WO2015118056A1

WO2015118056A1 - Conditionally replicating adenovirus and use thereof in the treatment of cancer

Info

Publication number: WO2015118056A1
Application number: PCT/EP2015/052388
Authority: WO
Inventors: Cristina Fillat Fonts; Xavier BOFILL DE ROS
Original assignee: Institut D'investigacions Biomèdiques August Pi I Sunyer (Idibaps)
Priority date: 2014-02-06
Filing date: 2015-02-05
Publication date: 2015-08-13

Abstract

The adenovirus comprises a heterologous nucleic acid sequence inserted in the 3' UTR region of adenoviral E1A gene, said sequence comprising a nucleotide sequence of formula (I), wherein: S1 to S10 represent DNA sequences, the same or different from one another, each one of these sequences having a length from 6 to 250 nucleotides and coding for an RNA sequence complementary to microRNA-148a sequence SEQ ID NO:1; (b) E1 to E9 represent DNA spacer sequences spacing sequences S1-S10, being these spacer sequences the same or different from one another and having a length from 3 to 20 nucleotides; and (c) a,b,c,d,e and f are the same or different from one another and represent an integer value that is selected from 0 and 1. The adenovirus of the invention shows selectivity against tumoral cells without raising pancreatic and hepatic toxicity S1-E1-S2-E2-S3-E3-S4-[E4-S5]a-[E5-S6]b-[E6-S7]c-[E7-S8]d-[E8-S9]e-[E9- S10]f (I)

Description

Conditionally replicating adenovirus and use thereof in the treatment of cancer

The present invention relates to the fields of molecular biology, tumor biology, and medicine. In particular, the present invention relates to a conditionally replicating adenovirus that is tumor-cell selective.

BACKGROUND

Cancer is a disease in which the body produces an excess of malignant cells (known as carcinogenic or cancerous), with growth and division beyond normal limits, invasion of adjoining tissues and, sometimes, metastasis.

Metastasis is the spreading of cells that cause cancer, mainly via lymphatic or blood vessels, and the growth of new tumors in the destination sites of said metastasis.

Many cancers can be treated and some cured, depending on the type, location and stage or phase of development. Once detected, it is treated with the appropriate combination of surgery, chemotherapy and radiotherapy.

Based on latest research, treatments are specified according to the type of cancer, and recently, also to the type of patient.

Pancreatic cancer is one of the most aggressive and devastating types of cancer in developed countries. The overall survival rate is less than 4%, and most patients die within the first year after diagnosis, due to the tumor's rapid spreading and metastatic dissemination.

Located above the abdomen, in the retroperitoneum, the pancreas is closely related to many of the body's main structures, including the portal vein, the stomach, the duodenum, the bile duct and the superior mesenteric artery.

As the tumor grows, the patient's symptoms are the result of the tumor's infiltration in the surrounding structure, causing pain, nausea, vomiting, weight loss and jaundice. Once the tumor's infiltration has taken place, other structures such as the portal vein are affected. Since a pancreatic carcinoma is asymptomatic in its initial stage, it is usually diagnosed (in most cases with the appearance of any of the symptoms indicated above) in an advanced stage of the disease. A late diagnosis has serious consequences, since an expansion to metastasis of the liver or lymph nodes has been observed in 60% of the diagnosed patients, this factor reducing the patient's mean life expectancy.

Effective treatments for pancreatic cancer must achieve two goals: to control the primary tumor mass, both initially and subsequently, and to treat the metastatic tumor cells.

Current therapies for this d iff icu It-to-treat disease include surgery and/or chemotherapy and radiotherapy. Often the tumor cannot be surgically removed, either because it has invaded vital structures that cannot be extracted or because it has spread to distal organs.

Patients with advanced pancreatic cancer are mainly treated using

chemotherapy. The aim of said chemotherapy is to prolong the patient's survival. Surgery and irradiation are used to relieve pain, as well as to reduce the obstruction of the organs.

The effectiveness of current therapies also faces with the resistance of tumor cells of the pancreas to both chemotherapy and radiotherapy treatments. Nevertheless, chemotherapeutic treatments, remain the standard therapies. Treatments with folfirinox and the combination of gemcitabine and nab- paclitaxel have led to some clinical improvement when compared to gemcitabine alone in patients with advanced pancreatic cancer (improved median survival of 4.3 months with folfirinox and of 1 .8 months with the combined treatment). However, tumor recurrence and the strong associated toxicities with folfirinox highlight the necessity to continue investigating for better therapies.

At present, the main objective is to develop a safe and effective treatment for pancreatic cancer, based on the identification of selective therapeutic agents with a potent effect, on both primary tumors and metastatic tumors, and which exhibit low toxicity when systemically administered. In this regard, genetic vaccines, gene therapy or oncolytic virotherapies constitute a group of experimental therapies from which pancreatic ductal adenocarcinoma (hereinafter also referred as "PDAC") patients may benefit in the near future. For designing all these developing molecular engineered therapies, the specificity of targeting neoplastic cells is extremely important to preserve normal cell function in non-tumor tissues with the aim to confer increased safety to the treatment. Therapy using conditionally replicating adenoviruses based on viral replication restricted to carcinogenic cells has emerged as a promising candidate for cancer treatment.

Adenoviruses are non-enveloped viruses having an icosahedral shape. The capsid comprises of 252 capsomeres of which 240 are hexons and 12 are pentons. The replicating cycle of the adenovirus is divided into the early phase (E) and the late phase (L). The late phase defines the onset of viral DNA replication. Following infection, the DNA and protein synthesis are inhibited in the host's infected cells. The lytic cycle of the adenovirus is effective, especially for those of serotypes 2 and 5, and results in the production of approximately 10,000 virions per cell and in the excessive synthesis of viral protein and DNA that are not incorporated in the virion.

Oncolytic adenoviruses can be engineered to specifically target, replicate in and destroy cancer cells. The treatment of pancreatic cancer with oncolytic adenoviruses capable of preserving normal pancreatic function of the nonneoplastic pancreas may be a potent anti-cancer approach offering patients with increased life quality. The main drawback of such therapy is to target the adenovirus specifically to neoplastic cells in order to preserve normal cell function in non-tumor tissues with the aim to confer increased safety to the treatment.

Therefore, in view of the above there is still the need of selective and non- toxic efficient treatments of pancreatic cancer. DESCRIPTION OF THE INVENTION

As it has been stated above, a major concern is raised to confer viral tumor targeting in order to minimize undesirable side effects.

The present inventors have explored to engineer binding sites recognizing hallmark microRNAs, which are differentially expressed in healthy pancreas and pancreatic tumors, to provide selectivity to conditionally replicating adenoviruses (Ad-miRT) and extended the analysis to potential unwanted cellular consequences that could limit miRNA activity in normal cells.

Collectively, the results obtained indicated that adenovirus engineered to control E1A expression by miR-148a recognition, significantly reduce the pancreas and liver damage triggered by an adenovirus while preserving active replication and antitumoral activity in pancreatic cancer cells. As it is shown below, E1A gene expression and viral propagation were efficiently controlled according to miRNA-148a content and miRNA-binding sites in Ad-miRT infected cells. A miRNA-dependent cytotoxic effect on pancreatic cells was detected and strong antitumor responses were recorded in Ad-miRT treated mice. These results provide compelling preclinical evidences for the usage of miR-148a to confer adenoviral selectivity, improving the safety profile of adenoviral-based therapies while retaining full lytic capacity. Moreover, these data highlights miR-148a as candidate miRNA to regulate a broad number of genetically-engineered therapies currently evaluated for the treatment of pancreatic cancer.

Thus, in a first aspect the present invention provides a conditionally replicating adenovirus comprising a heterologous nucleic acid sequence inserted in the 3'UTR region of adenoviral E1 A gene, wherein the heterologous sequence comprises a nucleotide sequence of formula (I):

S1 -E1 -S2-E2-S3-E3-S4-[E4-S5]a-[E5-S6]b-[E6-S7]c-[E7-S8]d-[E8-S9]e-[E9- S10]f(l) wherein: S1 to S10 represent DNA sequences, the same or different from one another, each one of the sequences having a length from 6 to 250 nucleotides and each one of sequences S1 to S10 coding for an RNA that is complementary to the microRNA-148a SEQ ID NO 1 : 5'- UCAGUGCACUACAGAACUUUGU-3';

E1 to E9 represent spacer DNA sequences separating sequences S1 - S10, these spacer sequences being the same or different from one another and having a length from 3 to 20 nucleotides; and

a,b,c,d,e and f are the same or different from one another and represent an integer number selected from 0 and 1 .

At a first stage, the present inventors found that miR-148a was differentially expressed in pancreatic cancer. In particular, it was found that miR-148a was downregulated in pancreatic cancer and that it specifically controlled the E1A gene expression and viral replication in liver and pancreas in line with miR- 148a cellular content. Diminished viral genome copy numbers were found in miR-148a expressing cells.

In good agreement with the adenoviral control of Ad-miRT, minimal pancreas and liver damage was observed when compared to wild-type adenovirus, providing enhanced safety to the administration of the virus. Since intraductal delivery is a locoregional route by which adenoviral transduction of the pancreas is notorious, the present inventors analysed whether throughout intraductal delivery Ad-wt administration was causing any tissue damage and which were the effects of miR-148a controlled adenoviruses. As an indication of pancreatic function the levels of the pancreatic enzymes amylase and lipase in the serum of Ad-miR148a treated mice were assessed. A significant increase in both amylase and lipase was observed upon Ad-wt administration. In contrast, all miR148a-controlled adenoviruses tested showed reduced levels of pancreatic enzymes. These data indicate that diminishing the expression of E1 A protein the pancreatic damage associated to adenovirus administration can be attenuated.

It has been described that the intravenous administration of high amounts of viral particles induces liver damage, mostly associated to the expression of the E1 A viral protein. In the present invention it has been found that the intravenous administration of the adenovirus of the first aspect of the invention attenuated hepatic toxicity when compared to Ad-wt as shown by reduced transaminases and total bilirubin as well as for the liver and serum aspect. This is of great importance because one of the main drawbacks of the oncolytic adenovirus systemic administration is the trigger of hepatic toxicity.

Conditionally replicating adenoviruses are well-known in the state of the art. Said adenoviruses are known as having oncolytic activity. Therefore, in the present invention the expressions "conditionally replicating adenovirus" and "oncolytic adenovirus" have the same meaning and are interchangeably used.

The E1 A gene (whose whole sequence is described in GenBank with number AC_000008.1 ); last update from August 23rd, 2012 is an activator of multiple products of adenoviral genes through activation of the promoters of E1 B, E2, E3 and E4. Region E1A is involved in the transcriptional transactivation of viral and cell genes, as well as in the transcriptional repression of other sequences. Gene E1A exerts an important control on the function of other adenoviral early messenger RNAs. In normal tissues, an active E1A product is necessary for the purpose of efficiently transcribing regions E1 B, E2A, E2B, E3, or E4. The "3'UTR region" is located in the GenBank referred sequence from nucleotide 1324 to nucleotide 1616 (see FIG.1 ).

The term "heterologous" is to be understood as a nucleic acid molecule that has been manipulated by human intervention so that it is located in a place other than the place in which it is naturally found. For example, a nucleic acid sequence from one species may be introduced into the genome of another species, or a nucleic acid sequence from one genomic locus may be moved to another genomic or extrachromasomal locus in the same species. In order to introduce the heterologous sequence in the adenoviral genome, there are well-known techniques in the state of the art (He et al., PNAS, 1998, Chillon M. et al., MMB 201 1 ).

The term "microRNA" (also known as "miRNA" or "miR") is to be understood as a small non-coding RNA molecule (15-22 nucleotides) found in plants and animals, which functions in transcriptional and post-transcriptional regulation of gene expression. Encoded by DNA, miRNAs function via base-pairing with complementary sequences within mRNA molecules, usually resulting in gene silencing via translational repression or target mRNA degradation. MicroRNA-148a sequence is available in the NCBI database updated on January, 7th, 2014, with the gene ID number 406940. The mature form of microRNA-148a has 22 nucleotides and corresponds to SEQ ID NO: 1 .

The term "complementary" means that two nucleic acid molecules contain a sufficient number of nucleotides capable of forming Watson-Crick base pairs to produce a region of double-strandedness between the two nucleic acids. Thus, for instance, guanine in one strand of nucleic acid will pair with cytosine in a complementary strand. It will be understood that each nucleotide in a nucleic acid molecule does not necessarily has to form a matched Watson- Crick base pair with a nucleotide in the opposing complementary strand to form a duplex. In order to consider that a sequence is complementary to sequence SEQ ID NO: 1 , at least 54% of the nucleotides forming the sequence SEQ ID NO: 1 has to form a double strand with the particular "S" sequence (i.e., S1 to S10) under physiological conditions (room temperature from 35 to 37°C and pH from 6.5 to 7.5). And there will be "maximum complementarity" when the "S" sequence hybridizes with the 100% of the nucleotides forming miR-148a sequence under physiological conditions (above referred). Watson-Crick base pair complementarity is associated to the formation of miRNA:mRNA target duplexes. Algorithms calculating the minimum free energy (Kcal/mol) parameter between miRNA:mRNA duplex have been developed to evaluate the thermodynamics of hybridization (Rehmsmeier et al. 2004). In the present case, it can be established that a sequence is complementary to SEQ ID NO: 1 when its minimum free energy is in the range from -15 to -50 Kcal/mol, preferably from -20 to -48 Kcal/mol, and more preferably from -30 to -46 Kcal/mol.

Sequences S1 -S10 and E1 -E9 can be synthesized by any of the well-known protocols available to the skilled person in the art. Illustrative and not limitative examples have been previously described (Brown D. M., 1993). Once synthesized sequences are placed together following well-established protocols, in molecular biology techniques, such are phosphorylation of oligonucleotides, ligation of DNA fragments, insertion into expression plasmid vectors, DNA digestion with restriction enzymes, PCR DNA amplification (Green M. R., 2012).

In one embodiment of the first aspect of the invention, each one of the sequences S1 -S10 is complementary to microRNA-148a region having sequence SEQ ID NO: 2:

5'-CAGUGC-3'

In one embodiment of the first aspect of the invention, each one of the sequences S1 -S10 is complementary to microRNA-148a region having sequence SEQ ID NO: 3:

5'-CAGUGCA-3'

In another embodiment of the first aspect of the invention, each one of the sequences S1 -S10 is complementary to nucleotides 2-8 and 13-16 of microRNA-148a sequence SEQ ID NO: 1 .

In another embodiment of the first aspect of the invention, each one of the sequences S1 -S10 is 100% complementary to the whole microRNA-148a sequence SEQ ID NO: 1 .

In another embodiment of the first aspect of the invention, each one of the sequences S1 -S10 has a length from 6 to 22 nucleotides. In another embodiment of the first aspect of the invention, the nucleotide sequence of formula (I) is one comprising from 4 to 8 DNA sequences, that is to say one in which "e" and "f are zero.

In another embodiment of the first aspect of the invention, the nucleotide sequence of formula (I) is one comprising 4 DNA sequences S1 to S4, that is to say one in which "a" to "f are zero. In another embodiment of the first aspect of the invention, the heterologous sequence comprises a nucleotide sequence of formula (I) where: (a) "e" and "f are zero; and (b) each one of the sequences S1 to S8, are the same or different from one another, have a length from 6 to 22 nucleotides, and code for an RNA sequence complementary to microRNA-148a sequence SEQ ID NO: 1 .

In another embodiment of the first aspect of the invention, each one of the sequences S1 -S10 comprises a sequence selected from the group consisting of SEQ ID NO: 4, SEQ ID NO: 5, and SEQ ID NO: 6:

SEQ ID NO: 4 5' GCACTG 3';

SQ ID NO: 5 5' TGCACTG 3'; and

SEQ ID NO: 6 5' ACAAAGTTCTGTAGTGCACTGA 3'.

In another embodiment of the first aspect of the invention, each one of the sequences S1 to S10 consists of a sequence selected from the group consisting of SEQ ID NO: 4, SEQ ID NO: 5, and SEQ ID NO: 6. Even the sequences SEQ ID NO: 4 to 6 are DNA sequences, the person skilled in the art will understand that the hybridization with miR-148a takes place in the cell, once the adenovirus is administered, enters the cell and the heterologous DNA from the adenoviral genome is transcribed, being such RNA "coded" by the heterologous DNA what hybridizes with miR-148a.

In an embodiment, the nucleotide sequences S1 to S10 are different, hybridizing with the same or different regions of miR-148a. For instance, the adenovirus can include a sequence which hybridizes with SEQ ID NO: 2, and another which hybridizes with SEQ ID NO: 3. Including several sequences complementary to overlapping regions of miR-148a, the resulting adenovirus can show a better efficiency when binding with miR148a and, therefore, the control replication and selectivity is improved.

In another embodiment of the first aspect of the invention, the nucleotide sequence of formula (I) is one in which: (a) "e" and "f are zero; (b) S1 to S8 are DNA sequences the same or different from one another and have a length from 6 to 22 nucleotides.

In another embodiment of the first aspect of the invention, the nucleotide sequence of formula (I) is one in which: (a) "a", "b", "c" and "d" are 1 , and "e" and "f are zero (thus the nucleotide sequence (I) comprises S1 to S8 sequences); (b) the sequences S1 to S8 are the same or different from one another, have a length from 6 to 22 nucleotides; and (c) each one of the S1 to S8 sequences codes for a RNA sequence complementary to microRNA-148a SEQ ID NO:1 .

In still another embodiment of the first aspect of the invention, the nucleotide sequence of formula (I) is one in which: (a) "a", "b", "c" and "d" are 1 , and "e" and "f are zero (thus comprising S1 to S8 sequences); (b) sequences S1 to S8 are the same or different from one another, have a length of 22

nucleotides; and (c) each one of the sequences codes for an RNA sequence complementary to microRNA-148a SEQ ID NO:1 .

In I another embodiment of the first aspect of the invention, the nucleotide sequence of formula (I) is one in which: (a) "a", "b", "c" and "d" are 1 , and "e" and "f are zero (thus the nucleotide sequence (I) comprises S1 to S8 sequences); (b) sequences S1 to S8 are the same from one another; and (c) each one of the S1 to S8 sequences consists fof the sequence SEQ ID NO:6. In one embodiment, the spacer sequences are selected from the group consisting of SEQ ID NO: 7 to 10:

SEQ ID NO: 7 ATGC,

SEQ ID NO: 8 TGCA,

SEQ ID NO: 9 GCAT, and

SEQ ID NO: 10 GATAACACTAGAGATAAC

In another embodiment of the first aspect of the present invention, the present invention provides a conditionally replicating adenovirus comprising an heterologous nucleotide sequence (I) inserted in the 3'UTR region of the adenoviral E1 A gene, wherein such heterologous sequence comprises a nucleotide sequence of formula (I) where: (a) "a" to "d" are one and "e" and "f are zero, in such a way that the nucleotide sequence (I) comprises sequences S1 to S8; (b) sequences S1 to S8 are the same from one another, each one of sequences S1 to S8 consisting of sequence SEQ ID NO:6; and (c) spacer sequences E3 to E7 are the same or different from one another, and are selected from the group consisting of SEQ ID NO: 7 to 10.

In still another embodiment, the nucleotide sequence of formula (I) comprises SEQ ID NO: 1 1 :

SEQ ID NO: 1 1

ACAAAGTTCTGTAGTGCACTGAATGCACAAAGTTCTGTAGTGCACTGAT GCAACAAAGTTCTGTAGTGCACTGAGCATACAAAGTTCTGTAGTGCACT GAGATAACACTAGAGATAACACAAAGTTCTGTAGTGCACTGAATGCACA AAGTTCTGTAGTGCACTGATGCAACAAAGTTCTGTAGTGCACTGAGCAT ACAAAGTTCTGTAGTGCACTGAGTT wherein the underlined fragments correspond to spacer sequences and the sequence in bold, repeated 8 times, consists of SEQ ID NO: 6.

Still in another embodiment of the first aspect of the invention, the nucleotide sequence of formula (I) consists in SEQ ID NO: 1 1 . Still in another embodiment of the first aspect of the invention, the

heterologous nucleotide sequence comprises the sequence SEQ ID NO: 1 1 .

Still in another embodiment of the first aspect of the invention, the

heterologous nucleotide sequence consists of the sequence SEQ ID NO: 1 1 .

In another embodiment of the first aspect of the invention, the heterologous sequence comprises, additionally, a nucleotide sequence of formula (II):

S1 1 -E10-S12-E1 1 -S13-E12-S14-[E13-S15]g-[E14-S16]h-[E15-S17]i-[E16- S18]j-[E17-S19]k-[E18-S20]l (II) wherein

S1 1 to S20 represent DNA sequences, the same or different from one another, each one of the sequences having a length from 6 to 250 nucleotides and coding for an RNA that is complementary to the microRNA-216a SEQ ID NO: 12: 5'- UAAUCUCAGCUGGCAACUGUGA-3';

E10 to E18 represent spacer DNA sequences separating sequences S1 1 -S20, these spacer sequences being the same or different from one another and having a length from 3 to 20 nucleotides; and

g, h, i, j, k, I are the same or different from one another and represent an integer number selected from 0 and 1 . MicroRNA-216a sequence is available in the NCBI database updated on January 19, 2014, with the gene ID number 406998. The mature form of microRNA-216 has 22 nucleotides and corresponds to SEQ ID NO: 12

The term "complementary" means that two nucleic acid molecules contain a sufficient number of nucleotides capable of forming Watson-Crick base pairs to produce a region of double-strandedness between the two nucleic acids. Thus, for instance, guanine in one nucleotide strand will pair with cytosine in complementary strand. It will be understood that each nucleotide in a nucleic acid molecule does not necessarily has to form a matched Watson-Crick base pair with a nucleotide in the opposed strand to form a duplex. In order to consider that a sequence is complementary to sequence SEQ ID NO: 12, at least 54% of the nucleotides forming the sequence SEQ ID NO: 12 have to forme a double strand with the particular "S" sequence (i.e., S1 1 to S20) under physiological conditions (room temperature from 35 to 37°C and pH from 6.5 to 7.5). And there will be "maximum complementarity" when the "S" sequence hybridizes with the 100% of the nucleotides forming miR-148a sequence under physiological conditions (above referred).

Watson-Crick base pair complementarity is associated to the formation of miRNA:mRNA target duplexes. Algorithms calculating the minimum free energy (Kcal/mol) parameter between miRNA:mRNA duplex have been developed to evaluate the thermodynamics of hybridization (Rehmsmeier et al. 2004). In the present case, it can be established that a sequence is complementary to SEQ ID NO: 12 when its minimum free energy is in the range from -15 to -50 Kcal/mol, preferably from -20 to -48 Kcal/mol, and more preferably from -30 to -46 Kcal/mol.

Sequences S1 1 -S20 and E10-E18 can be synthesized by any of the well- known protocols available to the skilled person in the art. Illustrative and not limitative examples have been previously described (Brown D. M., 1993). Once synthesized, sequences are placed together following well-established protocols, in molecular biology techniques, such are phosphorylation of oligonucleotides, ligation of DNA fragments, insertion into expressing plasmid vectors, DNA digestion with restriction enzymes, PCR DNA amplification (Green M. R., 2012).

The expression "heterologous sequence comprises, additionally, a nucleotide sequence of formula (II)" means that the heterologous sequence comprises both sequence of formula (I) and (II), said sequences being consecutive (that is one of them being immediately after the other) or spaced by a spacer sequence having a length from 3 to 20 nucleotides.

In one embodiment, each one of the sequences S1 1 to S20 is complementary to the miRNA-216a region having the sequence SEQ ID NO: 13: 5'AAUCUC3'

In still another embodiment, each one of the sequences S1 1 to S20 is complementary to the microRNA-216a region having the sequence SEQ ID NO: 14:

5'-AAUCUCA-3'.

In still another embodiment, each one of the sequences S1 1 to S20 is 100% complementary to the whole sequence SEQ ID NO: 12. In one embodiment, sequences S1 1 -S20 have a length from 6 to 22 nucleotides.

In another embodiment of the first aspect of the invention, the nucleotide sequence of formula (II) is one comprising from 4 to 8 DNA sequences, that is to say one in which "k" and "I" are zero.

In another embodiment, the nucleotide sequence of formula (II) is one comprising 4 DNA sequences, that is to say one in which "g", "h", "i", "j"_> "k" and "I" are zero.

In another embodiment, the nucleotide sequence of formula (II) is one in which: (a) "k" and "I" are zero; and (b) and each one of the sequences S1 1 to S18 are the same or different from one another, have a length from 6 to 22 nucleotides, and code for an RNA sequence which is complementary to microRNA-216a sequence SEQ ID NO: 12.

In still another embodiment, each one of the sequences S1 1 -S20 comprises a sequence selected from the group consisting of SEQ ID NO: 15, SEQ ID NO: 16, and SEQ ID NO: 17:

SEQ ID NO: 15 5'-GAGATT-3';

SEQ ID NO: 16 5'-TGAGATT-3'; and

SEQ ID NO: 17 5'-TCACAGTTGCCAGCTGAGATTA-3'.

In still another embodiment, each one of the sequences S1 1 -S20 consists of a sequence selected from the group consisting of SEQ ID NO: 15, SEQ ID NO: 16, and SEQ ID NO: 17: As above has been explained, although sequences SEQ ID NO: 15 to 16 are DNA sequences, a skilled person in the art will understand that the

hybridization with miR-216a takes place in the cell, once the adenovirus is administered, enters the cell and the heterologous DNA from the adenoviral genome is transcribed, being such RNA "coded" by the heterologous DNA which hybridizes with miR-216a. In still another embodiment, the nucleotide sequences S1 1 to S20 are different from one another, hybridizing with different regions of miR-216a. For instance, the adenovirus can include sequences hybridizing with SEQ ID NO: 13, and another complementary to SEQ ID NO: 14. Including several sequences complementary to overlapping regions of miR-216a, the resulting adenovirus can show a better efficiency when binding with miR216a and, therefore, the control replication and selectivity are improved.

In another embodiment the nucleotide sequence of formula (II) is one in which: (a) "k" and "I" are zero; (b) each one of the sequences S1 1 -S18 are the same from one another, have a length from 6 to 22 nucleotides and code for an RNA sequence that hybridizes with microRNA-216a SEQ ID NO:12.

In still another embodiment, the nucleotide sequence of formula (II) is one in which: (a) "g", "h", "i" "j" "k" and "I" are zero; and (b) each one of the

sequences S1 1 -S14 are the same from one another, have a length from 6 to 22 nucleotides; and code for an RNA sequence complementary to microRNA- 216a SEQ ID NO:12. In another embodiment, the nucleotide sequence of formula (II) is one wherein: (a) "g", "h", "i", "j", "k" and "I" are zero; and (b) each one of the sequences S1 1 -S14 are the same from one another and consist of SEQ ID NO:17. In still another embodiment, the nucleotide sequence of formula (li) is one in which: (a) "g", "h", "i", "j", "k" and "I" are zero; and (b) each one of the sequences S1 1 -S14 are the same from one another and consist of SEQ ID NO:17; and (c) the spacer sequences E10-E12 are selected from the group consisting of SEQ NO:7 to 10.

In another embodiment, the heterologous sequence comprises a nucleotide sequence of formula (I) and a nucleotide sequence of formula (II), where: (a) the nucleotide sequence of formula (i), is one in which from "a" to "f are zero and each one of the four sequences S1 to S4 consists of SEQ ID NO:6; (b) the nucleotide sequence of formula (II) is one in which "g" and "I" are zero, and each one of the sequences S1 1 to S14 consists of SEQ ID NO:17; and (c) the sequences S4 and S1 1 are spaced by spacer sequence E19, the spacer sequence E19 being selected from the group of sequences consisting of SEQ ID NO: 7to 10. In still another embodiment, the heterologous sequence comprises SEQ ID NO: 18:

SEQ ID NO: 18 ACAAAGTTCTGTAGTGCACTGAATGCACAAAGTTCTGTAGTGCACTGAT GCAACAAAGTTCTGTAGTGCACTGAGCATACAAAGTTCTGTAGTGCACT

GAGATAACACTAGAGATAACTCACAGTTGCCAGCTGAGATTAATGCTCAC AGTTGCCAGCTGAGATTATGCATCACAGTTGCCAGCTGAGATTAGCATTC ACAGTTGCCAGCTGAGATTAGTT wherein the sequence in bold, repeated 4 times, corresponds to SEQ ID NO: 6, the underlined sequence, which is repeated 4 times, corresponds to SEQ ID NO: 17, and the remaining fragments correspond to spacer sequences. Still in another embodiment, the heterologous sequence consists of sequence SEQ ID NO:18.

The present invention can apply to a large number of adenovirus of human origin, and more preferably, to serotype 5.

In good agreement with the adenoviral control of Ad-miRT, minimal pancreatic and liver damage was observed when compared to Ad-wt, suggesting that in a therapeutic setting it might be possible to increase the injection dose, leading to superior therapeutic effects.

Importantly, and in agreement with miR-148a and miR-216a expression, Ad- miRT exhibited similar anti-cancer activity in different pancreatic cancer models as compared with Ad-wt in vitro and in vivo, showing that Ad-miRT maintains a robust anti-tumor activity Taken together, the present inventors have demonstrated the suitability of miR-148a and miR-216a to control Ad-miRT engineered adenoviruses regulating E1 A gene expression, providing oncolytic adenoviruses with enhanced safety and robust antitumoral efficacy against PDAC.

Thus, in a second aspect the present invention provides the conditionally replicating adenovirus as defined above for use as a medicament.

In a third aspect, the present invention provides the conditionally replicating adenovirus as defined above for use in the treatment of cancer. This aspect can be alternatively formulated as the use of the conditionally replicating adenovirus as defined above for the manufacture of a medicament for the treatment of cancer. This aspect can be alternatively formulated as a method for treating cancer, the method comprising administering a therapeutically effective amount of the conditionally replicating adenovirus as defined above in a subject in need thereof.

In an embodiment of the third aspect of the invention, the adenovirus is used in the treatment of pancreatic cancer, either in a primary, or advanced stage, or metastatic pancreas cancer. This embodiment can be formulated as the use of the conditionally replicating adenovirus as defined above for the manufacture of a medicament for the treatment of pancreatic cancer either in a primary, or advanced stage, or metastatic pancreatic cancer. This embodiment can be reformulated as a method for treating pancreatic cancer either in a primary, or advanced stage, or metastatic pancreatic cancer which comprises the administration of a therapeutically effective amount of the adenovirus as defined above, in a subject in need thereof.

In one embodiment, the pancreatic cancer to be treated is pancreatic ductal adenocarcinoma.

The term "therapeutically effective amount" refers to the amount of adenovirus of the invention that, when administered, is sufficient to prevent development of, or alleviate to some extent, one or more of the symptoms of the disease. The term "therapeutically effective amount" also refers to the amount of adenovirus of the invention that is sufficient to elicit the biological or medical response of a cell, tissue, system, animal or human that is being sought by a researcher, veterinarian, medical, doctor or clinician.

In another embodiment of the third aspect of the invention, the adenovirus is used in the treatment of a liver cancer caused by a metastasis of pancreatic cancer.

In a fourth aspect, the present invention provides a pharmaceutical composition comprising the adenovirus of the first aspect of the invention together with pharmaceutically acceptable carrier and/or diluent.

Pharmaceutically acceptable carriers and excipients are well-known to those who are skilled in the art and are readily available. The choice of carrier will be determined in part by the particular method used to administer the

pharmaceutical composition.

In one embodiment, the pharmaceutical composition is administered systematically, preferably it is administered intratumorally, intravenously or intraductally to the common bile duct. There is a wide variety of suitable formulations for the pharmaceutical composition of the present invention. The following formulations and methods are merely exemplary and are in no way limiting. However, injectable formulations are preferred. Formulations suitable for parenteral administration include aqueous and nonaqueous, isotonic sterile injection solutions, which can contain anti-oxidants, buffers, bacteriostats, and solutes rendering the formulation isotonic with the blood of the intended recipient, and aqueous and non-aqueous sterile suspensions that can include suspending agents, solubilizers, thickening agents, stabilizers, and preservatives. The formulation can be presented in unit-dose or multi-dose sealed containers, such as ampoules and vials, and can be stored in a freeze-dried (lyophilized) condition requiring only the addition of the sterile liquid excipient, for example, water, for injections, immediately prior to use. Extemporaneous injection solutions or suspensions can be prepared from sterile powders, granules, and tablets of the kind previously described. The dose administered to an animal, particularly a human, in the context of the present invention will vary with the adenovirus of the invention, the composition containing the adenovirus, the method of administration, and the particular site and organism being treated. The dose should be sufficient to trigger a desirable response, e.g., therapeutic or prophylactic response, within a desirable time frame.

The dose and dosage regimen will depend upon the nature of the cancer (primary or metastatic) and its population, its therapeutic index, the patient, the patient's history and other factors.

In a fifth aspect, the present invention provides a nucleotide sequence of formula (I):

S1 -E1 -S2-E2-S3-E3-S4-[E4-S5]a-[E5-S6]b-[E6-S7]c-[E7-S8]d-[E8-S9]e-[E9- S10]f

(I) wherein

S1 to S10 represent DNA sequences, the same or different from one another, each one of these sequences having a length from 6 to 250 nucleotides and coding for an RNA sequence

complementary to microRNA-148a sequence SEQ ID NO:1 ;

E1 to E9 represent DNA spacer sequences spacing sequences

S1 -S10, being such spacer sequences the same or different from one another and having a length from 3 to 20 nucleotides; and a,b,c,d,e and f are the same or different from one another and represent an integer value that is selected from 0 and 1 .

In a sixth aspect, the present invention provides a nucleotide sequence of formula (II):

S1 1 to S20 represent DNA sequences, the same or different from one another, each one of these sequences having a length from 6 to 250 nucleotides and coding for an RNA sequence

complementary to microRNA-216a sequence SEQ ID NO:12; E10 to E18 represent DNA spacer sequences spacing sequences S1 1 -S20, being such spacer sequences the same or different from one another and having a length from 3 to 20 nucleotides; and g,h,i,j,k,l are the same or different from one another and represent an integer value that is selected from 0 and 1 .

All the embodiments referred for the adenovirus of the first aspect of the invention, related to sequences S1 to S20 and spacer sequences E1 -E18, also apply for the fifth and sixth aspects of the invention.

Throughout the description and claims the word "comprise" and variations of the word, are not intended to exclude other technical features, additives, components, or steps. Furthermore, the word "comprise" encompasses the case of "consisting of. Additional objects, advantages and features of the invention will become apparent to those skilled in the art upon examination of the description or may be learned by practice of the invention. The following examples and drawings are provided by way of illustration, and they are not intended to be limiting of the present invention. Furthermore, the present invention covers all possible combinations of particular and preferred embodiments described herein. Unless differently indicated, the numeric intervals referred throughout the present document include the values of the extremes (for instance, if it is indicated that a sequence includes 6 to 250 nucleotides, the invention includes, among others, a sequence with 6 nucleotides and one with 250).

BRIEF DESCRIPTION OF THE DRAWINGS

FIG. 1 shows part of the E1 A sequence annotated in GeneBank, with accession number AC_000008.1 . The underlined sequence illustrates the 3'UTR E1A region. FIG. 2 shows microRNA selectivity on luciferase activity based on the microRNA content. (A) shows schemes of pLuc-miR216aT, pLuc-miR148aT, pLuc-miR148a148aT and pLuc-miR148a216aT, luciferase reporter plasmids with fully-complementary binding sites for miR-216a and miR-148a. (B) 4x10⁴ HeLa (black bar) or RWP-1 (white bar) cells were seeded and a day later they were co-transfected with the above indicated reporter plasmids and the miR- 216a (p-miR-216a) and miR-148a (p-miR-148a) expression vectors (bars) or an empty control vector (dashed line). 48-hours post-transfection luciferase activity was analyzed (C). 4x10⁴ HeLa cells were seeded and a day later they were co-transfected with the above indicated reporter plasmids and the p-miR- 148a (black bar), p-miR-216a (white bar) expression vectors or an empty vector (grey bar). 48-hours post-transfection luciferase activity was analyzed. The values represent the mean ± SEM. ^*p<0.05 and ^**p<0.01 .

FIG. 3 shows Ad-miRT selectivity based on the microRNA content. (A) schemes of Ad-miR148aT, Ad-miR148a148aT and Ad-miR148a216aT, bearing target sites for the microRNAs in the 3'UTR of E1 A. (B,C) MIA PaCa-2 miR-148a (miRNA positive) cells and MIA PaCa-2 miR-SC and RWP-1 (miRNA negative) cells were transduced with Ad-miRTs at 10vp/cell (MIA PaCa-2 and RWP-1 ) and 48h later cell extracts were obtained. (B) E1A expression was analyzed by Western blot. (C) Viral progeny production studies were performed by hexon immunostaining. The values represent the mean ± SEM. ^*p<0.05.

FIG. 4 shows Ad-miRT selectivity in the pancreas when administered intraductally. C57BI/6J mice (Charles River) were injected with saline solution (n=3), or 2x10¹⁰ vp of Ad-wt (n=6) and Ad-miRTs (Ad-miR148aT (n=6), Ad- miR148a148aT (n=6), Ad-miR148a216aT (n=6)). At day 3 post-administration the animals were killed and the pancreas and blood were collected. (A) shows the results of Western blot analysis of E1A expression in pancreatic tissue extracts. Representative image and quantification. (B) shows the results of E1A expression analyzed by RT-qPCR in pancreatic tissue extracts. (C) shows viral replication assessed by qPCR of the adenoviral gene L3 in DNA extracted from pancreatic tissue. Values correspond to the mean ± SEM.

*p<0.05 and ^** p<0.01 .. (D) shows quantification of E1 A immunohistochemical staining in exocrine pancreas (black bar) and

Langerhans islets (white bar).

FIG. 5 shows serum markers analysis of pancreatic damage after intraductal administration of Ad-wt (n=6) and Ad-miRTs (Ad-miR148aT (n=6), Ad- miR148a148aT (n=6), Ad-miR148a216aT (n=6)). Serum from the animals was obtained 3 days post-viral injection and amylase and lipase activities were determined. Values correspond to the mean +SEM. ^*p<0.05. FIG. 6 shows the oncolytic efficacy of Ad-miRTs in vitro in a battery of pancreatic tumor cells and in mouse tumor xenografts. (A) A total of 3x10³ cells/well RWP-1 , MIA PaCa-2 miR-SC and MIA PaCa-2 miR-148a, were plated in triplicate and infected with a dose range from 0,001 to 1000 vp/cell of Ad-wt or Ad-miRTs (Ad-miR148aT, Ad-miR148a148aT and Ad- miR148a216aT). Four days later, cell viability was determined by MTT (USB) assay, following the manufacturer's instructions. The data were expressed as the percentage of absorbance of treated cells against those not treated. Dose- response curves were represented and the value of ID50 was calculated by a nonlinear model based on the Hill equation. Mixed models were used for statistical analysis for the dose-response curves. Values of ID50 were relativized and are presented as the mean ± SEM of 4 independent

experiments. Representative images of cytotoxic activities are shown. (B) Animals bearing MIA PaCa-2 subcutaneous tumors were randomized to five groups: saline (-·-) (n=8 tumors), Ad-wt (-■-) (n=8 tumors), Ad-miR148aT (-Δ- )(n=8 tumors), Ad-miR148a148aT (-♦-) (n=8 tumors) and Ad-miR148a216aT (n=8 tumors) (-V-). A dose of 5-10¹⁰ vp/tumor was intratumorally administered at days 8 and 16 after cell inoculation. Tumor growth curves are represented as the tumor volume mean ±SEM. Fold-change in tumor volume at day 35 relative to the tumor volume at the time of the first viral administration is also represented with scatter dot plot and median and interquartile range. ^*p<0.05 and ^** p<0.01 .

FIG. 7 shows Ad-miRT selectivity when administered intravenously. Mice were injected with saline solution (n=3), or 2x10¹⁰ vp of Ad-wt (n=6) or Ad- miR148a148aT (n=6). At day 3 post-administration the animals were killed and liver, pancreas and kidney were collected. (A) Western blot analysis of E1A expression in liver tissue extracts. Representative image and

quantification. (B) E1A expression analyzed by RT-qPCR in tissue extracts: liver (black bar); pancreas (white bar); kidney (grey bar). Expression was normalized to Gdx. (C) viral replication assessed by qPCR of the adenoviral gene L3 in DNA extracted from liver (black bar); pancreas (white bar); kidney (grey bar). Values correspond to the mean +SEM. ^*p<0.05 and ^** p<0.01 .

FIG. 8 shows Ad-miR148a148aT reduced toxicity and increased survival when administered intravenously. (A) serum markers analysis of liver damage after intravenous administration of Ad-wt (n=6) and Ad-miR148a148aT (n=6).

Serum from the animals was obtained 3 days post-viral injection. Aspartate aminotransferase (AST) (black bar), alanine aminotransferase (ALT) (white bar) and total bilirubin (grey bar) activities were determined. (B) Impact of viral dose on mice survival. Mice were injected with 2x10¹⁰ vp of Ad-wt (n=5) (a), 2x10¹⁰ vp of Ad-miR148a148aT (n=5) (b), 4x10¹⁰ vp of Ad-wt (n=5) (c), 4x10¹⁰ vp of Ad-miR148a148aT (n=5) (d) and 6x10¹⁰ vp of Ad-miR148a148aT (n=5) (e). Survival was analyzed with Kaplan-Meier curves and Log-rank test.

Values correspond to the mean +SEM. ^*p<0.05 and ^** p<0.01 . EXEMPLES

1 . Patient samples

Tumor samples were obtained from patients who undergo resection for pancreatic adenocarcinoma at the Hospital Clinic, Barcelona. All tissue specimens were obtained according to the Institutional Review Board- approved procedures for consent.

2. Determination of microRNA expression by RT-qPCR

Total RNA extracts were obtained from cell or tissues using miRNeasy Mini RNA Extraction Kit (Qiagen). RNA concentration and quality were assessed using a spectrophotometer (Nanodrop -Thermo Scientific). A total of 10 nanograms total RNA were reverse transcribed using a reverse transcriptase and stem-loop primers as indicated by the manufacturer (TaqMan MicroRNA Reverse Transcription Kit - Applied Biosystems). One and a half microliters of the reaction was used as a template for the qPCR amplification reaction (TaqMan Universal Master Mix, No AmpErase UNG - Applied Biosystems) in a thermocycler (ViiA 7 Real-Time PCR system - Applied Biosystems). Stem-loop primers and qPCR probes were purchased (TaqMan MicroRNA assay (Applied Biosystems): RNU6B (AB ID: 001093), hsa-miR-148a (AB ID: 000470), hsa-miR-216a (AB ID: 002220), hsa-miR-375 (AB ID: 000564)).

3. Constructs

A. pLuc-miR148aT,pLuc-miR216aT, pLuc-miR148a148aT and pLuc- miR148a216aT

Four oligonucleotide sequences of 1 18 base pairs (bp) were designed to contain 4 fully complementary target sites for miR-148a (SEQ ID NO: 6) or miR-216a (SEQ ID NO: 17) separated by three random sequences of 4 nucleotides (ATGC, TGCA, GCAT), (SEQ ID NO: 7 to 9) , an Hpal restriction site at 5' and 3' extremes plus the restriction site ends for Xbal.

MiR-148a SEQ ID NO: 19:

CTAGAGTTAACACAAAGTTCTGTAGTGCACTGAATGCACAAAGTTCTGTA GTGCACTGATGCAACAAAGTTCTGTAGTGCACTGAGCATACAAAGTTCTG TAGTGCACTGAGTTAACT;

MiR-148a SEQ ID NO: 20:

CTAGAGTTAACTCAGTGCACTACAGAACTTTGTATGCTCAGTGCACTACA GAACTTTGTTGCATCAGTGCACTACAGAACTTTGTGCATTCAGTGCACTA CAGAACTTTGTGTTAACT

MiR-216a SEQ ID NO: 21 :

CTAGAGTTAACTCACAGTTGCCAGCTGAGATTAATGCTCACAGTTGCCAG CTGAGATTATGCATCACAGTTGCCAGCTGAGATTAGCATTCACAGTTGCC AGCTGAGATTAGTTAACT

MiR-216a SEQ ID NO: 22:

CTAGAGTTAACTAATCTCAGCTGGCAACTGTGAATGCTAATCTCAGCTGG CAACTGTGATGCATAATCTCAGCTGGCAACTGTGAGCATTAATCTCAGCT GGCAACTGTGAGTTAACT

These oligonucleotides (1 18-mer) were chemically synthesized and HPLC purified (Bonsaitech, Madrid, Spain). Sequences SEQ ID NO: 19 to 22 (100 pmol) were annealed by incubating them in a buffered solution (20 nM Hepes pH 7.4 and 100 mM NaCI) at 95°C for 4 minutes to denaturize secondary structures, and then incubated at 70°C for 10 minutes to facilitate the pair base recognition. The annealed oligonucleotides were phosphorylated (T4 Polynucleotide Kinase - New England Biolabs) as describe by the

manufacturer. Luciferase expression vector pGL4.13 (Promega) was digested with Xbal (Fermentas) and phosphorylated oligonucleotides were cloned in the Xbal restriction site by DNA ligation (T4 DNA ligase - Roche). This procedure allowed generating pLuc-miR148aT and pLuc-miR216aT. Both, pLuc-miR148aT and pLuc-miR216aT were used as templates to generate pLuc-miR148a148aT, and pLuc-miR148a216aT. To this end the first Xbal restriction site was mutagenized to eliminate enzyme recognition

(QuickChange Multi Site-Directed Mutagenesis Kit - Stratagene) and facilitate further cloning of fragments containing miR-148a and miR-216a target sites into the second Xbal restriction site. For this procedure the following primers were used:

Mutagenesis pLuc-miR148a148aT SEQ ID NO: 23 :

AAAGTTCTGTAGTGCACTGAGATAACACTAGAGATAACACAAAGTTCTGT AGTGC

Mutagenesis pLuc-miR148a216aT SEQ ID NO: 24 :

GTTCTGTAGTGCACTGAGATAACACTAGAGATAACTCACAGTTGCCAGC

B. pEndK-miR148aT, pEndK-miR148a148aT and pEndK-miR148a216aT

Adenoviral plasmid shuttle pEndK (Rojas JJ Mol. Ther. 2010) coding for the E1 A gene was digested with Hpal (Fermentas) to insert DNA fragments containing miR148aT (heterologous sequence applying formula (I): where S1 , S2, S3 and S4 corresponds to SEQ ID NO: 6 and E1 corresponds to SEQ ID NO: 7, E2 corresponds to SEQ ID NO: 8 and E3 corresponds to SEQ ID NO: 9), miR148a148aT (SEQ ID NO: 1 1 ), or miR148a216aT (SEQ ID NO: 18) resulting from the digestion of the corresponding plasmids pLuc-miR148aT, pLuc-miR148a148aT, or pLuc-miR148a216aT, with Hpal. To this end, the DNA fragments were cloned in the Hpal restriction sites by DNA ligation (T4 DNA ligase - Roche), following manufacturer's instructions. With this procedure plasmids pEndK-miR148aT, pEndK-miR148a148aT and pEndK- miR148a216aT were generated. Previously, internal Xbal and Hpal restriction sites in pLuc-miR148a148aT and pLuc-miR148a216aT were mutagenized to eliminate undesired restriction.

C. miR-148a and miR-216a expression vectors (p-miR-148a, p-miR-216a, and p-miR-SC)

Vectors expressing miR-148a (p-miR-148a) and miR-216a (p-miR-216a) were generated from retroviral vectors (pBabe-puro - Addgene plasmid 1764) (Morgenstern JP, Land H., 1990, Nucleic Acids Research 18(12):3587-96.). PCR products containing target microRNAs were obtained by amplification of human genomic DNA with the indicated primers containing the Hind 111 restriction site:

148fw SEQ ID 25 : 5'-GGGAAGCTTGTTCCATTATCGGTCGCATC-3' 148rv SEQ ID 26 : 5'-CCCAAGCTTTTGGTCAAGTTCCTCGTGCT-3' 216fw SEQ ID 27 : 5'-GGGAAGCTTGCGAATCCAATAAAGGCAAA-3' 216rv SEQ ID 28: 5'-CCCAAGCTTAGGGGTACATCAGGGCTTCT-3'

Both PCR products were cloned in the Hind II I site of the pBabe-puro retroviral vector. This vector drives the expression of cloned genes through the SV40 promoter. Control vector expressing a scrambled microRNA (p-miR-SC) was generated from p-miR-148a by site-directed mutagenesis as described by the manufacturer (QuickChange Multi Site-Directed Mutagenesis kit - Stratagene) using the following primer: miR-SC mutagenesis SEQ ID NO: 29:

CCACAGCCTCTAGAGACAAAGTTCTGTAGGCGTGCAACTTCTATCATACT CAGAGTCGGAGTGTC

D. Cell Lines

RWP-1 pancreas adenocarcinoma line was obtained and cultured as previously described (Huch et al., 2006,). The following cell lines from the American Type Culture Collection (ATCC; Rockville, MD) were used: HEK293 (ATCC CRL-1573), HeLa (ATCC CCL-2), MIA PaCa-2 (ATCC CRL-1420). A549 cells (ECACC86012804) were obtained from the European Collection of Cell Cultures (Wiltshire, UK). MIA PaCa-2 miR-148a and MIA PaCa-2 miR-SC cells were obtained in the laboratory by transfection of MIA PaCa-2 parental cells. For this purpose, MIA PaCa-2 cells were transfected withp-miR-148a and p-miR-SC and, 24 hours later, they were selected with puromycin (the commercial plasmid used contains the gene encoding for puromycin resistance). Different clones were isolated and tested for miR-148a

expression.

E. Luciferase assays Transient transfections were performed in HeLa and RWP-1 cell lines, 24 hours after seeding in a 24 multiwell plate, with CalPhos Mammalian

Transfection Kit (Clontech, Takara Bio Group, France) according to the manufacturer's protocol. For this, 20 ng of pLuc plasmids (obtained as explained above) together with 10 ng of Renilla luciferase commercial vector (pGL4.75, Promega Corporation, Madison, USA) were used to normalize transfection efficiency. MicroRNA expression plasmids were transfected at 700 ng per well. Luciferasa protein extracts were obtained from transfected cells, washing them with passive lysis buffer (PLB). Then extracts were frozen and thawed three times, and then volumes of 10 microliters were loaded into the reading white plates. pLuc and renilla luciferase activity were measured according to Dual luciferase Reporter Assay System manufacturer protocol (Promega) with a spectrophotometer (Synergy HT - BioTek).

F. Adenoviruses: Ad-miR148aT, Ad-miR148a148aT and Ad-miR148a216aT pAdeno-miRTs (pAdeno-miR148aT, pAdeno-miR148a148aT,containing SEQ ID NO: 1 1 and pAdeno-miR148a216aT,containing SEQ ID NO: 18) were generated by homologous recombination of pEndK-miRTs (pEndK-miR148aT, pEndK-miR148a148aT and pEndK-miR148a216aT) with the genome of the serotype 5 wild-type adenovirus (Ad-wt) in E. Coli BJ5183 cells (Stratagene 200154) as previously described (He et al., PNAS, 1998, Chillon M. et al., MMB 201 1 ). HEK293 cells were transfected with the resulting adenovirus of the homologue recombination and following 5 cycles of amplification (He et al., PNAS, 1998) in A549 cells, they were purified by cesium chloride gradient. The Ad-wt adenovirus was obtained from the ATCC with reference VR5 (Manassas, VA).

With the aim of determining the exact concentration of the viral material to be administered in the biological activity tests, Ad-miRTs were titrated. The concentration of physical viral particles (vp/mL) was determined by means of optical density analysis (OD260) and that of infectious particles (pfu/mL) by means of hexon immunostaining (Cascante et al. 2007) in HEK293 cells. All viruses presented the same vp and pfu ratio.

4. Western blot analysis

Confluent cultures were resuspended in a lysis buffer (50mM Tris.CI pH 6.8, 2% SDS) containing 1 % Complete Mini Protease Inhibitor (Roche Diagnostics GMBH) and the resulting suspension was boiled for 10 min at 98°C. Cell lysates were centrifuged for 10 min. at 16000xg and the cell debris was discarded. Protein concentration was determined by BCATM Protein Assay Kit (Pierce, Thermo Fischer Scientific Inc, IL, USA). A total 70 g of protein were resolved by electrophoresis on 7.5% acrylamide gels (40 mA for 1 h 30 min) and transferred to nitrocellulose membranes under the following conditions: 400mA for 1 h. Membranes were immunoblotted with an anti-Adenovirus-2/5 E1 A (Santa Cruz Biotech), or anti-GAPDH (MilliPore) overnight at 4°C. Then the blots were rinsed with TBS-T and incubated for 1 hour at room

temperature with either HRP-conjugated anti-rabbit or anti-mouse IgG antibodies (DakoCytomation; Glostrup, Denmark). Antibody labeling was detected by the enhanced chemiluminesce method (ECL - Amersham

Biosciences Inc.).

5. Viral progeny production analysis

Progeny viral production of Ad-miRTs in MIAPaca-2 miR-148a, MIAPaca-2 miR-SC and RWP-1 cells was analyzed. Thus, cells were transduced with 10 vp/cell Ad-wt, Ad-miR148aT, Ad-miR148a148aT or Ad-miR148a216aT. Three days post-infection transduced cells were submitted to 3 cycles of freeze and thaw and resulting total cell lysates were used to assess for the viral progeny production. Titration was performed by hexon immunostaining in HEK293 cells (Cascante et al. 2007).

6. Pancreatic intraductal administration

Adenovirus intraductal administration was performed as previously described (Jose et al., 2013).

To administer adenoviruses, those are formulated in saline solution at 0.9 % NaCI. C57BI/6J mice (Charles River France, Lyon, France) were injected with 2x10¹⁰ vp of Ad-wt (n=6), Ad-miR148aT, Ad-miR148a148aT or Ad- miR148a216aT (n=6 for each virus) or 0.9 % NaCI saline solution (n=3), via the common bile duct in a final volume of 50 microliters. At day 3, blood samples were obtained by cardiac puncture under anesthesia. Then, mice were killed and different organs were collected and cryopreserved until their subsequent processing with the aim to analyse parameters related to viral replication and selectivity, among others. Pancreatic lesion biomarkers (amylase and lipase) were determined in an Olympus AU400 Analyzer.

7. Determination of the viral DNA in tissues

DNA was obtained from different tissues (pancreas, liver, kidneys) of the animals which had been injected with saline or the different viruses, as has been described in previous section 6. Frozen tissues were incubated in a buffer solution containing RNasaA 0.2 mg/mL (Sigma-Aldrich) and protease K 0.1 mg/mL (Invitrogen), overnight at 55°C. Viral DNA content was determined by real-time PCR assay (100 ng of DNA) with SYBER Green (Roche

Diagnostics). The following primers of the adenoviral L3 gene (AC000008) were used in order to quantify the amount of viral genomes:

SEQ ID NO: 30: 5' GCCGCAGTGGTCTTACATGCACATC 3'; and

SEQ ID NO: 31 : 5' CAGCACGCCGCGGATGTCAAAG 3'.

The number of adenovirus copies was quantified by interpolation on a standard curve consisting of viral DNA dilutions (100-10⁷ copies) in the presence of background genomic DNA. Samples and standard concentrations were amplified in triplicate. The mean value of the number of copies was expressed as viral genomes/mg tissue.

8. Immunohistochemistry and quantitative analysis

Five micrometer sections of adenovirally treated mice pancreas samples (obtained as explained above in section 6) were deparaffinized, rehydrated and treated with 10 mM citrate buffer (pH 6.0) in order to detect the presence of the adenoviral E1A expression. To this end, sections were incubated overnight with anti-Adenovirus 2/5 E1A (13 S-5) antibody (1/200) (Santa Cruz Biotech). The universal antibody detection with LSAB2+ system-HRP (Dako) was used. Sections were counter-stained with Mayer's Hematoxylin and examined under an Olympus BX43 Multi-observer microscope.

A total of 15 sections having an area of 358.800 square micrometers were counted to estimate the number of E1 A-positive cells per area in the pancreas for each treatment group. A mean of 30 Langerhans islets were analyzed per treatment group. The total surface area analyzed was similar for each of the different viral groups. Image analysis was assessed using ImageJ software (NIH). The number of E1 A-positive cells/1 OOOmicrom² was calculated according to the formula: [N (cell/1 OOOmicrom²) = N E1 A-positive cells / Analyzed area (microm²) x 1000].

9. Determination of gene expression by RT-qPCR

A total of one microgram of RNA from samples indicated in Tables 1 -4 and figures FIG. 4B and 7B was reverse transcribed using Moloney Murine Leukemia Virus reverse transcriptase and oligo(dT) (Ambion, Austin, TX). One microliter of the reaction was used as a template for the qPCR amplification reaction (LightCycler 480SYBER Green I Master Mix -Roche) in a

thermocycler (ViiA 7 Real-Time PCR system - Applied Biosystems).

The primers used for E1A were:

SEQ ID NO: 32: 5' CGGCCATTTCTTCGGTAATA 3', and

SEQ ID NO: 33: 5' CCTCCGGTGATAATGACAAG 3'. The primers used for Gdx were:

SEQ ID NO: 34: 5' GGCAGCTGATCTCCAAAGTCCTGG 3', and

SEQ ID NO: 35: 5' AACGTTCGATGTCATCCAGTGTTA 3'.

10. Systemic administration

Systemic administration of adenovirus (previously formulated with saline solution at 0.9% NaCI) was performed by tail vein injection. C57BI/6J mice (Charles River France, Lyon, France) were injected with 2x10¹⁰ vp of Ad-wt (n=6), Ad-miR148a148aT (n=6) or 0.9 % NaCI saline solution (n=3), in a final volume of 50 microliters. The weight of the animals was monitored daily. At day 3, blood samples were obtained by cardiac puncture under anesthesia. Then mice were killed and different organs were collected and cryopreserved until their subsequent processing. Liver lesion biomarkers (aspartate aminotransferase, alanine aminotransferase and total bilirubin) were determined in an Olympus AU400 Analyzer.

1 1 . In vitro cell survival studies

Dose-response curves were constructed for MIAPaCa-2 miR-148a,

MIAPaCa-2 miR-SC and RWP-1 . Cells were transduced with doses ranging from 0,001 vp/cell to 1000 vp/cell of Ad-wt, Ad-miR148aT, Ad-miR148a148aT or Ad-miR148a216aT. Cell viability was measured by a colorimetric assay (MTT Ultrapure - USB Corporation) 3 days post-infection. Culture survival of cells infected at a unique dose was additionally assessed by methylene blue staining (Sigma).

12. Tumor growth studies

A xenograft model was developed as follows. A total of 2.5x10⁶ MIA PaCa-2 cells embedded in a natural matrix (Matrigel - BD Biosciences) were inoculated subcutaneously (s.c) in the posterior flanks of BALB/c nude mice (Charles River France, Lyon, France). Tumors were measured 3 times week and the volumes were calculated according to the formula: V (mm³) = larger diameter (mm) x (smaller diameter)² (mm²) x pi /6. Treatment was initiated at day 8-post implantation when the tumors achieved a mean volume of 160 mm³. Next, tumors were treated with 5x10¹⁰ vp of Ad-wt (n=4 mice; n=8 tumors) or Ad-miR148aT, Ad-miR148a148aT or Ad- miR148a216aT (each virus n=4 mice; n=8 tumors); or 0.9 % NaCI saline solution (n=4 mice; n=8 tumors) were injected intratumorally. Adenoviral solutions were previously formulated in saline solution 0.9 % NaCI. All experimental groups received a second dose of virus administered as described above at day 16. All procedures followed in handling the laboratory animals were approved by the animal experimentation committee of the Regional Government of Catalonia and were developed following the guidelines of the European Community Directive 86/609/EEC.

13. Statistical analysis The statistical analysis was carried out using the GraphPad Prism software package (GraphPad Prism v5.0a - GraphPad Software). Results are expressed as the mean ± standard error of the mean (SEM). The

nonparametric tests (Mann-Whitney or Kruskal-Wallis) were applied for the (2- tailed) in vitro and in vivo studies. In the survival analyses, the log-rank test was used in order to calculate statistical significance. Tumor growth was analyzed with general linear-mixed models in order to estimate the effects of the treatments on tumor growth, taking repeated measures design into account (Heitjan et al., 1993). This analysis was performed with SPSS software (IBM SPSS Satatistics 20 - IBM). A value of p lower than or equal to 0.05 was considered significant.

Results

A) miR-148a and miR-216a are abundantly express in human and rodent pancreas but are lost in PDAC

A quantitative RT-PCR was performed in order to confirm the downregulation of miR-148a and miR-216a in primary tumors that were surgically resected before administration of chemotherapy. These tumors were classified as resectable (n= 9), locally advanced (n=1 1 ), metastatic (n= 9) and a control group of healthy pancreas (n=10). q RT-PCR validated miR-148a (AB ID: 000470) and miR-216a (AB ID: 002220) content was significantly reduced all PDAC groups (TABLE 1 .).

TABLE 1

Very low expression was also observed in neoplastic cell lines of pancreatic ductal cancer origin. Expression of miR-148a was detected in the engineered cell line MIA PaCa-2 miR-148a (TABLE 2).

TABLE 2

In healthy mouse pancreas both miRNAs were highly expressed. They were detected in the exocrine part of the pancreas and miR-148a was also present in the Langerhans islets (TABLE 3).

TABLE 3

Exocrine Langerhans

Pancreas Islets

2^Δα miR-148a 978.1 ± 275.6 134.0 ± 14.1

2^Δα miR-216a 37.0 ±9.8 0.0 ± 0.0

2^Δα miR-375 290.1 ± 59.0 1420.8 ± 193.4 These data confirms the loss of miR-148a and miR-216a in pancreatic tumors and revealed their abundance in healthy pancreas, reporting the presence of miR-148a in the Langerhans Islets. B) miR-148a and miR-216a control transgene expression

In order to assess the miR-148a and miR-216a repression abilities, on transgenes containing recognition sequences for both miRNAs, reporter plasmids (pLuc-miR216aT, pLuc-miR148aT, pLuc-miR148a148aT or pLuc- miR148a216aT) (FIG. 2A) with p-miR-216a or p-miR-148a expression vectors in HeLa cells (as it has been disclosed above under section (E)) . It was observed a reduction in luciferase expression. Increased reduction was obtained with plasmids containing 8 binding sites with a similar response between those engineered with 8-miR-148aT targets or those with 4-miR- 148aT+4-miR-216aT targets. Similar results were observed in the pancreatic cancer cell line RWP-1 (FIG. 2B). The inhibition was specific because no reduction in transgene expression was observed when pLuc-miR216aT with p-miR-148a or pLuc-miR148aT with p-miR-216a were co-transfected (FIG. 2C).

C) miR-148a and miR-216a selectively control E1A expression and viral replication

Three different adenoviruses Ad-miR148aT, Ad-miR148a148aT and Ad- miR148a216aT in which miR binding sites were engineered at the 3'UTR of the E1 A gene were generated on the genome of adenovirus (Ad5) as previously detailed in the section 3.F . In all the experiments Ad5 wild-type (Ad-wt) was used as control virus (FIG. 3A). To test the selective capacity of the different adenoviruses, MIAPaCa-2 cells stably expressing miR-148a (MIAPaCa-2 miR-148a), or seed-scrambled miR- 148a, unable of recognizing miR-148a targets (MIAPaCa-2 miR-SC) (see protocol detailed in previous section 3.C) were infected. E1A expression analysis shows a miRNA content dependent regulation. Thus, a strong inhibition was observed in MIAPaCa-2 miR-148a cells, by the three viruses whereas no effect was detected in MIAPaCa-2 miR-SC cells neither in RWP-1 cell line, both miR-148a and miR-216a double negative (FIG.3B).

Then, it was assessed whether miR-148a and miR-216a content influenced viral replication. Atenuation of viral replication in MIAPaCa-2 miR-148a cells infected with each one of the Ad-miRT, was observed. Comparable viral replication of Ad-miRT to Ad-wt was observed in the miR-148a and miR-216a negative MIAPaCa-2 miR-SC and RWP-1 cells (FIG. 3C). To evaluate in mouse pancreas whether miR-148a and miR-216a could successfully control adenovirus, 2x10¹⁰ vp/mouse of Ad-wt, Ad-miR148aT, Ad- miR148a148aT or Ad-miR148a216aT were injected into the common bile duct of C57/BI6 mice. This route of administration was selected as being a highly efficient approach to deliver adenovirus to the pancreas (Jose et al, 2013). Three days after viral administration, E1A expression and presence of viral genomes were analyzed. E1 A was highly expressed in the pancreas of mice receiving Ad-wt, both at the protein and mRNA levels. Nevertheless a highly significant reduction in E1A expression was observed in the groups receiving Ad-miR controlled viruses (FIG. 4A, 4B). E1 A gene expression was detected both in the exocrine and in the Langerhans islets in the pancreas of mice injected with Ad-wt whereas a significant reduction in the number of positive cells in both structures was observed in Ad-miR148a148aT (containing SEQ ID NO: 1 1 ) and Ad-miR148a216aT (containing SEQ ID NO: 18) treated pancreas. Ad-miR148aT treated mice also showed reduction in the exocrine pancreas (FIG. 4C).

Despite the impairment of human Ad5 to productively replicate in mice, certain level of replication exist in murine tissues. It was investigated whether miR- controlled adenoviruses could attenuate viral replication in pancreas. Mice intraductally injected with Ad-wt presented an average of 9x10⁷ genomes/mg pancreas, that represent approximately 2-fold more genome copies compared to the total amount of virus injected, suggesting some degree of replication. The analysis of viral genome content in Ad-miR148a148aT and Ad- miR148a216aT treated mice, showed 5x10⁷ and 4x10⁷genomes/mg tissue respectively, similar to the input dose, indicating lack of replication (FIG. 4D). These data confirm that miR-148a and miR-216a suppress E1A and that the adenovirus controlled by SEQ ID NO: 1 1 or SEQ ID NO: 18 allow reduced viral replication in healthy mouse pancreas.

D) miR-148a and miR-216a controlled adenoviruses reduce pancreatic damage

Since by the intraductal delivery adenoviral transduction of the pancreas is notorious, it was investigated whether Ad-wt administration was causing any tissue damage and which were the effects of miR-148a and miR-216a controlled adenoviruses. As an indication of pancreatic function we assessed the levels of the pancreatic enzymes amylase and lipase in the serum of untreated and Ad-wt, Ad-miR148aT, Ad-miR148a148aT and Ad- miR148a216aT treated mice (as it has been detailed in previous section 6). A significant increase in both amylase and lipase was observed upon Ad-wt administration. In contrast, Ad-miRT treated animal serums showed reduced levels of the pancreatic enzymes (FIG. 5). These data indicated that diminishing the expression of E1 A protein, pancreatic damage could be attenuated. E) Ad-miR148aT, Ad-miR148a148aT and Ad-miR148a216aT retain full lytic potency and induce an anti-tumor activity similar to Ad-wt

To evaluate whether Ad-miR148aT, Ad-miR148a148aT and Ad- miR148a216aT oncolytic activity can be regulated by miR-148a and miR- 216a, cell viability assays were performed in cell lines expressing miRNAs variable levels and the ID50 values were calculated. MIA PaCa-2-miR-148a cells infected with miR-controlled viruses were less cytotoxic than those Ad- wt-infected. However, no differences in cell viability were detected in MIA PaCa-2 miR-SC cells nor in RWP-1 , both negative for miR-148a and miR- 216a when infected with different adenovirus (FIG. 6A). Next, the anti-tumor efficacy of the different viruses in a MIA PaCa-2 xenograft model (generated as detailed in section 12) was assessed. Mice bearing subcutaneous tumors were treated intratumorally with two doses of 5x10¹⁰ vp/tumor administered once a week. Treatment with the different viruses produced a significant inhibition of tumor growth. In the control group (treated with saline solution) an increased volume from 3 to 10-fold was observed over a 27 day period, whereas in treated groups with different virus there was a strong delay in tumor progression and a regression in tumor volume was observed in some animals (FIG 6B). In agreement with the in vitro assays miR-controlled viruses presented similar in vivo antitumor effects to Ad-wt.

F) miR-148a regulation of Ad-miR148a148aT selectively supresses E1A expression and viral replication after systemic administration miR-148a analysis in murine tissues showed a remarkable expression in healthy pancreas and very reduced levels in healthy kidney, selected as negative control of miR-148a expression. On the other hand miR-216a was found to be highly specific of pancreatic tissue and was not detected in any of the other studied tissues (TABLE 4). TABLE 4

Treatment of pancreatic cancer metastasis requires the intravenous administration of the virus. However, notorious virus-related liver toxicity has been described upon systemic administration. Since miR-148a showed some expression in liver and pancreas, it was decided to explore Ad-miR148a148aT tissue-specific control upon i.v. administration. A strong inhibition in E1A protein expression, of 70-80%, was detected in the liver of Ad-miR148a148aT compared to Ad-wt (FIG. 7A). Reduced E1 A mRNA was detected in liver and pancreas, whereas similar E1A expression was observed in the kidney of animals treated with virus (FIG. 7B). The analysis of viral genomes also showed a reduction in viral genomes in liver and pancreas of Ad- miR148a148aT treated mice but similar levels in the kidney of Ad- miR148a148aT and Ad-wt treated mice were found (FIG. 7C).

These results show the liver and pancreatic control of Ad-miR148a148aT, containing SEQ ID NO: 1 1 , upon systemic administration. And are indicative of the potential of the adenovirus of the invention in the treatment of

metastasis in such organs.

G) Ad-miR148a148aT reduces liver damage after systemic injection

To evaluate the safety of Ad-miR148a148aT i.v. administration serum alanine aminotransferase (ALT), Aspartate aminotransferase (AST) and total bilirrubin were assessed in the serum of Ad-wt and Ad-miR148a148aT i.v. treated mice. Mice administered with Ad-wt showed significantly increased levels of the different markers (100 times higher than mice treated with saline) suggesting that substantial liver damage has occurred. Mice administered with Ad- miR148a148aT showed approximately a 10-fold less serum of ALT, AST and total bilirubin demonstrating that much less liver toxicity has occurred with Ad- miR148a148aT (FIG. 8A). Confirmation of the reduced toxicity came from the macroscopic analysis of the livers, and the reduced appearance of bright yellow sera.

In order to deeply analyse the biosecurity of Ad-miR148a148aT, a dose- escalating experiment was performed and the animal survival was monitored for 15 days. An i.v. injection of a 2-10¹⁰ vp dose of Ad-wt and Ad- miR148a148aT, gave rise to a survival of about 20% and 80%, respectively. The maximum-tolerated dose could be increased by 2-fold with Ad- miR148a148aT (FIG. 8B). These data suggests that by systemic Ad- miR148a148aT, containing SEQ ID NO: 1 1 , administration it would be feasible to increase the therapeutic dose, potentially leading to improved anticancer efficacy .

REFERENCES Cascante et al., "GCV modulates the antitumoural efficacy of a replicative adenovirus expressing the Tat8-TK as a late gene in a pancreatic tumour model", 2007, Gene Ther, v. 14, p.1471 -1480;

Chillon M, Alemany R., "Methods to construct recombinant adenovirus vectors", 201 1 , Methods Mol. Biol., v. 737, p.1 17-138; He et al., "A simplified system for generating recombinant adenoviruses", 1998, Proc. Natl. Acad. Sci. USA, v. 95, p. 2509-2514;

Heitzan et al., "Statistical analysis of in vivo tumor growth experiments", 1993, Cancer Res., v. 53, p. 6042-6050;

Huch et al. "Targeting the CYP2B 1 /cyclophosphamide suicide system to fibroblast growth factor receptors results in a potent antitumoral response in pancreatic cancer models", 2006, Hum. Gene Ther., v. 17, p. 1 187-1200;

Jose et al., "Intraductal delivery of adenoviruses targets pancreatic tumors in transgenic Ela-myc mice and orthotopic xenografts", 2013, Oncotarget, v.4, p.94-105. Morgenstern et al., "Advanced mammalian gene transfer: high titre retroviral vectors with multiple drug selection markers and a complementary helper-free packaging cell line" 1990, Nucleic Acids Research, v. 18, p.3587-96.

Rehmsmeier et al., "Fast and effective prediction of microRNA/target duplexes", 2004, RNA v. 10, p.1507-1517.

Rojas et al., "Minimal RB-responsive E1A Promoter Modification to Attain Potency, Selectivity, and Transgene arming Capacity in Oncolytic

Adenoviruses", 2010, Mol. Ther. v. 18, p.1 960-1971 .

Claims

1 . Conditionally replicating adenovirus comprising a heterologous nucleic acid sequence inserted in the 3' UTR region of adenoviral E1 A gene, the heterologous sequence comprising a nucleotide sequence of formula (I):

S1 -E1 -S2-E2-S3-E3-S4-[E4-S5]a-[E5-S6]b-[E6-S7]c-[E7-S8]d-[E8-S9]e-[E9- S10]f

(I)

wherein

complementary to microRNA-148a sequence SEQ ID NO:1 ;

E1 to E9 represent DNA spacer sequences spacing sequences

S1 -S10, being said spacer sequences the same or different from one another and having a length from 3 to 20 nucleotides; and a,b,c,d,e and f are the same or different from one another and represent an integer value that is selected from 0 and 1 .

2. The conditionally replicating adenovirus as claimed in claim 1 , wherein the heterologous sequences S1 to S10 have a length from 6 to 22 nucleotides.

3. The conditionally replicating adenovirus as claimed in any one of the preceding claims, in which each one of the sequences S1 -S10 comprises a sequence selected from the group consisting of SEC ID NO: 4, SEC ID NO: 5, and SEC ID NO: 6.

4. The conditionally replicating adenovirus as claimed in any one of the preceding claims, in which e and f have a value equal to 0.

5. The conditionally replicating adenovirus as claimed in any one of the preceding claims, in which a,b,c,d,e and f have a value equal to 0.

6. Conditionally replicating adenovirus as claimed in anyone of the preceding claims, in which the heterologous sequence comprises, additionally, a nucleic acid of formula (II): S1 1 -E10-S12-E1 1 -S13-E12-S14-[E13-S15]g-[E14-S16]h-[E15-S17]i-[E16- S18]j-[E17-S19]k-[E18-S20]l (II) wherein

complementary to microRNA-216a sequence SEQ ID NO:12;

E10 to E18 represent DNA spacer sequences spacing sequences

S1 1 -S20, being these spacer sequences the same or different from one another and having a length from 3 to 20 nucleotides; and g,h,i,j,k,l are the same or different from one another and represent an integer value that is selected from 0 and 1 .

7. The conditionally replicating adenovirus as claimed in claim 6, wherein sequences S1 1 to S20 have a length from 6 to 22 nucleotides.

8. The conditionally replicating adenovirus as claimed in any one of the claims 6-7, in which each one of the sequences S1 1 -S20 comprises a sequence selected from the group consisting of SEQ ID NO: 15, SEQ ID NO: 16, and SEQ ID NO: 17.

9. The conditionally replicating adenovirus as claimed in any one of the preceding claims, wherein each one of the spacer sequences E1 to E18 is selected from the group consisting of SEQ ID NO: 7, 8, 9, and 10.

10. The conditionally replicating adenovirus as claimed in any one of the preceding claims, wherein the heterologous sequence comprises the nucleotide sequence of formula (I), as defined in claim 1 , and the nucleotide sequence of formula (II), as defined in claim 6, wherein:

(a) the nucleotide sequence of formula (I), is one in which "a" to "f are zero and each one of the four sequences S1 to S4 consists of SEQ ID NO:6;

(b) the nucleotide sequence of formula (II) is one in which "g" to "I" are zero, and each of the sequences S1 1 to S14 consists of SEQ ID NO:17; and (c)sequences S4 and S1 1 are separated by a spacer sequence E19, being the spacer sequence E19 selected from the group of sequences consisting of: SEQ ID NO:7 to 10.

1 1 . The conditionally replicating adenovirus as claimed in claim 1 , wherein the heterologous sequence comprises the sequence SEQ ID NO: 1 1 or SEQ ID NO: 18.

12. The conditionally replicating adenovirus as claimed in claims 1 and 6, wherein the heterologous sequence consists in the sequence SEQ ID NO: 1 1 or SEQ ID NO: 18.

13. The conditionally replicating adenovirus as defined in any one of claims 1 - 12 for use as a medicament.

14. The conditionally replicating adenovirus as defined in any of claims 1 -12, for use in the treatment of cancer.

15. The conditionally replicating adenovirus according to any one of claims 1 - 12, for use in the treatment of pancreatic cancer in a primary or advanced state, or metastatic pancreatic cancer.

16. Nucleic acid sequence of formula (I): S1 -E1 -S2-E2-S3-E3-S4-[E4-S5]a-[E5-S6]b-[E6-S7]c-[E7-S8]d-[E8-S9]e-[E9- S10]f

(I) wherein

complementary to microRNA-148a sequence SEQ ID NO:1 ; E1 to E9 represent DNA spacer sequences spacing sequences S1 -S10, being these spacer sequences the same or different from one another and having a length from 3 to 20 nucleotides; and a,b,c,d,e and f are the same or different from one another and represent an integer value that is selected from 0 and 1 .