WO2015056917A1

WO2015056917A1 - Conjugate for sirna transfer and preparation method therefor

Info

Publication number: WO2015056917A1
Application number: PCT/KR2014/009385
Authority: WO
Inventors: 오병근; 최진하; 김현수; 엄숭호
Original assignee: 서강대학교 산학협력단
Priority date: 2013-10-14
Filing date: 2014-10-06
Publication date: 2015-04-23
Also published as: KR101494839B1

Abstract

The present invention relates to: a conjugate for siRNA transfer, comprising (a) serum albumin, (b) a gold nanorod, (c) siRNA, and (d) an antibody; and a preparation method therefor. The conjugate for siRNA transfer, of the present invention, has remarkable stability and economical efficiency, can be easily mass produced, and the size thereof is controllable, thereby enabling preparation into a size suitable for cell transfer. In addition, cancer cell-specific transfection can be carried out by using the antibody of the present invention, and cancer cell death can be effectively induced by using the synergistic effect of siRNA and a photothermal effect.

Description

【Specification】

[Name of invention]

siRNA delivery complex and preparation method

This patent application claims priority to Korean Patent Application No. 10-2013-0122147 filed with the Korean Patent Office on October 14, 2013, the disclosure of which is hereby incorporated by reference.

The present invention relates to a complex for s iRNA delivery and a method for preparing the same.

[Technique to become background of invention]

Recently, rapidly progressing into an aging society, the number one cause of death was the disease of cancer, and to overcome this attempt to treat various effects of the drug. Conventional anticancer drugs have excellent cancer killing effects, but include various problems such as attacking normal cells and developing resistance. In order to overcome this disadvantage, nano-based cancer therapeutics are in the spotlight, and there is an advantage of enabling targeted treatment at high concentrations of existing anticancer agents, short interfering RNA (siRNA), and antibodies. In particular, two or more cancer therapeutic agents may be combined to induce a synergistic effect of cancer treatment.

Nanoparticles using albumin protein have high biocompatibility and resolution and are not toxic in the human body. On the other hand, they can remain in the body for a long time and have many favorable conditions for cancer treatment, and can simultaneously transfer gold nanorod and short interfering RNA. It can be used as a complex and has the advantage of preventing the toxicity of gold nanorods. Throughout this specification, many papers and patent documents are referenced and their citations are indicated. The disclosures of cited papers and patent documents are incorporated herein by reference in their entirety, and the level of the technical field to which the present invention belongs and the contents of the present invention are more clearly explained. [Content of invention]

Problem to be solved

The present inventors have tried to develop an s iRNA transporter that can act specifically on cancer cells. As a result, s iRNAs that specifically bind to mRNA encoding anti-apoptotic proteins and antibodies to proteins that are specifically expressed on cancer cells were applied to the serum albumin (serum al bumin) and gold nanorods. The present invention has been completed by developing a complex for siRNA delivery. Accordingly, it is an object of the present invention to provide a complex for s iRNA delivery. Another object of the present invention is to provide a method for preparing a complex for siRNA delivery. Other objects and advantages of the present invention will become apparent from the following detailed description, claims and drawings. [Measures of problem]

According to one aspect of the invention, the invention (a) serum albumin (Serum albumin); (b) gold nanorods; (c) s iRNA; And (d) provides a complex for siRNA delivery comprising an antibody. The present inventors have tried to develop an s iRNA transporter that can act specifically on cancer cells. As a result, s iRNAs that specifically bind to mRNA encoding anti-apoptotic proteins and antibodies to proteins that are specifically expressed on cancer cells were applied to serum albumin and s based on gold nanorods. A complex for iRNA delivery was developed. Complex for delivery of s iRNA of the present invention is (a) serum albumin; (b) gold nanorods; (c) siRNA; And (d) antibodies.

According to one embodiment of the present invention, the serum albumin is directly attached to the gold nanorods by introducing a thiol residue. That is, serum proteins and gold nanoparticles are directly bound through thiol groups. The present invention has excellent biocompatibility by using serum albumin (FIG. 9).

The complex for siRNA delivery of the present invention has a spherical form and a negative surface charge.

According to one embodiment of the invention, the siRNA delivery complex has a diameter of 150 nm to 300 nm. According to another embodiment of the present invention, the siRNA suspension complex has a diameter of 180 nm to 300 ππι. According to a particular embodiment of the invention, the siRNA delivery complex has a diameter of 180 nm to 250 nm in the dry state, and 250 nm to 300 nm in the non-dry state.

According to one embodiment of the invention, the siRNA delivery complex has an average surface charge of -50 mV to -30 mV or -45 mV to -35 mV.

Gold nanorods included in the siRNA delivery complexes of the present invention are known in the art, for example, such as the combination of CTAB (Cetyl Trimethylanmonium Bromide), HAuC14 and NaBH4, and HAuC14, CTAB, AgN03 and ascorbic acid Combining method].

According to one embodiment of the invention, the gold nanorod has a length of 15-30 nm and a length of 1-10 nm, or a length of 16-28 πηι and a length of 5 길이 10 nm.

The complex for delivering siRNA of the present invention includes gold nanorods to which serum albumin is bound.

According to one embodiment of the present invention, the siRNA delivery complex of the present invention comprises about 1-20 or 5-15 gold nanorods.

The siRNA delivery complex of the present invention is introduced into cells specifically for cancer cells. This feature of the invention is conferred by the antibodies that make up the complex for siRNA delivery.

The siRNA is an siRNA that complementarily binds to a nucleotide sequence encoding an anti-apoptosis protein. According to one embodiment of the invention, the anti-cell death protein is one of the Bcl-2 family, such as Bd-2, Bcl-w and Bcl-xL, according to another embodiment of the invention, the anti-cell The killing protein is Bcl-2. According to certain embodiments of the invention, the siRNA has a nucleotide sequence of SEQ ID NO: 1.

The antibody constituting the siRNA delivery complex of the present invention is an antibody that specifically binds to a protein that is specifically expressed on the surface of cancer cells. According to one embodiment of the invention, the antibody is HER-2 (breast cancer),

Alpha-fetoprotein (Liver cancer), BCR-ABL (chronic myelogenous leukemia), BRCA1 / BRCA2 (breast cancer and ovarian cancer), BRAF V600E (medullary and colon cancer), CA-125 (ovarian cancer), CA19.9 (pancreatic cancer) ), CEA (Car ci noembr yon ic antigen; colon cancer), EGFR (Epidermal Growth Factor Receptor; non-small cell lung cancer), KIT (gastrointestinal stromal tumor) _; An antibody specific for PSA (Prostate Specific Antigen) or S100 (melanoma) is not limited thereto. According to another embodiment of the invention, the antibody is an antibody specific for HE-2.

The siRNA delivery complex of the present invention has excellent photothermal effect.

According to one embodiment of the present invention, when comparing the photothermal effect of the same gold nanorods with the siRNA delivery complex, it shows a similar degree of photothermal effect and after about 10 minutes shows almost the same photothermal effect. It can be seen that about ₇ gold nanorods are encapsulated per BSA particle, which shows about 7 times the difference in the photothermal effects when comparing the BSA / gold nanorod composite and the gold-based nanoparticles. . According to another aspect of the present invention, the present invention provides a method for preparing a complex for siRNA delivery, comprising the following steps:

(a) contacting the gold nanorods with serum albumin to prepare a serum albumin / gold nanorod complex;

(b) adding a siRNA to the serum albumin / gold nanorod complex and desolvating to prepare a serum albumin / gold nanorod / siRNA complex; And

(c) contacting the serum albumin / gold nanorods / siRNA complex and the antibody to prepare a siRNA delivery complex. Method for producing a s iRNA delivery complex of the present invention is a method for producing the s iRNA delivery complex, the common content between the two in order to avoid excessive complexity of the present specification, the description is omitted.

The desolvent action carried out in step (b) of the method for producing a s iRNA delivery complex of the present invention may be prepared according to methods known in the art. Compositions of the present invention may be prepared as pharmaceutical compositions /

According to a preferred embodiment of the present invention, the composition of the present invention comprises (a) a pharmaceutically effective amount of the complex for delivery of s iRNA of the present invention; And (b) a pharmaceutically acceptable carrier. As used herein, the term "pharmaceutically effective amount" means an amount sufficient to achieve the efficacy or activity of the complex for delivering s iRNA described above.

When the composition of the present invention is made into a pharmaceutical composition, the pharmaceutical composition of the present invention includes a pharmaceutically acceptable carrier. Pharmaceutically acceptable carriers contained in the pharmaceutical composition of the present invention are commonly used in the preparation, lactose, dextrose, sucrose, sorbbi, manny, starch, acacia rubber, calcium phosphate, alginate, Gelatin, calcium silicate, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, water, syrup, methyl cellulose, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil But not limited thereto. The pharmaceutical composition of the present invention may further include lubricants, wetting agents, sweeteners, flavoring agents, emulsifiers, suspending agents, preservatives, and the like in addition to the above components. Suitable pharmaceutically acceptable carriers and formulations are described in detail in Remington's Pharmaceut i Cal Sc ences (19 th ed., 1995).

The pharmaceutical composition of the present invention may be administered orally or parenterally, and preferably applied in an oral non-administrative manner.

Suitable dosages of the pharmaceutical compositions of the present invention may be prescribed in various ways depending on factors such as formulation method, mode of administration, age of patient, weight, sex, morbidity, food, time of administration, route of administration, rate of excretion and reaction response. Can be. Typical dosages of the pharmaceutical compositions of the invention are in the range of 0.001-100 mg / kg on an adult basis. The pharmaceutical compositions of the present invention may be prepared in unit dose form by formulating with a pharmaceutically acceptable carrier and / or excipient according to methods which can be easily carried out by those skilled in the art. Or may be prepared by incorporation into a multi-dose container. The formulation may be in the form of solutions, suspensions, syrups or emulsions in oils or aqueous media, or may be in the form of axes, powders, powders, granules, tablets or capsules, and may further comprise dispersants or stabilizers. According to another aspect of the invention, the invention ( _a ) serum albumin (Serum albumin); (b) gold nanorods; (c) siRNA; And (d) contacting the cell with an s iR A delivery complex comprising an antibody to a cell.

The s iRNA delivery method of the present invention is carried out using the above-described complex for s iRNA delivery, and the common content between the two is omitted in order to avoid excessive complexity of the present specification.

【Effects of the Invention】

The features and advantages of the present invention are summarized as follows:

(a) The present invention provides a decomposable s iRNA complex in the body.

(b) s iRNA delivery complex of the present invention is excellent in stability and economical efficiency, easy to mass production and size can be adjusted to a size suitable for cell delivery.

(c) Cancer cells can be specifically introduced using the antibody of the present invention, and cancer death can be effectively induced by using a synergistic effect of s iRNA and photothermal effects.

[Brief Description of Drawings]

Figure 1 schematically shows the preparation of the BSA / gold nanorods / s iRNA complex.

2 shows TEM images of BSA / gold nanorods / s iRNA complexes. Scale bar represents 100 ran. 3A and 3B show the properties of the BSA / gold nanorods / s iRNA complex. 3A shows that the average diameter of the BSA / gold nanorods / s iRNA complex is 278 ran. 3B shows that the average surface charge of the BSA / gold nanorods / s iRNA complex is -39.6 niV.

4 shows a standard curve of the Bradford assay for quantifying anti-HER2 antibodies bound to the surface of BSA / gold nanorod complexes.

5 shows a standard curve of a Ri bogreen assay for quantifying s iRNA encapsulated in BSA / gold nanorods.

6 is a graph analyzing the photothermal effects of the gold nanorods and BSA / gold nanorods composite.

Figure 7 shows the results confirming the cell import by the anti-HER2 antibody bound to the BSA / gold nanorod complex.

FIG. 8 shows the results of microscopic confirmation of cell incorporation of anti-HER2 antibody-bound BSA / gold nanoparticles into SkBr-2 cells expressing HER2.

9 shows the results of toxicity experiments of BSA / gold nanoparticles.

Figure 10 shows the results of analyzing the mRNA expression inhibition effect by BSA / gold nanoparticles / s iRNA at 24 hours and 48 hours.

[Specific contents to carry out invention]

Hereinafter, the present invention will be described in more detail with reference to Examples. These examples are only for illustrating the present invention in more detail, it will be apparent to those skilled in the art that the scope of the present invention is not limited by these examples in accordance with the gist of the present invention. . Example

Experimental Materials and Experimental Methods

BSA / gold nanorods / siRNA complex production method

1) Gold nanorods (width: 22 ± 3 ran / vertical length: 6 ± 2 ran) to be used in the experiment were prepared.

-Method of manufacturing the gold nanorod (i) 0.2 M CTAB 7.5 (sigma) and 0.01 M HAuC14 0.25 i (sigma) were mixed.

(ii) 0.01M NaBH 4 (sigma) 0.6 ^ was added to the mixture and stored.

(iii) 0.01 M HAuCH 10 mi and 0.1 M CTAB, 237.5 ^, were combined.

(iv) 0.01 M AgN03 (sigma) 1.5 ^ was added and mixed.

(V) 0.1 M ascorbic acid (sigma) 1.6 m £ was added and mixed. The color of the mixture turned transparent.

(vi) The solution 2 ^ prepared in step (ii) was added to the mixture of step (V) and reacted for 3 hours or more to prepare a gold nanorod.

2) The supernatant was removed by rotating the gold nanorods at 13,000 rpm for 30 minutes using a centrifugal separator, followed by washing three times by repeating the suspension by adding distilled water.

3) The final supernatant was removed and added to the precipitated gold nanorods with 1 ι of 20 rag / mi BSA solution and 20 ^ (ProteinMODS, USA) of 50 nig / ml SH-BSA solution and reacted at room temperature for 3 hours.

4) The gold nanorods were washed in the same manner as in step 2.

5) 100 mg of 20 mg / ml H 6 BSA solution and 1 nmol of siRNA (siBcl-2: GGAUUGUGGCCUUCUUUGAUU, Bioneer, Korea) were simultaneously added and mixed.

6) Encapsulate gold nanorods and siRNA with BSA through desolvent action

BSA / gold nanoparticle / siRNA complexes were prepared. To the gold nanorods and siRNA mixed solution, 100% ethanol was added 20 times by 10 ^ (60 7 min).

Proteins or polymers such as BSA can usually be made into nanoparticles using a method called desolvation. The principle of this method is to remove the water molecules between the BSA molecules, thus providing more opportunities for the BSA to stick together. This causes the BSA to aggregate to form nanoparticles. In this study, ethanol was slowly added as a method of desolvation. The gold nanorods were functionalized with BSA on the surface to allow them to aggregate together like BSA. Because siRNAs are small molecules, they appear to clump together when BSAs clump together. 7) When the solution turned cloudy from a transparent color, 8% glutaraldehyde 2 ^ was added to crosslink between BSA and reacted for more than 12 hours. -

8) BSA / gold nanoparticle / siRNA complexes were washed with PBS for 10 minutes in the same manner as in step 2.

9) 1 rag / ml Amine-PEG-Biotin, 1 mg / ιιώ streptavidin 10 ζί were incubated at room temperature for 3 hours to attach the antibody to the surface of the BSA / gold nanoparticle / siRNA complex.

10) The particles were washed in the same manner as in step 8.

11) 1 mg / iii «anti-Her2 antibody 5 with biotin was added and reacted at 4 ^° C. for at least 12 hours.

12) Wash the BSA / gold nanoparticle / siRNA / antibody complex in the same manner as in step 8 above. PBS, stored at 4 ^° C before use (Figure 1).

siRNA and antibody (ligand) quantification

After reacting the BSA / gold nanoparticle / siRNA complex with an anti-HER2 antibody (Abeam) [steps 9) to 12) of the 'Method for producing the BSA / gold nanoparticle / siRNA complex', the BSA complex and the BSA complex were centrifuged. The solution was separated to measure the anti-HER2 concentration in the solution, and compared with the concentration of the anti-HER2 antibody to confirm the degree of immobilization in the BSA complex.

The concentration of the antibody was measured by Bradford assay, one of protein quantification methods. Photothermal Effect Analysis

Photothermal effect experiment was conducted using the BSA / gold nanoparticles / siRNA complex 1 me synthesized in the above process. The intensity of the applied light was the same as 4 w / cm * s-3 and the wavelength was near infrared (810 nm). The light was applied for 2.5 minutes, 5 minutes, and 10 minutes, and the experiment was performed at a fixed initial temperature of 25 ^° C. To compare the photothermal effects of BSA / gold nanoparticles / siRNA complexes, the same volume of water, BSA nanoparticles, and gold nanoparticles were compared. In-vitro analysis

The cancer cell is SK-BR-3, which is a cancer cell overexpressing HER2 (normal cells are not overexpressed).

The cell incorporation confirmation method of the synthesized BSA / gold nanoparticle / siRNA complex was carried out by two methods of FACS analysis / confocal microscopy. The above method is to measure the fluorescence by encapsulating the FITC in the BSA complex to fluoresce the particles It was carried out in a manner to measure. BSA complex 1 ^Λ 109 was injected into the corresponding cells (SK-BR-3) 1 ^Λ 106 and reacted at 37 ^° C. for 3 hours, and the cells were washed three or more times using PBS. Then, after immobilizing the cells using 4% paraformaldehyde (paraformaldehyde), using a FACS device to obtain a percentage of the cells showing fluorescence (FITC) to evaluate the cell migration rate. Confocal microscopy was also used to assess cell incorporation by visually imaging whether or not the complex had been incorporated into real cells.

In order to observe the action of siRNA in the complex, RT-PCR technique was used to quantify the concentration of mRNA directly reacted by siRNA. Cell introduction BSA complex 1 109 was injected into the cells (SK-BR-3) 1 × 106 and reacted at 37 ^° C. for 24 hours, 48 hours, and 72 hours. In order to examine the siRNA operating efficiency of the complex, siRNA was compared with the case of incorporating siRNA alone by lipofectamine treatment. Over time, the cells were isolated by mRNA using _m RNA extraction kit (nucleospin RNA Π and MACHEREY-NAGEL), and the mRNA levels were measured and compared with LightCycler® RNA Master SYBR Green I and RT-PCR (roche). (SiRNA target is BeV2, one of the proteins involved in cell death). result

Characteristics of BSA / Gold Nanoparticles

The nanorods used in this experiment were prepared with reference to Langmuir 2004, 20, 6414-6420 and showed absorbance at about 750 ran. TEM image analysis confirmed that spherical BSA / gold nanoparticles having a size of about 200 ran were uniformly formed. The BSA / gold nanoparticles were dried and measured to have an actual size of about 278 ran. It was confirmed that the gold nanorods (6 nm X 22 ran) were distributed evenly in the BSA particles. Approximately 7.7 (± 0.8) gold nanorods were encapsulated per BSA particle (analysis of TEM images directly).

The size and charge of the BSA / gold nanoparticle composites were measured using a dynamic light scattering (Dynami cight scat tering) instrument. The size of the BSA / gold nanoparticles was about 278 nm, which was measured slightly larger compared to the TEM image. This is because the TSA dried the BSA / gold nanoparticles composites, it seems that there is a difference in the numerical value. The surface charge of the BSA / gold nanoparticle composite is about -40 mV, which is analyzed by the pi value of BSA (pi 4.7, negatively charged under conditions of thickening).

It is thought that the magnitude | size and surface charge for cell delivery and treatment are comparatively suitable. SiRNA and Antibody (ligand) Quantitation in Complexes

An experiment was conducted to confirm the anti-HER2 antibody immobilization rate of the prepared BSA / gold nanoparticle complex. As a result of the experiment, it was confirmed that the anti-HER2 antibody corresponding to the injected anti-HER2 antibody (about 43 »of 20 / g / m«) was immobilized (Table 1).

Table 1

'Only Ab-only Ab (NC)' of Table 1 indicates the degree of antibody immobilization of BSA particles to which streptavidin is not attached, and 'ST-Ab-ST- Ab (NC) 'is the degree of antibody immobilization when streptavidin is attached, indicating that straptavidin is required for particle preparation.

In order to measure the amount of encapsulated short interfering RNA (siRNA), the experiment was conducted in the same manner as the method used in the anti-HER2 immobilization rate was measured by measuring the concentration of the supernatant. Concentration was measured by Ribogreen assay, one of the RNA quantification method. Experimental results, it was confirmed that the siRNA encapsulated in the BSA / gold nanoparticle / siRNA complex encapsulated siRNA corresponding to about 96¾> of the RNA (4000 nM) injected (Table 2).

Table 2

The experimental results confirmed that anti-HER2 antibodies targeting the BSA / gold nanoparticles / siRNA complexes and siRNAs that enhance cancer treatment effects were effectively immobilized and encapsulated to form multifunctional nanocomposites. . Light heat effect

In order to confirm the photothermal effect of the actual BSA / gold nanoparticle / siRNA / antibody complex, the photothermal effect was measured over time compared with the same amount of gold nanorods.

As a result, when compared with the amount of the same gold nanorods, the light-heating effect was similar, and after 10 minutes, the light-heating effect was almost the same. About 7 gold nanorods are encapsulated per BSA particle, which is about 7 times higher than the BSA / gold nanorod composite and gold nanorods. Per 10 minutes). As a result of the temperature measurement of the photothermal effect, it is possible to induce cancer cell death through this particle, and the time can be estimated to be about 5 minutes. In general, cellular apoptosis occurs above 42 ^° C.

The photothermal effect of this BSA composite was found to be excellent when compared to rod. Especially, the photothermal effect of one particle is much better than that of gold nanorods. It is expected that the effect of inducing apoptosis due to the photothermal effect is better than that used. In-vitro analysis of the BSA

One of the most important requirements for treating cancer cells with nanoparticles is the ability to selectively act on the desired cancer cells. In order to determine this, it was confirmed the cell influx of the anti-HER2 antibody immobilized on the BSA / gold nanoparticle complex.

As a result of the experiment, it was confirmed that the complex that did not immobilize the anti-HER2 antibody was not introduced into the cell. In contrast, the immobilization of the anti-HER2 antibody confirmed that the complex was introduced into the cancer cell. In order to conduct experiments in vitro or in vivo, it is necessary to confirm the toxicity of the produced complex.

To determine toxicity, progress was made in four groups: no treatment (control), gold nanorods, BSA, BSA / gold nanorods. Cytotoxicity was confirmed by ΜΊΤ assay. As a result of toxicity, the survival rate of the cells in which the gold nanorods were inserted was significantly lower than that of the untreated cells, which may be due to the surface-active surfactant (CTAB) present in the gold nanorods. On the other hand, the BSA particles and the BSA / gold nanorod composite was confirmed that there is no cytotoxicity because the particles composed of biological material was used. In-vitro analysis of si 腿

In order to confirm the s iRNA action of the fabricated nanoparticles, RT-PCR technique, one of the methods of measuring mRNA concentration, was used. As a control, cells treated with nothing and cells treated with s iRNA were compared. As a result, 24 hours later, the mRNA concentration of s iRNA was 23% compared to untreated cells, and BSA complex was 48). After 48 hours, the mRNA expression rate was 32% based on s iRNA alone, and the BSA complex showed an expression rate of 2. It was determined that the s iRNA action was superior to s iRNA alone when treated for 24 hours, and that the s iRNA action of the BSA complex was better after 48 hours.

From these results, the s iRNA action of the BSA complex also appears to be relatively good, and the s iRNA action of the complex appears to be superior over time. When s iRNA alone is added, s iRNA acts directly, and siRNA is superior when a relatively short time passes, but s iRNA, which has to act over time, tends to be degraded or recovered, resulting in mRNA recovery. However, it was confirmed that s iRNA effect increased over time due to encapsulation of BSA and sustained release of s iRNA through enzymes in cells upon delivery of siRNA through the complex. This is expected to be an alternative to solve the problem of continuous action that has been pointed out as a disadvantage in using s iRNA. Having described the specific part of the present invention in detail, it is apparent to those skilled in the art that such a specific technology is only a preferred embodiment, and the scope of the present invention is not limited thereto. Therefore, the substantial scope of the present invention will be defined by the appended claims and equivalents thereof.

Claims

【Patent Claims】

【Claim 1】

(a) Serum albumin; (b) gold nanorods; (c) siRNA; and (d) a complex for siRNA delivery containing an antibody.

【Claim 2】

The siRNA delivery complex according to claim 1, wherein the serum albumin is directly bound to the gold nanorod by introducing a thiol residue.

[Claim 3]

The method of claim 1, wherein (a) serum albumin; (b) gold nanorods; and (c) siRNA; a complex for siRNA delivery, characterized in that it binds by desolvation.

[Claim 4]

The complex for siRNA delivery according to claim 1, wherein the gold nanorod has a horizontal length of 15-30 rai and a vertical length of 1-10 nm.

【Claim 5】

The siRNA delivery complex according to claim 1, wherein the siRNA is a siRNA that binds complementary to a nucleotide sequence encoding an anti-apoptosis protein.

【Claim 6】

The complex for siRNA delivery according to claim 1, wherein the complex has a diameter of 150 nm to 300 ran.

【Claim 71

The complex for siRNA delivery according to claim 1, wherein the complex has an average surface charge of -50 mV to ᅳ30 mV.

[Claim 8]

The complex for siRNA delivery according to claim 1, wherein the complex for siRNA delivery includes about 1-20 gold nanorods.

【Claim 9】

The complex according to claim 1, wherein the antibody is an antibody that specifically binds to a protein specifically expressed on the surface of cancer cells. 【Claim 10】

Method for preparing a complex for siRNA delivery comprising the following steps:

(a) contacting gold nanorods with serum albumin to prepare a serum albumin/gold nanorod complex;

(b) adding siRNA to the serum albumin/gold nanorod complex and performing desolvation to prepare a serum albumin/gold nanorod/siRNA complex; and

(c) preparing a complex for siRNA delivery by contacting the serum albumin/gold nanorod/siRNA complex with an antibody. 【Claim 11】

(a) Serum albumin; (b) gold nanorods; (c) siRNA; and (d) contacting a cell with a complex for siRNA delivery containing an antibody.