KR101494839B1 - Complexes for siRNA delivery and Preparation Method thereof - Google Patents

Abstract

The present invention relates to a complex for siRNA delivery, which includes (a) serum albumin; (b) a silver nanorod; (c) siRNA; and (d) an antibody, and to a method for preparing the same. The complex for siRNA delivery of the present invention has excellent stability and economic feasibility, is easily mass-produced, and is able to be manufactured in suitable sizes by having a controllable size. Moreover, the complex for siRNA delivery can be specifically flowed into cancer cells by using an antibody, and can effectively induce removal of cancer by using synergy of siRNA and a photothermal effect.

Description

[0002] Complexes for siRNA delivery and preparation methods thereof [

The present invention relates to siRNA delivery complexes and methods for their preparation.

Recently, as the society rapidly progressed into an aging society, the first cause of death was occupied by cancer, and various drug treatments are being tried to overcome it. Conventional anticancer agents are excellent in cancer killing effect, but they have various problems such as attacking normal cells and tolerance. In order to overcome these disadvantages, nanomaterial-based cancer treatment drugs are in the spotlight, and there is a strong point that it is possible to treat target cancer drugs, short interfering RNA (siRNA), antibodies and the like with high concentration. In particular, a combination of two or more cancer treatment agents can induce the synergistic effect of cancer treatment.

The nanoparticles using albumin protein have excellent biocompatibility and resolution, so they have no toxicity in the human body, but they can survive in the body for a long time. Therefore, they have many favorable conditions for cancer treatment, and they transmit gold nanorods and short interference RNA simultaneously It can be used as a composite and it has the advantage of preventing the gold nanorods from being toxic.

Numerous papers and patent documents are referenced and cited throughout this specification. The disclosures of the cited papers and patent documents are incorporated herein by reference in their entirety to better understand the state of the art to which the present invention pertains and the content of the present invention.

The present inventors have sought to develop an siRNA delivery vehicle capable of specifically acting on cancer cells. As a result, siRNAs that specifically bind to mRNA encoding anti-apoptotic proteins and siRNAs based on serum albumin and gold nanorods were applied by using antibodies against proteins specifically expressed in cancer cells The present invention has been completed.

Accordingly, an object of the present invention is to provide a complex for siRNA delivery.

It is another object of the present invention to provide a method for preparing siRNA delivery complexes.

Other objects and advantages of the present invention will become more apparent from the following detailed description of the invention, claims and drawings.

In accordance with one aspect of the present invention, the present invention provides a composition comprising (a) serum albumin; (b) gold nanorods; (c) siRNA; And (d) an antibody.

The present inventors have sought to develop an siRNA delivery vehicle capable of specifically acting on cancer cells. As a result, siRNAs that specifically bind to mRNA encoding anti-apoptotic proteins and siRNAs based on serum albumin and gold nanorods were applied by using antibodies against proteins specifically expressed in cancer cells .

The siRNA delivery complex of the present invention comprises (a) serum albumin; (b) gold nanorods; (c) siRNA; And (d) antibodies.

According to one embodiment of the present invention, the serum albumin is directly bound to the gold nanorod with a thiol residue introduced therein. That is, serum proteins and gold nanoparticles are directly bound through thiol groups.

The present invention has excellent biocompatibility by using serum albumin (Fig. 9).

The siRNA delivery complex of the present invention has spherical shape and negative surface charge.

According to one embodiment of the present invention, the complex for siRNA delivery has a diameter of 150 nm to 300 nm. According to another embodiment of the present invention, the siRNA delivery complex has a diameter of 180 nm to 300 nm. According to a particular embodiment of the present invention, the siRNA delivery complex has a diameter of from 180 nm to 250 nm in the dry state, and a diameter of from 250 nm to 300 nm in the non-dry state.

According to one embodiment of the present invention, the siRNA delivery complex has an average surface charge of -50 ㎷ to -30 ㎷ or -45 ㎷ to -35..

The gold nanorods included in the siRNA delivery complex of the present invention can be prepared by a method known in the art [for example, a mixture of CTAB (Cetyl Trimethylammonium Bromide), HAuCl ₄ and NaBH _{4 and} a mixture of HAuCl ₄ , CTAB, AgNO ₃ and ascorbic acid A method of mixing the above-mentioned components.

According to one embodiment of the present invention, the gold nanorods have a transverse length of 15-30 nm and a longitudinal length of 1-10 nm, or a transverse length of 16-28 nm and a longitudinal length of 5-10 nm.

The siRNA delivery complex of the present invention comprises gold nanorods bound with serum albumin.

According to one embodiment of the present invention, the siRNA delivery complex of the present invention comprises about 1-20 or 5-15 gold nanorods.

The siRNA delivery complex of the present invention is intracellularly transferred specifically to cancer cells. This aspect of the invention is conferred by the antibodies that make up the siRNA delivery complex.

The siRNA is an siRNA that complementarily binds to a nucleotide sequence encoding an anti-apoptosis protein. According to an embodiment of the present invention, the anti-apoptotic protein is one of the Bcl-2 family such as Bcl-2, Bcl-w and Bcl-xL. According to another embodiment of the present invention, The killing protein is Bcl-2.

According to a particular embodiment of the invention, the siRNA has the nucleotide sequence of the first sequence of the sequence listing.

The antibody constructing the siRNA delivery complex of the present invention is an antibody that specifically binds to a protein specifically expressed on the surface of a cancer cell.

According to one embodiment of the invention, the antibody is selected from the group consisting of HER-2 (breast cancer), AFP (alpha-fetoprotein), BCR- ABL (chronic myelogenous leukemia), BRCA1 / BRCA2 (breast cancer and ovarian cancer), BRAF V600E (Cancer of the stomach), CA-125 (ovarian cancer), CA19.9 (pancreatic cancer), carcinoembryonic antigen (colon cancer), EGFR (non-small cell lung cancer) An antibody specific for PSA (Prostate Specific Antigen) or S100 (melanoma), but is not limited thereto. According to another embodiment of the present invention, the antibody is an antibody specific for HER-2.

The siRNA delivery complex of the present invention has an excellent light heat effect.

According to an embodiment of the present invention, when the light heat effects of the same gold nanorods as the siRNA delivery complex are compared, they exhibit a similar light heat effect and exhibit almost the same light heat effect after 10 minutes. When the BSA / gold nanorod composite and gold nanorods are compared with the photothermal effect of particles, the difference in photothermal effect is about 7 times that of about 7 gold nanorods encapsulated per BSA particle.

According to another aspect of the present invention, the present invention provides a method of producing a siRNA delivery complex comprising the steps of:

(a) preparing a serum albumin / gold nanorod complex by contacting gold nanorods with serum albumin;

(b) preparing a serum albumin / gold nanorod / siRNA complex by adding siRNA to the serum albumin / gold nanorod complex and desolvating it; And

(c) preparing an siRNA delivery complex by contacting the serum albumin / gold nanorod / siRNA complex with an antibody.

The method for producing siRNA delivery complex of the present invention is a method for producing the above siRNA delivery complex, and the description common to both is omitted in order to avoid the excessive complexity of the present specification.

The desolvation effect which is carried out in step (b) of the method for producing a siRNA delivery complex of the present invention can be produced according to a method known in the art.

The compositions of the present invention may be prepared with pharmaceutical compositions.

According to a preferred embodiment of the present invention, the composition of the present invention comprises (a) a pharmaceutically effective amount of the aforementioned siRNA delivery complex of the present invention; And (b) a pharmaceutically acceptable carrier. As used herein, the term " pharmaceutically effective amount " means an amount sufficient to achieve efficacy or activity of the siRNA delivery complex described above.

When the composition of the present invention is manufactured from a pharmaceutical composition, the pharmaceutical composition of the present invention includes a pharmaceutically acceptable carrier. The pharmaceutically acceptable carriers to be contained in the pharmaceutical composition of the present invention are those conventionally used in the present invention and include lactose, dextrose, sucrose, sorbitol, mannitol, starch, acacia rubber, calcium phosphate, alginate, gelatin, But are not limited to, calcium silicate, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, water, syrups, methylcellulose, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil. It is not. The pharmaceutical composition of the present invention may further contain a lubricant, a wetting agent, a sweetening agent, a flavoring agent, an emulsifying agent, a suspending agent, a preservative, etc. in addition to the above components. Suitable pharmaceutically acceptable carriers and formulations are described in detail in Remington ' s Pharmaceutical Sciences (19th ed., 1995).

The pharmaceutical composition of the present invention may be administered orally or parenterally, preferably by oral non-administration.

The appropriate dosage of the pharmaceutical composition of the present invention may vary depending on factors such as the formulation method, administration method, age, body weight, sex, pathological condition, food, administration time, administration route, excretion rate, . Typical dosages of the pharmaceutical compositions of this invention are in the range of 0.001-100 mg / kg on an adult basis.

The pharmaceutical composition of the present invention may be formulated into a unit dose form by formulating it using a pharmaceutically acceptable carrier and / or excipient according to a method which can be easily carried out by a person having ordinary skill in the art to which the present invention belongs. Or by intrusion into a multi-dose container. The formulations may be in the form of solutions, suspensions, syrups or emulsions in oils or aqueous media, or in the form of excipients, powders, powders, granules, tablets or capsules, and may additionally contain dispersing or stabilizing agents.

The features and advantages of the present invention are summarized as follows:

(a) The present invention provides a body-degradable siRNA delivery complex.

(b) The siRNA delivery complex of the present invention is excellent in stability and economical efficiency, is easy to mass-produce, and can be regulated in size, and can be manufactured to a size suitable for cell delivery.

(c) cancer cells can be specifically transferred using the antibody of the present invention, and cancer death can be effectively induced using the synergistic effect of siRNA and photothermal effect.

Figure 1 schematically illustrates a method for preparing a BSA / gold nanorod / siRNA complex.
Figure 2 shows a TEM image of the BSA / gold nanorods / siRNA complex. The scale bar represents 100 nm.
Figures 3a and 3b show the characteristics of BSA / gold nanorods / siRNA complexes. Figure 3a shows that the average diameter of the BSA / gold nanorods / siRNA complex is 278 nm. Figure 3b shows that the average surface charge of the BSA / gold nanorods / siRNA complex is -39.6 [mu] m.
Figure 4 shows a standard curve for the Bradford assay for quantifying anti-HER2 antibodies bound to the surface of a BSA / gold nanorod complex.
Figure 5 shows a standard curve of the Ribogreen assay for quantifying siRNA encapsulated in BSA / gold nanorods.
FIG. 6 is a graph showing the photothermal effect of a gold nanorod and a BSA / gold nanorod composite.
FIG. 7 shows the results of confirming cell migration by the anti-HER2 antibody bound to the BSA / gold nanorod complex.
FIG. 8 shows the results of microscopic examination of BSA / gold nanoparticles to which HER2-expressing SkBr-2 cells were bound with anti-HER2 antibody.
Fig. 9 shows the results of the toxicity test of BSA / gold nanoparticles.
Fig. 10 shows the results of analysis of the inhibitory effect of mRNA expression by BSA / gold nanoparticles / siRNA at 24 hours and 48 hours.

Hereinafter, the present invention will be described in more detail with reference to Examples. It is to be understood by those skilled in the art that these embodiments are only for describing the present invention in more detail and that the scope of the present invention is not limited by these embodiments in accordance with the gist of the present invention .

Example

Materials and Experiments

How to make BSA / gold nanorods / siRNA complex

1) Gold nanorods (width: 22 ± 3 ㎚ / length: 6 ± 2 ㎚) to be used in the experiment were fabricated

- Method of making gold nanorods

(I) 7.5 ml of 0.2 M CTAB (sigma) and 0.25 ml of 0.01 M HAuCl ₄ (sigma) were mixed.

(Ii) 0.6 ml of 0.01 M NaBH ₄ (Sigma) was added and mixed and stored.

(Iii) 10 ml of 0.01 M HAuCl ₄ and 237.5 ml of 0.1 M CTAB were mixed.

_{(Ⅳ) 0.01M AgNO 3 (sigma} ) 1.5 ml were added and mixed.

(V) 1.6 ml of 0.1 M ascorbic acid (sigma) was added and mixed. The color of the mixture changed transparently.

(Vi) 2 ml of the solution prepared in step (ii) was added to the mixture of step (v) and reacted for 3 hours or longer to prepare gold nanorods.

2) The gold nanorods were centrifuged at 13,000 rpm for 30 minutes, and the supernatant was removed.

3) After removing the final supernatant, 1 ml of 20 mg / ml BSA solution and 20 μl of 50 mg / ml SH-BSA solution (ProteinMODS, USA) were added to the precipitated gold nanorods and reacted at room temperature for 3 hours.

4) The gold nanorods were washed in the same manner as in No. 2 above.

5) 100 ㎕ of 20 mg / ml pH 6 BSA solution and 1 nmol of siRNA (siBcl-2: GGAUUGUGGCCUUCUUUGAUU, Bioneer, Korea) were simultaneously added and mixed.

6) BSA / gold nanoparticles / siRNA complexes were prepared by encapsulating gold nanorods and siRNA with BSA through desolvation. 10 μl of 100% ethanol was added 20 times (60 μl / min) to the mixed solution of gold nanorod and siRNA.

Proteins or macromolecules such as BSA can be made into nanoparticles using a method called desolvation. The principle of this method is to remove the water molecules between the BSA molecules and consequently provide more opportunities for the BSAs to coalesce together. This causes BSA to aggregate and form nanoparticles. In this study, ethanol was slowly added to desolvation method. The gold nanorods were functionalized with BSA on the surface so that they could coalesce with BSA in order to coalesce with BSA. Since siRNA is a small molecule, it appears to bind together when BSA is clustered.

7) When the solution turned cloudy in color, 2 μl of 8% glutaraldehyde was added and cross-linked with BSA to react for 12 hours or more.

8) BSA / gold nanoparticle / siRNA complexes were washed with PBS for 10 min in the same manner as in No. 2 above.

9) To attach the antibody to the surface of the BSA / gold nanoparticle / siRNA complex, 10 μl of 1 mg / ml Amine-PEG-Biotin and 1 mg / ml streptavidin were incubated for 3 hours at room temperature.

10) The particles were washed in the same manner as in step 8 above.

11) 5 μl of 1 mg / ml anti-Her2 antibody with biotin was added and reacted at 4 ° C for 12 hours or more.

12) Wash the BSA / gold nanoparticle / siRNA / antibody complex in the same manner as in step 8 above. Before use, PBS was stored at 4 째 C (Fig. 1).

siRNA  And antibodies Ligand ) Quantity

BSA / gold nanoparticle / siRNA complex and anti-HER2 antibody (Abcam) [the above-mentioned 'BSA / gold nanoparticle / siRNA complex preparation method 9] to 12)], The solution was separated to measure the anti-HER2 concentration in the solution, and compared to the concentration of the anti-HER2 antibody before the reaction, the degree of immobilization on the BSA complex was confirmed.

The antibody concentration was measured by Bradford method, one of the protein quantification methods.

Photothermal effect  analysis

A photothermal effect experiment was performed using 1 ml of the BSA / gold nanoparticle / siRNA complex synthesized in the above procedure. The intensity of the applied light was the same as 4 w / cm * s ^-3 , and the wavelength was near infrared (810 nm). The light was applied for 2.5 minutes, 5 minutes, and 10 minutes, and the initial temperature was fixed at 25 ° C. To compare the photothermal effects of BSA / gold nanoparticles / siRNA complexes, the same volume of water, BSA nanoparticles, and gold nanoparticles were compared to the same amount.

In-beat analysis

The cancer cell is SK-BR-3, which is a cancer cell overexpressing HER2 (normal cells are not overexpressed).

The method of confirming the cell integration of the synthesized BSA / gold nanoparticle / siRNA complex was carried out by two methods of FACS analysis / confocal microscopy analysis. The above method was a method of measuring fluorescence, encapsulating FITC in the BSA complex, And the fluorescence was measured. BSA complex 1 ^ 10 ⁹ was added to 1 × 10 ⁶ cells (SK-BR-3), reacted at 37 ° C for 3 hours, and cells were washed 3 times or more with PBS. Then, the cells were immobilized using 4% paraformaldehyde, and the percentage of cells having fluorescence (FITC) was measured using a FACS instrument to evaluate cell migration rate. In addition, confocal microscopy was used to visually image whether or not the complex was introduced into actual cells to evaluate cell migration.

In order to observe the action of siRNA in the complex, RT-PCR technique was used to quantify the concentration of mRNA in which the siRNA directly reacted. Cells transfected the cells (SK-BR-3) In a BSA conjugate 1 × 10 ⁹ to 1 × 10 ^6, and the mixture was reacted under the conditions of 37 ℃ for 24 hours, 48 hours and 72 hours. To investigate the siRNA working efficiency of the complex, siRNA was compared with the case of siRNA alone treatment with lipofectamine treatment. After the passage of time, the cells were isolated with mRNA extraction kit (nucleospin RNA Ⅱ, MACHEREY-NAGEL) and mRNA concentration was measured and compared with LightCycler RNA Master SYBR Green I and RT-PCR (siRNA Target is Bcl-2, one of the proteins involved in cell death).

result

BSA / Characteristics of gold nanoparticles

The nanorods used in this experiment were prepared by reference to Langmuir 2004 , 20 , 6414-6420 and showed absorbance at about 750 ㎚.

TEM image analysis showed that spherical BSA / gold nanoparticles with a size of about 200 nm were uniformly formed. The BSA / gold nanoparticles were dried and the actual size was measured to be about 278 nm. It was confirmed that gold nanorods (6 ㎚ × 22 ㎚) were distributed evenly in BSA particles. Approximately 7.7 (± 0.8) gold nanorods per BSA particle were encapsulated (analysis by direct repair of TEM image).

The size and charge of the BSA / gold nanoparticle complex were measured using dynamic light scattering equipment. The size of the BSA / gold nanoparticles was about 278 nm, which was slightly larger than that of the TEM image. This is because the BSA / gold nanoparticle composites were dried in the case of TEM, indicating that the values are different. The surface charge of the BSA / gold nanoparticle complex is about -40 ㎷, which is interpreted as the effect of the pI value of BSA (pI 4.7, negatively charged under neutral conditions).

The size and surface charge for cell delivery and therapy are considered relatively reasonable.

Within the complex siRNA  And antibodies Ligand ) Quantity

Experiments were conducted to confirm the immobilization rate of anti-HER2 antibody in the prepared BSA / gold nanoparticle complex. As a result, it was confirmed that anti-HER2 antibody corresponding to about 43% of the added anti-HER2 antibody (20 / / ml) was immobilized (Table 1).

'ST-Ab-ST-Ab (NC)' in Table 1 indicates the degree of antibody immobilization of BSA particles not containing streptavidin, and 'ST-Ab- This indicates that streptavidin is required for particle formation through the immobilization of antibody at the time of administration.

In order to measure the amount of encapsulated short interfering RNA (siRNA), the experiment was conducted in such a manner that the concentration of the supernatant was measured in the same manner as that used in the measurement of the anti-HER2 immobilization ratio. Ribogreen assay, one of the RNA quantification methods, was used for the concentration measurement. As a result, it was confirmed that about 96% of the siRNA encapsulated in the BSA / gold nanoparticle / siRNA complex encapsulated the RNA (4000 nM) encapsulated (Table 2).

As a result, it was confirmed that the anti-HER2 antibody that performs the targeting function to the BSA / gold nanoparticle / siRNA complex and the siRNA that enhances the cancer treatment effect were effectively immobilized and encapsulated to form a multi-functional nanocomposite .

Photothermal effect

To determine the photothermal effect of the actual BSA / gold nanoparticle / siRNA / antibody complex, the photothermal effect was measured over time compared to the same amount of gold nanorods.

As a result, it showed a similar light heat effect compared to the same amount of gold nanorods, and showed almost the same light heat effect after 10 minutes. The BSA / gold nano-bar composite and the gold nanorods exhibit about seven times the photothermal effect difference compared to the particle-based photothermal effects of BSA particles, 10 minutes).

As a result of temperature measurement of the photothermal effect, it is thought that it is possible to induce cancer cell death sufficiently through this particle, and the time can be estimated to be about 5 minutes. Generally, cell apoptosis occurs above 42 ° C.

The photothermal effect of this BSA complex was found to be superior to that of the rod, especially when compared to gold nanorods, the photothermal effect of one particle is expected to be much better. When applied to cells, It is expected that the effect of inducing apoptosis due to the photothermal effect is better than that of using it.

BSA of Invitro  analysis

One of the most important requirements for the treatment of cancer cells using nanoparticles is the ability to selectively act on desired cancer cells. To determine this, the rate of cell migration following immobilization of the anti-HER2 antibody in the BSA / gold nanoparticle complex was determined.

As a result of the experiment, it was confirmed that the complex not immobilized with the anti-HER2 antibody did not enter into the cell, while the immobilized anti-HER2 antibody confirmed that the complex was introduced into the cancer cell. In order to conduct in vitro or in vivo experiments, it is necessary to confirm the toxicity of the prepared complex.

To confirm the toxicity, we proceeded to four groups of untreated (control), gold nanorod, BSA, BSA / gold nanorods. The cytotoxicity assays were performed by MTT assay. As a result of the toxicity test, the survival rate of gold nanoparticles was significantly lower than that of untreated cells, which is presumably due to the surfactant (CTAB) present in gold nanorods. On the other hand, the BSA particles and the BSA / gold nanorod complexes were confirmed to be free of cytotoxicity because they were composed of biomaterial particles.

siRNA of Invitro  analysis

To confirm the siRNA effect of the prepared nanoparticles, RT-PCR technique, which is one of the methods of measuring mRNA concentration, was used. Cells treated with nothing as a control and siRNA only treated cells were compared.

When the mRNA concentration after 24 hours was compared, the concentration of siRNA was 23% when compared with untreated cells and 48% with BSA complex. The expression rate of mRNA after 48 hours was 32% for siRNA alone and 21% for BSA complex. This indicates that the siRNA effect at 24 hours was better when siRNA was treated alone, and the siRNA effect of the BSA complex was better at 48 hours.

These results show that the siRNA action of the BSA complex is also relatively good, and the siRNA action of the complex over time appears to be superior over time. When siRNA is added alone, the siRNA acts directly and the siRNA function is excellent when the time passes relatively shortly, but the siRNA that should act over time is decomposed or the mRNA is restored after the action is finished. However, during siRNA delivery via the complex, the siRNA effect was increased over time due to encapsulation of BSA and continuous siRNA release via intracellular enzymes. This is expected to be an alternative to solve the problem of continuous operation which has been pointed out as a drawback to using siRNA.

While the present invention has been particularly shown and described with reference to exemplary embodiments thereof, it is to be understood that the same is by way of illustration and example only and is not to be construed as limiting the scope of the present invention. It is therefore intended that the scope of the invention be defined by the claims appended hereto and their equivalents.

<110> SOGANG UNIVERSITY RESEARCH FOUNDATION <120> Complexes for siRNA Delivery and Preparation Method thereof <130> PN130428 <160> 1 <170> Kopatentin 2.0 <210> 1 <211> 21 <212> RNA <213> siRNA against Bcl-2 <400> 1 ggauuguggc cuucuuugau u 21

Claims (10)

(a) Serum albumin; (b) gold nanorods; (c) siRNA; And (d) an antibody.
The siRNA delivery complex according to claim 1, wherein the serum albumin is directly bound to gold nanorods by introducing a thiol residue.
The method according to claim 1, wherein the (a) serum albumin; (b) gold nanorods; And (c) the siRNA is bound by desolvation.
The complex for siRNA delivery according to claim 1, wherein the gold nanorods have a transverse length of 15-30 nm and a longitudinal length of 1-10 nm.
delete 2. The complex for siRNA delivery according to claim 1, wherein the complex has a diameter of 150 nm to 300 nm.
2. The complex for siRNA delivery according to claim 1, wherein the complex has an average surface charge of -50 &lt; 0 &gt;
The siRNA delivery complex according to claim 1, wherein the siRNA delivery complex comprises 1-20 gold nanorods.
The complex according to claim 1, wherein the antibody is an antibody that specifically binds to a protein specifically expressed on a cancer cell surface.
A method for preparing an siRNA delivery complex comprising the steps of:
(a) preparing a serum albumin / gold nanorod complex by contacting gold nanorods with serum albumin;
(b) preparing a serum albumin / gold nanorod / siRNA complex by adding siRNA to the serum albumin / gold nanorod complex and desolvating it; And
(c) preparing an siRNA delivery complex by contacting the serum albumin / gold nanorod / siRNA complex with an antibody.

Images