pfister M, Kaibacher H, Knipper M. Differential expression of otoferlin in brain, vestibular system, immature and mature cochlea of the rat, Eur J Neurosci., 2006; 24: 3372-80).
  • the RT-PCR assay in Fig. 2 with a specific primer pair confirms expression in the following cell lines (expected fragment length: 229 base pairs): A 172, A 1207, U 251, U 373, TC 620, U 178, SKN-MC, SH-SY5Y, GLC-8A, SCLC-24H, H146, HL60, HELA, HT29, BCP AP, FTC-133, GLC-2, GLC- 36, H1184. Since several investigated cell lines have an expression, the gene product according to the invention is suitable as a target for diagnosis and therapy.
  • SED1 is published in GenBank under accession number NM_001114614.1.
  • SED-1 is a membrane-associated protein with a MW of 45 kD and is expressed in MIkroglia and macrophages.
  • Expression in bladder and breast cancers, in melanomas, in tumors of hematopoietic systems, as well as in HeLa and C6 glioma cells (rat) has been described (Liu Y, Yang X, Guo C, None P, Liu Y, Ma J. Essential role of MFG -E8 for phagocytic properties of microglial cells, PLoS One.
  • the RT-PCR assay in Fig. 2 with a specific primer pair confirms expression in the following cell lines (expected fragment length of 267 base pairs): A 172, A 1207, U 251, U 373, SK-MG-5, U87-MG , TC620, U178, SKN-MC, SH-SY5Y, GLC-8A, SCLC-24H, H146, HL60, HELA, HT29, BCP AP, FTC-133, GLC-36, H1184, A549. Since several investigated cell lines have an expression, the gene product according to the invention is suitable as a target for diagnosis and therapy.
  • Example 32 Identification of ZAN as a Diagnostic and Therapeutic Target
  • ZAN The sequence of ZAN is published in GenBank under accession number NM_003386.1.
  • Zonadhesin is a membrane protein with a MW of around 240 kD. Expression in sperm cells. Expression in tumors is not known (Herlyn H, Zischler H. The molecular evolution of sperm zonadhesin, Int J Dev Biol. 2008; 52: 781-90).
  • the RT-PCR assay in Fig. 2 with a specific primer pair confirms expression in the following cell lines (expected fragment length 252 base pairs): A 172, A 1207, U 251, U 373, SK-MG-5, U87-MG, TC620, U178, SKN-MC, GLC-8A, SCLC-24H, H146, HL60, HT29, BCP AP, FTC-133, GLC2, H1184, A549. Since several investigated cell lines have an expression, the gene product according to the invention is suitable as a target for diagnosis and therapy.
  • MMP15 is published in GenBank under accession number NM_002428.2.
  • MMP15 is a membrane protein of 76 kDa expressed in esophageal carcinomas (Chen et al., Anticancer Res. 2010, 30: 4363).
  • the RT-PCR assay in Fig. 2 with a specific primer pair confirms expression in the following cell lines (expected fragment length 193 basepairs): A 172, A 1207, U251, U373, SK-MG-5, U 87-MG, TC620 , U178, SKN-MC, GLC 8A, SCLC-24H, H 146, HL 60, HELA, HT-29, BCPAP, GLC-2, GLC-36, H 1184. Since several cell lines studied have expression, the gene product is According to the invention suitable as a target for diagnosis and therapy.
  • Example 34 Identification of MMP 16 as a Diagnostic and Therapeutic Target
  • MMP16 is a membrane protein of 52 kDa expressed in cartilage cells. Expression in lung tumors (NSCLC) and astrocytomas has been described (Darrah C, Donell ST, Shepstone L, Porter S, Brockbank SM, Edwards DR, Parker AE, Clark IM Arthritis Rheum. 2004; 50: 131-141; Grant GM, Giambernardi TA, Grant AM, Adhesive RJ. Overview of expression of matrix metalloproteinases (MMP-17, MMP-18, and MMP). 20) in cultured human cells, Matrix Biol. 1999; 18: 145-8).
  • the RT-PCR assay in Fig. 2 with a specific primer pair confirms expression in the following cell lines investigated (expected fragment length 192 base pairs): A 172, A 1207, U251, U373, SK-MG-5, U 87-MG, TC620, U178, SKN-MC, GLC 8A, H 146, BCPAP, GLC-2, GLC-36, H 1184. Since several examined cell lines have an expression, the gene product according to the invention is suitable as target for diagnosis and therapy.
  • MMP-17 is a membrane protein of 76 kDa. Normal expression in eosinophils (Gauthier MC, Racine C, Ferland C, Flamand N, Chakir J, Tremblay GM, Laviolette M. Expression of membrane type-4 matrix metalloproteinase (metalloproteinase-17) by human eosinophils Int J Biochem Cell Biol.
  • Example 36 Identification of MMP 20 as Diagnostic and Therapeutic
  • MMP20 is a membrane protein of 76 kDa. Normal expression is limited to enamel-forming ameloblasts (Bartlett JD, Simmer JP, Proteinases in developing dental enamel, Crit Rev Oral Biol Med. 1999; 10: 425-4). Expression in lingual carcinomas has been demonstrated (Väänänen A, Srinivas R, Parikka M, Palosaari H, Bartlett JD, Iwata K, Grenman R, Stenman UH, Sorsa T, Salo T expression of regulation of MMP-20 in human tongue carcinoma cells Dent Res. 2001; 80: 1884-9).
  • FIG. 3 The following cell lines were investigated for example 36 (FIG. 3): A 172, A 1207, U251, U373, SK-MG-5, U 87-MG, TC 620, U 178, SKN-MC, SH-SY5Y, GLC 8A, SCLC-24H, H146, HL 60, HELA, HT-29, BCPAP, FTC-133, CAL-62, GLC-2, GLC-36, H 1184, A549.
  • the upper gel half shows: B-CPAP (lane 1), FTC-133 (lane 2), CAL-62 (lane 3), GLC-2 (lane 4), GLC-8A (lane 5), GLC-36 (lane 6), SCLC-24H (lane 7), H146 (lane 8), H-1184 (lane 9), A549 (lane 10), A172 (lane 11), A1207 (lane 12), blank (lane 13), negative control (Lane 14).
  • the lower half of the gel shows: U251 (lane 1), U373 (lane 2), SK-MG-5 (lane 3), U87-MG (lane 4), TC620 (lane 5), U178 (lane 6), SKN-MC (Lane 7), SH-SY5Y (lane 8), HL-60 (lane 9), HeLa (lane 10), HT-29 (lane 11), empty (lane 12, 13), negative control (lane 14).
  • the RT-PCR assay in Figure 3 with a specific primer pair confirms expression in the following cell line cell lines (expected fragment length 223 base pairs): H-1184, A172, A1207, U251, U87-MG, HT-29. Since several investigated cell lines have an expression, the gene product according to the invention is suitable as a target for diagnosis and therapy.
  • ZP1 Zona pellucida protein 1
  • ZP2 Zona pellucida protein 2
  • ZP3 Zona pellucida protein 3
  • Otoferlin Otoferlin

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Pathology (AREA)
  • Analytical Chemistry (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Wood Science & Technology (AREA)
  • Physics & Mathematics (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Hospice & Palliative Care (AREA)
  • Biophysics (AREA)
  • Oncology (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

L'invention concerne une composition pharmaceutique comprenant un agent qui décèle ou inhibe l'expression ou l'activité d'un antigène associé à une tumeur, ainsi qu'un procédé de traitement et de diagnostic d'une maladie tumorale. Cet agent et ce procédé permettent de créer des structures cibles pour le diagnostic et la thérapie de certaines maladies, en particulier des cancers.
PCT/DE2015/000077 2014-02-20 2015-02-19 Antigènes associés à une tumeur et produits géniques dans le diagnostic et la thérapie WO2015124138A1 (fr)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
DE102014002256.0 2014-02-20
DE102014002256.0A DE102014002256A1 (de) 2014-02-20 2014-02-20 Genprodukte für Diagnose und Therapie
DE102014011258.6 2014-07-30
DE102014011258.6A DE102014011258A1 (de) 2014-07-30 2014-07-30 Tumor assozziierte Antigene für Diagnose und Therapie

Publications (1)

Publication Number Publication Date
WO2015124138A1 true WO2015124138A1 (fr) 2015-08-27

Family

ID=52779439

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/DE2015/000077 WO2015124138A1 (fr) 2014-02-20 2015-02-19 Antigènes associés à une tumeur et produits géniques dans le diagnostic et la thérapie

Country Status (1)

Country Link
WO (1) WO2015124138A1 (fr)

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2002086071A2 (fr) * 2001-04-20 2002-10-31 Ludwig Institute For Cancer Research Antigenes du cancer et des testicules
WO2004047863A2 (fr) * 2002-11-22 2004-06-10 Ganymed Pharmaceuticals Ag Produits geniques exprimes de maniere differentielle dans des tumeurs et leur utilisation

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2002086071A2 (fr) * 2001-04-20 2002-10-31 Ludwig Institute For Cancer Research Antigenes du cancer et des testicules
WO2004047863A2 (fr) * 2002-11-22 2004-06-10 Ganymed Pharmaceuticals Ag Produits geniques exprimes de maniere differentielle dans des tumeurs et leur utilisation

Non-Patent Citations (55)

* Cited by examiner, † Cited by third party
Title
A. W. WHITEHURST ET AL: "Tumor Antigen Acrosin Binding Protein Normalizes Mitotic Spindle Function to Promote Cancer Cell Proliferation", CANCER RESEARCH, vol. 70, no. 19, 28 September 2010 (2010-09-28), pages 7652 - 7661, XP055193483, ISSN: 0008-5472, DOI: 10.1158/0008-5472.CAN-10-0840 *
AHMED D; EIDE PW; EILERTSEN IA; DANIELSEN SA; EKNAES M; HEKTOEN M; LIND GE; LOTHE RA: "Epigenetic and genetic features of 24 colon cancer cell lines", ONCOGENESIS, vol. 2, 2013, pages E71
BARTLETT JD; SIMMER JP: "Proteinases in developing dental enamel", CRIT REV ORAL BIOL MED., vol. 10, 1999, pages 425 - 4
BIANCHI E; DOE B; GOULDING D; WRIGHT GJ: "Juno is the egg Izumo receptor and is essential for mammalian fertilization", NATURE, vol. 508, 2014, pages 483 - 7
BIRNIE GD: "The HL60 cell line: a model system for studying human myeloid cell differentiation", BR J CANCER, vol. 9, 1988, pages 41 - 5
BU HF; ZUO XL; WANG X; ENSSLIN MA; KOTI V; HSUEH W; RAYMOND AS; SHUR BD; TAN XD: "Milk fat globule-EGF factor 8/lactadherin plays a crucial role in maintenance and repair of murine intestinal epithelium", J CLIN INVEST., vol. 117, 2007, pages 3673 - 83
CAMOLOTTO SA; RACCA AC; RIDANO ME; GENTI-RAIMONDI S; PANZETTA-DUTARI GM: "PSG gene expression is up-regulated by lysine acetylation involving histone and nonhistone proteins", PLOS ONE, vol. 8, no. 2, 2013, pages E55992
CARR DW; FUJITA A; STENTZ CL; LIBERTY GA; OLSON GE; NARUMIYA S: "Identification of sperm-specific proteins that interact with A-kinase anchoring proteins in a manner similar to the type 11 regulatory subunit of PKA", J BIOL CHEM., vol. 276, no. 20, 7 February 2001 (2001-02-07), pages 17332 - 8
CHEN ET AL., ANTICANCER RES., vol. 30, 2010, pages 4363
CHUNG JJ; NAVARRO B; RAPIVINSKY G; KRAPIVINSKY L; CLAPHAM DE: "A novel gene required for male fertility and functional CATSPER channel formation in spermatozoa", NAT COMMUN., vol. 2, 11 January 2011 (2011-01-11), pages 153
DARRAH C; DONELL ST; SHEPSTONE L; PORTER S; BROCKBANK SM; EDWARDS DR; PARKER AE; CLARK IM: "Expression profiling of metalloproteinases and their inhibitors in cartilage", ARTHRITIS RHEUM., vol. 50, 2004, pages 131 - 141
ELLERMAN DA; PEI J; GUPTA S; SNELL WJ; MYLES D; PRIMAKOFF P: "Izumo is part of a multiprotein family whose members form large complexes on mammalian sperm", MOL REPROD DEV., vol. 76, 2009, pages 1188 - 99
GAUTHIER MC; RACINE C; FERLAND C; FLAMAND N; CHAKIR J; TREMBLAY GM; LAVIOLETTE: "Expression of membrane type-4 matrix metalloproteinase (metalloproteinase-17) by human eosinophils", INT J BIOCHEM CELL BIOL., vol. 35, 2003, pages 1667 - 73
GIBBS GM; ROELANTS K; O'BRYAN MK: "The CAP superfamily: cysteine-rich secretory proteins, antigen 5, and pathogenesis-related 1 proteins--roles in reproduction, cancer, and immune defense", ENDOCR REV., vol. 29, 2008, pages 865 - 97
GOLDBERG GS; BECHBERGER JF; TAJIMA Y; MERRITT M; OMORI Y; GAWINOWICZ MA; NARAYANAN R; TAN Y; SANAI Y; YAMASAKI H: "Connexin43 suppresses MFG-E8 while inducing contact growth inhibition of glioma cells", CANCER RES., vol. 60, no. 21, 1 November 2000 (2000-11-01), pages 6018 - 26
GRANT GM; GIAMBERNARDI TA; GRANT AM; KLEBE RJ: "Overview of expression of ; matrix metalloproteinases (MMP-17, MMP-18, and MMP-20) in cultured human cells", MATRIX BIOL., vol. 18, 1999, pages 145 - 8
GRANT GM; GIAMBERNARDI TA; GRANT AM; KLEBE RJ: "Overview of expression of matrix metalloproteinases (MMP-1 7, MMP-18, and MMP-20) in cultured human cells", MATRIX BIOL, vol. 18, 1999, pages 145 - 8
GRUPP K; KOHL S; SIRMA H; SIMON R; STEURER S; BECKER A; ADAM M; IZBICKI J; SAUTER G; MINNER S: "Cysteine-rich secretory protein 3 overexpression is linked to a subset of P EN-deleted. ERG fusion-positive prostate cancers with early biochemical recurrence", MOD PATHOL., vol. 26, no. 5, 30 November 2012 (2012-11-30), pages 733 - 42
GUPTA SK; BHANDARI B; SHRESTHA A; BISWAL BK; PALANIAPPAN C; MALHOTRA SS; GUPTA N: "Mammalian zona pellucida glycoproteins: structure and function during fertilization", CELL TISSUE RES., vol. 349, 2012, pages 665 - 78
HERLYN H; ZISCHLER H: "The molecular evolution of sperm zonadhesin", INT J DEV BIOL., vol. 52, 2008, pages 781 - 90
INABA N; RENK T; WURSTER K; RAPP W; BOHN H: "Ectopic synthesis of pregnancy specific beta 1 - glycoprotein (SP1) and placental specific tissue proteins (PP5, PP10, PP11, PP12) in nontrophoblastic malignant tumours. Possible markers in oncology", KLIN WOCHENSCHR., vol. 58, 1980, pages 789 - 91
JAMSAI D; BIANCO DM; SMITH SJ; MERRINER DJ; LY-HUYNH JD; HERLIHY A; NIRANJAN B; GIBBS GM; O'BRYAN MK: "Characterization of gametogenetin 1 (GGN1) and its potential role in male fertility through the interaction with the ion channel regulator, cysteine-rich secretory protein 2 (CRISP2) in the sperm tail", REPRODUCTION, vol. 135, no. 6, June 2008 (2008-06-01), pages 751 - 9
KRÄTZSCHMAR J; HAENDLER B; EBERSPAECHER U; ROOSTERMAN D; DONNER P; SCHLEUNING WD: "The human cysteine-rich secretory protein (CRISP) family. Primary structure and tissue distribution of CRISP-1, CRISP-2 and CRISP-3", EUR J BIOCHEM., vol. 236, no. 3, 15 March 1996 (1996-03-15), pages 827 - 36
KUKLINSKI S; PESHEVA P; HEIMANN C; URSCHEL S; GLOOR S; GRAEBER S; HERZOG V; PIETSCH T; WIESTLER OD; PROBSTMEIER R: "Expression pattern of galectin-3 in neural tumor cell lines", J NEUROSCI RES., vol. 60, 2000, pages 45 - 57
LANDRY JJ; PYL PT; RAUSCH T; ZICHNER T; TEKKEDIL MM; STÜTZ AM; JAUCH A; AIYAR RS; PAU G; DELHOMME N: "The genomic and transcriptomic landscape of a HeLa cell line", G3 (BETHESDA, vol. 3, 2013, pages 1213 - 24
LEDIG S; RÖPKE A; WIEACKER P: "Copy number variants in premature ovarian failure and ovarian dysgenesis", SEX DEV., vol. 4, no. 4-5, 3 July 2010 (2010-07-03), pages 225 - 32
LEUNG C; SHAHEEN F; BERNATCHEZ P; HACKETT TL: "Expression of myoferlin in human airway epithelium and its role in cell adhesion and zonula occludens-1 expression", PLOS ONE, vol. 7, no. 7, 2012, pages E40478
LEUNG C; YU C; LIN MI; TOGNON C; BERNATCHEZ P: "Expression of myoferlin in human and murine carcinoma tumors: role in membrane repair; cell proliferation, and tumorigenesis", AM J PATHOL., vol. 182, 2013, pages 1900 - 9
LIU J; XIA J; CHO KH; CLAPHAM DE; REN D: "CatSperbeta, a novel transmembrane protein in the CatSper channel complex", J BIOL CHEM., vol. 282, no. 26, 3 May 2007 (2007-05-03), pages 18945 - 52
LIU Y; YANG X; GUO C; NIE P; LIU Y; MA J: "Essential role of MFG-E8 for phagocytic properties of microglial cells", PLOS ONE, vol. 8, no. 2, 2013, pages E55754
LOBLEY A; PIERRON V; REYNOLDS L; ALLEN L; MICHALOVICH D: "Identification of human and mouse CatSper3 and CatSper4 genes: characterisation of a common interaction domain and evidence for expression in testis", REPROD BIOL ENDOCRINO, vol. 1, 2003, pages 53
MURMANN T; CARRILLO-GARCIA C; VEIT N; COURTS C; GLASSMANN A; JANZEN V; MADEA B; REINARTZ M; HARZEN A; NOWAK M: "Staurosporine and extracellular matrix proteins mediate the differentiation of small cell lung carcinoma cells into a neuron-like phenotype", PLOSONE, 2014
NEILSON LI; SCHNEIDER PA; VAN DEERLIN, PG; KIRIAKIDOU M; DRISCOLL DA; PELLEGRINI MC; MILLINDER S; YAMAMOTO KK; FRENCH CK; STRAUSS: "cDNA cloning and characterization of a human sperm antigen (SPAG6) with homology to the product of the Chlamydomonas PF16 locus", GENOMICS, vol. 60, no. 3, 15 September 1999 (1999-09-15), pages 272 - 80
ONO T; KURASHIGE T; HARADA N; NOGUCHI Y; SAIKA T; NIIKAWA N; AOE M; NAKAMURA S; HIGASHI T; HIRAKI A: "Identification of proacrosin binding protein sp32 precursor as a human cancer/testis antigen", PROC NATL ACAD SCI USA., vol. 98, no. 6, 13 March 2001 (2001-03-13), pages 3282 - 7
PAN CJ; CHAMBERLIN ME; WU SM; CHAN WY; CHOU JY: "Pregnancy-specific glycoprotein gene expression and the induction by 5-bromo-2'-deoxyuridine", BIOCHEMISTRY, vol. 33, no. 23, 14 June 1994 (1994-06-14), pages 7260 - 6
POSEY AD JR; PYTEL P; GARDIKIOTES K; DEMONBREUN AR; RAINEY M; GEORGE M; BAND H; MCNALLY EM: "Endocytic recycling proteins EHD1 and EHD2 interact with fer-1-like-5 (Fer1 L5) and mediate myoblast fusion", J BIOL CHEM., vol. 286, no. 9, 22 December 2010 (2010-12-22), pages 7379 - 88
QUILL TA; REN D; CLAPHAM DE; GARBERS DL: "A voltage-gated ion channei, expressed specifically in spermatozoa", PROC NATL ACAD SCI USA., vol. 98, no. 22, 23 October 2001 (2001-10-23), pages 12527 - 31
RAHMAN N ET AL.: "A novel treatment strategy for ovarian cancer based on immunization against zona pellucida protein (ZP) 3", FASEB J., vol. 26, 2012, pages 324 - 33
REN D; NAVARRO B; PEREZ G; JACKSON AC; HSU S; SHI Q; TILLY JL; CLAPHAM DE: "A sperm ion channel required for sperm motility and male fertility", NATURE, vol. 413, no. 6856, 11 October 2001 (2001-10-11), pages 603 - 9
SCHUG N; BRAIG C; ZIMMERMANN U; ENGEL J; WINTER H; RUTH P; BLIN N; PFISTER M; KALBACHER H; KNIPPER M: "Differential expression of otoferlin in brain, vestibuiar system, immature and mature cochlea of the rat", EUR J NEUROSCI., vol. 24, 2006, pages 3372 - 80
SCHWEPPE RE; KLOPPER JP; KORCH C; PUGAZHENTHI U; BENEZRA M; KNAUF JA; FAGIN JA; MARLOW LA; COPLAND JA; SMALLRIDGE RC: "Deoxyribonucleic acid profiling analysis of 40 human thyroid cancer cell lines reveals cross-contamination resulting in cell line redundancy and misidentification", J CLIN ENDOCRINOL METAB., vol. 93, 2008, pages 4331 - 41
SEHRAWAT B; SRIDHARAN M; GHOSH S; ROBSON P; CASS CE; MACKEY JR; GREINER R; DAMARAJU S: "Potential novel candidate polymorphisms identified in genome-wide association study for breast cancer susceptibility", HUM GENET., vol. 130, no. 4, 19 March 2011 (2011-03-19), pages 529 - 37
SHABANOWITZ RB; O'RAND MG: "Molecular changes in the human zona pellucida associated with fertilization and human sperm-zona interactions", ANN N Y ACAD SCI., vol. 541, 1988, pages 621 - 32
SILI A K; ZAYAKIN P; KALNINA Z; IVANOVA L; MEISTERE I; ENDZELINS E; ABOLS A; STENGREVICS A; LEJA M; DUCENA K: "Sperm-associated antigens as targets for cancer immunotherapy: expression pattern and humoral immune response in cancer patients", J IMMUNOTHER., vol. 34, no. 1, January 2011 (2011-01-01), pages 28 - 44
SILINA K; ZAYAKIN P; KALNINA Z; IVANOVA L; MEISTERE I; ENDZETINš E; ABOLS A; STENGREVICS A; LEJA M; DUCENA K: "Sperm-associated antigens as targets for cancer immunotherapy: expression pattern and humoral immune response in cancer patients", J LMMUNOTHER., vol. 34, no. 1, January 2011 (2011-01-01), pages 28 - 44
SILINA K; ZAYAKIN P; KALNINA Z; IVANOVA L; MEISTERE; ENDZELINS E; ABOLS A; STENGREVICS A; LEJA M; DUCENA K: "Sperm-associated antigens as targets for cancer immunotherapy: expression pattem and humoral immune response in cancer patients", J IMMUNOTHER., vol. 34, no. 1, January 2011 (2011-01-01), pages 28 - 44
SPIEGELSTEIN O; EUDY JD; FINNELL RH: "Identification of two putative novel folate receptor genes in humans and mouse", GENE, vol. 258, 2000, pages 117 - 25
VÄÄNÄNEN A; SRINIVAS R; PARIKKA M; PALOSAARI H; BARTLETT JD; IWATA K; GRENMAN R; STENMAN UH; SORSA T; SALO T: "Expression an regulation of MMP-20 in human tongue carcinoma cells", J DENT RES., vol. 80, 2001, pages 1884 - 9
WANG H; LIU J; CHO KH; REN D: "A novel, single, transmembrane protein CATSPERG is associated with CATSPER1 channel protein", BIOL REPROD., vol. 81, no. 3, 10 June 2009 (2009-06-10), pages 539 - 44
WATANABE T; MIURA T; DEGAWA Y; FUJITA Y; INOUE M; KAWAGUCHI M; FURIHATA C: "Comparison of lung cancer cell lines representing four histopathological subtypes with gene expression profiling using quantitative real-time PCR", CANCER CELL INT., vol. 10, 2010, pages 2
YAN-HO CHENG ET AL: "Cancer/testis (CT) antigens, carcinogenesis and spermatogenesis", SPERMATOGENESIS, vol. 1, no. 3, 1 July 2011 (2011-07-01), pages 209 - 220, XP055193493, DOI: 10.4161/spmg.1.3.17990 *
ZHANG J; WANG Y; ZHOU Y; CAO Z; HUANG P; LU B: "Yeast two-hybrid screens imply that GGNBP1, GGNBP2 and OAZ3 are potential interaction partners of testicular germ cell-specific protein GGN1", FEBS LETT., vol. 579, no. 2, 2005, pages 559 - 66
ZHANG XD; MIAO SY; WANG LF; LI Y; ZONG SD; YAN YC; KOIDE SS: "Human sperm membrane protein (hSMP-1): a developmental testis-specific component during germ cell differentiation", ARCH ANDROL., vol. 45, no. 3, November 2000 (2000-11-01), pages 239 - 46
ZHANG Z; JONES BH; TANG W; MOSS SB; WEI Z; HO C; POLLACK M; HOROWITZ E; BENNETT J; BAKER ME: "Dissecting the axoneme interactome: the mammalian orthologue of Chlamydomonas PF6 interacts with sperm-associated antigen 6, the mammalian' orthologue of Chlamydomonas PF16", MOL CELL PROTEOMICS, vol. 4, no. 7, 12 April 2005 (2005-04-12), pages 914 - 23
ZHAO Q; ZHOU Y; CAO Z; ZHU H; HUANG P; LU B: "Germ-cell specific protein gametogenetin protein 2 (GGN2), expression in the testis, and association with intracellular membrane", MOL REPROD DEV., vol. 72, no. 1, September 2005 (2005-09-01), pages 31 - 9

Similar Documents

Publication Publication Date Title
AU2020270508B2 (en) C/EBP alpha short activating RNA compositions and methods of use
AU2022201307B2 (en) Genetically modified cells, tissues, and organs for treating disease
AU2017267184B2 (en) Method for assessing a prognosis and predicting the response of patients with malignant diseases to immunotherapy
US6262333B1 (en) Human genes and gene expression products
KR101234281B1 (ko) 염색체 안정화에 관한 유전자를 표적으로 하는 암세포 특이적 아포토시스 유도제
US11103538B2 (en) Targeting epigenetic regulators using a bacterial delivery system
KR20190017985A (ko) 질환을 치료하기 위한 유전적으로 변형된 세포, 조직, 및 장기
KR20120082906A (ko) 자가포식현상-향상 유전자 생성물의 조절을 통한 자가포식현상의 조절 방법
US20220389519A1 (en) Biomarkers predictive of anti-immune checkpoint response
KR20180093902A (ko) 태아와 임신 여성간에 상이하게 메틸화된 디엔에이 영역을 이용한 태아 염색체 이수성의 검출
CN101258249A (zh) 检测黑素瘤的方法和试剂
CN109863251A (zh) 对肺鳞状细胞癌亚型分型的方法
KR20110015409A (ko) 염증성 장 질환에 대한 유전자 발현 마커
KR20200123450A (ko) 전립선암 검출 및 치료 방법
JP2003304888A (ja) 化合物の毒性予測のための方法
WO2021183218A1 (fr) Compositions et procédés de modulation de l'interaction entre l'oncoprotéine de fusion ss18-ssx et les nucléosomes
KR20070099564A (ko) 급성 골수성 백혈병 환자를 평가하는 방법
KR20040065524A (ko) 백혈병을 검사 및 치료하는 방법
KR20140113021A (ko) 약물 중독 및 의존성 확인용 바이오마커
US20020137077A1 (en) Genes regulated in activated T cells
JP2003259877A (ja) 肝線維症疾患マーカーおよびその利用
KR20190126812A (ko) 질환 진단용 바이오마커
US20220265798A1 (en) Cancer vaccine compositions and methods for using same to prevent and/or treat cancer
CN100516876C (zh) 用于诊断肾细胞癌(rcc)和其他实体瘤的方法
KR100877554B1 (ko) 간암 환자 생존기간 예측용 마커, 그를 포함하는 키트 및마이크로어레이, 및 상기 마커를 이용한 간암 환자생존기간 예측 방법

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 15713128

Country of ref document: EP

Kind code of ref document: A1

122 Ep: pct application non-entry in european phase

Ref document number: 15713128

Country of ref document: EP

Kind code of ref document: A1